Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Intellectual disability syndromic and non-syndromic v1.774 EMG1 Zornitza Stark edited their review of gene: EMG1: Added comment: Affected individuals present with severe developmental delay, microcephaly, growth failure, micrognathia, joint contractures and early death. Functional studies show loss‑of‑function through protein destabilisation, reduced EMG1 levels, binucleate fibroblasts, G2/M arrest, impaired 18S rRNA processing and recapitulation of the phenotype in a mouse knock‑in model.

GDA to remain as AMBER as the same founder variant in the Hutterite population has been reported in the additional PMIDs and could potentially be the same families. Further reports would be required to upgrade to Green.; Changed publications: 19463982, 27798105, 26676230, 25708872
Intellectual disability syndromic and non-syndromic v1.772 KLHL15 Zornitza Stark edited their review of gene: KLHL15: Added comment: Additional male individual presenting with impaired intelligence, short stature, frequent hypoglycaemia and periodic fever.
Hemizygous variant was identified in the proband c.736 C>T p.(Arg246*) - absent from gnomAD v4.1; Changed rating: GREEN; Changed publications: 25644381, 24817631, 37452054; Changed phenotypes: intellectual disability, X-linked 103 MONDO:0010508
Intellectual disability syndromic and non-syndromic v1.768 GSX2 Zornitza Stark edited their review of gene: GSX2: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.768 GSX2 Zornitza Stark edited their review of gene: GSX2: Added comment: Additional report of siblings from a consanguineous family affected with diencephalic-mesencephalic junction dysplasia
Proband was tested, and a homozygous variant was identified: c.747G>C (p.Trp249Cys) - variant is absent in gnomAD v4.1
The sibling was not tested but both healthy parents were identified as heterozygous.; Changed publications: 31412107, 39119454; Changed phenotypes: Diencephalic-mesencephalic junction dysplasia syndrome 2 618646, Intellectual disability, Dystonia, Spastic tetra paresis
Intellectual disability syndromic and non-syndromic v1.766 NPRL2 Lucy Spencer edited their review of gene: NPRL2: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.766 NPRL2 Lucy Spencer changed review comment from: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy;

PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes

PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2

PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2

PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad

Borderline amber/green for this panel
Sources: Literature; to: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy;

PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes

PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2

PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2

PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad

Sources: Literature
Intellectual disability syndromic and non-syndromic v1.763 LMAN2L Zornitza Stark edited their review of gene: LMAN2L: Added comment: Upgrade AR GDA to Green given the reports of biallelic variants in affected individuals.
No new reports supportive of the AD GDA association.

PMID: 40221759 and 37667433 report two additional probands presenting with ID, global DD and other neurodevelopmental features. Both probands were compound heterozygous.; Changed rating: GREEN; Changed publications: 40221759, 37667433
Intellectual disability syndromic and non-syndromic v1.762 Zornitza Stark removed gene:NDUFA5 from the panel
Intellectual disability syndromic and non-syndromic v1.757 SLC20A2 Zornitza Stark changed review comment from: Progressive neurological condition, ID is not part of the phenotype.; to: Mono-allelic association: Progressive neurological condition, ID is not part of the phenotype.
Intellectual disability syndromic and non-syndromic v1.757 SLC20A2 Zornitza Stark edited their review of gene: SLC20A2: Added comment: PMID 41458256: Reports a single individual a homozygous nonsense SLC20A2 variant presenting with infantile primary familial brain calcification, cerebral arterial vasculopathy and ischaemic stroke. Individual exhibited seizures, hypotonia, poor feeding, and extensive ischaemic changes.

PMID 35881308: reports two siblings from a consanguineous Turkish family with a homozygous splice‑site loss‑of‑function variant NM_006749.5:c.1794+1G>A. The affected children presented with severe paediatric‑onset features resembling congenital CMV infection: growth retardation, bilateral cataracts, microcephaly, seizures, cerebral atrophy, corpus callosum hypoplasia and brain microcalcifications.

Gene is classically associated with a milder mono-allelic disorder, which typically does not involve ID.; Changed rating: AMBER; Changed publications: 41458256, 35881308; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.756 MAU2 Zornitza Stark reviewed gene: MAU2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cornelia de Lange syndrome 7, MIM# 621570; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.755 CRMP1 Zornitza Stark edited their review of gene: CRMP1: Changed phenotypes: neurodevelopmental disorder, MONDO:0700092, CRMP1-related
Intellectual disability syndromic and non-syndromic v1.752 NPRL2 Lucy Spencer gene: NPRL2 was added
gene: NPRL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NPRL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NPRL2 were set to 26505888; 34376795; 40804712; 30093711
Phenotypes for gene: NPRL2 were set to epilepsy, familial focal, with variable foci 2 (MIM#617116)
Review for gene: NPRL2 was set to AMBER
Added comment: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy;

PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes

PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2

PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2

PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad

Borderline amber/green for this panel
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.751 IQSEC2 Zornitza Stark Phenotypes for gene: IQSEC2 were changed from Intellectual developmental disorder, X-linked 1 MIM#309530, MONDO:0010656; Severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome MONDO:0018347 to Intellectual developmental disorder, X-linked 1, MIM# 309530; Neurodevelopmental disorder, X-linked, with poor or absent speech and behavioral abnormalities, MIM# 301164
Intellectual disability syndromic and non-syndromic v1.750 IQSEC2 Zornitza Stark edited their review of gene: IQSEC2: Changed phenotypes: Intellectual developmental disorder, X-linked 1, MIM# 309530, Neurodevelopmental disorder, X-linked, with poor or absent speech and behavioral abnormalities, MIM# 301164
Intellectual disability syndromic and non-syndromic v1.749 PSMC5 Zornitza Stark edited their review of gene: PSMC5: Changed rating: GREEN; Changed phenotypes: Yu-Kury neurodevelopmental syndrome, MIM# 621565
Intellectual disability syndromic and non-syndromic v1.749 EMX2 Krithika Murali changed review comment from: PMID: 25577462 Lin et al 2014 - novel, heterozygous EMX2 PTC variant (p.E142X) identified in an XX female with didelphic uterus, variant inheritance unknown. Western blot and functional studies indicated formation of a truncated protein with dominant-negative effect. Variant was identified through direct sequencing of EMX2 in a cohort of 517 patients with incomplete Mullerian fusion.

PMID: 33434492 Chen et al 2021 AJHG, identified a novel, heterozygous EMX2 PTC variant (p.Tyr120ter) in a female with type I MKHS (inheritance unknown). Identified through exome-sequencing in an MKHS cohort.

PMID: 34829455 Miclea et al 2021 (Diagnostic) - large panel sequencing performed in a DSD cohort. Novel missense (inheritance unknown) - p.Arg205Gln - identified in a 4 yo XY male with hypospadius, GDD/ID, Pierre-robin sequence, hydrocephalus. Variant located in the DNA binding domain, classified as VUS.

PMID: 41765865 Stamou et al 2026 (Genetics in Medicine) performed trio WES on an idiopathic hypogonadotrophic hypogonadism cohort. 3 de novo CNVs that included 18 genes in the minimal critical region including EMX2 in individuals with DSD and developmental delay. In addition, x2 unrelated individuals with DSD, dev delay, hearing loss had a heterozygous de novo p.Lys199Gln missense variant located in the DNA binding domain. x1 individual identified with crytorchidism and a heterozygous Ser111Ter variant (inheritance unknown).

Based on the current evidence:
- Green for hypogonadotrophic hypogonadism and DSD
- Amber for ID - based on 3 unrelated individuals with dev delay and variants in the DNA binding domain (p.Arg205Gln, p.Lys199Gln)
- Red for Pierre-Robin sequence; to: PMID: 25577462 Lin et al 2014 - novel, heterozygous EMX2 PTC variant (p.E142X) identified in an XX female with didelphic uterus, variant inheritance unknown. Western blot and functional studies indicated formation of a truncated protein with dominant-negative effect. Variant was identified through direct sequencing of EMX2 in a cohort of 517 patients with incomplete Mullerian fusion.

PMID: 33434492 Chen et al 2021 AJHG, identified a novel, heterozygous EMX2 PTC variant (p.Tyr120ter) in a female with type I MKHS (inheritance unknown). Identified through exome-sequencing in an MKHS cohort.

PMID: 34829455 Miclea et al 2021 (Diagnostic) - large panel sequencing performed in a DSD cohort. Novel missense (inheritance unknown) - p.Arg205Gln - identified in a 4 yo XY male with hypospadius, GDD/ID, Pierre-robin sequence, hydrocephalus. Variant located in the DNA binding domain, classified as VUS.

PMID: 41765865 Stamou et al 2026 (Genetics in Medicine) performed trio WES on an idiopathic hypogonadotrophic hypogonadism cohort. 3 de novo CNVs detected in individuals with DSD and developmental delay - 18 genes including EMX2 in the minimal critical region. In addition, x2 unrelated individuals with DSD, dev delay, hearing loss had a heterozygous de novo p.Lys199Gln missense variant located in the DNA binding domain. x1 individual identified with crytorchidism and a heterozygous Ser111Ter variant (inheritance unknown).

Based on the current evidence:
- Green for hypogonadotrophic hypogonadism and DSD
- Amber for ID - based on 3 unrelated individuals with dev delay and variants in the DNA binding domain (p.Arg205Gln, p.Lys199Gln)
- Red for Pierre-Robin sequence
Intellectual disability syndromic and non-syndromic v1.743 DIP2B Bryony Thompson Deleted their comment
Intellectual disability syndromic and non-syndromic v1.743 DIP2B Bryony Thompson edited their review of gene: DIP2B: Added comment: PMID 33688487 reports two siblings from one family with a heterozygous splice‑site loss‑of‑function DIP2B variant causing moderate intellectual disability.; Changed rating: RED; Changed publications: 33688487; Changed phenotypes: intellectual disability MONDO:0001071; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.742 WSB2 Zornitza Stark reviewed gene: WSB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Luo-Agrawal neurodevelopmental syndrome, MIM# 621552; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.742 KCNJ4 Chirag Patel changed review comment from: PMID 41830586 reports 4 individuals from 4 families with heterozygous missense KCNJ4 variants presenting with refractory epilepsy and neurodevelopmental delay/intellectual disability. Clinical features range from isolated epilepsy to severe developmental and epileptic encephalopathy. Two variants arose de novo and two had unknown segregation status. Electrophysiology in Xenopus oocytes demonstrates variant‑specific gain‑of‑function (Gly136Ser and Glu384Lys) or loss‑of‑function effects (Val206Met and Met293Lys).
Sources: Literature; to: PMID 41830586 reports 4 individuals from 4 families with rare heterozygous missense KCNJ4 variants presenting with refractory epilepsy and neurodevelopmental delay/intellectual disability. Clinical features range from isolated epilepsy to severe developmental and epileptic encephalopathy. Two variants arose de novo and two had unknown segregation status. Electrophysiology in Xenopus oocytes demonstrates variant‑specific gain‑of‑function (Gly136Ser and Glu384Lys) or loss‑of‑function effects (Val206Met and Met293Lys).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.742 KCNJ4 Chirag Patel gene: KCNJ4 was added
gene: KCNJ4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: KCNJ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNJ4 were set to 41830586
Phenotypes for gene: KCNJ4 were set to Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related
Mode of pathogenicity for gene: KCNJ4 was set to Other
Intellectual disability syndromic and non-syndromic v1.735 TSEN54 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v1.726 ABCB7 Lucy Spencer gene: ABCB7 was added
gene: ABCB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ABCB7 were set to 11050011; 26242992
Phenotypes for gene: ABCB7 were set to Anaemia, sideroblastic, with ataxia, MIM# 301310
Review for gene: ABCB7 was set to AMBER
Added comment: Some limited reports of developmental delay/ID in the literature and mentioned in the ClinGen review
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.713 POC1A Chirag Patel reviewed gene: POC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 39662966; Phenotypes: Short stature-onychodysplasia-facial dysmorphism-hypotrichosis syndrome, MONDO:0013894; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.711 TRIM71 Zornitza Stark edited their review of gene: TRIM71: Added comment: PMID 38833623 reports 20 individuals from 13 unrelated families with heterozygous de novo or rare inherited TRIM71 variants (missense, nonsense, splice‑site, frameshift) presenting with congenital hydrocephalus/ventriculomegaly, developmental delay, dysmorphic features, corpus callosum dysgenesis, white‑matter hypoplasia, limb and craniofacial anomalies, hearing and cardiac defects. Functional studies in HEK293T cells show NHL‑domain missense variants impair binding to CDKN1A/EGR1 and disrupt P‑body localization, supporting loss‑of‑function/altered‑function mechanisms.; Changed publications: 40892928, 38833623
Intellectual disability syndromic and non-syndromic v1.710 PSMC3 Zornitza Stark Phenotypes for gene: PSMC3 were changed from neurodevelopmental disorder, MONDO:0700092, PSMC3-related; Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354 to Ebstein-Bezieau neurodevelopmental syndrome, MIM# 621539; Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354
Intellectual disability syndromic and non-syndromic v1.709 TNK2 Sarah Milton gene: TNK2 was added
gene: TNK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: TNK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: TNK2 were set to 27977884; 23686771; 31517310
Phenotypes for gene: TNK2 were set to late onset infantile epilepsy; Mayer-Rokitansky-Küster-Hauser syndrome
Intellectual disability syndromic and non-syndromic v1.704 FMO4 Chirag Patel gene: FMO4 was added
gene: FMO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: FMO4 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: FMO4 were set to 41714691, 28940097
Phenotypes for gene: FMO4 were set to Neurodevelopmental disorder, MONDO:0700092; FMO4 related
Intellectual disability syndromic and non-syndromic v1.701 NRDC Zornitza Stark reviewed gene: NRDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 41734767, 41449824, 28017472; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, NRDC-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.696 RDH11 Lucy Spencer changed review comment from: PMID: 41459630 proband with oligodontia and malocclusion, dysmorphic hands and feet, microcephaly, ASD but otherwise normal development, homozygous for Cys72*. following the genetic findings the proband had an ophthalmological examination which showed a mild retinopathy consisting of yellow deposits and hyperpigmentation within the RPE, but the patient was visually asymptomatic at age 7. However in the original family PMID: 24916380 progressive visual acuity decrease did not occur until ages 10 or 8 in the 3 affected siblings. This family also had widely spaced oligodontia and malocclusion.; to: PMID: 41459630 proband with oligodontia and malocclusion, dysmorphic hands and feet, microcephaly, ASD but otherwise normal development, homozygous for Cys72*. following the genetic findings the proband had an ophthalmological examination which showed a mild retinopathy consisting of yellow deposits and hyperpigmentation within the RPE, but the patient was visually asymptomatic at age 7. However in the original family PMID: 24916380 progressive visual acuity decrease did not occur until ages 10 or 8 in the 3 affected siblings. This family also had widely spaced oligodontia and malocclusion.

ID also reported in PMID: 24916380 and PMID 34988992 families
Intellectual disability syndromic and non-syndromic v1.690 JKAMP Zornitza Stark gene: JKAMP was added
gene: JKAMP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JKAMP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: JKAMP were set to 41643666
Phenotypes for gene: JKAMP were set to Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533
Review for gene: JKAMP was set to GREEN
Added comment: 14 individuals from 10 families reported. All had moderate to profound neurodevelopmental delay, intellectual disability, and infantile-onset epilepsy. Six were nonverbal, and the remaining individuals spoke only a few words. Five individuals had neurodevelopmental regression. Three individuals died suddenly; death was associated with seizures or status epilepticus in two. Thirteen individuals had hypotonia, 5 had visual impairment, 5 had microcephaly, and 1 had hearing loss. Brain MRIs showed cortical or cerebral atrophy in 11, delayed myelination in 6, and diffuse demyelinating disease in 1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.686 TRAPPC2L Krithika Murali Phenotypes for gene: TRAPPC2L were changed from Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 to Neurodevelopmental disorder - MONDO:0700092, TRAPPC2L-related
Intellectual disability syndromic and non-syndromic v1.679 ATP2B3 Bryony Thompson edited their review of gene: ATP2B3: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.679 ATP2B3 Bryony Thompson changed review comment from: PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123).; to: At least 3 cases reported with ID/developmental delay without other variants detected
PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123).
Intellectual disability syndromic and non-syndromic v1.679 ATP2B3 Bryony Thompson edited their review of gene: ATP2B3: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.677 PPP1R12A Zornitza Stark edited their review of gene: PPP1R12A: Changed phenotypes: Genitourinary and/or/brain malformation syndrome MIM#618820
Intellectual disability syndromic and non-syndromic v1.676 NAV2 Zornitza Stark reviewed gene: NAV2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, NAV2-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.674 LRRC32 Zornitza Stark edited their review of gene: LRRC32: Added comment: Further family reported in PMID 41041957, homozygous missense variant.; Changed publications: 30976112, 41041957
Intellectual disability syndromic and non-syndromic v1.673 EXOC8 Bryony Thompson gene: EXOC8 was added
gene: EXOC8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: EXOC8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOC8 were set to 32103185; 22700954; 36344539; 35460391
Phenotypes for gene: EXOC8 were set to neurodevelopmental disorder with microcephaly, seizures, and brain atrophy MONDO:0033662
Intellectual disability syndromic and non-syndromic v1.672 ARHGEF2 Bryony Thompson gene: ARHGEF2 was added
gene: ARHGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARHGEF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARHGEF2 were set to 28453519
Phenotypes for gene: ARHGEF2 were set to neurodevelopmental disorder with midbrain and hindbrain malformations MONDO:0056797
Intellectual disability syndromic and non-syndromic v1.670 CDK4 Zornitza Stark edited their review of gene: CDK4: Changed phenotypes: Microcephaly 31, primary, autosomal recessive, MIM# 621507
Intellectual disability syndromic and non-syndromic v1.669 EPG5 Zornitza Stark edited their review of gene: EPG5: Added comment: Neurodevelopmental disorder with parkinsonism or other movement abnormalities (NEDPAM) is an autosomal recessive disorder characterized by mild to severe developmental delay or intellectual disability and movement abnormalities including spasticity, early onset-parkinsonism with dystonia, myoclonus, or a combination of these. Movement abnormalities may have onset from birth to adulthood in the sixth decade of life. Adolescent-onset dystonia and parkinsonism on the background of neurodevelopmental delay may be rapidly progressive, with cognitive decline. Patients may have additional features such as seizures and optic nerve atrophy. PMIDs 41053928, 36410285 and 40192014 report over 100 affected individuals.; Changed publications: 23222957, 26917586, 41053928, 36410285, 40192014; Changed phenotypes: Vici syndrome, MIM# 242840, Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506
Intellectual disability syndromic and non-syndromic v1.668 FSCN1 Lilian Downie reviewed gene: FSCN1: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 40874942; Phenotypes: neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.666 PTBP1 Zornitza Stark reviewed gene: PTBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: STAD syndrome, MIM# 621495; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.665 PRODH Krithika Murali reviewed gene: PRODH: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID 34285201, 17412540, 18197084, 12525555; Phenotypes: hyperprolinemia type 1 - MONDO:0009400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.665 CELSR1 Rylee Peters changed review comment from: GREEN rating for biallelic neurodevelopmental disorder association
PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls.

PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI.
Sources: Literature; to: GREEN rating for biallelic neurodevelopmental disorder association
PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants associated with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls.

PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.664 CELSR1 Rylee Peters changed review comment from: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls.

PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI.
Sources: Literature; to: GREEN rating for biallelic neurodevelopmental disorder association
PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls.

PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.663 CELSR1 Rylee Peters gene: CELSR1 was added
gene: CELSR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELSR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CELSR1 were set to 41530147; 36453712
Review for gene: CELSR1 was set to GREEN
Added comment: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls.

PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.659 MAP2K4 Sangavi Sivagnanasundram gene: MAP2K4 was added
gene: MAP2K4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAP2K4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAP2K4 were set to 41480045
Phenotypes for gene: MAP2K4 were set to Neurodevelopmental disorder, MONDO:0700092
Mode of pathogenicity for gene: MAP2K4 was set to Other
Intellectual disability syndromic and non-syndromic v1.656 CTNND2 Zornitza Stark edited their review of gene: CTNND2: Added comment: PMID 41502569 (preprint) reports phenotypic and molecular information for 57 individuals, 42 previously unpublished, with heterozygous CTNND2 variants. The 41 CTNND2 variants included 12 previously reported loss-of-function- and one missense variant, and 28 novel variants comprising 10 missense and 18 predicted loss-of-function changes. Eight of the novel variants occurred de novo, and 12 were inherited from a parent with a neurodevelopmental phenotype. The most common clinical features were developmental delay (90%), intellectual disability (74%), and behavioral abnormalities (79%). Functional studies revealed impaired early neurogenesis in one patient-derived line, characterized by aberrant neural rosette formation. Transcriptome analysis showed dysregulated WNT signaling, and partial rescue of these defects was achieved by modulating the WNT pathway, highlighting δ-catenin's role in early neural development.

Note several of the reported missense variants in this gene have high gnomAD counts so these should be interpreted with caution. Nevertheless, large number of individuals reported now with LoF variants and NDD phenotype.; Changed rating: GREEN; Changed publications: 25839933, 29127138, 25807484, 41502569; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CTNND2-related
Intellectual disability syndromic and non-syndromic v1.655 PGBD5 Zornitza Stark gene: PGBD5 was added
gene: PGBD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PGBD5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PGBD5 were set to 41533792
Phenotypes for gene: PGBD5 were set to Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482
Review for gene: PGBD5 was set to GREEN
Added comment: 10 individuals reported from 5 consanguineous families with bi-allelic variants in this gene and global developmental delay with impaired intellectual development, delayed motor skills, and motor abnormalities. Affected individuals were unable to speak or walk due to peripheral spasticity, ataxia, or hypotonia, and developed early-onset seizures. Additional features included dysmorphic facies, short stature, and brain imaging abnormalities, such as thin corpus callosum and cerebellar atrophy.

Pgbd5-null mice were runted and had significantly smaller brains compared to wildtype. Mutant mice showed increased locomotor activity, reduced anxiety-like behavior, impaired motor coordination, increased susceptibility to seizures, and decreased cortical volume on brain MRI. Analysis of neurons derived from Pgbd5-null mouse brains showed reduced DNA breakage and repair in postmitotic neuronal precursors during cortical development compared to controls.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.651 KDM2B Zornitza Stark Phenotypes for gene: KDM2B were changed from neurodevelopmental disorder MONDO#0700092, KDM2B-related to Neurodevelopmental disorder with congenital cardiac defects and variable renal and ocular abnormalities, MIM# 621474
Intellectual disability syndromic and non-syndromic v1.650 KDM2B Zornitza Stark edited their review of gene: KDM2B: Changed phenotypes: Neurodevelopmental disorder with congenital cardiac defects and variable renal and ocular abnormalities, MIM# 621474
Intellectual disability syndromic and non-syndromic v1.648 SMARCA1 Zornitza Stark edited their review of gene: SMARCA1: Added comment: Now published.; Changed publications: 37841849, 41213919
Intellectual disability syndromic and non-syndromic v1.645 ISCA-46743-Gain Sarah Milton Region: ISCA-46743-Gain was added
Region: ISCA-46743-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46743-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for Region: ISCA-46743-Gain were set to Xq25 duplication syndrome, MIM#300979
Intellectual disability syndromic and non-syndromic v1.642 ISCA-46299-Gain Sarah Milton Region: ISCA-46299-Gain was added
Region: ISCA-46299-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-46299-Gain.
Mode of inheritance for Region: ISCA-46299-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-46299-Gain were set to PMID: 22840365
Phenotypes for Region: ISCA-46299-Gain were set to Xp11.22 microduplication syndrome MIM#300705
Intellectual disability syndromic and non-syndromic v1.638 TMPRSS7 Zornitza Stark changed review comment from: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus.
Sources: Literature; to: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder, presenting with fetal agenesis of the corpus callosum and ventriculomegaly. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.637 ARCN1 Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.636 ARCN1 Zornitza Stark changed review comment from: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; to: At least 14 individuals reported, summarised in PMID 35300924. Intrauterine growth restriction, micrognathia, and short stature were present in all patients. Other common features included prematurity (11/15, 73.3%), developmental delay (10/14, 71.4%), genitourinary malformations in males (6/8, 75%), and microcephaly (12/15, 80%).
Intellectual disability syndromic and non-syndromic v1.636 ARCN1 Zornitza Stark edited their review of gene: ARCN1: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.635 ARCN1 Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.634 ARCN1 Zornitza Stark edited their review of gene: ARCN1: Added comment: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; Changed publications: 27476655, 33154040, 35300924; Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.633 YWHAZ Zornitza Stark edited their review of gene: YWHAZ: Added comment: Further invidividual reported as part of a large CFC cohort PMID 40692796, missense variant, limited further information.; Changed publications: 31024343, 35143101, 35501409, 22124272, 26207352, 40692796
Intellectual disability syndromic and non-syndromic v1.630 MTSS1L Zornitza Stark reviewed gene: MTSS1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 39890443, 40698928; Phenotypes: Intellectual developmental disorder with ocular anomalies and distinctive facial features, MIM# 620086; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.628 SF3B1 Zornitza Stark reviewed gene: SF3B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 41577671; Phenotypes: complex neurodevelopmental disorder MONDO:0100038, SF3B1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.626 VPS51 Zornitza Stark edited their review of gene: VPS51: Added comment: PMID 40176246 Reports another individual with autosomal recessive homozygous in-frame duplication in VPS51 (p.Lys126_Met132dup) presenting with severe global developmental delay, microcephaly, hypotonia, hypomyelination, and cerebral and cerebellar atrophy. No functional studies performed; variant absent from gnomAD.

PMID 40565173 reports 2 affected individuals another family with a homozygous missense variant NM_013265.4:c.1511C>T (p.Thr504Met) in VPS51. The siblings presented with developmental delay, severe intellectual disability, microcephaly, thin corpus callosum, epilepsy, hearing loss and dysphagia. Biparental inheritance demonstrated. Functional assays in patient fibroblasts showed reduced VPS51 mRNA and protein levels, altered autophagy marker expression (LC3B, p62), and increased mitochondria‑lysosome contacts, supporting a loss‑of‑function mechanism.; Changed rating: GREEN; Changed publications: 30624672, 31207318, 40176246, 40565173; Changed phenotypes: Pontocerebellar hypoplasia, type 13, MIM# 618606
Intellectual disability syndromic and non-syndromic v1.624 SEC31A Zornitza Stark edited their review of gene: SEC31A: Added comment: PMID 39725565: Reports another individual from unrelated family with a homozygous splice‑acceptor loss‑of‑function variant (c.14351G>A) presenting with lethal neurodevelopmental disorder, dysmorphic facial features, brain anomalies, and severe skeletal defects. RT‑PCR on patient and carrier parents blood samples shows exon 12 skipping and markedly reduced SEC31A transcript, supporting loss‑of‑function.

Functional data from PMID 30464055: knockdown SEC31A Drosophila had defective brains and early lethality. In line with SEC31A encoding one of the two coating layers comprising the Coat protein complex II (COP-II) complex, trafficking newly synthesised proteins from the endoplasmic reticulum (ER) to the Golgi, CRISPR/Cas9-mediated SEC31A null mutant cells demonstrated reduced viability through upregulation of ER-stress pathways.; Changed rating: GREEN; Changed publications: 30464055, 40508110, 39725565; Changed phenotypes: Halperin-Birk syndrome, MIM# 618651
Intellectual disability syndromic and non-syndromic v1.624 LGI1 Zornitza Stark Phenotypes for gene: LGI1 were changed from Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related to Developmental and epileptic encephalopathy 121, MIM# 621475
Intellectual disability syndromic and non-syndromic v1.623 LGI1 Zornitza Stark reviewed gene: LGI1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 121, MIM# 621475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.621 ZNF185 Lucy Spencer gene: ZNF185 was added
gene: ZNF185 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF185 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: ZNF185 were set to 41404552
Phenotypes for gene: ZNF185 were set to Cerebrooculonasal syndrome MONDO:0011575, ZNF185-related
Review for gene: ZNF185 was set to RED
Added comment: PMID 41404552 describes a single female individual with cerebro oculo nasal syndrome and a de novo heterozygous X linked frameshift ZNF185. The proband presented with developmental delay, moderate ID, dysmorphic facial features, cleft lip/palate, nasal anomaly, CHD and anopthalmia. She was shown to have skewed X-inactivation 19:81, however it is not stated if the skewing was towards the allele with the variant. The variant in this individual (p.Gln102SerfsTer18) is NMD predicted and absent from gnomad, however there are at least 6 NMD variants present in gnomad as hemizygous (4 with over 4 hemis) all of which also have over 5 heterozygotes
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.615 GSPT2 Zornitza Stark edited their review of gene: GSPT2: Added comment: PMID 41420488: Six unrelated males reported with hemizygosity for variants in GSTP2 and neurodevelopmental disorder including intellectual disability, language impairment, autism, motor impairment, epilepsy, or abnormal fetal brain development. Variants were reported to be inherited from unaffected mothers. Functional evidence did support deleterious effects of the variants and gene knock-out.; Changed rating: GREEN; Changed publications: 28414775, 41420488; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, GSPT2-related
Intellectual disability syndromic and non-syndromic v1.607 MIR17HG Zornitza Stark changed review comment from: 4 unrelated cases reported - 3 with gene deletions, 1 with SNV.
Sources: Expert list; to: 4 unrelated cases reported - 3 with gene deletions, 1 with SNV. The deletions include portion of GPC5 as well.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.607 MIR17HG Zornitza Stark edited their review of gene: MIR17HG: Added comment: Multiple mouse models.; Changed publications: 25391829, 21892160, 29636449
Intellectual disability syndromic and non-syndromic v1.607 BAIAP2 Zornitza Stark Phenotypes for gene: BAIAP2 were changed from BAIAP2-related complex neurodevelopmental disorder MONDO:0100038 to Developmental and epileptic encephalopathy 120, MIM# 621468
Intellectual disability syndromic and non-syndromic v1.606 BAIAP2 Zornitza Stark reviewed gene: BAIAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 120, MIM# 621468; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.605 SCAMP5 Zornitza Stark edited their review of gene: SCAMP5: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, SCAMP5-related
Intellectual disability syndromic and non-syndromic v1.602 COPB1 Zornitza Stark edited their review of gene: COPB1: Added comment: PMID 40396222 adds two siblings from a consanguineous Pakistani family with a homozygous missense variant c.2693G>T (p.Arg898Leu) and consistent phenotype. Combined evidence comprises eight patients from three unrelated families, loss‑of‑function mechanism, and functional validation including splice disruption, Xenopus CRISPR modelling, protein stability/Golgi localisation assays, and in silico structural modeling.; Changed rating: GREEN; Changed publications: 33632302, 40396222; Changed phenotypes: Baralle-Macken syndrome, MIM# 619255
Intellectual disability syndromic and non-syndromic v1.600 ISCA-46295-Loss Sarah Milton Region: ISCA-46295-Loss was added
Region: ISCA-46295-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-46295-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for Region: ISCA-46295-Loss were set to PMID: 19289393
Phenotypes for Region: ISCA-46295-Loss were set to Chromosome 15q13.3 microdeletion syndrome MIM#612001; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.593 RNU4-2 Zornitza Stark Mode of inheritance for gene: RNU4-2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.592 RNU4-2 Zornitza Stark edited their review of gene: RNU4-2: Added comment: PMID 40297424: preprint reporting 16 individuals from 10 families with balletic variants and presenting with global developmental delay, intellectual disability, speech delay or absence, hypotonia, spasticity, microcephaly, ophthalmologic and visual impairment, seizures, and variable genital, skin, hair and limb anomalies; brain MRI shows distinctive white‑matter abnormalities and cerebellar atrophy.; Changed publications: 38991538, 40297424; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.591 ATP9A Zornitza Stark Mode of inheritance for gene: ATP9A was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.590 ATP9A Zornitza Stark edited their review of gene: ATP9A: Added comment: PMIDs 34379057, 34764295, 36604604 and 40226306 report 12 unrelated families with ATP9A variants. Six families carry biallelic loss‑of‑function variants causing an autosomal recessive neurodevelopmental disorder with post‑natal microcephaly, failure‑to‑thrive and behavioural abnormalities; five families carry de novo heterozygous missense variants causing autosomal dominant nonsyndromic intellectual disability with seizures and autism‑like features. Multiple functional studies in patient cells, mouse knock‑out models and rescue assays provide strong loss‑of‑function evidence.; Changed publications: 34379057, 34764295, 36604604, 40226306; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.590 DLAT Chris Ciotta reviewed gene: DLAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 39007626, 29093066, 16049940; Phenotypes: Pyruvate dehydrogenase E2 deficiency, MIM#245348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.590 ISCA-37494-Gain Sarah Milton Region: ISCA-37494-Gain was added
Region: ISCA-37494-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37494-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37494-Gain were set to 25927380; 20301461; 32043567; 32112660
Phenotypes for Region: ISCA-37494-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815; intellectual disability; hypotonia; seizures; spasticity; recurrent respiratory infections
Intellectual disability syndromic and non-syndromic v1.584 ISCA-37468-Loss Sarah Milton Region: ISCA-37468-Loss was added
Region: ISCA-37468-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen,Expert Review Green
SV/CNV tags were added to Region: ISCA-37468-Loss.
Mode of inheritance for Region: ISCA-37468-Loss was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37468-Loss were set to PMID: 22126752; 16385466; 20186789
Phenotypes for Region: ISCA-37468-Loss were set to Chromosome Xp11.3 deletion syndrome MIM#300578; intellectual disability; retinal dystrophy
Intellectual disability syndromic and non-syndromic v1.579 SCYL2 Zornitza Stark Phenotypes for gene: SCYL2 were changed from Arthrogryposis multiplex congenita (AMC); Zain syndrome to Arthrogryposis multiplex congenita 4, neurogenic, with agenesis of the corpus callosum, MIM# 618766
Intellectual disability syndromic and non-syndromic v1.577 SCYL2 Zornitza Stark gene: SCYL2 was added
gene: SCYL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SCYL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCYL2 were set to 31960134; 26203146
Phenotypes for gene: SCYL2 were set to Arthrogryposis multiplex congenita (AMC); Zain syndrome
Intellectual disability syndromic and non-syndromic v1.575 PPP5C Zornitza Stark reviewed gene: PPP5C: Rating: AMBER; Mode of pathogenicity: None; Publications: 40172746; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, PPP5C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.574 PIGW Zornitza Stark edited their review of gene: PIGW: Added comment: PMID 40180615; 39924787; 39766333; 38055078: additional cases not included in the ClinGen assessment.; Changed rating: GREEN; Changed publications: 24367057, 27626616, 30813920, 32198969, 40180615, 39924787, 39766333, 38055078
Intellectual disability syndromic and non-syndromic v1.574 ISCA-37439-Gain Sarah Milton Region: ISCA-37439-Gain was added
Region: ISCA-37439-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37439-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37439-Gain were set to PMID: 20004760
Phenotypes for Region: ISCA-37439-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815
Intellectual disability syndromic and non-syndromic v1.572 RPS6KC1 Zornitza Stark Phenotypes for gene: RPS6KC1 were changed from Complex neurodevelopmental disorder, MONDO:0100038, RPS6KC1-related to Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460
Intellectual disability syndromic and non-syndromic v1.571 RPS6KC1 Zornitza Stark reviewed gene: RPS6KC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.561 TMEM251 Zornitza Stark gene: TMEM251 was added
gene: TMEM251 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM251 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM251 were set to 40171858; 33252156
Phenotypes for gene: TMEM251 were set to Dysostosis multiplex, Ain-Naz type MIM@619345
Review for gene: TMEM251 was set to GREEN
Added comment: PMID 40171858: reports 2 siblings from an Iranian consanguineous family and six previously reported families (8 patients, 7 unrelated families) with biallelic loss‑of‑function LYSET variants presenting with MLII‑like mucolipidosis; core features include dysostosis multiplex, coarse facial features, hepatomegaly, joint contractures, developmental delay; mouse knockout recapitulates the phenotype, supporting gene‑disease causality.

HGNC approved name is LYSET.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.557 ZFHX4 Boris Keren reviewed gene: ZFHX4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40367947; Phenotypes: intellectual disability, short stature, cleft; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.555 EMC10 Zornitza Stark edited their review of gene: EMC10: Added comment: PMIDs 35684946, 37318954, 40150819 report 10 additional unrelated families with loss‑of‑function EMC10 variants; Changed publications: 33531666, 35684946, 37318954, 40150819
Intellectual disability syndromic and non-syndromic v1.555 UNC13A Zornitza Stark Phenotypes for gene: UNC13A were changed from neurodevelopmental disorder MONDO#0700092, UNC13A-related; Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455 to Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456; Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455
Intellectual disability syndromic and non-syndromic v1.554 UNC13A Zornitza Stark edited their review of gene: UNC13A: Changed phenotypes: Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456, Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455
Intellectual disability syndromic and non-syndromic v1.554 UNC13A Zornitza Stark Phenotypes for gene: UNC13A were changed from Congenital myasthenia; dyskinesia; autism; developmental delay; neurodevelopmental disorder MONDO#0700092, UNC13A-related to neurodevelopmental disorder MONDO#0700092, UNC13A-related; Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455
Intellectual disability syndromic and non-syndromic v1.552 UNC13A Zornitza Stark edited their review of gene: UNC13A: Changed publications: 27648472, 28192369, 41125872
Intellectual disability syndromic and non-syndromic v1.552 UNC13A Zornitza Stark edited their review of gene: UNC13A: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.552 UNC13A Zornitza Stark edited their review of gene: UNC13A: Added comment: PMID 41125872 reports 48 individuals with neurodevelopmental disorders and UNC13A variants. Of these, 20 classified as pathogenic. Of these 6 individuals had biallelic variants and presented with severe-to-profound GDD or intellectual disability, hypotonia and seizures of different types (largely controllable with medication) or death in early childhood caused by respiratory failure after pneumonia in one case. Mechanism for this subgroup is LoF with carrier parents unaffected.

A second group of 13 patients (21 months to 32 years old) harboured pathogenic, heterozygous de novo missense variants with multiple substitutions at amino acids 808, 811 and 814 (hinge region). They presented with variable degrees of GDD, hypotonia, seizures of different types (mainly refractory to treatment) and typically exhibited ataxia, tremor or dyskinetic movements rarely observed in other patients.

Also a family identified with at least four affected members across two generations (4 years to 35 years old) harbouring a pathogenic heterozygous missense variant (C587F) that caused learning difficulties to mild–moderate intellectual disability as well as controlled seizures.

Three different types of mechanism of pathogenicity proposed.; Changed phenotypes: neurodevelopmental disorder MONDO#0700092, UNC13A-related, Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455
Intellectual disability syndromic and non-syndromic v1.552 WDR83 Chirag Patel gene: WDR83 was added
gene: WDR83 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR83 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: WDR83 were set to 41381792
Phenotypes for gene: WDR83 were set to Neurodevelopmental disorder, MONDO:0700092, WDR83-related
Mode of pathogenicity for gene: WDR83 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v1.548 FIBP Zornitza Stark edited their review of gene: FIBP: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.548 FIBP Zornitza Stark edited their review of gene: FIBP: Added comment: Beyond the two families previously reviewed (PMIDs 26660953; 27183861), four additional studies (PMIDs 36919607, 37218527, 37876348, 40099975) contribute four new unrelated families (total six unrelated families, nine patients) with a consistent autosomal‑recessive overgrowth syndrome. All six families have biallelic loss‑of‑function FIBP variants (nonsense or frameshift leading to NMD). Detailed clinical descriptions include overgrowth, macrocephaly, facial dysmorphism, developmental delay/intellectual disability, renal dysplasia and, in two families, early‑onset tumor predisposition. Segregation analyses confirm recessive inheritance in every case. Functional work (RT‑qPCR, fibroblast proliferation assays, mouse embryonic expression) demonstrates reduced FIBP expression and increased cell proliferation, supporting pathogenicity.; Changed publications: 40099975, 37876348, 36919607, 27183861, 26660953
Intellectual disability syndromic and non-syndromic v1.546 DPH2 Zornitza Stark edited their review of gene: DPH2: Added comment: Third family reported with biallelic LoF variant c.1429C>T (p.Arg477*) presenting with developmental delay, proportionate short stature, sparse hair, dysmorphic facial features, hypotonia, seizures, neuroimaging abnormalities, and behavioral issues.; Changed rating: GREEN; Changed publications: 40130534
Intellectual disability syndromic and non-syndromic v1.545 WASHC3 Zornitza Stark edited their review of gene: WASHC3: Changed publications: 40129681
Intellectual disability syndromic and non-syndromic v1.540 RSPRY1 Zornitza Stark edited their review of gene: RSPRY1: Added comment: PMIDs 30063090, 38562122 and 39940902 add three additional unrelated families (total 5 families, 12 patients) with autosomal recessive loss‑of‑function RSPRY1 variants causing spondyloepimetaphyseal dysplasia, Faden‑Alkuraya type.; Changed rating: GREEN; Changed publications: 26365341, 30063090, 38562122, 39940902
Intellectual disability syndromic and non-syndromic v1.540 USMG5 Zornitza Stark gene: USMG5 was added
gene: USMG5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: USMG5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: USMG5 were set to 29917077; 30240627; 40014158
Phenotypes for gene: USMG5 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 6 MIM#618683
Intellectual disability syndromic and non-syndromic v1.538 C14orf80 Zornitza Stark edited their review of gene: C14orf80: Added comment: PMID 30842647 reports another individual with compound heterozygous loss‑of‑function TEDC1 variants (splice and frameshift) causing primary microcephaly, primordial dwarfism and developmental delay. Promote to Green.; Changed rating: GREEN; Changed publications: 39979680, 38252227, 30842647
Intellectual disability syndromic and non-syndromic v1.534 SELENOI Zornitza Stark changed review comment from: Four families reported now, upgrade to Green. Although spasticity and motor delay are prominent, intellectual impairment and speech delay are also a feature.; to: 8 individuals from four families reported now, upgrade to Green. Although spasticity and motor delay are prominent, intellectual impairment and speech delay are also a feature. Profound ID in one individual, others described as mild or showing signs of regression.
Intellectual disability syndromic and non-syndromic v1.534 SELENOI Zornitza Stark Phenotypes for gene: SELENOI were changed from developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals; microcephaly to Spastic paraplegia 81, autosomal recessive, MIM# 618768
Intellectual disability syndromic and non-syndromic v1.531 SELENOI Zornitza Stark edited their review of gene: SELENOI: Added comment: Four families reported now, upgrade to Green. Although spasticity and motor delay are prominent, intellectual impairment and speech delay are also a feature.; Changed rating: GREEN; Changed publications: 28052917, 39806532, 29500230, 33454747; Changed phenotypes: Spastic paraplegia 81, autosomal recessive, MIM# 618768
Intellectual disability syndromic and non-syndromic v1.528 HCN2 Zornitza Stark Phenotypes for gene: HCN2 were changed from Neurodevelopmental disorder (MONDO#0700092), HCN2-related to Neurodevelopmental disorder (MONDO#0700092), HCN2-related; Generalized epilepsy with febrile seizures plus, type 11, MIM# 602477
Intellectual disability syndromic and non-syndromic v1.526 HCN2 Zornitza Stark reviewed gene: HCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Generalized epilepsy with febrile seizures plus, type 11, MIM# 602477; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.525 PPP1R3F Paul De Fazio reviewed gene: PPP1R3F: Rating: AMBER; Mode of pathogenicity: None; Publications: 37531237; Phenotypes: Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.523 BAZ2B Zornitza Stark edited their review of gene: BAZ2B: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.520 ISCA-37429-Loss Sarah Milton Region: ISCA-37429-Loss was added
Region: ISCA-37429-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37429-Loss.
Mode of inheritance for Region: ISCA-37429-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37429-Loss were set to Wolf-Hirschhorn syndrome, MIM# 194190; intellectual disability; growth retardation; seizures; dysmorphic features
Intellectual disability syndromic and non-syndromic v1.519 ISCA-37425-Loss Sarah Milton Region: ISCA-37425-Loss was added
Region: ISCA-37425-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37425-Loss.
Mode of inheritance for Region: ISCA-37425-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37425-Loss were set to 23190751; 19596467
Phenotypes for Region: ISCA-37425-Loss were set to Sotos syndrome, chromosome 5q35 deletion; intellectual disability; overgrowth
Intellectual disability syndromic and non-syndromic v1.518 ISCA-37425-Gain Sarah Milton Region: ISCA-37425-Gain was added
Region: ISCA-37425-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37425-Gain.
Mode of inheritance for Region: ISCA-37425-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37425-Gain were set to 24819041
Phenotypes for Region: ISCA-37425-Gain were set to Chromosome 5q35 duplication syndrome; microcephaly; failure to thrive; seizures
Intellectual disability syndromic and non-syndromic v1.514 KIF21A Rylee Peters reviewed gene: KIF21A: Rating: AMBER; Mode of pathogenicity: None; Publications: 37921537, 39643435, 41282472, 32141982, 24715754, 36494820, 22699964; Phenotypes: Fibrosis of extraocular muscles, congenital, 1/3B, MIM#135700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.510 EMX2 Zornitza Stark edited their review of gene: EMX2: Changed rating: RED
Intellectual disability syndromic and non-syndromic v1.510 CRNKL1 Zornitza Stark reviewed gene: CRNKL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Microcephaly, progressive, with simplified gyral pattern and cerebellar hypoplasia, MIM# 621436; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.508 THG1L Zornitza Stark Tag founder tag was added to gene: THG1L.
Intellectual disability syndromic and non-syndromic v1.508 THG1L Zornitza Stark reviewed gene: THG1L: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.506 ISCA-37418-Loss Zornitza Stark Phenotypes for Region: ISCA-37418-Loss were changed from Potocki-Lupski syndrome; Smith-Magenis syndrome; moderate intellectual disability, delayed speech and language skills, distinctive facial features, sleep disturbances, and behavioral problems; 182290; Structural cardiovascular anomalies (dilated aortic root, bicommissural aortic valve, atrial/ventricular and septal defects) and sleep disturbance; hypotonia, failure to thrive, mental retardation, pervasive developmental disorders, congenital anomalies; Dental abnormalities; hypotonia, poor feeding, failure to thrive, developmental delay particularly cognitive and language deficity, mild-moderate intellectual deficit, and neuropsychiatric disorders to Smith-Magenis syndrome, MIM#182290
Intellectual disability syndromic and non-syndromic v1.503 ISCA-37418-Loss Sarah Milton Region: ISCA-37418-Loss was added
Region: ISCA-37418-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,NHS GMS
Mode of inheritance for Region: ISCA-37418-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for Region: ISCA-37418-Loss were set to Potocki-Lupski syndrome; Smith-Magenis syndrome; moderate intellectual disability, delayed speech and language skills, distinctive facial features, sleep disturbances, and behavioral problems; 182290; Structural cardiovascular anomalies (dilated aortic root, bicommissural aortic valve, atrial/ventricular and septal defects) and sleep disturbance; hypotonia, failure to thrive, mental retardation, pervasive developmental disorders, congenital anomalies; Dental abnormalities; hypotonia, poor feeding, failure to thrive, developmental delay particularly cognitive and language deficity, mild-moderate intellectual deficit, and neuropsychiatric disorders
Intellectual disability syndromic and non-syndromic v1.501 ISCA-37415-Gain Sarah Milton Region: ISCA-37415-Gain was added
Region: ISCA-37415-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37415-Gain.
Mode of inheritance for Region: ISCA-37415-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37415-Gain were set to 30287593
Phenotypes for Region: ISCA-37415-Gain were set to 16p13.11 microduplication syndrome; intellectual disability; autism; aortopathy
Intellectual disability syndromic and non-syndromic v1.500 ISCA-37411-Loss Sarah Milton Region: ISCA-37411-Loss was added
Region: ISCA-37411-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37411-Loss.
Mode of inheritance for Region: ISCA-37411-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for Region: ISCA-37411-Loss were set to 19372089; 20979196
Phenotypes for Region: ISCA-37411-Loss were set to Chromosome 15q13.3 microdeletion syndrome, MIM# 612001; intellectual disability; epilepsy
Intellectual disability syndromic and non-syndromic v1.499 ISCA-37405-Loss Sarah Milton Region: ISCA-37405-Loss was added
Region: ISCA-37405-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37405-Loss.
Mode of inheritance for Region: ISCA-37405-Loss was set to BIALLELIC, autosomal or pseudoautosomal
Publications for Region: ISCA-37405-Loss were set to 29146700
Phenotypes for Region: ISCA-37405-Loss were set to Nephronophthisis 1, juvenile, MIM# 256100; Joubert syndrome 4, MIM# 609583; Senior-Loken syndrome 1, MIM# 266900
Intellectual disability syndromic and non-syndromic v1.497 CTNND2 Zornitza Stark Added comment: Comment when marking as ready: Additional cytogenetic evidence noted. However, causality not established by these observations, maintain Amber rating.
Intellectual disability syndromic and non-syndromic v1.496 HNRNPU Chirag Patel Deleted their review
Intellectual disability syndromic and non-syndromic v1.496 HNRNPU Chirag Patel Deleted their comment
Intellectual disability syndromic and non-syndromic v1.496 HNRNPU Chirag Patel reviewed gene: HNRNPU: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.492 SLC39A8 Zornitza Stark edited their review of gene: SLC39A8: Changed phenotypes: Congenital disorder of glycosylation, type IIn , MIM#616721
Intellectual disability syndromic and non-syndromic v1.491 RSPRY1 Zornitza Stark edited their review of gene: RSPRY1: Changed phenotypes: Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, MIM# 616723
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.; to: Additional cases:
PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel - first case). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica reviewed gene: CTNND2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38604781, PMID: 25473103, PMID: 31814264,; Phenotypes: Neurodevelopmental disorders (NDDs), intellectual disability (ID), autism, behavioural issues; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.487 Zornitza Stark Added reviews for gene PPM1K from panel Aminoacidopathy
Intellectual disability syndromic and non-syndromic v1.484 ISCA-37397-Loss Sarah Milton Region: ISCA-37397-Loss was added
Region: ISCA-37397-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37397-Loss.
Mode of inheritance for Region: ISCA-37397-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37397-Loss were set to 21671380; 23765049; 18179902
Phenotypes for Region: ISCA-37397-Loss were set to Chromosome 22q11.2 deletion syndrome, distal, MIM#611867; intellectual disability; seizures; growth retardation; multiple congenital anomalies
Intellectual disability syndromic and non-syndromic v1.482 ISCA-37396-Loss Sarah Milton Region: ISCA-37396-Loss was added
Region: ISCA-37396-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37396-Loss.
Mode of inheritance for Region: ISCA-37396-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37396-Loss were set to 22180641; 19557438; 19233321; 22359776
Phenotypes for Region: ISCA-37396-Loss were set to Chromosome 15q24 deletion syndrome, MIM#613406; intellectual disability; facial dysmorphisms; congenital malformations of the hands and feet, eye, and genitalia; joint laxity; and growth retardation and failure to thrive
Intellectual disability syndromic and non-syndromic v1.479 ISCA-37392-Loss Sarah Milton Region: ISCA-37392-Loss was added
Region: ISCA-37392-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37392-Loss.
Mode of inheritance for Region: ISCA-37392-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37392-Loss were set to 20301427
Phenotypes for Region: ISCA-37392-Loss were set to Williams-Beuren syndrome, MIM# 194050; intellectual disability; growth retardation; cardiovascular disease
Intellectual disability syndromic and non-syndromic v1.475 MT-ATP6 Zornitza Stark gene: MT-ATP6 was added
gene: MT-ATP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-ATP6.
Mode of inheritance for gene gene: MT-ATP6 was set to MITOCHONDRIAL
Publications for gene: MT-ATP6 were set to 40112238
Phenotypes for gene: MT-ATP6 were set to Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related
Intellectual disability syndromic and non-syndromic v1.473 FASTKD5 Zornitza Stark reviewed gene: FASTKD5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 24, MIM# 621431; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.470 ABI2 Zornitza Stark changed review comment from: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.
Sources: Literature; to: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.

Amber as still a preprint. Additional individual with recurrent variant identified internally.

Sources: Literature
Intellectual disability syndromic and non-syndromic v1.470 ABI2 Zornitza Stark gene: ABI2 was added
gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ABI2 were set to 40475134
Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related
Review for gene: ABI2 was set to AMBER
Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.469 NUDT2 Zornitza Stark Phenotypes for gene: NUDT2 were changed from Muscular hypotonia; Global developmental delay; Intellectual disability; Polyneuropathy to Intellectual developmental disorder with or without peripheral neuropathy MIM#619844
Intellectual disability syndromic and non-syndromic v1.468 NUDT2 Zornitza Stark edited their review of gene: NUDT2: Added comment: PMID 38141063 reports 18 individuals from 10 unrelated families with biallelic loss‑of‑function NUDT2 variants presenting with early‑onset neurodevelopmental disorder characterized by hypotonia, motor delay, gait disturbance, mild intellectual disability, peripheral neuropathy, corpus callosum abnormalities and progressive basal ganglia signal abnormalities.; Changed publications: 27431290, 30059600, 33058507, 38141063
Intellectual disability syndromic and non-syndromic v1.468 NUDT2 Zornitza Stark edited their review of gene: NUDT2: Changed phenotypes: Intellectual developmental disorder with or without peripheral neuropathy MIM#619844
Intellectual disability syndromic and non-syndromic v1.468 KARS Zornitza Stark changed review comment from: Sources: Expert list; to: Infantile-onset progressive leukoencephalopathy with or without deafness (LEPID) is a complex neurodegenerative disorder with onset of symptoms in infancy or early childhood. Most individuals present with sensorineural deafness or hypoacousia and global developmental delay. Affected individuals show episodic regression with progressive motor deterioration resulting in spastic tetraplegia and loss of ambulation, as well as impaired intellectual development with poor or absent speech. Additional more variable features may include poor overall growth with microcephaly, seizures, visual loss, microcytic anaemia, and hepatic enlargement or abnormal liver enzymes.

Brain imaging shows deep white matter abnormalities consistent with a progressive leukoencephalopathy.

Calcifications of the brain and spinal cord are a feature.
Intellectual disability syndromic and non-syndromic v1.467 HID1 Lucy Spencer Phenotypes for gene: HID1 were changed from Syndromic infantile encephalopathy; Hypopituitarism to Developmental and epileptic encephalopathy 105 with hypopituitarism MIM#619983
Intellectual disability syndromic and non-syndromic v1.465 HDAC4 Lucy Spencer Phenotypes for gene: HDAC4 were changed from Brachydactyly mental retardation syndrome; Brachydactyly without intellectual disability to Neurodevelopmental disorder with central hypotonia and dysmorphic facies MIM#619797; Brachydactyly mental retardation syndrome; Brachydactyly without intellectual disability
Intellectual disability syndromic and non-syndromic v1.459 GRIN2B Lucy Spencer Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to GRIN2B-related complex neurodevelopmental disorder MONDO:0700350; Developmental and epileptic encephalopathy 27 MIM#616139; Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM#613970
Intellectual disability syndromic and non-syndromic v1.458 GRIK2 Lucy Spencer Phenotypes for gene: GRIK2 were changed from Mental retardation, autosomal recessive, 6 MIM# 611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures, MIM# 619580 to Intellectual developmental disorder, autosomal recessive 6 MIM#611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures MIM#619580
Intellectual disability syndromic and non-syndromic v1.457 GNB5 Lucy Spencer Phenotypes for gene: GNB5 were changed from Intellectual developmental disorder with cardiac arrhythmia, 617173; Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia, 617182; Early infantile epileptic encephalopathy (EIEE) to gnb5-related intellectual disability-cardiac arrhythmia syndrome MONDO:0014953; Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173); Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182)
Intellectual disability syndromic and non-syndromic v1.455 TRA2B Zornitza Stark reviewed gene: TRA2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ramond-Elliott neurodevelopmental syndrome, MIM# 621421; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.454 MET Chirag Patel Mode of inheritance for gene: MET was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.453 MET Chirag Patel edited their review of gene: MET: Added comment: ClinGen DISPUTED - Jan 2021; Changed phenotypes: complex neurodevelopmental disorder, MONDO:0100038; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.450 CNTN4 Chirag Patel reviewed gene: CNTN4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.450 CNTNAP5 Chirag Patel reviewed gene: CNTNAP5: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.450 SLC9A9 Chirag Patel Source Genetic Health Queensland was removed from SLC9A9.
Source ClinGen was added to SLC9A9.
Mode of inheritance for gene SLC9A9 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Tag disputed tag was added to SLC9A9.
Intellectual disability syndromic and non-syndromic v1.449 SLC9A9 Chirag Patel reviewed gene: SLC9A9: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.445 COQ5 Zornitza Stark Phenotypes for gene: COQ5 were changed from Coenzyme Q10 deficiency, primary 9, MIM#619028; Cerebellar ataxia; encephalopathy; generalized tonic-clonic seizures; intellectual disability to Coenzyme Q10 deficiency, primary, 9 MIM#619028
Intellectual disability syndromic and non-syndromic v1.440 SEC31A Zornitza Stark Phenotypes for gene: SEC31A were changed from ?Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, OMIM #618651 to Halperin-Birk syndrome, MIM# 618651
Intellectual disability syndromic and non-syndromic v1.438 Zornitza Stark Added reviews for gene SEC31A from panel Arthrogryposis
Intellectual disability syndromic and non-syndromic v1.434 GAD1 Zornitza Stark Phenotypes for gene: GAD1 were changed from Cerebral palsy, spastic quadriplegic, 1, MIM#603513; Developmental and epileptic encephalopathy 89, MIM# 619124 to Developmental and epileptic encephalopathy 89, MIM# 619124
Intellectual disability syndromic and non-syndromic v1.432 CACNA1A Zornitza Stark Mode of inheritance for gene: CACNA1A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.429 TUBA8 Chirag Patel reviewed gene: TUBA8: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.429 IGBP1 Chirag Patel Deleted their review
Intellectual disability syndromic and non-syndromic v1.429 IGBP1 Chirag Patel Deleted their comment
Intellectual disability syndromic and non-syndromic v1.429 IGBP1 Chirag Patel reviewed gene: IGBP1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.429 ARHGEF6 Chirag Patel reviewed gene: ARHGEF6: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Non-syndromic X-linked intellectual disability, MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.429 SRPX2 Chirag Patel reviewed gene: SRPX2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.427 DOCK4 Zornitza Stark edited their review of gene: DOCK4: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, DOCK4-related
Intellectual disability syndromic and non-syndromic v1.426 LRRC7 Zornitza Stark edited their review of gene: LRRC7: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 77, MIM# 621415
Intellectual disability syndromic and non-syndromic v1.425 KLHL13 Krithika Murali gene: KLHL13 was added
gene: KLHL13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KLHL13 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: KLHL13 were set to PMID: 41159445
Phenotypes for gene: KLHL13 were set to Neurodevelopmental disorder, MONDO:0700092, KLHL13-related
Review for gene: KLHL13 was set to GREEN
Added comment: PMID: 41159445 Akhther et al 2025 (pre-print) report 8 affected individuals from 4 unrelated famlies with hemizygous/heterozygous KLHL13 variants and an X-linked neurodevelopmental disorder with the following phenotypic features including mild-severe ID, developmental delay, macrocephaly, hypotonia, unsteady gait, facial dysmrophism and behavioural issues. Functional studies support LoF disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.416 CCNK Sangavi Sivagnanasundram changed review comment from: CCNK encodes a regulatory subunit of cyclin-dependent kinases that mediates activation of target kinases.
Reported affected individuals presented with a syndromic neurodevelopmental disorder (i.e. DD, ID, language impairment and various dysmorphic features)
7 unrelated families with different de novo variants (missense and CNV, deletion). All variants were either rare for AD gene or absent in gnomAD v4.1.
Supportive functional studies (knockdown zebrafish and mouse model) showed recapitulation of human phenotype and was supportive of LoF as the mechanism of disease
Sources: Literature; to: CCNK encodes a regulatory subunit of cyclin-dependent kinases that mediates activation of target kinases.
Reported affected individuals presented with a syndromic neurodevelopmental disorder (i.e. DD, ID, language impairment and various dysmorphic features)
7 unrelated families with different de novo variants (missense and CNV, deletion). All variants were absent in gnomAD v4.1.
Supportive functional studies (knockdown zebrafish and mouse model) showed recapitulation of human phenotype and was supportive of LoF as the mechanism of disease
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.414 SRRM1 Zornitza Stark gene: SRRM1 was added
gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRRM1 were set to 41145827
Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related
Review for gene: SRRM1 was set to GREEN
Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism.

Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.412 SGSM3 Zornitza Stark reviewed gene: SGSM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 84, MIM# 620401; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.412 PAN2 Zornitza Stark Phenotypes for gene: PAN2 were changed from Syndromic disease MONDO:0002254 to Developmental delay with variable cardiac and renal congenital anomalies and dysmoprhic facies, MIM# 621384
Intellectual disability syndromic and non-syndromic v1.411 PAN2 Zornitza Stark reviewed gene: PAN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay with variable cardiac and renal congenital anomalies and dysmoprhic facies, MIM# 621384; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.410 TAF2 Zornitza Stark edited their review of gene: TAF2: Changed phenotypes: Intellectual development disorder, autosomal recessive 40, MIM# 615599
Intellectual disability syndromic and non-syndromic v1.409 CXorf56 Zornitza Stark edited their review of gene: CXorf56: Changed phenotypes: Intellectual developmental disorder, X-linked 107, MIM# 301013
Intellectual disability syndromic and non-syndromic v1.409 SKOR2 Zornitza Stark Phenotypes for gene: SKOR2 were changed from complex neurodevelopmental disorder with motor features MONDO:0100516 to Valence-Farazi cerebellar ataxia syndrome, MIM# 621386
Intellectual disability syndromic and non-syndromic v1.408 SKOR2 Zornitza Stark edited their review of gene: SKOR2: Changed phenotypes: Valence-Farazi cerebellar ataxia syndrome, MIM# 621386
Intellectual disability syndromic and non-syndromic v1.398 OTUD7A Rylee Peters reviewed gene: OTUD7A: Rating: GREEN; Mode of pathogenicity: None; Publications: 29395075, 31997314, 33381903, 36180924, 41028987; Phenotypes: Neurodevelopmental disorder with hypotonia and seizures (MIM#620790), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.398 AUTS2 Fahaz Nazer reviewed gene: AUTS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 39953909; Phenotypes: Intellectual developmental disorder, autosomal dominant 26, MIM# 615834; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.398 SLC31A1 Rylee Peters reviewed gene: SLC31A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 41040850; Phenotypes: Neurodegeneration and seizures due to copper transport defect MIM#620306; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.397 DIP2B_FRA12A_CGG Bryony Thompson edited their review of STR: DIP2B_FRA12A_CGG: Added comment: Unsure about the expansions association with disease due to variable phenotypes and possible incomplete penetrance PMID 17236128, 39854091, and 41028987 report 23 unrelated families with heterozygous CGG repeat expansions in the 5′UTR of DIP2B. Sixteen families present with intellectual disability associated with the FRA12A fragile site, while seven families (including two siblings, five ataxia probands, and one dystonia case) exhibit neurodevelopmental disability with progressive movement disorders (chorea, dystonia, ataxia). Functional studies demonstrate reduced DIP2B expression via promoter hypermethylation. Segregation analysis shows segregation from unaffected parents (possibly reduced penetrance) and de novo events. DIP2B expansion OR 2.8 (p=0.04) in ataxia cohort (5/788) vs gnomAD.; Changed publications: 17236128, 33510257, 39854091, 41028987; Changed phenotypes: intellectual disability, FRA12A type MONDO:0007634
Intellectual disability syndromic and non-syndromic v1.392 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.391 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder (MONDO:0700092), KLHL20-related to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.390 KLHL20 Zornitza Stark reviewed gene: KLHL20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.390 SNAPIN Zornitza Stark Phenotypes for gene: SNAPIN were changed from Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393 to Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393
Intellectual disability syndromic and non-syndromic v1.389 SNAPIN Zornitza Stark Phenotypes for gene: SNAPIN were changed from Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related to Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393
Intellectual disability syndromic and non-syndromic v1.388 SNAPIN Zornitza Stark reviewed gene: SNAPIN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark edited their review of gene: CDKL1: Changed rating: RED
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark Mode of pathogenicity for gene: CDKL1 was changed from None to None
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark Mode of pathogenicity for gene: CDKL1 was changed from Other to None
Intellectual disability syndromic and non-syndromic v1.384 CDKL1 Zornitza Stark edited their review of gene: CDKL1: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.384 CDKL1 Zornitza Stark commented on gene: CDKL1: PMID 40088891 reports two unrelated individuals with de novo heterozygous CDKL1 missense variants (p.Val115Ala, p.Arg169Cys) presenting with childhood‑onset neurodevelopmental disorder, developmental delay and seizures; Drosophila rescue assays show dominant‑negative activity of the variants. However, note that the variants are present at low frequency in gnomAD v4, p.Val115Ala: 2 individuals, p.Arg169Cys: 13 individuals. Some supportive functional data presented. Upgrade to Amber but not Green due to pop counts.
Intellectual disability syndromic and non-syndromic v1.382 MOCS3 Zornitza Stark edited their review of gene: MOCS3: Changed phenotypes: Molybdenum cofactor deficiency, type B2, MIM# 621373
Intellectual disability syndromic and non-syndromic v1.382 TBCB Zornitza Stark Phenotypes for gene: TBCB were changed from Neurodevelopmental disorder, MONDO:0700092, TBCB-related to Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382
Intellectual disability syndromic and non-syndromic v1.381 TBCB Zornitza Stark reviewed gene: TBCB: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.381 KMT2B Zornitza Stark commented on gene: KMT2B: Note ClinGen have lumped the dystonia and ID phenotypes as these overlap in the same families. Association considered DEFINITIVE.
Intellectual disability syndromic and non-syndromic v1.380 TBX2 Krithika Murali gene: TBX2 was added
gene: TBX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TBX2 were set to PMID: 36733940
Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction - MIM#618223
Review for gene: TBX2 was set to AMBER
Added comment: PMID: 36733940 Rafeeq et al 2022 report a novel de novo nonsense variant (c.529A>T; p.Lys177*; NM_005994.4) in a child with chondrodysplasia. Skeletal features included spinal deformities, short limbs, metaphyseal and epiphyseal dysplasia, and bilateral developmental dislocation of the hip (DDH).

Global developmental delay was also noted in this child.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.378 EIF3B Zornitza Stark gene: EIF3B was added
gene: EIF3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3B were set to 41033306
Phenotypes for gene: EIF3B were set to Syndromic disease (MONDO:0002254), EIF3B-related
Review for gene: EIF3B was set to GREEN
Added comment: Fourteen individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark changed review comment from: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature; to: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark edited their review of gene: EIF3A: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark gene: EIF3A was added
gene: EIF3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3A were set to 41033306
Phenotypes for gene: EIF3A were set to Syndromic disease (MONDO:0002254), EIF3A-related
Added comment: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.373 MDGA2 Zornitza Stark gene: MDGA2 was added
gene: MDGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MDGA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MDGA2 were set to https://doi.org/10.1101/2025.08.28.25330873; 40168357; 27608760
Phenotypes for gene: MDGA2 were set to MDGA2-related neurodevelopmental disorder MONDO:0700092
Review for gene: MDGA2 was set to GREEN
Added comment: Affected individuals present with a broad neurodevelopmental impairment-like phenotype.

Pre-print - https://doi.org/10.1101/2025.08.28.25330873
Individuals with developmental and epileptic encephalopathy (DEE)
8 individuals from 6 consanguineous families exhibiting infantile hypotonia, severe neurodevelopmental delay, intractable seizures, progressive brain atrophy, and consistent dysmorphic features.
7 different biallelic LoF variants were identified
p.Tyr913Ter, p.Arg404Ter, p.Leu920Ter, c.421-1G>A, p.Lys391SerfsTer7 and c.421-96_595+99del - all variants are rare or absent in gnomAD v4.1
In vitro functional studies of three nonsense variants in mammalian expression systems and hippocampal cultured neurons that resulted in impaired MDGA2 membrane trafficking are supportive of a loss-of-function mechanism.

PMID: 40168357, 27608760
A knockout mouse model showed that MGAD2-deficient mice presented with autism-like behaviours (social deficits, repetitive behaviour, and cognitive impairment).
The mice also showed abnormalities in excitatory synapses.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.371 DBX1 Zornitza Stark gene: DBX1 was added
gene: DBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DBX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DBX1 were set to 40995053
Phenotypes for gene: DBX1 were set to central hypoventilation syndrome, congenital MONDO:0800031
Review for gene: DBX1 was set to RED
Added comment: Single individual reported with congenital central hypoventilation syndrome (atypical CCHS) with central hypotonia, global developmental delay, seizures, autoaggressive behaviour. Consanguineous parents, hmz frameshift variant c.340_341delGC, absent from gnomAD.
Mouse Dbx1 knockout is lethal indicating essential role in respiration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.369 NFXL1 Zornitza Stark gene: NFXL1 was added
gene: NFXL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NFXL1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NFXL1 were set to 40430072; 41024252
Phenotypes for gene: NFXL1 were set to Syndromic disease (MONDO:0002254), NFXL1-related
Review for gene: NFXL1 was set to AMBER
Added comment: PMID: 40430072 2 siblings with psychosis and schizophrenia, homozygous for Cys441Tyr. Some modelling suggested a deleterious affect but no functional studies performed.

PMID: 41024252 8 patients from 7 families with joint hyperlaxity, with or without short stature and renal disease. 6 families were homozygous for p.(Cys539Trpfs*64) while the other two were homozygous for p.(Lys681*). Paper described both as founder variants but they are rare/absent in gnomad.

Joint hyperlaxity (7), chronic kidney disease/FSGS (2) small echogenic kidneys (3), acute kidney injury (1), dysmorphic features (6), short stature (6), speech delay (3).

One patient also had epilepsy, developmental delay and spasticity however c.728+1G>A in WDR45 explained this part of her phenotype. Other patients also had more severe outlying symptoms with no other explanation mentioned: 1 with developmental delay, hearing loss, brain malformations, skeletal abnormalities, and another a 3 year old who passed away following a complex medical course including blue sclera, proximal tibial fracture, severe respiratory distress due to a chest infection, and acute kidney injury.

Amber given the variable phenotype findings of the reported patients and only 2 homozygous variants identified so far.

Extent of associated DD/ID currently unclear but adding on this panel as it is often ordered in children with multi-system features suggestive of an underlying syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.366 CDK9 Zornitza Stark gene: CDK9 was added
gene: CDK9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDK9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDK9 were set to 33640901; 30237576; 26633546
Phenotypes for gene: CDK9 were set to multiple congenital anomalies/dysmorphic syndrome-variable intellectual disability syndrome MONDO:0015160; CHARGE-like syndrome with retinal dystrophy
Review for gene: CDK9 was set to AMBER
Added comment: Two independent reports:
1) A boy with a phenotype resembling CHARGE syndrome (multiple anomalies involving the eyes, ears, cleft lip, and palate, and intellectual disability) with retinal dystrophy (p.A288T/p.R303C),
2) 4 consanguineous families homozygous for p.R225C, including a set of cousins.
CDK9 variants demonstrated decreased kinase activity. One of the studies suggested the extent the kinase activity is reduced may account for the absence/presence of the CHARGE-like phenotype with retinal dystrophy

One additional family with retinal dystrophy only.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.365 AGTPBP1 Chirag Patel Phenotypes for gene: AGTPBP1 were changed from Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy; Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 to Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650
Publications for gene AGTPBP1 were changed from 30420557, 28600779, 30976113, 38153683, 28325758 to 30420557, 28600779, 30976113, 38153683, 28325758
Intellectual disability syndromic and non-syndromic v1.364 ATP1A3 Chirag Patel Source Genetic Health Queensland was removed from ATP1A3.
Source Expert list was added to ATP1A3.
Phenotypes for gene: ATP1A3 were changed from Alternating hemiplegia of childhood 2, MIM#614820; Developmental and epileptic encephalopathy, polymicrogyria to ATP1A3-associated neurological disorder, MONDO:0700002
Publications for gene ATP1A3 were changed from 33880529, 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 to 33880529, 15260953, 22842232, 24468074, 33762331, 29861155, 31425744
Intellectual disability syndromic and non-syndromic v1.363 ALS2 Chirag Patel Source Genetic Health Queensland was removed from ALS2.
Source ClinGen was added to ALS2.
Phenotypes for gene: ALS2 were changed from Spastic paralysis, infantile onset ascending, MIM#607225 to ALS2-related motor neuron disease, MONDO:0100227
Intellectual disability syndromic and non-syndromic v1.362 ALG14 Chirag Patel Source Genetic Health Queensland was removed from ALG14.
Source Expert list was added to ALG14.
Publications for gene ALG14 were changed from 30221345, 23404334, 28733338, 33751823, 34971077 to 30221345, 23404334, 28733338, 33751823, 34971077
Intellectual disability syndromic and non-syndromic v1.361 DHCR24 Chirag Patel Source Genetic Health Queensland was removed from DHCR24.
Source ClinGen was added to DHCR24.
Phenotypes for gene: DHCR24 were changed from Desmosterolosis, MIM# 602398 to Desmosterolosis, MONDO:0011217
Publications for gene DHCR24 were changed from 11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936 to 11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936
Intellectual disability syndromic and non-syndromic v1.360 DDX11 Chirag Patel Source Genetic Health Queensland was removed from DDX11.
Source ClinGen was added to DDX11.
Phenotypes for gene: DDX11 were changed from Warsaw breakage syndrome, MIM# 613398; MONDO:0013252 to Warsaw breakage syndrome, MONDO:0013252
Publications for gene DDX11 were changed from 20137776, 23033317, 30216658, 30924321, 32855419, 36703504, 26089203 to 20137776, 23033317, 30216658, 30924321, 32855419, 36703504, 26089203
Intellectual disability syndromic and non-syndromic v1.358 UGGT1 Zornitza Stark reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type IICC, MIM# 621381; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.358 NAA20 Chern Lim reviewed gene: NAA20: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37191084; Phenotypes: Intellectual developmental disorder, autosomal recessive 73, MIM# 619717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.354 DDOST Bryony Thompson edited their review of gene: DDOST: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.354 DDOST Bryony Thompson reviewed gene: DDOST: Rating: ; Mode of pathogenicity: None; Publications: 22305527, 34462534, 36214423, 37848450, 33413482, 36631682; Phenotypes: DDOST-congenital disorder of glycosylation MONDO:0013789; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.353 TM2D3 Zornitza Stark edited their review of gene: TM2D3: Changed phenotypes: Neurocardiorenal malformation syndrome, MIM# 621379
Intellectual disability syndromic and non-syndromic v1.352 ATXN7L3 Zornitza Stark reviewed gene: ATXN7L3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Harel-Tora neurodevelopmental syndrome, MIM# 621377; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.350 BCAT1 Lucy Spencer gene: BCAT1 was added
gene: BCAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BCAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BCAT1 were set to 41029903
Phenotypes for gene: BCAT1 were set to Neurodevelopmental disorder (MONDO:0700092), BCAT1-related
Review for gene: BCAT1 was set to RED
Added comment: PMID: 41029903 One patient with a suspected neurometabolic disorder; congenital blindness and suspected Leber Congenital Amaurosis, microcephaly, failure to thrive, profound global developmental delay and extensive delayed myelination on MRI. AT 10 he was non-verbal and non-ambulatory with regression of motor skills and -3SD for height and weight. Compound heterozygous for Phe264Leu (539 hets but no homs in gnomad v4) and Glu348Lys (over 8000 hets and 24 homs in gnomad v4).

in compound heterozygous iPSCs a severe 75% reduction in BCAT1 protein levels was seen, but mRNA levels were normal suggesting the variants affect protein stability or increased degradation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 HYPK Sangavi Sivagnanasundram reviewed gene: HYPK: Rating: ; Mode of pathogenicity: None; Publications: 40986405; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, HYPK-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.350 RNU6ATAC Lucy Spencer gene: RNU6ATAC was added
gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNU6ATAC were set to 40975062
Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related
Review for gene: RNU6ATAC was set to RED
Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP1 Lucy Spencer gene: PTBP1 was added
gene: PTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP1 were set to 40965981
Phenotypes for gene: PTBP1 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP1-related
Review for gene: PTBP1 was set to GREEN
Added comment: PMID: 40965981 27 individuals with abnormal prenatal ultrasound in thirteen (48%) including short femora, IUGR, hydramnios, increased nuchal translucency, asymmetry of heart cavities, and bilateral hydronephrosis. Skeletal anomalies were seen in 24 (89%), short stature/limbs in 63%, facial dysmorphism 25 (93%), developmental delay in 78%, behavioral problems in 30% and ID in 26% generally mild/moderate, 43% had variable brain MRI abnormalities. additional features included skin, nail, and hair anomalies (52%), dental anomalies (37%), ophthalmological findings (44%), and cardiovascular defects (22%).

Variants a mix of missense and startloss, and were confirmed de novo in 23/17 cases.

Various functional studies showed reduced nuclear localization and enhanced cytoplasmic retention, with start-loss variants also leading to increased protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP2 Lucy Spencer gene: PTBP2 was added
gene: PTBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP2 were set to 40965981
Phenotypes for gene: PTBP2 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP2-related
Review for gene: PTBP2 was set to AMBER
Added comment: PMID: 40965981 2 males with developmental delay, ID, autistic features. 1 had some dysmorphic features and tonic-clonic seizures. both probands had a de novo variant in PTBP2 NM_021190.4:c.2T>C (p.Met1?) and NM_021190.4:c.41G>C (p.Arg14Thr), absent from gnomad. Transfection of the variants in transfection in NIH-3T3 cells showed the missense had cytoplasmic retention and colocalization with processing bodies, and that there were 2 alternative downstream start sites Met32 and Met35 that may be used instead.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 ITGAV Zornitza Stark Phenotypes for gene: ITGAV were changed from Syndromic disease, MONDO:0002254, ITGAV-related to Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372
Intellectual disability syndromic and non-syndromic v1.348 ITGAV Zornitza Stark edited their review of gene: ITGAV: Changed rating: GREEN; Changed phenotypes: Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372
Intellectual disability syndromic and non-syndromic v1.348 UBR5 Zornitza Stark Phenotypes for gene: UBR5 were changed from Neurodevelopmental disorder MONDO:0700092, UBR5-related to Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372
Intellectual disability syndromic and non-syndromic v1.347 UBR5 Zornitza Stark reviewed gene: UBR5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.347 DNM1L Chirag Patel Source Genetic Health Queensland was removed from DNM1L.
Source ClinGen was added to DNM1L.
Source Literature was added to DNM1L.
Mode of pathogenicity for gene DNM1L was changed from to Other
Phenotypes for gene: DNM1L were changed from Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388 to Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726
Publications for gene DNM1L were changed from 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748 to 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748
Intellectual disability syndromic and non-syndromic v1.346 SF1 Sarah Milton changed review comment from: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
Variant types included missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature; to: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
12 confirmed to have de novo variants including missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.346 SF1 Sarah Milton gene: SF1 was added
gene: SF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SF1 were set to PMID: 40987292
Phenotypes for gene: SF1 were set to Neurodevelopmental disorder, MONDO:0700092, SF1-related
Review for gene: SF1 was set to GREEN
Added comment: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
Variant types included missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.344 DIAPH1 Chirag Patel Source Genetic Health Queensland was removed from DIAPH1.
Source Literature was added to DIAPH1.
Phenotypes for gene: DIAPH1 were changed from progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714 to Progressive microcephaly-seizures-cortical blindness-developmental delay syndrome, MONDO:0014714
Publications for gene DIAPH1 were changed from 24781755, 26463574, 33662367, 36212620, 39076976, 39120629 to 24781755, 26463574, 33662367, 36212620, 39076976, 39120629
Intellectual disability syndromic and non-syndromic v1.342 LEO1 Chirag Patel reviewed gene: LEO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 40993282, 33004838, 31785789, 40671880, 29674594; Phenotypes: Neurodevelopmental disorder MONDO:0700092, LEO-1 related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.342 SYNE2 Chirag Patel gene: SYNE2 was added
gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SYNE2 were set to 34573277
Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related
Review for gene: SYNE2 was set to RED
Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells.

SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton gene: INTS6 was added
gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: INTS6 were set to PMID: 40966122
Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related
Review for gene: INTS6 was set to GREEN
Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.339 RNU2-2P Zornitza Stark Mode of inheritance for gene: RNU2-2P was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.338 RNU2-2P Zornitza Stark edited their review of gene: RNU2-2P: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.338 RNU2-2P Zornitza Stark edited their review of gene: RNU2-2P: Added comment: PMID 40950445: reports bi-allelic cases in a cohort of over 100 individuals. One variant frequently de novo in trans with inherited variant.; Changed publications: 40210679, 40442284, 40950445
Intellectual disability syndromic and non-syndromic v1.337 CRNKL1 Boris Keren reviewed gene: CRNKL1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 40857589; Phenotypes: microcephaly, intellectual disability, simplified gyration, epilepsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.335 MRPS36 Krithika Murali gene: MRPS36 was added
gene: MRPS36 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRPS36 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPS36 were set to PMID: 41018056; 38685873
Phenotypes for gene: MRPS36 were set to Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related
Review for gene: MRPS36 was set to AMBER
Added comment: 3 individuals from 2 unrelated families reported with biallelic MRPS36 variants (current HGNC is KGD4). Gene encodes E4 subunit of OGDHC complex. Individuals present with a phenotype consistent with Leigh syndrome including seizures, hypotonia, dystonia, brain imaging anomalies, persistent lactic acidosis. GDD, ID and cardiomyopathy also reported.

Patient-derived fibroblast studies demonstrates reduced OGDHC enzymatic activity, however, this functional evidence is not gene or variant-specific.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.330 GTF2I Zornitza Stark edited their review of gene: GTF2I: Added comment: 7 individuals reported with de novo variants in this gene and a neurodevelopmental disorder. All but one of the variants are absent from gnomAD v4 (one het present for the indel variant).; Changed rating: GREEN; Changed publications: 40962490; Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF2I-relatedder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.329 BBOX1 Zornitza Stark gene: BBOX1 was added
gene: BBOX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BBOX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BBOX1 were set to 41022783
Phenotypes for gene: BBOX1 were set to Carnitine deficiency, MONDO:0017716, BBOX1-related
Review for gene: BBOX1 was set to AMBER
Added comment: Three individuals from two unrelated families reported, presenting with myopathy, neurodevelopmental delay, and later-onset psychiatric manifestations. C. elegans knockout and patient-variant models show embryonic lethality rescued by L‑carnitine supplementation
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.328 INPP4A Zornitza Stark Phenotypes for gene: INPP4A were changed from Intellectual disability to Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354
Intellectual disability syndromic and non-syndromic v1.326 INPP4A Zornitza Stark edited their review of gene: INPP4A: Changed phenotypes: Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354
Intellectual disability syndromic and non-syndromic v1.326 B9D1 Zornitza Stark Phenotypes for gene: B9D1 were changed from Joubert syndrome 27, MIM#617120; Meckel syndrome 9, MIM#614209 to Ciliopathy, MONDO:0005308, B9D1-related
Intellectual disability syndromic and non-syndromic v1.323 B9D1 Zornitza Stark edited their review of gene: B9D1: Added comment: Lumped by ClinGen. Additional individuals reported, promote to Green.; Changed publications: 24886560, 21493627, 40565534, 40933483; Changed phenotypes: Ciliopathy, MONDO:0005308, B9D1-related
Intellectual disability syndromic and non-syndromic v1.323 DNM1 Chirag Patel Source Genetic Health Queensland was removed from DNM1.
Source Literature was added to DNM1.
Publications for gene DNM1 were changed from 25262651; 27066543; 33372033; 34172529; 36553519; 37900685 to 25262651; 27066543; 33372033; 34172529; 36553519; 37900685
Intellectual disability syndromic and non-syndromic v1.322 RALGAPA1 Zornitza Stark Phenotypes for gene: RALGAPA1 were changed from Intellectual disability; hypotonia; infantile spasms. to Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797
Intellectual disability syndromic and non-syndromic v1.321 RALGAPA1 Zornitza Stark edited their review of gene: RALGAPA1: Changed phenotypes: Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797
Intellectual disability syndromic and non-syndromic v1.319 RAC1 Zornitza Stark edited their review of gene: RAC1: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 48 MIM#617751
Intellectual disability syndromic and non-syndromic v1.318 RAB14 Zornitza Stark edited their review of gene: RAB14: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, RAB14-related
Intellectual disability syndromic and non-syndromic v1.317 PJA1 Zornitza Stark edited their review of gene: PJA1: Changed phenotypes: X-linked complex neurodevelopmental disorder, PJA1-related, MONDO:0100148
Intellectual disability syndromic and non-syndromic v1.317 NDE1 Zornitza Stark Phenotypes for gene: NDE1 were changed from Lissencephaly 4 (with microcephaly), MIM# 614019; MONDO:0013527; Microhydranencephaly, MIM# 605013; MONDO:0011504 to Microcephaly with lissencephaly and/or hydranencephaly, MONDO:0700116
Intellectual disability syndromic and non-syndromic v1.316 NDE1 Zornitza Stark edited their review of gene: NDE1: Changed phenotypes: Microcephaly with lissencephaly and/or hydranencephaly, MONDO:0700116
Intellectual disability syndromic and non-syndromic v1.314 ALG2 Chirag Patel reviewed gene: ALG2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 12684507, 34980536, 23404334, 30397276, 33644825; Phenotypes: Congenital disorder of glycosylation, type Ii, MIM# 607906; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.311 AP2S1 Boris Keren reviewed gene: AP2S1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 31981491, 33057194, 35982160, 35982159; Phenotypes: intellectual disability, epilepsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.310 GPHN Bryony Thompson reviewed gene: GPHN: Rating: GREEN; Mode of pathogenicity: None; Publications: 22040219, 11095995, 9812897, 34617111; Phenotypes: sulfite oxidase deficiency due to molybdenum cofactor deficiency type C MONDO:0014212; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.309 BRSK2 Sarah Milton reviewed gene: BRSK2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, BRSK2-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.304 GNAI2 Rylee Peters reviewed gene: GNAI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 40926810, 39298586; Phenotypes: Syndromic disease MONDO:0002254, GNAI2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.304 TRPC5 Rylee Peters reviewed gene: TRPC5: Rating: AMBER; Mode of pathogenicity: None; Publications: 40907672; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TRPC5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.304 KDM5A Rylee Peters reviewed gene: KDM5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 33350388; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), KDM5A-related, AD; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.304 COL4A3BP Elena Savva Phenotypes for gene: COL4A3BP were changed from Intellectual developmental disorder 34 (MIM#616351) to Neurodevelopmental disorder with hypotonia, speech delay, and dysmorphic facies (MIM#616351)
Intellectual disability syndromic and non-syndromic v1.302 TMEM167A Chirag Patel gene: TMEM167A was added
gene: TMEM167A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM167A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM167A were set to PMID: 40924476
Phenotypes for gene: TMEM167A were set to Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related
Review for gene: TMEM167A was set to GREEN
Added comment: 6 individuals from 6 unrelated families (4/6 consanguineous) presenting with neonatal diabetes onset <4mths (6/6), severe microcephaly (6/6), epilepsy (5/6), and developmental delay (4/6).

Whole genome sequencing identified biallelic variants in TMEM167A gene. Variants were homozygous in 5/6 families, and variant types were missense (4), frameshift (1), and splice (1), and all variants were rare/unreported in gnomAD. Segregation studies not reported in paper.

Microcephaly, epilepsy and diabetes syndrome has 2 known associated genes (IER3IP1 and YIPF5) which encode proteins involved in endoplasmic reticulum to Golgi trafficking. TMEM167A is highly expressed in developing and adult human pancreas and brain. Both TMEM167A depletion in EndoC-βH1 cells and knock‑in of p.Val59Glu variant in iPSC-derived β cells sensitized β cells to ER stress. The p.Val59Glu variant impaired proinsulin trafficking to the Golgi and induced iPSC-β cell dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.299 RAB11A Zornitza Stark edited their review of gene: RAB11A: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, RAB11A-related
Intellectual disability syndromic and non-syndromic v1.298 ZNF865 Zornitza Stark reviewed gene: ZNF865: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ZNF865‑associated neurodevelopmental disorder MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.298 PSMC1 Zornitza Stark Phenotypes for gene: PSMC1 were changed from Neurodevelopmental disorder with poor growth, spastic tetraplegia, and hearing loss , MIM# 620071 to Birk-Aharoni syndrome MIM# 620071
Intellectual disability syndromic and non-syndromic v1.297 PSMC1 Zornitza Stark edited their review of gene: PSMC1: Changed phenotypes: Birk-Aharoni syndrome MIM# 620071
Intellectual disability syndromic and non-syndromic v1.296 ZNF865 Sangavi Sivagnanasundram gene: ZNF865 was added
gene: ZNF865 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF865 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF865 were set to 40936200
Phenotypes for gene: ZNF865 were set to ZNF865‑associated neurodevelopmental disorder MONDO:0700092
Review for gene: ZNF865 was set to AMBER
Added comment: PMID: 40936200
18 patients reported with DD, hypotonia and six individuals were reported with some dysmorphic features (frontal bossing, a broad nasal bridge, hypertelorism, and low-set ears)
All 18 individuals were reported with de novo truncating variants in ZNF865. All variants were rare/absent in gnomAD v4.1.

The mechanism of disease for this gene is unknown. No pathogenic SNVs have been reported in ClinVar at this stage however there are reports of VUS’s and pathogenic CNVs.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.296 SNAPIN Lucy Spencer gene: SNAPIN was added
gene: SNAPIN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNAPIN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNAPIN were set to 40930097; 26539891
Phenotypes for gene: SNAPIN were set to Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related
Review for gene: SNAPIN was set to GREEN
Added comment: PMID: 40930097 6 patients from 5 families with neuroanatomical, craniofacial, and skeletal anomalies on prenatal ultrasound/MRI, all homozygous for variants in SNAPIN. 2 stopgain, 1 canonical splice, 5 missense. common phenotypes: ventriculomegaly 5/6, cerebellar hypoplasia/atrophy 5/6, clubfeet 4/6, corpus callosum agenesis 4/6, flexion contractures 4/6, microcephaly 3/6, micrognathia/retrognathia 4/6. The patients with the nonsense or splice variants did not survive the perinatal period, while those with missense survived into early childhood.

This paper also mentions a 7th patient reported in PMID: 26539891, who has ID, microcephaly, cortical atrophy, bulbar and cerebellar hypoplasia, sensorineural polyneuropathy, and hypotonia. They are homozygous for a missense variant Asn55Tyr. Of note, the other paper report this as Arg55Trp and one of their patients also has this variant, based off the transcript information provided in both papers Arg55Trp is correct.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.295 SKOR2 Zornitza Stark gene: SKOR2 was added
gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600
Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516
Review for gene: SKOR2 was set to GREEN
Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model:
PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous).

PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant.

PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.293 PSMB1 Zornitza Stark edited their review of gene: PSMB1: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, PSMB1-related
Intellectual disability syndromic and non-syndromic v1.293 GBX1 Zornitza Stark gene: GBX1 was added
gene: GBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GBX1 were set to 40519143
Phenotypes for gene: GBX1 were set to Neurodevelopmental disorder, MONDO:0700092, GBX1-related
Review for gene: GBX1 was set to RED
Added comment: Single individual with de novo LoF variant with DD and focal epilepsy. Zebrafish model had abnormal morphology of the interocular area. Furthermore, the zebrafish larvae exhibited an increased susceptibility to neurophysiological abnormalities associated with epileptiform activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.291 MTERF3 Zornitza Stark gene: MTERF3 was added
gene: MTERF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTERF3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MTERF3 were set to 40543543
Phenotypes for gene: MTERF3 were set to Mitochondrial disease (MONDO:0044970), MTERF3-related
Review for gene: MTERF3 was set to AMBER
Added comment: Two individuals reported from unrelated families, presenting with DD/ID, intermittent hypoglycaemia and metabolic acidosis. Genetic testing identified compound heterozygous variants c.635dup p.(Asn212Lysfs*7) and c.1055C > T p.(Pro352Leu) in Patient 1, and a homozygous variant c.943A > Gp.(Met315Val) in Patient 2. Patient's fibroblasts and MTERF3 knockdown cells showed impaired mitochondrial respiration and reduced levels of OXPHOS complexes I, III, and IV. Transcription of MT-ND5, ND6, COII, and COIII was reduced, while other mitochondrial genes were upregulated. Wild-type MTERF3 expression restored these defects, but the variant Pro352Leu from patient failed to rescue mitochondrial dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.289 ATP5A1 Zornitza Stark gene: ATP5A1 was added
gene: ATP5A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP5A1 were set to 34483339; 34954817; 40859057
Phenotypes for gene: ATP5A1 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD
Review for gene: ATP5A1 was set to GREEN
Added comment: At least 12 individuals reported with de novo missense variants in this gene, several recurrent.

PMIDs: 34483339, 34954817: 6xde novo patients 4 with Arg207His, 1 Arg182Gln 1 Ser346Phe. All Arg207His patients were neonates with failure to thrive, hyperammonemia, lactic acidosis, and respiratory defects in fibroblasts, major symptoms remitted with treatment by late infancy, and at age 14mo to 3yrs growth and development were normal. Other 2 patients are 17yo with ID, ataxia, spastic paraparesis and dystonia, and a 12yo with psychomotor retardation, spastic tetraparesis, generalised dystonia, absent speech, swallowing problems, and increased blood lactate concentrations.

And an internal VCGS patient Arg182Gln (variant also seen in a different patient above) with ID, muscular hypotonia, clinodactyly of the 5th finger, and dysmorphic facial features, proteomics showed decreased ATP5F1A and a complex V deficiency. There is also an alternative change at this residue in the DECIPHER cohort Arg182Pro de novo in an individual with a neurodevelopmental disorder.

PMID: 40672495: 6x de novo individuals - 4 variants p.Arg182Gln, p.Ser346Phe, p.Pro331Leu, and p.Leu109Ser - with complex but overlapping neurological phenotypes including developmental delays, intellectual disability, pyramidal tract dysfunction, and dystonia.

In vivo functional studies in C. elegans were performed for three of the variants, showing growth defects and disruption of mitochondrial function (measured by mitochondrial stress). Authors suggest a dominant negative mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.285 UPF1 Zornitza Stark edited their review of gene: UPF1: Added comment: Additional reports identified:

PMID:28135719 (2017) reported four unrelated patients with de novo heterozygous missense variants in UPF1 gene from the Deciphering Developmental Disorders Study cohort, for which no detailed phenotypic information was available in the publication. Three patients were reported with global developmental delay (mild in one) and the fourth patient was reported with neurodevelopmental delay as one of the presenting phenotypes in the Decipher database (https://www.deciphergenomics.org/gene/UPF1/patient-overlap/snvs)

PMID:28539120 (2017) reported a patient with significant intellectual disability (ID) and gross motor delay and with a heterozygous likely pathogenic variant in UPF1 gene (c.1576_1577delinsAA/ p.Ala526Asn). However, this patient also harboured a heterozygous likely pathogenic variant in SQSTM1 gene. As reviewed below by Ivone Leong, the authors suggested that it is plausible that the haploinsufficiency of SQSTM1 may have caused neurofunctional defects, which the haploinsufficiency of UPF1 may have exacerbated.

PMID:39571789 (2024) reported two unrelated paediatric patients with intellectual disabilities, frontal bossing, hypertelorism, high frontal hairline, and thin upper lip. They both had language and motor delays and were identified with de novo heterozygous variants in UPF1 gene (c.949_951del/ p.Asp317del & c.1984G>A/ p.Asp662Asn). The p.Asp662Asn variant has also been previously reported in a patient from PMID:28135719.

PMID:39993774 (2025) reported a 17‐year‐old male patient with moderate intellectual disability, atypical autism, ADHD, and aggressivity. He was identified with a de novo missense variant in UPF1 gene - c.1576G>A/ p.Ala526Thr.; Changed rating: GREEN; Changed publications: 33057194, 28135719, 28539120, 39571789, 39993774; Changed phenotypes: neurodevelopmental disorder, MONDO:0700092, UPF1-related
Intellectual disability syndromic and non-syndromic v1.285 COMMD9 Krithika Murali gene: COMMD9 was added
gene: COMMD9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD9 were set to PMID: 40601774
Phenotypes for gene: COMMD9 were set to Neurodevelopmental disorder, MONDO:0700092, COMMD9-related
Review for gene: COMMD9 was set to RED
Added comment: PMID: 40601774 report a cohort ascertained through GeneMatcher with phenotypic features overlapping with Ritscher-Schinzel syndrome.

Homozygous fs variant in COMMD9 [NM_014186.3:c.208_209del, p.Leu70Glyfs*5] identified in a 4 yo M with dev delay, dysmorphism, skeletal changes including brachydactyly and radioulnar dysostosis, hypotonia, MRI-B anomalies - dysgyria, dilated
lateral ventricles, deep white matter periventricular demyelination, thin corpus callosum, cerebellar vermis hypoplasia and malrotation.

Consanguineous parents confirmed to be heterozygous carriers. No information provided regarding segregation of these variants in unaffected siblings.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.283 TBCB Krithika Murali gene: TBCB was added
gene: TBCB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBCB were set to PMID: 40856104
Phenotypes for gene: TBCB were set to Neurodevelopmental disorder, MONDO:0700092, TBCB-related
Review for gene: TBCB was set to AMBER
Added comment: PMID: 40856104 Bratman, S. et al 2025 (Genetics in Medicine) report 10 individuals from 8 unrelated families of Ashkenazi Jewish descent with a homozygous missense founder variant in TBCB (c.589T>A, p.Tyr197Asn) identified through exome sequencing. This variant is present at 1.3% carrier frequency in the AJ population in gnomAD v4 with 0 homozygotes. Variant is reasonably well-conserved, REVEL 0.9 and in the Cap-Gly domain. No other homozygous missense variants in this region in gnomAD v4 and homozygous variants rare, overall.

Phenotypic features included:
- Motor/speech delays in infancy (almost all)
- ASD (8/10)
- ADHD (5/10)
- Mild ID - formal cognitive evaluation (5/8).
- Spastic paraparesis in late childhood (9-12y) with slowly progressive gait difficulties and lower limb spasticity. Urinary abnormalities were not reported.
- Brain MRI was performed on five individuals - three displayed a thin corpus callosum,
and two had decreased white matter.

No prenatal features reported.

Supportive Drosophilia models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.281 COMMD4 Lucy Spencer gene: COMMD4 was added
gene: COMMD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD4 were set to 40601774
Phenotypes for gene: COMMD4 were set to Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related
Review for gene: COMMD4 was set to RED
Added comment: PMID: 40601774 3 siblings with Ritscher-Schinzel syndrome and a homozygous missense in COMMD4 NM_017828.5:c.122T>G; p.Leu41Arg. All three individuals died in infancy and the authors suggest there could be a dual diagnosis to explain the severity.

This variant was expressed in a H4 neuroglioma cell line with COMMD4 knocked out, and showed an enhanced degradative turnover compared to WT when treated with cyclohexamide. Western blot in HEK293T cells showed a decrease in the steady-state abundance of COMMD4.

Knock out of COMMD4 protein leads to destabilization of the Commander complex.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.280 TMEM184B Lucy Spencer gene: TMEM184B was added
gene: TMEM184B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM184B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TMEM184B were set to 39006436
Phenotypes for gene: TMEM184B were set to Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related
Review for gene: TMEM184B was set to GREEN
Added comment: A cohort of 6 patients with developmental delay (5/6), corpus callosum hypoplasia (4/6), microcephaly (1/6), seizures (3/6), and ID (2/6). 2 patients also had gastrointestinal motility disruption. All 6 have de novo variants in TMEM184B, 5 missense 1 canonical splice. 1 of the missense variants has 35 hets in gnomad but the rest are absent. The authors also say they are aware of a 7th patient with overlapping features by personal communication.

A knockout zebrafish model showed a dose dependent reduction in head size and body length in larvae. Knock-in of 2 of the missense variants also showed head size and body length reduction, but the other missense did not. However the other three missense failed to rescue the phenotype of a knockout zebrafish while WT and a negative control did. The authors suggest the first 2 variants are dominant negative while the latter three and loss of function.

The splice variant was shown to cause exon 7 skipping which is out of frame.

Transfection of the missense and splice variants in HEK293T cells showed that all but 1 had reduced TMEM184B protein levels.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.280 POLR3D Zornitza Stark gene: POLR3D was added
gene: POLR3D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR3D was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3D were set to 37915380
Phenotypes for gene: POLR3D were set to Leukodystrophy, MONDO:0019046, POLR3D-related
Review for gene: POLR3D was set to RED
Added comment: PMID 37915380: single individual with compound het variants in POLR3D and childhood onset leukodystrophy manifesting as DD/ID.

Additional neurological features included cerebellar signs (e.g., dysarthria, ataxia, and intention tremor) and dysphagia, while non-neurological features included hypodontia, hypogonadotropic hypogonadism, and dysmorphic facial features. Her MRI was notable for diffuse hypomyelination with myelin preservation of early myelinating structures, characteristic of POLR3-related leukodystrophy. Exome sequencing revealed the biallelic variants in POLR3D, a missense variant (c.541C > T, p.P181S) and an intronic splice site variant (c.656-6G > A, p.?). Functional studies of the patient's fibroblasts demonstrated significantly decreased RNA-level expression of POLR3D, along with reduced expression of other Pol III subunit genes. Notably, Pol III transcription was also shown to be aberrant, with a significant decrease in 7SK RNA and several distinct tRNA genes analyzed. Affinity purification coupled to mass spectrometry of the POLR3D p.P181S variant showed normal assembly of Pol III subunits yet altered interaction of Pol III with the PAQosome chaperone complex, indicating the missense variant is likely to alter complex maturation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.278 HS6ST2 Bryony Thompson gene: HS6ST2 was added
gene: HS6ST2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HS6ST2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: HS6ST2 were set to 40686562; 30471091; 36993824; 38015989
Phenotypes for gene: HS6ST2 were set to X-linked syndromic intellectual disability MONDO:0020119
Review for gene: HS6ST2 was set to GREEN
Added comment: 4 males with a neurodevelopmental phenotype from 3 families (1 set monozygotic twins) hemizygous for rare missense variants and a supporting mouse model.
PMID: 40686562 - a Chinese male child with a syndromic neurodevelopmental phenotype hemizygous c.764C>A (p.Pro255Glu) and in vitro assays showing the variant alters function. Parents were unaffected and variant was maternally inherited.

PMID: 38015989 - knockout mouse model impairs dendritic spines of hippocampal neurons, and affects memory.

PMID: 36993824 - an Iranian male child with a syndromic neurodevelopmental phenotype hemizygouc.979C>T p.Pro327Ser.

PMID: 30471091 - Italian monozygotic male twins with a syndromic neurodevelopmental phenotype hemizygous c.916G>C (p.G306R - inherited from unaffected mother) and functional assay showing altered enzyme activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.277 CSMD2 Zornitza Stark Deleted their review
Intellectual disability syndromic and non-syndromic v1.277 CSMD2 Zornitza Stark reviewed gene: CSMD2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Focal epilepsy - MONDO:0005384, CSMD2-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.277 FSCN1 Zornitza Stark gene: FSCN1 was added
gene: FSCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FSCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FSCN1 were set to 40874942
Phenotypes for gene: FSCN1 were set to Neurodevelopmental disorder, MONDO:0700092, FSCN1-related
Review for gene: FSCN1 was set to RED
Added comment: Two individuals reported from an Iranian cohort with same missense variant, c.665C>A; p.Ala222Asp plus other circumstantial data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.276 TTC1 Zornitza Stark gene: TTC1 was added
gene: TTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TTC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC1 were set to 40879651
Phenotypes for gene: TTC1 were set to Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related
Review for gene: TTC1 was set to RED
Added comment: Four individuals from two families reported with the same homozygous missense variant, NM_003314.3: c.784 T > G, p.Phe262Val. No other supporting data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.275 MAEA Zornitza Stark changed review comment from: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands.
Sources: Literature; to: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands. Amber rating as scant detail on the affected individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.274 MAEA Zornitza Stark gene: MAEA was added
gene: MAEA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAEA were set to 40880485
Phenotypes for gene: MAEA were set to Neurodevelopmental disorder, MONDO:0700092, MAEA-related
Review for gene: MAEA was set to AMBER
Added comment: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.273 CSMD2 Krithika Murali changed review comment from: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature; to: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. In addition, no information about unaffected/affected siblings and segregation testing has been provided

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.272 CDK6 Zornitza Stark edited their review of gene: CDK6: Added comment: Second family reported, but same homozygous missense variant, likely founder.; Changed publications: 23918663, 40801391
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.270 NSF Zornitza Stark edited their review of gene: NSF: Added comment: Personal communication of additional cases with de novo variants and epilepsy; internal case at VCGS.; Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.268 RNF2 Zornitza Stark edited their review of gene: RNF2: Added comment: PMID 40831499 is a preprint which identifies additional individuals with de novo variants. p.S82R is recurrent. Functional data to support gene-disease association.; Changed rating: GREEN; Changed publications: 33864376, 40831499
Intellectual disability syndromic and non-syndromic v1.267 CCDC93 Zornitza Stark reviewed gene: CCDC93: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.267 WDR18 Krithika Murali gene: WDR18 was added
gene: WDR18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR18 were set to PMID: 40677927
Phenotypes for gene: WDR18 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: WDR18 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.266 MIS18BP1 Krithika Murali gene: MIS18BP1 was added
gene: MIS18BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MIS18BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MIS18BP1 were set to PMID: 40677927
Phenotypes for gene: MIS18BP1 were set to Cornelia de Lange syndrome (MONDO:0016033)
Review for gene: MIS18BP1 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.265 HYPK Zornitza Stark gene: HYPK was added
gene: HYPK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HYPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HYPK were set to Clinical Genetics Early View
Phenotypes for gene: HYPK were set to Neurodevelopmental disorder, MONDO:0700092, HYPK-related
Review for gene: HYPK was set to RED
Added comment: Single case report - Patel, R. et al 2025 Clinical Genetics Early View

Male proband with developmental delay, autism and facial dysmorphism with a de novo missense HYPK variant (p. R70I). Variant-specific biochemical analyses demonstrates enhanced inhibitory activity of HYPK on NatA-mediated N-terminal protein acetylation.

GestaltMatcher analysis indicates that the proband's facial phenotype closely resembles Ogden syndrome (NAA10) and some resemblance to NAA15-NDS - both associated genes are also involved in the N-terminal acetylation pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.264 DDX39A Zornitza Stark gene: DDX39A was added
gene: DDX39A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX39A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX39A were set to 40726340
Phenotypes for gene: DDX39A were set to Neurodevelopmental disorder, MONDO:0700092, DDX39A-related
Review for gene: DDX39A was set to RED
Added comment: PMID: 40726340 Ahmed et al 2025 (Clinical Genetics) report a 7 month old F with GDD, seizures, microcephaly, hypotonia, corpus callosum thinning and homozygous missense variant (p.Lys137Gln) in DDX39A on trio WES with both non-consanguineous parents confirmed to be heterozygous carriers. DDX39A is involved in mRNA splicing and export. Patient-derived fibroblast studies showed that mutant protein resulted in aberrant nuclear clumping and failure to interact with the TREX complex.

Of note, closely-related paralogue DDX39B is also a component of the TREX complex and has a definitive monoallelic association with neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.263 ARID3A Zornitza Stark gene: ARID3A was added
gene: ARID3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARID3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARID3A were set to 40677927
Phenotypes for gene: ARID3A were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: ARID3A was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.262 PIK3C3 Zornitza Stark gene: PIK3C3 was added
gene: PIK3C3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIK3C3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PIK3C3 were set to 40677927
Phenotypes for gene: PIK3C3 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: PIK3C3 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark changed review comment from: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature; to: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of oedema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark gene: GLYAT was added
gene: GLYAT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GLYAT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLYAT were set to 40747359
Phenotypes for gene: GLYAT were set to Neurodevelopmental disorder, MONDO:0700092, GLYAT-related
Review for gene: GLYAT was set to RED
Added comment: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.258 C1orf109 Zornitza Stark gene: C1orf109 was added
gene: C1orf109 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C1orf109 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C1orf109 were set to 40760247
Phenotypes for gene: C1orf109 were set to Neurodevelopmental disorder, MONDO:0700092, C1orf109-related
Review for gene: C1orf109 was set to GREEN
Added comment: Cohort of 11 unrelated families, encompassing 18 individuals with bi-allelic variants in C1orf109, 17 liveborn. Affected individuals presented with moderate-to-severe or severe global developmental delay/intellectual disability (17 of 17) and never achieved developmental milestones. Microcephaly and seizures were other common features.

Reduced ribosome activity demonstrated during early brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.256 ASAP2 Zornitza Stark gene: ASAP2 was added
gene: ASAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ASAP2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ASAP2 were set to 40770811; 28191890; 33057194; 35982160
Phenotypes for gene: ASAP2 were set to Neurodevelopmental disorder, MONDO:0700092, ASAP2-related
Review for gene: ASAP2 was set to AMBER
Added comment: One individual reported with compound het missense variants. Identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811. Another individual with biallelic variants identified in the DDD cohort. Several others found with de novo variants through retrospective literature review of large cohort studies reporting multiple gene candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of ASAP2 in brain development. Rated AMBER as only two families with bi-allelic variants and minimal information on the cases with mono-allelic variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.255 RTF1 Zornitza Stark changed review comment from: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data.
Sources: Literature; to: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of RTF1 in brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.254 RTF1 Zornitza Stark gene: RTF1 was added
gene: RTF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RTF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RTF1 were set to 40770811; 33057194; 35982160; 31038196
Phenotypes for gene: RTF1 were set to Neurodevelopmental disorder, MONDO:0700092, RTF1-related
Review for gene: RTF1 was set to GREEN
Added comment: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 MED29 Sarah Milton gene: MED29 was added
gene: MED29 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED29 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED29 were set to PMID: 40745490
Phenotypes for gene: MED29 were set to Pontocerebellar hypoplasia, MONDO:0020135, MED29-related
Review for gene: MED29 was set to AMBER
Added comment: MED29 encodes part of the mediator (MED) complex which has role in RNA polymerase II (Poll II) gene transcription.

PMID: 40745490 describes 2 siblings from one consanguineous family affected with pontocerebellar hypoplasia, profound GDD, severe microcephaly, cataracts and variable seizures.
Both shared the same homozygous missense variant with presumed LOF mechanism.

No homozygous LOF variants in gnomAD v4.

Extensive functional studies performed with morpholino knockdown of MED29 having marked reduction of GABAergic neurons and abnormal touch response.
Studies of hippocampal neurons from mice with knockdown MED29 showed impaired development.
Mouse embryos that had knockdown of MED29 during development demonstrated abnormal neuronal migration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 CCDC93 Sarah Milton gene: CCDC93 was added
gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC93 were set to PMID: 40601774
Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related
Review for gene: CCDC93 was set to AMBER
Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins.

PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts.
Variants were missense and nonsense.

No homozygous LOF variants in gnomAD v4.

Some supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 SCN3B Sarah Milton gene: SCN3B was added
gene: SCN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SCN3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCN3B were set to PMID: 40879121
Phenotypes for gene: SCN3B were set to Neurodevelopmental disorder, MONDO:0700092, SCN3B-related
Review for gene: SCN3B was set to AMBER
Added comment: SCN3B Encodes b3 auxiliary subunit of the sodium channel.

4 affected individuals from 2 consanguineous families reported in PMID: 40879121 with biallelic variants in this gene with neurodevelopmental phenotypes. Presentation included GDD, ID of variable severity, autism, seizures.
One variant was nonsense, one canonical splice site in the penultimate exon.

No homozygous LOF variants in gnomAD v4.

Some functional studies performed with loss of function of channel demonstrated for one variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 XPO1 Sangavi Sivagnanasundram gene: XPO1 was added
gene: XPO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: XPO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: XPO1 were set to 40819229
Phenotypes for gene: XPO1 were set to Neurodevelopmental disorder, XPO1-related, MONDO:0700092
Review for gene: XPO1 was set to GREEN
Added comment: Established gene-disease association
22 probands with de novo XPO1 variants presenting with phenotypes associated with NDD (DD, ID, motor delay, behavioral problems, facial dysmorphisms, microcephaly and organ anomalies) along with supportive Drosophila knockdown model reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 ZNF496 Zornitza Stark gene: ZNF496 was added
gene: ZNF496 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF496 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF496 were set to 40806714
Phenotypes for gene: ZNF496 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF496-related
Review for gene: ZNF496 was set to RED
Added comment: Single individual with NDD and de novo LoF variant, no other supportive data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.251 TRIM74 Sangavi Sivagnanasundram gene: TRIM74 was added
gene: TRIM74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRIM74 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRIM74 were set to 40735933
Phenotypes for gene: TRIM74 were set to Neurodevelopmental disorder, TRIM74-related, MONDO:0700092
Review for gene: TRIM74 was set to RED
Added comment: Only one reported case with DD.

PMID: 40735933
5yr M presenting from non consanguineous parents with global developmental delay, hypotonia, seizures, and diffuse cerebral atrophy with mega cisterna magna. Parents of the proband were found to be carriers of the variant.
Homozygous variant c.562C > T (p.Pro121Leu) - NFE AF 0.0188% - rare enough for AR

Supportive functional analysis on human fibroblast showed protein function disruption leading to protein aggregation, proteostasis collapse, and cell death.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.250 BAZ2B Zornitza Stark edited their review of gene: BAZ2B: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, BAZ2B-related
Intellectual disability syndromic and non-syndromic v1.250 TP63 Zornitza Stark Phenotypes for gene: TP63 were changed from ADULT syndrome, OMIM #103285; Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome 3, OMIM #604292; Hay-Wells syndrome, OMIM #106260; Limb-mammary syndrome, OMIM #603543; Orofacial cleft 8, OMIM #618149; Rapp-Hodgkin syndrome, OMIM #129400; Split-hand/foot malformation 4, OMIM #605289 to TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001
Intellectual disability syndromic and non-syndromic v1.249 TP63 Zornitza Stark reviewed gene: TP63: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.248 TMPRSS7 Zornitza Stark gene: TMPRSS7 was added
gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMPRSS7 were set to 40796295
Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related
Review for gene: TMPRSS7 was set to RED
Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.247 PPP1R2 Zornitza Stark gene: PPP1R2 was added
gene: PPP1R2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP1R2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPP1R2 were set to 40597352; 26558779
Phenotypes for gene: PPP1R2 were set to Neurodevelopmental disorder, PPP1R2-related
Review for gene: PPP1R2 was set to RED
Added comment: Single individual reported with homozygous splicing variant c.403 + 3 A >T. Abnormal splicing demonstrated but leaky. Clinical features included pre and postnatal growth restriction, ventricular septal defect, dysmorphic features (proptosis, long eye lashes, thick eyebrows, low-set ears), microcephaly, sensorineural hearing loss, cortical cataracts, retinal defects, intellectual disability with limited speech, and autism spectrum disorder. Note mouse model is embryonically lethal, leading the authors to speculate survival may be due to fraction of normally spliced transcripts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.245 BORCS5 Zornitza Stark gene: BORCS5 was added
gene: BORCS5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BORCS5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BORCS5 were set to 40385417
Phenotypes for gene: BORCS5 were set to Lysosomal storage disease, MONDO:0002561, BORCS5-related
Review for gene: BORCS5 was set to GREEN
Added comment: preprint PMID 40385417, describing 12 individuals from 7 families with a spectrum of abnormalities (osteopetrosis not mentioned), suggestive of lysosomal disorder.

Homozygous loss-of-function variants presented with prenatally lethal arthrogryposis multiplex congenita, brain malformations, and neuropathological evidence of diffuse neuroaxonal dystrophy. Individuals with missense variants presented differently, with microcephaly, developmental epileptic encephalopathy, intellectual disability, optic atrophy, spasticity, and progressive movement disorders. In this group, brain MRI showed diffuse hypomyelination and progressive global cerebral atrophy, consistent with neurodegeneration. Borcs5 knockout in zebrafish exhibited microcephaly, motor deficits, and seizures, mirroring the patients' clinical presentation. At the cellular level, BORCS5 loss-of-function but not missense variants, resulted in lower protein expression and impaired BORC assembly, paralleled by perinuclear lysosomal clustering. However, both loss-of-function and missense BORCS5 variants were associated with reduced total lysosomal proteolysis, reduced activity of the lysosomal hydrolases glucocerebrosidase and cathepsin B, and presence of multilamellar bodies, indicating lysosomal dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.244 ARNTL Sarah Milton gene: ARNTL was added
gene: ARNTL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARNTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARNTL were set to PMID: 40720646
Phenotypes for gene: ARNTL were set to Neurodevelopmental disorder, MONDO:0700092, BMAL1-related
Review for gene: ARNTL was set to GREEN
Added comment: Note has new HGNC approved name - BMAL1

BMAL1 encodes a transcription factor that plays a role in the mammalian molecular clock, binds to promoter of PER and CRY family genes to promote transcription. Other circardian genes have sleep phase disorder assoc but not neurodevelopmental phenotype.

10 affected individuals described in PMID: 40455867 with variable developmental delay/ID from average IQ to severe ID, seizures in 50%, autism, some had sleep disturbance and marfanoid habitus.
Variants were LOF & missense and very rare or absent in gnomAD v4.
5 confirmed de novo, 2 confirmed inherited (one from apparently unaffected mother).

Functional studies using luciferase reporter assay of downstream target PER showed reduced luminescence for most variants with presumed LOF mechanism. One variant p.(Ile201Thr) led to increased luminescence with author's postulating GOF mechanism for this variant. Drosophilia studies for 2 of the variants demonstrated altered circadian rhythm. ?needs more studies to further define mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.242 MAN2A2 Zornitza Stark edited their review of gene: MAN2A2: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.242 MAN2A2 Zornitza Stark edited their review of gene: MAN2A2: Added comment: PMID 40628855: second unrelated individual reported, presenting with ID/autism and with bi-allelic variants, one missense and the other LoF. Abnormal glycosylation patterns observed consistent with CDG.; Changed publications: 36357165, 40628855
Intellectual disability syndromic and non-syndromic v1.241 CCDC186 Zornitza Stark gene: CCDC186 was added
gene: CCDC186 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC186 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC186 were set to 33259146; 37569695; 40633195
Phenotypes for gene: CCDC186 were set to Neurodevelopmental disorder, MONDO:0700092, CCDC186-related
Review for gene: CCDC186 was set to GREEN
Added comment: At least 3 unrelated families reported with bi-allelic LoF variants and a neurodevelopmental phenotype comprising ID and seizures, plus other more variable features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.238 PCLO Zornitza Stark edited their review of gene: PCLO: Added comment: PMID 40661989: additional case report of a Thai patient with PCH and compound het LoF variants in this gene. PMID 32122952: rat model consistent with human phenotype. PMID 30287594: additional family with 5 affected sibs, compound het for LoF variants and PCH. Upgrade to GREEN.; Changed rating: GREEN; Changed publications: 25832664, 40661989, 32122952, 30287594
Intellectual disability syndromic and non-syndromic v1.236 TAF13 Zornitza Stark edited their review of gene: TAF13: Changed publications: 28257693, 40679298; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 60, MIM# 617432
Intellectual disability syndromic and non-syndromic v1.234 FAAH2 Zornitza Stark edited their review of gene: FAAH2: Added comment: Further case report of novel missense variant in an individual with a neurodevelopmental disorder, no supportive evidence.; Changed publications: 25885783, 40744325; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, FAAH2-related
Intellectual disability syndromic and non-syndromic v1.234 NDC1 Zornitza Stark Phenotypes for gene: NDC1 were changed from triple-A syndrome MONDO:0009279 to Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328
Intellectual disability syndromic and non-syndromic v1.233 NDC1 Zornitza Stark reviewed gene: NDC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.232 SEPHS1 Zornitza Stark edited their review of gene: SEPHS1: Changed phenotypes: Ververi-Brady syndrome 2, MIM# 621325
Intellectual disability syndromic and non-syndromic v1.231 TDGF1 Zornitza Stark edited their review of gene: TDGF1: Changed rating: RED; Changed phenotypes: Congenital nervous system disorder, MONDO:0002320, TDGF1-related
Intellectual disability syndromic and non-syndromic v1.230 TCF7L2 Zornitza Stark edited their review of gene: TCF7L2: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, TCF7L2-related
Intellectual disability syndromic and non-syndromic v1.229 SYP Zornitza Stark edited their review of gene: SYP: Changed phenotypes: Intellectual developmental disorder, X-linked 96, MIM# 300802
Intellectual disability syndromic and non-syndromic v1.228 SPOP Zornitza Stark edited their review of gene: SPOP: Changed phenotypes: Nabais Sa-de Vries syndrome, type 1 MIM#618828, Nabais Sa-de Vries syndrome, type 2, MIM#618829
Intellectual disability syndromic and non-syndromic v1.228 SPOP Zornitza Stark edited their review of gene: SPOP: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, SPOP-related
Intellectual disability syndromic and non-syndromic v1.227 SOBP Zornitza Stark edited their review of gene: SOBP: Changed phenotypes: Impaired intellectual development, anterior maxillary protrusion, and strabismus, MIM# 613671
Intellectual disability syndromic and non-syndromic v1.226 SNX27 Zornitza Stark edited their review of gene: SNX27: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, SNX27-related
Intellectual disability syndromic and non-syndromic v1.225 SMARCD1 Zornitza Stark reviewed gene: SMARCD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder MONDO:0700092, SMARCD1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.224 SMARCA5 Zornitza Stark edited their review of gene: SMARCA5: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, SMARCA5-related
Intellectual disability syndromic and non-syndromic v1.223 SLC6A17 Zornitza Stark edited their review of gene: SLC6A17: Changed phenotypes: Intellectual developmental disorder, autosomal recessive 48, MIM# 616269
Intellectual disability syndromic and non-syndromic v1.221 YWHAZ Zornitza Stark reviewed gene: YWHAZ: Rating: AMBER; Mode of pathogenicity: None; Publications: 31024343, 35143101, 35501409, 22124272, 26207352; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, YWHAZ-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.221 THRA Zornitza Stark reviewed gene: THRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypothyroidism congenital nongoitrous 6 (MIM 614450); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.219 RNU5B-1 Zornitza Stark Phenotypes for gene: RNU5B-1 were changed from Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related to Neurodevelopmental disorder with seizures and joint laxity, MIM# 621302
Intellectual disability syndromic and non-syndromic v1.217 RNU5B-1 Zornitza Stark edited their review of gene: RNU5B-1: Changed publications: 40442284; Changed phenotypes: Neurodevelopmental disorder with seizures and joint laxity, MIM# 621302
Intellectual disability syndromic and non-syndromic v1.217 RNU2-2P Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related to Developmental and epileptic encephalopathy 119, MIM# 621304
Intellectual disability syndromic and non-syndromic v1.215 RNU2-2P Zornitza Stark edited their review of gene: RNU2-2P: Changed publications: 40210679, 40442284; Changed phenotypes: Developmental and epileptic encephalopathy 119, MIM# 621304
Intellectual disability syndromic and non-syndromic v1.213 FRYL Zornitza Stark edited their review of gene: FRYL: Added comment: Published literature re-reviewed:
A number of variants reported in currently published gene discovery paper were not absent in gnomAD v4.

Loss of function is the proposed mechanism of disease however too many NMD predicted variants throughout the gene in gnomAD v4 to be consistent with rare disease.

Functional studies performed in drosophila using FRY orthologue, however, humans have two paralogous genes - FRY and FRYL. As such, difficult to translate this model to implications in human disease or even judge to what extent it recapitulates the human phenotype.

Note multiple isoforms for FRYL however no clear paucity of NMD predicted variants in the population within one region of the gene.

Requires further literature to establish gene disease association.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.213 ST5 Rylee Peters gene: ST5 was added
gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ST5 were set to 40717498
Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related
Review for gene: ST5 was set to GREEN
Added comment: HGNC: DENND2B
Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10.

Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment).

In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.213 BLOC1S1 Rylee Peters changed review comment from: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy (in some cases), and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.; to: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy, and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.
Intellectual disability syndromic and non-syndromic v1.213 BLOC1S1 Rylee Peters reviewed gene: BLOC1S1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://www.medrxiv.org/content/10.1101/2025.07.17.25331211v1; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.213 CHTF18 Zornitza Stark Phenotypes for gene: CHTF18 were changed from complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465 to Neurodevelopmental disorder MONDO#0700092, CHTF18-related
Intellectual disability syndromic and non-syndromic v1.211 CHTF18 Zornitza Stark edited their review of gene: CHTF18: Changed phenotypes: Neurodevelopmental disorder MONDO#0700092, CHTF18-related
Intellectual disability syndromic and non-syndromic v1.211 CHTF18 Zornitza Stark reviewed gene: CHTF18: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.210 KDM2B Zornitza Stark reviewed gene: KDM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 40420380; Phenotypes: neurodevelopmental disorder MONDO#0700092, KDM2B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.209 SNW1 Lucy Spencer gene: SNW1 was added
gene: SNW1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNW1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SNW1 were set to 40608414
Phenotypes for gene: SNW1 were set to Neurodevelopmental disorder (MONDO:0700092), SNW1-related
Review for gene: SNW1 was set to GREEN
Added comment: cohort of 9 patients with moderate to profound ID, microcephaly, seizures (7/9), facial dysmorphism, and brain malformations (6/9 - corpus callosum hypoplasia, Dandy-Walker malformation).

3 splice, 1 frameshift, 2 missense, 3 in frame deletions, 1 start loss. all but 1 de novo (the last parents not available).

SNW1 is a core component of the spliceosome and facilitates the conformational changes of the spliceosome. Expression of variants in HEK293 cells showed some decreased SNW1 expression while others increased it (including the frameshift), and only the frameshift variant was mislocalised/in the cytoplasm instead of the nucleus. Several of the variants caused loss of binding to PPIL1 or other proteins which SNW1 usually recruits to the spliceosome. All variants in this study were found to either affect protein expression or localization or influence interactions with other proteins in the spliceosome complex suggesting loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.208 PDCD6IP Zornitza Stark edited their review of gene: PDCD6IP: Added comment: Additional individual with homozygous truncating variant, mild ID, microcephaly and mild thrombocytopenia.
p.Arg322* - present in gnomAD (NFE AF - 0.0006%).; Changed rating: GREEN; Changed publications: https://doi.org/10.1111/cge.70025
Intellectual disability syndromic and non-syndromic v1.208 CHTF18 Sangavi Sivagnanasundram gene: CHTF18 was added
gene: CHTF18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHTF18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHTF18 were set to 40717333
Phenotypes for gene: CHTF18 were set to complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465
Review for gene: CHTF18 was set to AMBER
Added comment: Only two individuals reported with ID/DD:
1 - 9M with DD, autism and seizures. De novo variant identified - p.Leu355Val
2 - 23month F with congenital bilateral ventriculomegaly status post ventriculoperitoneal shunt placement, epilepsy, right eye optic nerve hypoplasia, hypotonic cerebral palsy complicated by left hip subluxation, and G-tube dependence. De novo variant identified - p.His645Pro
3 - 3F presenting with global DD, hypotonia, seizure and abnormal brain MRI. De novo variant identified - p.Leu676Arg
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.207 SV2A Ava Stevenson reviewed gene: SV2A: Rating: AMBER; Mode of pathogenicity: None; Publications: 36350923, 37861890; Phenotypes: Developmental and epileptic encephalopathy 113 (MIM#620772), AR, Neurodevelopmental disorder, MONDO:0700092, SV2A-related, AD; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.206 RNU5A-1 Zornitza Stark gene: RNU5A-1 was added
gene: RNU5A-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU5A-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU5A-1 were set to 40379786
Phenotypes for gene: RNU5A-1 were set to Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related
Review for gene: RNU5A-1 was set to AMBER
Added comment: PMID: 40379786 (2025) - three unrelated individuals with de novo variants in the RNU5A-1 gene (classified as VUS) and a neurodevelopmental disorder. Six individuals with rare de novo variants were identified in total but clinical details were only available for 3/6. Of these three individuals, two harboured the same variant (n.40_41insA) on the maternal allele, while the third individual harboured a different variant (n.39del) but also on the 5′ loop I domain of RNU5A-1. Clinical data showed neurodevelopmental abnormalities (mild ID (2), severe ID (1), epilepsy (2), brain MRI abnormalities (1)) with variable congenital malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.204 BSN Zornitza Stark gene: BSN was added
gene: BSN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: BSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BSN were set to 40393460
Phenotypes for gene: BSN were set to Neurodevelopmental disorder (MONDO:0700092), BSN-related
Review for gene: BSN was set to GREEN
Added comment: Guzman et al 2025: Described 12 additional patients with missense (3/12) and premature termination variants (9/12) which included de novo and inherited variants, suggesting incomplete penetrance.

They assessed all reported patients (n=29) which revealed common clinical characteristics including epilepsy(13/29), febrile seizures (7/29), generalised tonic-clonic seizures (5/29), and focal-onset seizures (3/29). Behavioural phenotypes were present in almost half of all individuals (14/29), which included ADHD (7/29) and autistic behaviour (5/29). Additional common features included developmental delay (11/29), obesity (10/29), and delayed speech (8/29). In adults with BSN PTVs, milder features were common, suggesting phenotypic variability, including a range of individuals without obvious neurodevelopmental features (7/29).
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.199 MARK2 Zornitza Stark reviewed gene: MARK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 76, MIM# 621285; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.198 PDE1B Zornitza Stark gene: PDE1B was added
gene: PDE1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PDE1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE1B were set to 40492975
Phenotypes for gene: PDE1B were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related
Review for gene: PDE1B was set to GREEN
Added comment: PMID:40492975 reported seven individuals from five unrelated families identified with biallelic PDE1B variants. Three truncating (p.Gln45Ter, p.Gln86Ter, p.Ser298Alafs*6) and three splicing variants (c.594 + 2 T>G, c.735 + 5G>A, c.837-1G>C) were identified from these patients in total. They presented with an early-onset movement disorder characterised by hypotonia in infancy, progressing to ataxia and dystonia in early childhood, with motor and speech delay, and intellectual disability. Functional evidence is also available for these variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.195 FASTKD5 Chirag Patel gene: FASTKD5 was added
gene: FASTKD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FASTKD5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FASTKD5 were set to PMID: 40499538
Phenotypes for gene: FASTKD5 were set to Leigh syndrome MONDO:0009723
Review for gene: FASTKD5 was set to GREEN
Added comment: 3 unrelated individuals with Leigh syndrome (1 x severe/early-onset/fatal, 1 x milder/childhood-onset, 1 x adult-onset). WES identified compound heterozygous variants in FASTKD5 gene (3 x missense variants, 2 x frameshift variants leading to a premature stop codon). The FASTKD5 gene codes for a mitochondrial protein essential for processing mRNAs at non-canonical cleavage sites in the primary mitochondrial transcript.

Analysis of fibroblasts from two subjects showed reduced steady-state levels of FASTKD5 protein by immunoblot, reduced translation of the cytochrome c oxidase subunit 1, impaired assembly of complex IV, and a consequent decrease in cytochrome c oxidase enzymatic activity. The extent of these deficiencies appeared to correlate with the severity of the clinical phenotype. Expression of a wild-type FASTKD5 cDNA, but not cDNAs expressing the missense variants, rescued all the molecular defects in the subjects' fibroblasts, demonstrating that the alleles are pathogenic. 2/3 missense variants resulted in near complete loss of function, while one was hypomorphic, resulting from impaired protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.193 NDUFA4 Sarah Milton gene: NDUFA4 was added
gene: NDUFA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDUFA4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA4 were set to PMID: 39967265
Phenotypes for gene: NDUFA4 were set to Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065
Review for gene: NDUFA4 was set to GREEN
Added comment: HGNC symbol now COXFA4

Around 10 patients reported in literature thus far with most having developmental delay. Association with hypertrophic cardiomyopathy reported in 3 siblings from a family in PMID: 39967265
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.193 FEM1B Zornitza Stark Phenotypes for gene: FEM1B were changed from Syndromic disease MONDO:0002254, FEM1B-related to Neurodevelopmental disorder with behavioral, ear, and skeletal abnormalities, MIM# 621263
Intellectual disability syndromic and non-syndromic v1.192 FEM1B Zornitza Stark edited their review of gene: FEM1B: Changed phenotypes: Neurodevelopmental disorder with behavioral, ear, and skeletal abnormalities, MIM# 621263
Intellectual disability syndromic and non-syndromic v1.191 DOT1L Zornitza Stark edited their review of gene: DOT1L: Changed phenotypes: Nil-Deshwan neurodevelopmental syndrome, MIM# 621265
Intellectual disability syndromic and non-syndromic v1.191 LONP1 Zornitza Stark Phenotypes for gene: LONP1 were changed from CODAS syndrome, MIM#600373; Mitochondrial cytopathy to CODAS syndrome, MIM#600373; mitochondrial disease (MONDO:0044970), LONP1-related
Intellectual disability syndromic and non-syndromic v1.189 LONP1 Zornitza Stark Mode of inheritance for gene: LONP1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.188 LONP1 Zornitza Stark edited their review of gene: LONP1: Added comment: New reports of autosomal dominant mitochondrial disease due to missense variants at p.Arg301.

- PMID: 36353900; Hartley 2023: 1x heterozygous de novo individual with p.(Arg301Gln), with dystonia, hearing loss, seizures.
p.(Arg301Gln) has been reported as de novo in a heterozygous individual with dystonia, delayed speech and language development (VCGS/MCRI internal case)

- PMID: 31923470; Besse 2020: 1x heterozygous de novo individual with p.(Arg301Trp) with seizures, encephalopathy, pachygyria and microcephaly.
- p.(Arg301Trp) has also been reported in a heterozygous individual with recurrent neonatal seizures, suspected mitochondrial disorder, elevated lactate, microcephaly, EEG showing significantly increased seizure susceptibility which was de novo but parentage not tested (ClinVar, personal communication).
- p.(Arg301Trp) has also been identified in a heterozygous individual with neonatal intractable epileptic encephalopathy and lactic acidosis. MRI changes in keeping with mitochondrial disorder, a combined Complex I and complex IV defect identified in muscle (but not liver) by RCE (VCGS/MCRI internal case)

- p.(Arg301Gly) has been reported de novo in a heterozygous individual with epileptic encephalopathy, microcephaly and dyskinesia (ClinVar, personal communication)

LONP1 functions as both a chaperone and an ATP-dependent protease. Functional evidence in Besse shows p.(Arg301Trp) results in loss of chaperone activity but retains proteolytic activity. Expression of WT LONP1 in patient fibroblast cells did not rescue dysfunction (measured via levels of MRPL44, RPL11, PDHE1a, TFAM, PINK1, complex 1 and complex IV) - indicating NOT LoF effect. Overexpression of LONP1 in control fibroblast cells leads to dysfunction (decrease in NDUFB8, COXIV, MRPL44 and TFAM), however, MRPL11, PDHE1a and PINK1 proteins were unchanged compared to controls. Variant p.R721G associated with AR disease showed decreased homo-oligomerisation whilst p.R301W showed increased WT-Mut and WT-WT oligomers. GoF was suggested but no dose-dependent studies so DN cannot be excluded.; Changed publications: 31636596, 36353900 31923470; Changed phenotypes: CODAS syndrome, MIM#600373, mitochondrial disease (MONDO:0044970), LONP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.187 PIGU Zornitza Stark reviewed gene: PIGU: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 21, OMIM #618590; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.187 TMEM63B Zornitza Stark Phenotypes for gene: TMEM63B were changed from developmental and epileptic encephalopathy, MONDO:0100062, TMEM63B-related to Developmental and epileptic encephalopathy 118, MIM# 621250
Intellectual disability syndromic and non-syndromic v1.186 TMEM63B Zornitza Stark edited their review of gene: TMEM63B: Changed phenotypes: Developmental and epileptic encephalopathy 118, MIM# 621250
Intellectual disability syndromic and non-syndromic v1.185 LGI1 Krithika Murali gene: LGI1 was added
gene: LGI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LGI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LGI1 were set to PMID:40455867
Phenotypes for gene: LGI1 were set to Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related
Review for gene: LGI1 was set to GREEN
Added comment: PMID: 40455867 report patients with biallelic variants in 6 individuals from 4 consanguineous families with a more severe DEE phenotype. All indivduals had seizures, global dev delay/ID and generalised hypotonia. Four out of five exhibited spasticity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.183 WDR91 Bryony Thompson gene: WDR91 was added
gene: WDR91 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR91 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR91 were set to 32732226; 38041506; 34791078; 40550703; 28860274; 34028500; ClinVar: SCV000965687.1
Phenotypes for gene: WDR91 were set to Complex neurodevelopmental disorder MONDO:0100038
Review for gene: WDR91 was set to GREEN
Added comment: Homozygous LoF variants were identified in at least 5 families with a mainly neurodevelopmental disorder phenotype. Also, supporting mouse models
1. Brain malformation
2. Severe developmental delay, microcephaly, severe microlissencephaly, agenesis of corpus callosum, epilepsy, spastic tetraparesis, laryngomalacia, bicuspid aortic valve, congenital hip dislocation, growth retardation, dysmorphisms
3. Severe microcephaly, dysmorphic features, and organomegaly, along with early onset psychomotor delay, hypotonia, sensorineural hearing impairment, and visual impairment
4. Hygroma, macrocephaly, abnormal ears, unilateral simian crease, hydrocephaly, cerebellar hypoplasia, interventricular
communication
5. Neurodevelopmental disorder with brain malformations and multiple congenital anomalies
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.178 NSUN3 Zornitza Stark gene: NSUN3 was added
gene: NSUN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSUN3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSUN3 were set to 27356879; 32488845; 40465263
Phenotypes for gene: NSUN3 were set to Combined oxidative phosphorylation deficiency 48, MIM# 619012
Review for gene: NSUN3 was set to GREEN
Added comment: Six families reported. DD/ID can be part of the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.177 SREK1 Sangavi Sivagnanasundram gene: SREK1 was added
gene: SREK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SREK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SREK1 were set to 40549565
Phenotypes for gene: SREK1 were set to Prader-Willi-like syndrome, SREK1-related MONDO:0008300
Review for gene: SREK1 was set to AMBER
Added comment: Three Pakistani probands from three consanguineous families identified with biallelic variants in SREK1. Affected individuals presented with hyperphagic obesity and neurodevelopmental delay. They also presented with psychological and behavioural issues and were phenotypically similar to Prader-Willi affected individuals. ID/DD is a feature in the affected individuals.

Further testing was conducted using human induced pluripotent stem cell (iPSC) -derived neurons followed by RNA sequencing conducted on the neurons.
The results of the assay was suggestive that variants located in the RNA recognition domain (residues 19–96 and 173–256) of SREK1 downregulation of SNORD115 and SNORD116 leading to Prader-Willi-like phenotype however proper validation and controls weren't used.

No relevant mouse models were identified on IMPC (international mouse phenotype consortium) to further support gene-disease association there gene reviewed as Amber.

Variants identified in SREK1 - AF's from gnomADv4.1
P95L - absent in gnomAD v4.1
T194M - EAS PopMax AF - 0.03787% (47 hets)
E601K - SAS PopMax AF - 0.01319% (12 hets)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 ADAM23 Sarah Milton gene: ADAM23 was added
gene: ADAM23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADAM23 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAM23 were set to PMID: 40455867
Phenotypes for gene: ADAM23 were set to Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related
Review for gene: ADAM23 was set to AMBER
Added comment: ADAM23 encodes a transmembrane protein receptor which is a receptor for LGI1. LGI1/ADAM22/ADAM23 form a complex that regulates excitatory synaptic transmission and neuronal excitability in the brain.

1 affected individual described in PMID: 40455867 with severe neonatal seizures, joint contractures, absent reflexes. Noted to have a homozygous NMD predicted variant in ADAM23.
Also had a de novo missense variant in PRKD1.

Knockout ADAM23 mice show early lethal epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 ADD1 Ava Stevenson reviewed gene: ADD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 34906466; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.176 SMARCC1 Gemma Edwards gene: SMARCC1 was added
gene: SMARCC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCC1 were set to 29983323; 37285932
Phenotypes for gene: SMARCC1 were set to SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123)
Review for gene: SMARCC1 was set to GREEN
Added comment: Phenotype expansion since original literature. ClinGen - "SMARCC1-associated developmental dysgenesis syndrome is characterized by developmental delay, cerebral ventriculomegaly, aqueductal stenosis, and other associated structural brain and cardiac defects". See cases in PMIDs 29983323, 37285932.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.175 IKZF2 Zornitza Stark gene: IKZF2 was added
gene: IKZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IKZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: IKZF2 were set to 37316189
Phenotypes for gene: IKZF2 were set to Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234
Review for gene: IKZF2 was set to AMBER
Added comment: PMID 37316189: two individuals with de novo variants and syndromic immunodysregulation, including craniofacial anomalies, hearing impairment, athelia, and developmental delay.

Note that variants in this gene are also associated with non-syndromic immune dysregulation and non-syndromic HL. Genotype-phenotype correlation unclear.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.173 ANKS1B Lilian Downie gene: ANKS1B was added
gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: ANKS1B.
Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKS1B were set to PMID: 31388001; 38129387
Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related
Review for gene: ANKS1B was set to GREEN
Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model.

Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.171 KCNA6 Zornitza Stark gene: KCNA6 was added
gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNA6 were set to 36318112; 40472070
Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related
Review for gene: KCNA6 was set to GREEN
Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.169 PIP5K1C Zornitza Stark reviewed gene: PIP5K1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 37451268; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.168 ZBTB7B Zornitza Stark gene: ZBTB7B was added
gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZBTB7B were set to 40392549
Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related
Review for gene: ZBTB7B was set to AMBER
Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure.

K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.164 PTPN1 Zornitza Stark gene: PTPN1 was added
gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTPN1 were set to 39986310
Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related
Review for gene: PTPN1 was set to GREEN
Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.162 WSB2 Krithika Murali gene: WSB2 was added
gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WSB2 were set to PMID:40374945
Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related
Review for gene: WSB2 was set to GREEN
Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include:
- Dev delay (all)
- Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia)
- Dysmorphic feature
- IUGR/oligohydramnios (3/5)
- Hypotonia (all)
- Microcephaly (3/5)
- Seizures (3/5)

Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense.

Supportive mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.161 NKAP Zornitza Stark Mode of inheritance for gene: NKAP was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.156 TAF1C Zornitza Stark edited their review of gene: TAF1C: Changed phenotypes: Neurodevelopmental disorder (MONDO#0700092), TAF1C-related
Intellectual disability syndromic and non-syndromic v1.156 TAF1C Zornitza Stark reviewed gene: TAF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 40371665; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.155 TM2D3 Zornitza Stark gene: TM2D3 was added
gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TM2D3 were set to 40449487
Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related
Review for gene: TM2D3 was set to GREEN
Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.153 SLK Zornitza Stark gene: SLK was added
gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLK were set to 40347834
Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related
Review for gene: SLK was set to GREEN
Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.151 RREB1 Chirag Patel reviewed gene: RREB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40418122; Phenotypes: Rasopathy, MONDO:0021060, RREB1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.150 GON4L Zornitza Stark reviewed gene: GON4L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Li-Takada-Miyake syndrome, MIM# 621212; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.150 PRR12 Boris Keren reviewed gene: PRR12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33824499; Phenotypes: intellectual disability, ocular anomalies, heart defects, growth failure, kidney anomalies; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.148 MYCBP2 Zornitza Stark edited their review of gene: MYCBP2: Added comment: Concerns about LoF variants in population datasets as well as in individuals undergoing diagnostic testing for a wide variety of unrelated phenotypes: downgrade to RED.; Changed rating: RED
Intellectual disability syndromic and non-syndromic v1.148 TOP2B Chris Ciotta reviewed gene: TOP2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33459963, 31953910, 28343847; Phenotypes: Intellectual disability (MONDO:0001071), TOP2B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.148 PIP5K1C Sarah Pantaleo reviewed gene: PIP5K1C: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.146 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported.; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Intellectual disability syndromic and non-syndromic v1.146 FAM177A1 Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177a1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152
Intellectual disability syndromic and non-syndromic v1.145 FAM177A1 Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.145 GTF3C3 Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Intellectual disability syndromic and non-syndromic v1.144 GTF3C3 Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Intellectual disability syndromic and non-syndromic v1.144 PTPMT1 Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199
Intellectual disability syndromic and non-syndromic v1.143 PTPMT1 Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.142 PPP2R5C Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.141 MRPL49 Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195
Intellectual disability syndromic and non-syndromic v1.140 LSM1 Zornitza Stark reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: FICUS syndrome, MIM# 621193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.138 PLK1 Zornitza Stark edited their review of gene: PLK1: Changed phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.138 PLXNA2 Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.134 AMOTL1 Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.134 NAV3 Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Intellectual disability syndromic and non-syndromic v1.133 NAV3 Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Intellectual disability syndromic and non-syndromic v1.132 FBXO22 Sarah Milton gene: FBXO22 was added
gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO22 were set to PMID: 40215970
Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related
Review for gene: FBXO22 was set to GREEN
Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases.

14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4).

Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies.

Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark gene: GAP43 was added
gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GAP43 were set to 39738362
Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related
Review for gene: GAP43 was set to RED
Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities.

The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Previously referred to as RNU2-2P
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.125 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant.

Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID.

Supportive functional data, including animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.121 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene.

3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes.

The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments.

RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene.

3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes.

The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments.

RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals.
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton edited their review of gene: LSM1: Changed publications: (PMID: 31010896, PMID: 36100156, PMID: 40204357)
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: (PMID: 31010896, 36100156, 40204357); Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.120 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram edited their review of gene: EIF3K: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram gene: EIF3K was added
gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3K were set to 40219605
Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092
Review for gene: EIF3K was set to RED
Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Other
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants.

Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.115 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.113 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.111 FMR1_FXS_CGG Bryony Thompson STR: FMR1_FXS_CGG was added
STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184
Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624
Review for STR: FMR1_FXS_CGG was set to GREEN
STR: FMR1_FXS_CGG was marked as clinically relevant
STR: FMR1_FXS_CGG was marked as current diagnostic
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.106 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.104 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.100 EEF1D Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.100 SPOUT1 Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154
Intellectual disability syndromic and non-syndromic v1.99 SPOUT1 Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.98 DISP1 Zornitza Stark edited their review of gene: DISP1: Changed phenotypes: Holoprosencephaly 10, MIM# 621143
Intellectual disability syndromic and non-syndromic v1.97 CDKL2 Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Sarah Milton gene: CDKL1 was added
gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL1 were set to PMID: 40088891
Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related
Mode of pathogenicity for gene: CDKL1 was set to Other
Review for gene: CDKL1 was set to AMBER
Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4).

Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 CDKL2 Sarah Milton gene: CDKL2 was added
gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL2 were set to PMID: 40088891
Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related
Penetrance for gene: CDKL2 were set to Complete
Mode of pathogenicity for gene: CDKL2 was set to Other
Review for gene: CDKL2 was set to AMBER
Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion.
2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging.

Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5)

Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.94 MED16 Zornitza Stark reviewed gene: MED16: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081376; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, MED16-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.93 CELF4 Zornitza Stark gene: CELF4 was added
gene: CELF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF4 were set to 40108438
Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related
Review for gene: CELF4 was set to GREEN
Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.92 SVBP Zornitza Stark Phenotypes for gene: SVBP were changed from Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569 to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569; Spastic paraplegia 94, autosomal recessive, MIM# 621150
Intellectual disability syndromic and non-syndromic v1.90 SVBP Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150
Intellectual disability syndromic and non-syndromic v1.89 CRMP1 Zornitza Stark gene: CRMP1 was added
gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CRMP1 were set to 36511780; 39758889
Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related
Review for gene: CRMP1 was set to GREEN
Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants.

PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID.

Four individuals with neurodevelopmental disorders and de novo variants in this gene.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.86 SLC35F1 Zornitza Stark edited their review of gene: SLC35F1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated, Rett-like syndrome
Intellectual disability syndromic and non-syndromic v1.85 EXOSC2 Zornitza Stark edited their review of gene: EXOSC2: Added comment: LIMITED by ClinGen. Two additional patients reported but again, predominantly missense variants.; Changed rating: AMBER; Changed publications: 26843489, 31628467, 36344539, 36069504
Intellectual disability syndromic and non-syndromic v1.83 KMT2C Zornitza Stark edited their review of gene: KMT2C: Added comment: Additional report of >80 individuals suggesting condition is distinct from Kleefstra syndrome and needs to be renamed.; Changed publications: 39013459; Changed phenotypes: Kleefstra syndrome 2, MIM#617768, Neurodevelopmental disorder, MONDO:0700092, KMT2C-related
Intellectual disability syndromic and non-syndromic v1.82 MEG3 Zornitza Stark gene: MEG3 was added
gene: MEG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MEG3 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Publications for gene: MEG3 were set to 33010492; 33746039; 33067531; 38212313
Phenotypes for gene: MEG3 were set to Kagami-Ogata syndrome, MIM# 608149
Review for gene: MEG3 was set to GREEN
Added comment: Small deletions of MAG3 reported in multiple patients as one of the mechanisms of disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.80 PPFIA3 Zornitza Stark edited their review of gene: PPFIA3: Changed phenotypes: Paul-Chao neurodevelopmental syndrome, MIM# 621122
Intellectual disability syndromic and non-syndromic v1.79 PIGW Zornitza Stark edited their review of gene: PIGW: Added comment: Downgraded to AMBER, assessed as LIMITED by ClinGen.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.79 PPP2R5E Chirag Patel gene: PPP2R5E was added
gene: PPP2R5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP2R5E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5E were set to PMID: 39284558
Phenotypes for gene: PPP2R5E were set to Mendelian neurodevelopmental disorder MONDO:0100500
Review for gene: PPP2R5E was set to RED
Added comment: One 20yrs old individual with learning issues, motor coordination disorders, hypotonia (myopathy on EMG), and behavioural issues (mood and emotional dysregulation). WES testing identified a de novo heterozygous missense variant (Glu191Lys) in PPP2R5E gene. The variant was not found in the 4 healthy brothers of the individual. The variant is located within a conserved LFDSEDPRER motif common to all PPP2R5 B-subunits. Biochemical assays demonstrated a decreased interaction with the PP2A A and C subunits, leading to disturbances in holoenzyme formation.

Protein phosphatase 2A (PP2A) is a family of multifunctional enzymatic complexes crucial for cellular signalling, playing a pivotal role in brain function and development. Mutations in specific genes encoding PP2A complexes have been associated with neurodevelopmental disorders with hypotonia and high risk of seizures (e.g. PP2AR-1A, 2B, 3C, 5C, 5D).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.76 CDO1 Zornitza Stark gene: CDO1 was added
gene: CDO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDO1 were set to 39949058
Phenotypes for gene: CDO1 were set to Syndromic disease, MONDO:0002254, CDO1-related
Review for gene: CDO1 was set to AMBER
Added comment: Three children with overlapping features including severe microcephaly and DD/ID. Three missense de novo variants were identified and were clustered around exon 3 and exon 4. The three missense variants identified p.(His147Arg, Ala131Val, Glu143Lys) are all absent from gnomAD v4.1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.74 PHACTR4 Zornitza Stark gene: PHACTR4 was added
gene: PHACTR4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PHACTR4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHACTR4 were set to 40012205
Phenotypes for gene: PHACTR4 were set to Syndromic disease, MONDO:0002254, PHACTR4-related
Review for gene: PHACTR4 was set to AMBER
Added comment: Two individuals with syndromic disease and de novo missense variants reported together with aggregate information on additional individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.72 C14orf80 Zornitza Stark gene: C14orf80 was added
gene: C14orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: C14orf80.
Mode of inheritance for gene: C14orf80 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C14orf80 were set to 39979680; 38252227
Phenotypes for gene: C14orf80 were set to Primary microcephaly, MONDO:0016660
Review for gene: C14orf80 was set to AMBER
Added comment: New HGNC approved Gene Name: TEDC1
Only two families reported with biallelic variants in this gene - Reports of a supportive functional assay however rated as Amber given that one of the reported families are consanguineous with hmz missense.

PMID: 39979680 - Male sibs from non-consanguineous parents presenting with a range of phenotypes including growth development abnormalities, microcephaly, DD, ID and endocrine insufficiency. The brothers were found to carry chet variants identified in trans [NM_001134877.1 c.[104-5C>G];[787delG] p.[?];[(Ala263LeufsTer29)].
Homozygous zebrafish model recapitulated the human phenotype and is supportive of the loss of function mechanism of disease.

PMID: 38252227 - Iranian consanguineous families identified with a rare biallelic missense variant (Gln269Arg). The affected brothers presented with a range of developmental phenotypes including cognitive impairment and microcephaly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.70 SPOUT1 Bryony Thompson gene: SPOUT1 was added
gene: SPOUT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPOUT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPOUT1 were set to 39962046
Phenotypes for gene: SPOUT1 were set to complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related
Review for gene: SPOUT1 was set to GREEN
Added comment: Biallelic SPOUT1 variants were identified in 28 individuals with a complex neurodevelopmental disorder from 21 unrelated families. Common phenotypes include microcephaly (18/21), seizures (20/28), intellectual disability (14/14), and varying degrees of developmental delays (28/28). Also, supporting zebrafish model. The suggested name of the disorder is SpADMiSS (SPOUT1 Associated Development delay Microcephaly Seizures Short stature).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.68 SIN3B Zornitza Stark reviewed gene: SIN3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SIN3B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.68 DDX39B Sangavi Sivagnanasundram gene: DDX39B was added
gene: DDX39B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX39B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DDX39B were set to 39918047
Phenotypes for gene: DDX39B were set to neurodevelopmental disorder MONDO:0700092, DDX39B-related
Review for gene: DDX39B was set to GREEN
Added comment: Established gene-disease association - ID/DD is a prominent feature in affected individuals.

6 individuals from 5 families with variable neurological and developmental phenotypes including hypotonia, DD, ID and epilepsy.
4 de novo missense variants and 1 inherited splice variant were identified. All variants are absent from gnomAD v4.1.
In vivo functional assay using Drosophila transgenic flies was supportive of a loss of function phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.67 SMARCA1 Zornitza Stark gene: SMARCA1 was added
gene: SMARCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: SMARCA1 were set to 37841849
Phenotypes for gene: SMARCA1 were set to Neurodevelopmental disorder, MONDO:0700092, SMARCA1-related
Review for gene: SMARCA1 was set to GREEN
Added comment: 40 individuals from 30 families with NDD and variants in this gene reported in this preprint, publication imminent
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.64 C12orf66 Zornitza Stark edited their review of gene: C12orf66: Changed rating: GREEN; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 83, MIM# 621100; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.64 EEFSEC Zornitza Stark Phenotypes for gene: EEFSEC were changed from Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related to Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102
Intellectual disability syndromic and non-syndromic v1.63 EEFSEC Zornitza Stark edited their review of gene: EEFSEC: Changed phenotypes: Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102
Intellectual disability syndromic and non-syndromic v1.62 ARHGEF40 Zornitza Stark reviewed gene: ARHGEF40: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.62 C12orf66 Chirag Patel reviewed gene: C12orf66: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39824192; Phenotypes: Neurodevelopmental disorder MONDO:0700092; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.62 ARHGEF40 Chirag Patel gene: ARHGEF40 was added
gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARHGEF40 were set to PMID: 39838643
Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: ARHGEF40 was set to RED
Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of
the importance of this residue.

The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.59 HECTD1 Chirag Patel gene: HECTD1 was added
gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HECTD1 were set to PMID: 39879987
Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: HECTD1 was set to GREEN
Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy.

The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype.

Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease.

HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.57 PTPMT1 Bryony Thompson gene: PTPMT1 was added
gene: PTPMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPMT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTPMT1 were set to 39279645; 37672386
Phenotypes for gene: PTPMT1 were set to inborn mitochondrial metabolism disorder MONDO:0004069
Review for gene: PTPMT1 was set to GREEN
Added comment: 6 cases from 3 independent families with biallelic variants in PTPMT1 (a mitochondrial tyrosine phosphatase required for de novo cardiolipin biosynthesis). All cases presented with a complex, neonatal/infantile onset neurological and neurodevelopmental syndrome including developmental delay, microcephaly, facial dysmorphism, epilepsy, spasticity, cerebellar ataxia and nystagmus, sensorineural hearing loss, optic atrophy and bulbar dysfunction. Supporting knockout zebrafish and mouse models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.55 ITGAV Zornitza Stark gene: ITGAV was added
gene: ITGAV was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ITGAV was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ITGAV were set to 39526957
Phenotypes for gene: ITGAV were set to Syndromic disease, MONDO:0002254, ITGAV-related
Review for gene: ITGAV was set to AMBER
Added comment: Three unrelated families reported: two with affected children (one hmz missense; other compound het LoF with missense) and one family with four affected fetuses. Clinical features included brain and eye anomalies and IBD/immune dysregulation. TGF-beta signalling pathway affected. The deletion of itgav in zebrafish recapitulated patient phenotypes including retinal and brain defects and the loss of microglia in early development as well as colitis in juvenile zebrafish with reduced SMAD3 expression and transcriptional regulation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.52 RYBP Zornitza Stark gene: RYBP was added
gene: RYBP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RYBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RYBP were set to 39891528
Phenotypes for gene: RYBP were set to Neurodevelopmental disorder, MONDO:0700092, RYBP-related
Review for gene: RYBP was set to GREEN
Added comment: Seven individuals with heterozygous de novo variants in RYBP reported. Clinical findings include severe developmental delay, dysmorphisms and multiple congenital anomalies. All the single nucleotide variants in RYBP localized to the N-terminal domain of the gene, which encodes the zinc finger domain and ubiquitin binding moiety. Further supportive in vitro and Drosophila functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.51 SEL1L Zornitza Stark Phenotypes for gene: SEL1L were changed from Neurodevelopmental disorder, MONDO:0700092, SEL1L-related to Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068; Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067
Intellectual disability syndromic and non-syndromic v1.50 SEL1L Zornitza Stark reviewed gene: SEL1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068, Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.49 MGA Zornitza Stark edited their review of gene: MGA: Added comment: Note LoF variants now also associated with POF, supportive mouse model. Downgrade to Amber until further delineation of phenotypes and mechanisms.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.47 TRPM7 Zornitza Stark gene: TRPM7 was added
gene: TRPM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRPM7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPM7 were set to 35561741; 35712613; 39099563
Phenotypes for gene: TRPM7 were set to Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related
Review for gene: TRPM7 was set to GREEN
Added comment: Protein expressed in the distal tubule, related to TRPM6. Postulated link with hypoMg with secondary hypoCa.
PMID 35561741: two families reported with dominant inheritance. F1: three affected individuals with splicing variant; some supportive functional data. F2: single affected individual, de novo missense variant.
PMID 35712613: de novo missense variant in an individual with hypoMg.
PMID 39099563: three affected individuals with missense variants, all de novo. Probands had DD, two had seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.45 TAOK2 Zornitza Stark gene: TAOK2 was added
gene: TAOK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAOK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAOK2 were set to 39737487
Phenotypes for gene: TAOK2 were set to neurodevelopmental disorder, MONDO:0700092, TAOK2-related
Review for gene: TAOK2 was set to GREEN
Added comment: PMID:39737487 reported 10 individuals with monoallelic TAOK2 variants and with a neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.44 GTF3C3 Chirag Patel reviewed gene: GTF3C3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39636576; Phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF3C3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.43 INPP4A Chirag Patel reviewed gene: INPP4A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39315527; Phenotypes: INPP4A-related neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.42 LRRC45 Zornitza Stark gene: LRRC45 was added
gene: LRRC45 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC45 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LRRC45 were set to 39638757
Phenotypes for gene: LRRC45 were set to Neurodevelopmental disorder MONDO:0700092, LRRC45-related
Review for gene: LRRC45 was set to AMBER
Added comment: Three individuals from two families reported with two homozygous variants, one splice site and the other missense. Features of a neurological ciliopathy with some supportive experimental evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.41 WASHC3 Zornitza Stark gene: WASHC3 was added
gene: WASHC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WASHC3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915
Phenotypes for gene: WASHC3 were set to neurodevelopmental disorder MONDO:0700092, WASHC3 related
Review for gene: WASHC3 was set to RED
Added comment: One family with de novo missense. Two families with homozygous start loss variant. The functional evidence provided does not directly link to the human phenotype. Given two variants and two different MOIs, RED rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.39 NAV3 Zornitza Stark gene: NAV3 was added
gene: NAV3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAV3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAV3 were set to 39708122; 38977784
Phenotypes for gene: NAV3 were set to Neurodevelopmental disorder, MONDO:0700092, NAV3-related
Review for gene: NAV3 was set to GREEN
Added comment: 17 individuals from 11 families reported with bi-allelic variants and neurodevelopmental phenotypes, including DD/ID and behavioural abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.37 EEFSEC Zornitza Stark gene: EEFSEC was added
gene: EEFSEC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EEFSEC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EEFSEC were set to 39753114
Phenotypes for gene: EEFSEC were set to Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related
Review for gene: EEFSEC was set to GREEN
Added comment: Nine individuals from 8 unrelated families reported with bi-allelic variants in this gene and progressive neurodevelopmental disorder manifesting with global developmental delay, progressive spasticity, ataxia, and seizures. Cerebral MRI primarily demonstrated a cerebellar pathology, including hypoplasia and progressive atrophy. In line with the clinical phenotype, an eEFSec-RNAi Drosophila model displays progressive impairment of motor function, which is reflected in the synaptic defects in this model organisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.35 CCT3 Zornitza Stark reviewed gene: CCT3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with speech or visual impairment and brain hypomyelination, MIM# 621034; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.35 TCP1 Zornitza Stark Phenotypes for gene: TCP1 were changed from neurodevelopmental disorder MONDO:0700092, TCP1-related to Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021
Intellectual disability syndromic and non-syndromic v1.34 TCP1 Zornitza Stark reviewed gene: TCP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.33 EP400 Sangavi Sivagnanasundram gene: EP400 was added
gene: EP400 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EP400 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EP400 were set to 39708813
Phenotypes for gene: EP400 were set to neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930
Review for gene: EP400 was set to GREEN
Added comment: 6 unrelated probands presenting with epilepsy with NDD (including ID and DD) had compound heterozygous variants in EP400. They were confirmed in trans and inherited from their asymptomatic parents.

Knockdown of EP400 ortholog in Drosophila showed an increase in seizure-like susceptibility and abnormal neurological behaviour.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.33 LRRC8C Sangavi Sivagnanasundram gene: LRRC8C was added
gene: LRRC8C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC8C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: LRRC8C were set to 39623139
Phenotypes for gene: LRRC8C were set to TIMES syndrome MIM#621056
Mode of pathogenicity for gene: LRRC8C was set to Other
Review for gene: LRRC8C was set to AMBER
Added comment: TIMES syndrome is a multisystem disorder characterised by considerable phenotypic variability, but overlapping features include telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature. Patients exhibit striking cutis marmorata in infancy.

Two individuals from unrelated families presenting with similar features consistent with TIMES syndrome.
Leu400IlefsTer8 and Val390Leu variants were identified however the proposed mechanism of disease is GoF.
Supporting in vitro functional assay was conducted however further evidence is required to upgrade the gene classification.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.32 RICTOR Bryony Thompson gene: RICTOR was added
gene: RICTOR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RICTOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RICTOR were set to 39738822
Phenotypes for gene: RICTOR were set to Neurodevelopmental disorder MONDO:0700092, RICTOR-related
Review for gene: RICTOR was set to GREEN
Added comment: 8 unrelated cases presenting with ID and/or developmental delay with de novo or heterozygous variants inherited from one affected parent, including three missense variants, four loss-of-function variants and one 3 kb deletion encompassing RICTOR. Possible gain of function and loss of function mechanism of disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.30 UBR5 Bryony Thompson gene: UBR5 was added
gene: UBR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBR5 were set to 39721588
Phenotypes for gene: UBR5 were set to Neurodevelopmental disorder MONDO:0700092, UBR5-related
Review for gene: UBR5 was set to GREEN
Added comment: 29 individuals with a neurodevelopment syndrome (24 de novo variants) with a core phenotype characterised by developmental delay (26/28), autism (16/26), and intellectual disability (56%). Additionally, some individuals presented with epilepsy/seizures (11/27), movement disorders, and/or genital anomalies (35%). Loss of function is the expected mechanism of disease with functional experiments in C. elegans and in vitro ubiquitination assays.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.28 ZNF711 Zornitza Stark reviewed gene: ZNF711: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 97, MIM# 300803; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.27 FRYL Zornitza Stark reviewed gene: FRYL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pan-Chung-Bellen syndrome, MIM# 621049; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.27 PIGG Ain Roesley Phenotypes for gene: PIGG were changed from Mental retardation, autosomal recessive 53, MIM#616917 to Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy MIM#616917
Intellectual disability syndromic and non-syndromic v1.23 RUNX1T1 Chirag Patel gene: RUNX1T1 was added
gene: RUNX1T1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RUNX1T1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340
Phenotypes for gene: RUNX1T1 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: RUNX1T1 was set to GREEN
Added comment: RUNX1T1 encodes a transcription regulator for hematopoietic genes and is well-known for its involvement in hematologic malignancies. Germline RUNX1T1 variants may also play a role in human congenital neurodevelopmental disorders.

PMID: 39568205
3 unrelated individuals with developmental delay, learning disability, ASD, ADHD, and dysmorphism (1 x heart defects). Trio WES identified de novo variants in RUNX1T1 gene (1 x nonsense variant in 5' region [p.Gln36Ter], 2 x missense variants in C-terminus [p.Gly412Arg and p.His521Tyr]).

PMID: 19172993
1 individual with mild-moderate ID and congenital heart disease, and chromosome t(5;8)(q32;q21.3) translocation. Molecular characterization revealed that one of the break points was within the RUNX1T1 gene. Analysis of RUNX1T1 expression in human embryonic and fetal tissues suggests a role of RUNX1T1 in brain and heart development.

PMID: 22644616
1 individual with mild ID and dysmorphism, and de novo deletion exons 3-7 in RUNX1T1.

PMID: 31223340
1 individual with ID, anaemia, atrial septal defect, dysmorphism, and seizures. Found to have a 2.1 Mb deletion at 8q21.3q22.1 involving entire RUNX1T1 gene (and 2 adjacent genes - SLC26A7 and TRIQK), and a benign familial 4.3 Mb duplication at 1p22.1p21.3 (present in unaffected healthy brother).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.19 CAPZA2 Chris Ciotta reviewed gene: CAPZA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32338762, 38374166, 35856264; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v1.13 CLASP1 Ain Roesley gene: CLASP1 was added
gene: CLASP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLASP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CLASP1 were set to 39040917
Phenotypes for gene: CLASP1 were set to neurodevelopmental disorder MONDO:0700092, CLASP1-related
Review for gene: CLASP1 was set to RED
gene: CLASP1 was marked as current diagnostic
Added comment: 3 siblings from a consanguineous family, homozygous for p.(Arg1481His)
at birth, all had low weight and microcephaly (< 3-4SD), profound dev delay, spasticity, seizures and lissencephaly

Arg1481His - 3 hets 0 Homs in v4
codon is highly conserved with a high REVEL score 0.83
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.11 GPATCH11 Zornitza Stark reviewed gene: GPATCH11: Rating: GREEN; Mode of pathogenicity: None; Publications: 39572588; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.10 MGA Zornitza Stark gene: MGA was added
gene: MGA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MGA were set to 39600096; 20044811
Phenotypes for gene: MGA were set to Syndromic disease, MONDO:0002254, MGA-related
Review for gene: MGA was set to GREEN
Added comment: Three individuals with de novo LoF variants reported in individuals with ID and congenital anomalies. Zebrafish model supports role of this transcription factor in organogenesis. Note there are previous, less clear reports of association with NDD/CHD. Gene is constrained for LoF variants in gnomad v4; however, note there are ~30 individuals with LoF variants present. Borderline Green/Amber.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.7 PPP2R2B Bryony Thompson gene: PPP2R2B was added
gene: PPP2R2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP2R2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R2B were set to 25356899; 39565297
Phenotypes for gene: PPP2R2B were set to Neurodevelopmental disorder MONDO:0700092, PPP2R2B-related
Review for gene: PPP2R2B was set to AMBER
Added comment: 5 cases with NDD and heterozygous missense (4/5 confirmed de novo): p.Thr246Lys (unknown inheritance), p.Asn310Lys (confirmed de novo), p.Glu37Lys (confirmed de novo, also had RNU4-2 path de novo Path variant), p.Ile427Thr (confirmed de novo, also had TAOK1 inherited Path variant), p.Arg149Pro (confirmed de novo). 5/5 with intellectual disability and developmental delay, 4/5 with seizures, 2/5 with hearing loss/auditory neuropathy. Study includes in vitro functional assays supporting a possible loss of function mechanism of disease. The 2 missense with additional diagnoses (E37K & I427T) demonstrated a partial reduction in PP2A holoenzyme assembly. Only 3 cases with a possible diagnosis that could be attributed to the PPP2R2B only, and only 2 were confirmed de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.5 WDR47 Bryony Thompson gene: WDR47 was added
gene: WDR47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR47 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR47 were set to 39609633
Phenotypes for gene: WDR47 were set to Complex neurodevelopmental disorder MONDO:0100038, WDR47-related
Review for gene: WDR47 was set to GREEN
Added comment: 7 cases from 5 unrelated families with biallelic variants and a complex neurodevelopmental syndrome. The most frequent phenotypes were corpus callosum dysgenesis (7/7), microcephaly (7/7), mild to severe intellectual disability (7/7), epilepsy (7/7). Additionally, mouse models recapitulate the human phenotype. Loss of function is the mechanism of disease. Heterozygous parents had no phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.3 PPP5C Lucy Spencer gene: PPP5C was added
gene: PPP5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP5C were set to 35361529; 25363768; 33057194
Phenotypes for gene: PPP5C were set to Neurodevelopmental disorder, MONDO:0700092, PPP5C-related
Review for gene: PPP5C was set to AMBER
Added comment: PMID: 35361529 - reported a de novo missense in a proband with microcephaly, developmental delay and epilepsy. However, after personal communication with the undiagnosed disease network this proband has since been found to have a different diagnosis with a nonsense and a missense in VARS1 identified, so unclear if the PPP5C variant is contributing to their phenotype.

3 more probands with de novo missense variants have been published in large autism or developmental disorder cohort with limited information (PMIDs: 25363768, 33057194)

An internal VCGS proband with intellectual disability and failure to thrive was also found to have a de novo missense variant in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.3 WDR83OS Zornitza Stark Phenotypes for gene: WDR83OS were changed from complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia to Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016
Intellectual disability syndromic and non-syndromic v1.2 WDR83OS Zornitza Stark reviewed gene: WDR83OS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.1 SLC35F1 Zornitza Stark edited their review of gene: SLC35F1: Added comment: Likely second individual identified internally at VCGS, AS/Rett-like phenotype and de novo Gly226Arg variant.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.1 LINC01578 Zornitza Stark Phenotypes for gene: LINC01578 were changed from Neurodevelopmental disorder, MONDO:0700092, CHASERR-related to Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012
Intellectual disability syndromic and non-syndromic v1.0 LINC01578 Zornitza Stark edited their review of gene: LINC01578: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012
Intellectual disability syndromic and non-syndromic v0.6905 STN1 Zornitza Stark Phenotypes for gene: STN1 were changed from cerebral calcification; premature ageing; bone marrow failure; retinal telangiactasia; hepatic fibrosis to Cerebroretinal microangiopathy with calcification and cysts 2, MIM#617341
Intellectual disability syndromic and non-syndromic v0.6896 PAX8 Zornitza Stark Phenotypes for gene: PAX8 were changed from to Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700
Intellectual disability syndromic and non-syndromic v0.6893 PAX6 Zornitza Stark Phenotypes for gene: PAX6 were changed from Microphthalmia/coloboma 12, OMIM #120200 to Microphthalmia/coloboma 12, OMIM #120200
Intellectual disability syndromic and non-syndromic v0.6892 PAX6 Zornitza Stark Phenotypes for gene: PAX6 were changed from to Microphthalmia/coloboma 12, OMIM #120200
Intellectual disability syndromic and non-syndromic v0.6886 OTX2 Zornitza Stark Phenotypes for gene: OTX2 were changed from to Microphthalmia, syndromic 5, MIM# 610125; Pituitary hormone deficiency, combined, 6, MIM# 613986; Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125; Otocephaly-dysgnathia complex
Intellectual disability syndromic and non-syndromic v0.6883 OPA3 Zornitza Stark Phenotypes for gene: OPA3 were changed from to 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR; Optic atrophy 3 with cataract (MIM#165300), AD
Intellectual disability syndromic and non-syndromic v0.6880 OPA3 Zornitza Stark Mode of inheritance for gene: OPA3 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6879 OPA3 Zornitza Stark Mode of inheritance for gene: OPA3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6873 NRAS Zornitza Stark Mode of pathogenicity for gene: NRAS was changed from Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6872 NRAS Zornitza Stark Mode of pathogenicity for gene: NRAS was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6870 NPHP1 Zornitza Stark Phenotypes for gene: NPHP1 were changed from to Joubert syndrome 4, MIM# 609583; Nephronophthisis 1, juvenile, MIM# 256100; Senior-Loken syndrome-1, MIM# 266900
Intellectual disability syndromic and non-syndromic v0.6851 MYCN Zornitza Stark reviewed gene: MYCN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Feingold syndrome 1 MIM#164280; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6845 LARGE1 Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840
Intellectual disability syndromic and non-syndromic v0.6839 LAMP2 Zornitza Stark Mode of inheritance for gene: LAMP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6836 KRAS Zornitza Stark Mode of pathogenicity for gene: KRAS was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6824 INPP5K Zornitza Stark Phenotypes for gene: INPP5K were changed from to congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607
Intellectual disability syndromic and non-syndromic v0.6817 DHRSX Zornitza Stark edited their review of gene: DHRSX: Changed phenotypes: Congenital disorder of glycosylation, type 1DD, MIM# 301133
Intellectual disability syndromic and non-syndromic v0.6814 IFIH1 Zornitza Stark Phenotypes for gene: IFIH1 were changed from to IFIH1-related type 1 interferonopathy MONDO:0700262
Intellectual disability syndromic and non-syndromic v0.6805 IDS Zornitza Stark Mode of inheritance for gene: IDS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6801 HTRA2 Zornitza Stark Phenotypes for gene: HTRA2 were changed from to 3-methylglutaconic aciduria type 8 MONDO:0044723
Intellectual disability syndromic and non-syndromic v0.6793 HSPD1 Zornitza Stark reviewed gene: HSPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571143, 27405012, 32532876, 28377887, 27405012, 11898127, 17420924; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM# 612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6790 HSD17B10 Zornitza Stark Mode of inheritance for gene: HSD17B10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6783 HPD Zornitza Stark reviewed gene: HPD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6781 HOXA1 Zornitza Stark Phenotypes for gene: HOXA1 were changed from to Bosley-Salih-Alorainy syndrome, MIM#601536 and Athabaskan brainstem dysgenesis syndrome, MIM#601536
Intellectual disability syndromic and non-syndromic v0.6777 HMGCL Zornitza Stark Phenotypes for gene: HMGCL were changed from to 3-hydroxy-3-methylglutaric aciduria MONDO:0009520
Intellectual disability syndromic and non-syndromic v0.6774 HLCS Zornitza Stark Phenotypes for gene: HLCS were changed from to holocarboxylase synthetase deficiency MONDO:0009666
Intellectual disability syndromic and non-syndromic v0.6756 HESX1 Zornitza Stark Mode of inheritance for gene: HESX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6755 HESX1 Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6755 HEPACAM Zornitza Stark Phenotypes for gene: HEPACAM were changed from to Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490; Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491
Intellectual disability syndromic and non-syndromic v0.6753 HEPACAM Zornitza Stark Mode of inheritance for gene: HEPACAM was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6752 HCCS Zornitza Stark Phenotypes for gene: HCCS were changed from to linear skin defects with multiple congenital anomalies 1 (MONDO:0024552)
Intellectual disability syndromic and non-syndromic v0.6750 HCCS Zornitza Stark Mode of inheritance for gene: HCCS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6749 HCCS Zornitza Stark reviewed gene: HCCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6749 GTF2H5 Zornitza Stark Phenotypes for gene: GTF2H5 were changed from to Trichothiodystrophy 3, photosensitive MIM#616395
Intellectual disability syndromic and non-syndromic v0.6746 GTF2H5 Zornitza Stark reviewed gene: GTF2H5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6743 GRM1 Zornitza Stark reviewed gene: GRM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6741 GPC3 Zornitza Stark Mode of inheritance for gene: GPC3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6731 GMPPB Zornitza Stark Phenotypes for gene: GMPPB were changed from to myopathy caused by variation in GMPPB MONDO:0700084
Intellectual disability syndromic and non-syndromic v0.6720 PSPH Ain Roesley reviewed gene: PSPH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Phosphoserine phosphatase deficiency MIM#614023; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Mode of inheritance for gene: PRPS1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6718 PRPS1 Ain Roesley reviewed gene: PRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24961627; Phenotypes: PRPS1 deficiency disorder MONDO:0100061; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6716 PRODH Ain Roesley reviewed gene: PRODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 17412540, 12217952; Phenotypes: Hyperprolinemia, type I MIM#239500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6714 PPT1 Ain Roesley reviewed gene: PPT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7637805, 9425237, 9664077; Phenotypes: Ceroid lipofuscinosis, neuronal, 1 MIM#256730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6710 PPP3CA Ain Roesley Phenotypes for gene: PPP3CA were changed from to Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265; Developmental and epileptic encephalopathy 91 MIM617711
Intellectual disability syndromic and non-syndromic v0.6709 PPP3CA Ain Roesley reviewed gene: PPP3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 29432562, 32593294; Phenotypes: Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265, Developmental and epileptic encephalopathy 91 MIM617711; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6709 POMT2 Ain Roesley Phenotypes for gene: POMT2 were changed from myopathy caused by variation in POMT2 MONDO:0700071 to myopathy caused by variation in POMT2 MONDO:0700071
Intellectual disability syndromic and non-syndromic v0.6708 POMT2 Ain Roesley Phenotypes for gene: POMT2 were changed from to myopathy caused by variation in POMT2 MONDO:0700071
Intellectual disability syndromic and non-syndromic v0.6707 POMT2 Ain Roesley reviewed gene: POMT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT2 MONDO:0700071; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6707 POMT1 Ain Roesley Phenotypes for gene: POMT1 were changed from to myopathy caused by variation in POMT1 MONDO:0700070
Intellectual disability syndromic and non-syndromic v0.6706 POMT1 Ain Roesley reviewed gene: POMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT1 MONDO:0700070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6706 POMGNT2 Ain Roesley Phenotypes for gene: POMGNT2 were changed from to myopathy caused by variation in POMGNT2 MONDO:0700069
Intellectual disability syndromic and non-syndromic v0.6705 POMGNT2 Ain Roesley reviewed gene: POMGNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT2 MONDO:0700069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6705 POMGNT1 Ain Roesley Phenotypes for gene: POMGNT1 were changed from myopathy caused by variation in POMGNT1 MONDO:0700068 to myopathy caused by variation in POMGNT1 MONDO:0700068
Intellectual disability syndromic and non-syndromic v0.6704 POMGNT1 Ain Roesley Phenotypes for gene: POMGNT1 were changed from myopathy caused by variation in POMGNT1 MONDO:0700068 to myopathy caused by variation in POMGNT1 MONDO:0700068
Intellectual disability syndromic and non-syndromic v0.6704 POMGNT1 Ain Roesley Phenotypes for gene: POMGNT1 were changed from to myopathy caused by variation in POMGNT1 MONDO:0700068
Intellectual disability syndromic and non-syndromic v0.6703 POMGNT1 Ain Roesley changed review comment from: DD/ID is a feature

the following has been lumped by clingen as one entity

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280
Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151
Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157; to: DD/ID is a feature

the following has been lumped by clingen as one entity

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280
Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151
Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157

https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_03bb8479-2ed3-4b15-9e54-378ea0729ab2-2024-08-14T190000.000Z?page=1&size=25&search=
Intellectual disability syndromic and non-syndromic v0.6703 POMGNT1 Ain Roesley reviewed gene: POMGNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT1 MONDO:0700068; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6703 POLR3B Ain Roesley Mode of inheritance for gene: POLR3B was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6702 POLR3B Ain Roesley Mode of inheritance for gene: POLR3B was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6702 POLR3B Ain Roesley Phenotypes for gene: POLR3B were changed from to POLR3B-related disorder MONDO:0700277; Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742; Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381
Intellectual disability syndromic and non-syndromic v0.6701 POLR3B Ain Roesley reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33417887; Phenotypes: POLR3B-related disorder MONDO:0700277, Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742, Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6699 POLR3A Ain Roesley reviewed gene: POLR3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: POLR3A-related disorder MONDO:0700276; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6699 POLG Ain Roesley Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Phenotypes for gene: POLG were changed from to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Mode of inheritance for gene: POLG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6697 POLG Ain Roesley reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301791; Phenotypes: Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700, Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662, Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459, Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450, Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6695 PNPLA6 Ain Roesley reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25299038; Phenotypes: retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6693 PLA2G6 Ain Roesley Phenotypes for gene: PLA2G6 were changed from Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217 to Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217
Intellectual disability syndromic and non-syndromic v0.6692 PLA2G6 Ain Roesley Phenotypes for gene: PLA2G6 were changed from to Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217
Intellectual disability syndromic and non-syndromic v0.6692 PMM2 Ain Roesley reviewed gene: PMM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301289; Phenotypes: Congenital disorder of glycosylation, type Ia MIM#212065; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6691 PLA2G6 Ain Roesley reviewed gene: PLA2G6: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301718; Phenotypes: nfantile neuroaxonal dystrophy 1 MIM#256600, Neurodegeneration with brain iron accumulation 2B MIM#610217; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Phenotypes for gene: PIK3CA were changed from PIK3CA-related overgrowth spectrum MONDO:1040002 to PIK3CA-related overgrowth spectrum MONDO:1040002
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Phenotypes for gene: PIK3CA were changed from PIK3CA-related overgrowth spectrum MONDO:1040002 to PIK3CA-related overgrowth spectrum MONDO:1040002
Intellectual disability syndromic and non-syndromic v0.6690 PIK3CA Ain Roesley Phenotypes for gene: PIK3CA were changed from to PIK3CA-related overgrowth spectrum MONDO:1040002
Intellectual disability syndromic and non-syndromic v0.6689 PIK3CA Ain Roesley reviewed gene: PIK3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 23946963; Phenotypes: PIK3CA-related overgrowth spectrum MONDO:1040002; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6687 PHGDH Ain Roesley reviewed gene: PHGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Neu-Laxova syndrome 1 MIM#256520, Phosphoglycerate dehydrogenase deficiency MIM#601815; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6685 PEX7 Ain Roesley reviewed gene: PEX7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301447; Phenotypes: Peroxisome biogenesis disorder 9B MIM#614879, Rhizomelic chondrodysplasia punctata, type 1 MIM#215100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6684 PEX6 Ain Roesley edited their review of gene: PEX6: Changed publications: 29220678, 20301621
Intellectual disability syndromic and non-syndromic v0.6684 PEX6 Ain Roesley Mode of inheritance for gene: PEX6 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6683 PEX6 Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6683 PEX6 Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6683 PEX6 Ain Roesley reviewed gene: PEX6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Peroxisome biogenesis disorder 4A (Zellweger) MIM#614862, Peroxisome biogenesis disorder 4B MIM#614863; Mode of inheritance: None; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6681 PEX5 Ain Roesley reviewed gene: PEX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110, Peroxisome biogenesis disorder 2B MIM#202370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6680 PEX3 Ain Roesley reviewed gene: PEX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10942428, 10958759, 10968777, 27557811, 33101983, 20301621; Phenotypes: Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882, Peroxisome biogenesis disorder 10B , MIM# 617370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6678 PEX26 Ain Roesley Deleted their comment
Intellectual disability syndromic and non-syndromic v0.6677 PEX26 Ain Roesley commented on gene: PEX26: ID/DD is part of the Zellweger spectrum
Intellectual disability syndromic and non-syndromic v0.6677 PEX26 Ain Roesley reviewed gene: PEX26: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872, Peroxisome biogenesis disorder 7B MIM614873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6676 PEX2 Ain Roesley changed review comment from: Few individuals reported with variants in PEX19 however,; to: ID/DD is part of the Zellweger spectrum
Intellectual disability syndromic and non-syndromic v0.6676 PEX2 Ain Roesley commented on gene: PEX2: Few individuals reported with variants in PEX19 however,
Intellectual disability syndromic and non-syndromic v0.6676 PEX2 Ain Roesley reviewed gene: PEX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866, Peroxisome biogenesis disorder 5B MIM#614867; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6674 PEX19 Ain Roesley reviewed gene: PEX19: Rating: GREEN; Mode of pathogenicity: None; Publications: 10051604, 20683989, 11883941, 28391327; Phenotypes: Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6672 PEX16 Ain Roesley edited their review of gene: PEX16: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.6672 PEX16 Ain Roesley reviewed gene: PEX16: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876, Peroxisome biogenesis disorder 8B MIM#614877; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6671 PEX14 Ain Roesley Mode of inheritance for gene: PEX14 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6670 PEX14 Ain Roesley reviewed gene: PEX14: Rating: GREEN; Mode of pathogenicity: None; Publications: 37493040, 20301621; Phenotypes: Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887, peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6668 PEX13 Ain Roesley reviewed gene: PEX13: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 11A (Zellweger) MIM#614883, Peroxisome biogenesis disorder 11B MIM#614885; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6666 PEX12 Ain Roesley reviewed gene: PEX12: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859, Peroxisome biogenesis disorder 3B MIM#266510; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6665 TSHZ3 Bryony Thompson gene: TSHZ3 was added
gene: TSHZ3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TSHZ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TSHZ3 were set to 27668656; 34919690; 36553458; 39420202
Phenotypes for gene: TSHZ3 were set to congenital anomaly of kidney and urinary tract MONDO:0019719
Review for gene: TSHZ3 was set to AMBER
Added comment: More evidence for the gene-disease association is required
PMID: 27668656 - TSHZ3 is included in the region deleted in chromosome 19q13.11 Deletion Syndrome, which includes intellectual disability and behavioural issues, congenital anomalies of the kidney and urinary tract (CAKUT)
PMID: 34919690 - haploinsufficient mouse model leads to kidney defects
PMID: 36553458 - heterozygous frameshift variant c.119_120dup p.Pro41SerfsTer79 in a case with intellectual disability, behavioural issues, pyelocaliceal dilatation, and mild urethral stenosis.
PMID: 39420202 - 12 CAKUT patients from 9/301 (3%) families carried 5 different rare heterozygous TSHZ3 missense variants. However, 1 of the variants (p.Ser58Gly) present in 5 of the families is more common in gnomAD v4.1 than you would expect for a dominant disease including 5 homozygotes (1,408/1,612,114 alleles, 5 hom, AF=0.0008734). The authors state this is not unexpected in a condition, such as CAKUT. However, the different missense variants are inherited from unaffected parents in at least 2/9 families (there was no phenotype information available for an additional 3 parents).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6663 WDR83OS Bryony Thompson gene: WDR83OS was added
gene: WDR83OS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR83OS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR83OS were set to 39471804; 30250217
Phenotypes for gene: WDR83OS were set to complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia
Review for gene: WDR83OS was set to GREEN
Added comment: Now 14 cases from 9 unrelated families with homozygous LoF variants, including the family reported in 2019. Consistent clinical features include NDD (14/14), facial dysmorphism (13/14), intractable itching (9/14), and elevated bile acids (5/6). Also, supporting null zebrafish model that recapitulates the human phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6661 GON4L Bryony Thompson gene: GON4L was added
gene: GON4L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GON4L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON4L were set to 39500882; 21937992
Phenotypes for gene: GON4L were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: GON4L was set to GREEN
Added comment: 2 LoF variants in 4 cases from 3 unrelated consanguineous families, and supporting null zebrafish model
PMID: 39500882 - 2 homozygous truncating GON4L variants [NM_001282860.2: c.62_63del, p.(Gln21Argfs*12) and c.5517+1G>A] in 3 patients from 2 consanguineous families with prenatal-onset growth impairment, developmental delay, mild intellectual disability, speech impairment, progressive and disproportionate microcephaly, facial asymmetry, congenital heart anomaly, and brain structure abnormalities.
Null zebrafish model had distinct morphological and size abnormalities in the craniofacial cartilage of zebrafish larvae
Heterozygous carriers in biallelic families were unaffected
PMID: 21937992 - a case from Iran from a consanguineous family homozygous for c.5517+1G>A with syndromic ID. No other clinical details provided
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6658 UBTF Zornitza Stark Phenotypes for gene: UBTF were changed from Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701 to Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701; Neurodevelopmental disorder, MONDO:0700092, UBTF-related
Intellectual disability syndromic and non-syndromic v0.6654 BHLHE22 Zornitza Stark gene: BHLHE22 was added
gene: BHLHE22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BHLHE22 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: BHLHE22 were set to 39502664
Phenotypes for gene: BHLHE22 were set to Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related
Review for gene: BHLHE22 was set to GREEN
Added comment: Four individuals with de novo missense variants within the highly conserved helix-loop-helix domain and seven individuals from five unrelated families with a recurrent homozygous frameshift variant, p.(Gly74Alafs*18).

Individuals presented with absent or limited speech, severely impaired motor abilities, intellectual disability (ID), involuntary movements, autistic traits with stereotypies, abnormal muscle tone. The majority of individuals had partial or complete agenesis of the corpus callosum (ACC). Additional symptoms comprised epilepsy, variable dysmorphic features, and eye anomalies. One additional individual had spastic paraplegia without delayed development and ACC, expanding the phenotype to milder and later onset forms.

Mice lacking bhlhe22 show nearly complete loss of three brain comminsure, including the corpus callosum.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6652 MRPL49 Zornitza Stark gene: MRPL49 was added
gene: MRPL49 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRPL49 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPL49 were set to 39417135
Phenotypes for gene: MRPL49 were set to Mitochondrial disease, MONDO:0044970, MRPL49-related
Review for gene: MRPL49 was set to GREEN
Added comment: Five unrelated families with presentations ranging from Perrault syndrome (primary ovarian insufficiency and sensorineural hearing loss) to severe childhood onset of leukodystrophy, learning disability, microcephaly and retinal dystrophy and bi-allelic variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6651 SATB1 Sangavi Sivagnanasundram reviewed gene: SATB1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008481; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6647 PEX11B Ain Roesley reviewed gene: PEX11B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28129423, 22581968; Phenotypes: Peroxisome biogenesis disorder 14B MIM#614920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6645 PEX10 Ain Roesley reviewed gene: PEX10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870, Peroxisome biogenesis disorder 6B MIM#614871; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6644 PEX1 Ain Roesley edited their review of gene: PEX1: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.6644 PEX1 Ain Roesley reviewed gene: PEX1: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Heimler syndrome 1 MIM#234580, Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100, Peroxisome biogenesis disorder 1B (NALD/IRD) MIM#601539; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6642 PEPD Ain Roesley reviewed gene: PEPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26110198, 32455636; Phenotypes: Prolidase deficiency MIM#170100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6638 PDSS2 Ain Roesley reviewed gene: PDSS2: Rating: RED; Mode of pathogenicity: None; Publications: 28125198, 29032433, 25349199, 17186472, 21723727, 10972372; Phenotypes: Coenzyme Q10 deficiency, primary, 3 MIM#614652; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6636 PDHX Ain Roesley reviewed gene: PDHX: Rating: GREEN; Mode of pathogenicity: None; Publications: 34138529; Phenotypes: Lacticacidemia due to PDX1 deficiency MIM#245349; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6635 PDHA1 Ain Roesley Mode of inheritance for gene: PDHA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6634 PDHA1 Ain Roesley changed review comment from: In subjects surviving past 6 months, a broad range of intellectual outcomes was observed.; to: ID is a feature of this condition.

PMID:23021068 "In subjects surviving past 6 months, a broad range of intellectual outcomes was observed."
Intellectual disability syndromic and non-syndromic v0.6634 PDHA1 Ain Roesley reviewed gene: PDHA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23021068; Phenotypes: Pyruvate dehydrogenase E1-alpha deficiency MIM#312170; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6634 PDGFRB Ain Roesley Phenotypes for gene: PDGFRB were changed from Kosaki overgrowth syndrome MIM#616592 to Kosaki overgrowth syndrome MIM#616592
Intellectual disability syndromic and non-syndromic v0.6633 PDGFRB Ain Roesley Phenotypes for gene: PDGFRB were changed from to Kosaki overgrowth syndrome MIM#616592
Intellectual disability syndromic and non-syndromic v0.6632 PDGFRB Ain Roesley reviewed gene: PDGFRB: Rating: GREEN; Mode of pathogenicity: None; Publications: 31710779, 35221873; Phenotypes: Kosaki overgrowth syndrome MIM#616592; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6632 PCNT Ain Roesley reviewed gene: PCNT: Rating: AMBER; Mode of pathogenicity: None; Publications: 34978779; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II MIM#210720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Phenotypes for gene: PCDH19 were changed from to Developmental and epileptic encephalopathy 9 MIM#300088
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Mode of inheritance for gene: PCDH19 was changed from Unknown to Other
Intellectual disability syndromic and non-syndromic v0.6629 PCDH19 Ain Roesley reviewed gene: PCDH19: Rating: GREEN; Mode of pathogenicity: None; Publications: 28669061; Phenotypes: Developmental and epileptic encephalopathy 9 MIM#300088; Mode of inheritance: Other; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6629 PCCB Ain Roesley reviewed gene: PCCB: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6628 PCCA Ain Roesley reviewed gene: PCCA: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6628 MARK2 Chirag Patel gene: MARK2 was added
gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MARK2 were set to PMID: 39419027, 39436150
Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: MARK2 was set to GREEN
Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears).

WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains.

The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6627 UBTF Chirag Patel reviewed gene: UBTF: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 39366741; Phenotypes: Global developmental delay without neuroregression; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6627 SGSM3 Sangavi Sivagnanasundram reviewed gene: SGSM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 39390489; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), SGSM3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6626 LINC01578 Zornitza Stark gene: LINC01578 was added
gene: LINC01578 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: LINC01578.
Mode of inheritance for gene: LINC01578 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LINC01578 were set to 39442041
Phenotypes for gene: LINC01578 were set to Neurodevelopmental disorder, MONDO:0700092, CHASERR-related
Review for gene: LINC01578 was set to GREEN
Added comment: CHASERR encodes a human long noncoding RNA (lncRNA) adjacent to CHD2, a coding gene in which de novo loss-of-function variants cause developmental and epileptic encephalopathy. Three unrelated children reported with a syndromic, early-onset neurodevelopmental disorder, each of whom had a de novo deletion in the CHASERR locus. The children had severe encephalopathy, shared facial dysmorphisms, cortical atrophy, and cerebral hypomyelination - a phenotype that is distinct from the phenotypes of patients with CHD2 haploinsufficiency. CHASERR deletion results in increased CHD2 protein abundance in patient-derived cell lines and increased expression of the CHD2 transcript in cis, indicating bidirectional dosage sensitivity in human disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6623 RNU5B-1 Zornitza Stark edited their review of gene: RNU5B-1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related
Intellectual disability syndromic and non-syndromic v0.6623 RNU5B-1 Zornitza Stark gene: RNU5B-1 was added
gene: RNU5B-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU5B-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1
Review for gene: RNU5B-1 was set to GREEN
Added comment: 20 individuals reported in two preprints with de novo variants in this gene and a neurodevelopmental phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6622 MBOAT7 Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6621 MBOAT7 Zornitza Stark reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6620 SRPK3 Zornitza Stark edited their review of gene: SRPK3: Changed phenotypes: Intellectual developmental disorder, X-linked, 114, MIM#301134
Intellectual disability syndromic and non-syndromic v0.6620 KCNJ11 Zornitza Stark Phenotypes for gene: KCNJ11 were changed from to {Diabetes mellitus, type 2, susceptibility to} 125853; Diabetes mellitus, transient neonatal, 3 610582; Diabetes, permanent neonatal, with or without neurologic features 606176; Hyperinsulinemic hypoglycemia, familial, 2 601820; Maturity-onset diabetes of the young, type 13 616329 AD
Intellectual disability syndromic and non-syndromic v0.6619 KCNJ11 Zornitza Stark Mode of inheritance for gene: KCNJ11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6618 YAP1 Zornitza Stark Phenotypes for gene: YAP1 were changed from to Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation OMIM #120433
Intellectual disability syndromic and non-syndromic v0.6608 SLC6A19 Zornitza Stark commented on gene: SLC6A19: Well established gene-disease association with several neurological manifestations, including DD.
Intellectual disability syndromic and non-syndromic v0.6608 SLC6A19 Zornitza Stark reviewed gene: SLC6A19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hartnup disorder, MIM# 234500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6606 DHX9 Zornitza Stark edited their review of gene: DHX9: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 75, MIM# 620988
Intellectual disability syndromic and non-syndromic v0.6604 ANKRD31 Megan Ball gene: ANKRD31 was added
gene: ANKRD31 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ANKRD31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKRD31 were set to 27541642
Review for gene: ANKRD31 was set to RED
Added comment: 1 individual with Rett-like phenotype. De novo missense. C.196A>T, p.Ile66Phe. Onset of features at 3 years, delayed ambulation, epilepsy, developmental regression, stereotypies, non-verbal. 17 years old at time of publication. A C.elegans model of ANKRD31 with a deletion showed significantly defective locomotion and asymmetric dynamics of axonal and dendritic microtubule defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6604 SLC35A2 Zornitza Stark Phenotypes for gene: SLC35A2 were changed from to Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854; Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE)
Intellectual disability syndromic and non-syndromic v0.6602 SLC35A2 Zornitza Stark Mode of inheritance for gene: SLC35A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6601 SLC35A2 Zornitza Stark reviewed gene: SLC35A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23561849, 24115232, 27743886, 25778940, 33407896; Phenotypes: Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854, Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6598 SLC33A1 Zornitza Stark reviewed gene: SLC33A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31194315; Phenotypes: Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6598 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from to GLUT1-deficiency syndrome, MONDO:0000188; Dystonia 9 601042; GLUT1 deficiency syndrome 1, infantile onset, severe 606777; GLUT1 deficiency syndrome 2, childhood onset 612126; Stomatin-deficient cryohydrocytosis with neurologic defects 608885
Intellectual disability syndromic and non-syndromic v0.6596 SLC2A1 Zornitza Stark Mode of inheritance for gene: SLC2A1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6595 SLC2A1 Zornitza Stark reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32913944; Phenotypes: GLUT1-deficiency syndrome, MONDO:0000188, Dystonia 9 601042, GLUT1 deficiency syndrome 1, infantile onset, severe 606777, GLUT1 deficiency syndrome 2, childhood onset 612126, Stomatin-deficient cryohydrocytosis with neurologic defects 608885; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6595 SLC25A22 Zornitza Stark Phenotypes for gene: SLC25A22 were changed from to Developmental and epileptic encephalopathy 3, MIM# 609304
Intellectual disability syndromic and non-syndromic v0.6592 SLC25A22 Zornitza Stark reviewed gene: SLC25A22: Rating: GREEN; Mode of pathogenicity: None; Publications: 15592994, 19780765, 24596948, 33821742, 33342683, 31285529; Phenotypes: Developmental and epileptic encephalopathy 3, MIM# 609304; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6591 ZRSR2 Zornitza Stark reviewed gene: ZRSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Orofaciodigital syndrome XXI, MIM# 301132; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6591 SLC25A12 Zornitza Stark Phenotypes for gene: SLC25A12 were changed from to Developmental and epileptic encephalopathy 39, MIM# 612949
Intellectual disability syndromic and non-syndromic v0.6588 SLC25A12 Zornitza Stark reviewed gene: SLC25A12: Rating: GREEN; Mode of pathogenicity: None; Publications: 19641205, 24515575, 35008954, 32700846, 31766059, 31514314; Phenotypes: Developmental and epileptic encephalopathy 39, MIM# 612949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6585 SLC17A5 Zornitza Stark edited their review of gene: SLC17A5: Changed publications: 10581036, 10947946
Intellectual disability syndromic and non-syndromic v0.6585 SLC17A5 Zornitza Stark commented on gene: SLC17A5: Sialic acid storage diseases are autosomal recessive neurodegenerative disorders that may present as a severe infantile form, including DD/IDD or a slowly progressive adult form, which is prevalent in Finland and referred to as Salla disease. p.Arg39Cys is a founder Finnish variant. Multiple families reported.
Intellectual disability syndromic and non-syndromic v0.6585 SLC17A5 Zornitza Stark reviewed gene: SLC17A5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sialic acid storage disorder, infantile, MIM# 269920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6585 SLC12A6 Zornitza Stark Phenotypes for gene: SLC12A6 were changed from to Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000
Intellectual disability syndromic and non-syndromic v0.6581 SLC12A6 Zornitza Stark reviewed gene: SLC12A6: Rating: GREEN; Mode of pathogenicity: None; Publications: 31439721, 27485015, 16606917, 21628467, 12368912, 17893295; Phenotypes: Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6580 AJAP1 Zornitza Stark gene: AJAP1 was added
gene: AJAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AJAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AJAP1 were set to 38985877
Phenotypes for gene: AJAP1 were set to neurodevelopmental disorder, MONDO:0700092, AJAP1-related
Review for gene: AJAP1 was set to GREEN
Added comment: PMID:38985877 reported five unrelated individuals with monoallelic variants or a deletion in AJAP1 gene and they presented with epilepsy, neurodevelopmental problems, or intellectual disability. There is also supporting functional evidence available.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6572 KIF7 Zornitza Stark Phenotypes for gene: KIF7 were changed from acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990 to acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990
Intellectual disability syndromic and non-syndromic v0.6571 KIF7 Zornitza Stark Phenotypes for gene: KIF7 were changed from to acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990
Intellectual disability syndromic and non-syndromic v0.6554 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643
Intellectual disability syndromic and non-syndromic v0.6549 ISPD Sangavi Sivagnanasundram reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23288328; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 LAMA1 Sangavi Sivagnanasundram reviewed gene: LAMA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24013853; Phenotypes: ataxia - intellectual disability - oculomotor apraxia - cerebellar cysts syndrome MONDO:0014419; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 L2HGDH Sangavi Sivagnanasundram reviewed gene: L2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37113859; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 KLHL7 Sangavi Sivagnanasundram reviewed gene: KLHL7: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392078, 30142437, 29074562; Phenotypes: PERCHING syndrome MONDO:0014890, acrocallosal syndrome MONDO:0008708; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 KIF7 Sangavi Sivagnanasundram reviewed gene: KIF7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301500; Phenotypes: acrocallosal syndrome MONDO:0008708, KIF7-related ciliopathy MONDO:0800463, Joubert syndrome 12 MIM#200990; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 KIF5A Sangavi Sivagnanasundram reviewed gene: KIF5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 18853458; Phenotypes: Spastic paraplegia 10, autosomal dominant, MIM# 604187, inherited neurodegenerative disorder MONDO:0024237; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6548 DHRSX Zornitza Stark edited their review of gene: DHRSX: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.6548 DHRSX Zornitza Stark gene: DHRSX was added
gene: DHRSX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHRSX was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DHRSX were set to 38821050
Phenotypes for gene: DHRSX were set to congenital disorder of glycosylation, MONDO:0015286, DHRSX-related
Added comment: PMID:38821050 reported the identification of biallelic missense variants in DHRSX gene in four patients from three unrelated families with a congenital disorder of glycosylation. They displayed distinct facial features, severe neurological involvement including hypotonia, scoliosis, contractures, profound intellectual disability, epilepsy, and sensorineural hearing loss. These patients also experienced severe failure to thrive (requiring tube feeding); variable respiratory insufficiency; and involvement of the eyes, the gastrointestinal system, and other organs.

Gene located in PAR.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6540 KCNT1 Zornitza Stark Phenotypes for gene: KCNT1 were changed from to Developmental and epileptic encephalopathy MIM#614959; childhood-onset epilepsy syndrome MONDO:0020072
Intellectual disability syndromic and non-syndromic v0.6537 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726); progressive myoclonus epilepsy MONDO:0020074 to progressive myoclonus epilepsy MONDO:0020074; Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726)
Intellectual disability syndromic and non-syndromic v0.6536 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726); progressive myoclonus epilepsy MONDO:0020074
Intellectual disability syndromic and non-syndromic v0.6531 KDM6A Zornitza Stark Mode of inheritance for gene: KDM6A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6528 KIAA0586 Sangavi Sivagnanasundram reviewed gene: KIAA0586: Rating: GREEN; Mode of pathogenicity: None; Publications: 26096313; Phenotypes: Joubert syndrome 23 MIM#616490; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6528 KDM6A Sangavi Sivagnanasundram reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33674768; Phenotypes: Kabuki syndrome 2 MONDO:0010465; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6528 KCTD7 Sangavi Sivagnanasundram reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 30295347, 31197948; Phenotypes: progressive myoclonus epilepsy MONDO:0020074; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6528 KCNT1 Sangavi Sivagnanasundram reviewed gene: KCNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23086397, 24029078; Phenotypes: childhood-onset epilepsy syndrome MONDO:0020072; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6528 IVD Sangavi Sivagnanasundram reviewed gene: IVD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26018748; Phenotypes: isovaleric acidemia MONDO:0009475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6528 ITPR1 Sangavi Sivagnanasundram reviewed gene: ITPR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108797, 27108798, 15623688, 22986007, 28488678; Phenotypes: aniridia-cerebellar ataxia-intellectual disability syndrome MONDO:0008795, spinocerebellar ataxia type 29 MONDO:0007298; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6527 MSL2 Zornitza Stark edited their review of gene: MSL2: Changed phenotypes: Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985
Intellectual disability syndromic and non-syndromic v0.6527 BORCS8 Zornitza Stark Phenotypes for gene: BORCS8 were changed from Neurodevelopmental disorder (MONDO#0700092), BORCS8-related to Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987
Intellectual disability syndromic and non-syndromic v0.6526 BORCS8 Zornitza Stark reviewed gene: BORCS8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6522 GLYCTK Bryony Thompson reviewed gene: GLYCTK: Rating: AMBER; Mode of pathogenicity: None; Publications: 20949620, 31837836, 3588091, 30637540, 28462797, 20949620, 28190537; Phenotypes: D-glyceric aciduria MONDO:0009070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6519 GLI3 Bryony Thompson reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301619, 20301638; Phenotypes: Greig cephalopolysyndactyly syndrome MONDO:0008287; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6516 GLI2 Bryony Thompson reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24744436; Phenotypes: postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6516 GLDC Bryony Thompson Phenotypes for gene: GLDC were changed from to glycine encephalopathy MONDO:0011612
Intellectual disability syndromic and non-syndromic v0.6513 GLDC Bryony Thompson reviewed gene: GLDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301531; Phenotypes: glycine encephalopathy MONDO:0011612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6510 GLB1 Bryony Thompson reviewed gene: GLB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24156116; Phenotypes: GM1 gangliosidosis MONDO:0018149, mucopolysaccharidosis type 4B MONDO:0009660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6507 GK Bryony Thompson reviewed gene: GK: Rating: GREEN; Mode of pathogenicity: None; Publications: 37091526, 33212314; Phenotypes: inborn glycerol kinase deficiency MONDO:0010613, X-linked adrenal hypoplasia congenita MONDO:0010264; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6506 MAL Zornitza Stark edited their review of gene: MAL: Changed phenotypes: Leukodystrophy, hypomyelinating, 28, MIM# 620978
Intellectual disability syndromic and non-syndromic v0.6505 GJC2 Bryony Thompson reviewed gene: GJC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29276893; Phenotypes: hypomyelinating leukodystrophy 2 MONDO:0012125, hereditary spastic paraplegia 44 MONDO:0013179; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6500 GFM1 Bryony Thompson reviewed gene: GFM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25852744, 31680380, 21986555, 32776492; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6500 SLC12A5 Zornitza Stark Phenotypes for gene: SLC12A5 were changed from to Developmental and epileptic encephalopathy 34, MIM# 616645
Intellectual disability syndromic and non-syndromic v0.6497 SLC12A5 Zornitza Stark changed review comment from: Note LIMITED by ClinGen. However, note functional evidence including mouse model.

Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship.; to: LIMITED by ClinGen. However, note functional evidence including mouse model and additional family in 38660387, again with supportive functional data.

Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship.
Intellectual disability syndromic and non-syndromic v0.6497 SLC12A5 Zornitza Stark edited their review of gene: SLC12A5: Changed publications: 26333769, 27436767, 31618474, 12000122, 38660387
Intellectual disability syndromic and non-syndromic v0.6497 SLC12A5 Zornitza Stark reviewed gene: SLC12A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26333769, 27436767, 31618474, 12000122; Phenotypes: Developmental and epileptic encephalopathy 34, MIM# 616645; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6497 SC5D Zornitza Stark Phenotypes for gene: SC5D were changed from to Lathosterolosis, MIM#607330
Intellectual disability syndromic and non-syndromic v0.6494 SC5D Zornitza Stark changed review comment from: Well established gene-disease association. DD/ID is part of the phenotype.; to: Well established gene-disease association. DD/ID is part of the phenotype. More than 5 families reported.
Intellectual disability syndromic and non-syndromic v0.6494 SC5D Zornitza Stark edited their review of gene: SC5D: Changed publications: 17853487, 12189593, 12812989, 24142275
Intellectual disability syndromic and non-syndromic v0.6494 SC5D Zornitza Stark reviewed gene: SC5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lathosterolosis, MIM#607330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6491 RTEL1 Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dyskeratosis congenita, autosomal recessive 5, MIM#615190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6491 RRM2B Zornitza Stark Phenotypes for gene: RRM2B were changed from to Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075; Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075
Intellectual disability syndromic and non-syndromic v0.6489 RRM2B Zornitza Stark reviewed gene: RRM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075, Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6489 UFC1 Zornitza Stark reviewed gene: UFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with spasticity and poor growth, OMIM #618076; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6487 RPS6KA3 Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Lowry syndrome MIM# 303600; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6485 RPGRIP1L Zornitza Stark reviewed gene: RPGRIP1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Joubert syndrome 7, MIM# 611560, Meckel syndrome 5, MIM# 611561; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6485 RNASET2 Zornitza Stark Phenotypes for gene: RNASET2 were changed from to Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951
Intellectual disability syndromic and non-syndromic v0.6482 RNASET2 Zornitza Stark edited their review of gene: RNASET2: Added comment: More than 10 families reported, DD/ID is part of the phenotype.; Changed publications: 31349848, 19525954, 27091087, 29336640, 18545798, 15851732
Intellectual disability syndromic and non-syndromic v0.6482 RNASET2 Zornitza Stark reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6480 RNASEH2C Zornitza Stark reviewed gene: RNASEH2C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 3, MIM# 610329; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6478 RNASEH2B Zornitza Stark reviewed gene: RNASEH2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 2, MIM# 610181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6476 RNASEH2A Zornitza Stark reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 4, MIM# 610333; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6473 RMND1 Zornitza Stark reviewed gene: RMND1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 11 MIM#614922; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6471 RIT1 Zornitza Stark Mode of pathogenicity for gene: RIT1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6468 RFC4 Zornitza Stark reviewed gene: RFC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RFC4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6465 RARS2 Zornitza Stark reviewed gene: RARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17847012, 20635367, 25809939; Phenotypes: Pontocerebellar hypoplasia, type 6, MIM# 611523; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6464 IPO8 Zornitza Stark gene: IPO8 was added
gene: IPO8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IPO8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IPO8 were set to 34010604; 33875846; 34010605
Phenotypes for gene: IPO8 were set to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities
Review for gene: IPO8 was set to GREEN
Added comment: There are 35 unrelated cases with a IPO8 variant, 4/35 with mild ID, 1/35 with severe ID and 7 global developmental delay. There is a further case with severe ID, but the patient also has a 1.779Mb deletion in 19q13.4, which could be responsible for the ID (PMID: 34010605).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6461 PRKACB Zornitza Stark edited their review of gene: PRKACB: Added comment: Additional individual reported with ID and de novo missense variant.; Changed rating: GREEN; Changed publications: 39095811
Intellectual disability syndromic and non-syndromic v0.6458 RAF1 Zornitza Stark Mode of pathogenicity for gene: RAF1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6456 RAB18 Zornitza Stark changed review comment from: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln; to: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe ID, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln
Intellectual disability syndromic and non-syndromic v0.6453 RAB18 Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6450 PYCR1 Zornitza Stark reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19648921, 4076251, 22052856, 19576563, 19648921, 9648921, 22052856, 28294978, 27756598; Phenotypes: Cutis laxa, autosomal recessive, type IIB, MIM# 612940, Cutis laxa, autosomal recessive, type IIIB, MIM# 614438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6450 PUS1 Zornitza Stark Phenotypes for gene: PUS1 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Intellectual disability syndromic and non-syndromic v0.6447 PUS1 Zornitza Stark edited their review of gene: PUS1: Changed phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Intellectual disability syndromic and non-syndromic v0.6447 PUS1 Zornitza Stark reviewed gene: PUS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25227147, 17056637, 15108122, 32287105, 31641589, 28832011; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6444 PTS Zornitza Stark reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6444 PTPN11 Zornitza Stark Phenotypes for gene: PTPN11 were changed from to Noonan syndrome 1, MIM#163950 AD; LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines)
Intellectual disability syndromic and non-syndromic v0.6442 PTPN11 Zornitza Stark Mode of pathogenicity for gene: PTPN11 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6437 PTF1A Zornitza Stark reviewed gene: PTF1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 21749365, 10507728, 15543146, 19650412; Phenotypes: Pancreatic and cerebellar agenesis, MIM# 609069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6433 PTDSS1 Zornitza Stark commented on gene: PTDSS1: Lenz-Majewski hyperostotic dwarfism is a rare condition characterized by intellectual disability, sclerosing bone dysplasia, distinct craniofacial and dental anomalies, loose skin, and distal limb anomalies, particularly brachydactyly and symphalangism. Patients have multiple radiographic abnormalities due to progressive generalized hyperostosis that affects the cranium, vertebrae, and diaphyses of tubular bones, leading to severe growth retardation.

Multiple families. Gain-of-function is the established or expected mechanism of disease for these variants.
Intellectual disability syndromic and non-syndromic v0.6433 PTDSS1 Zornitza Stark edited their review of gene: PTDSS1: Changed publications: 24241535, 29341480, 31403251
Intellectual disability syndromic and non-syndromic v0.6433 PTDSS1 Zornitza Stark reviewed gene: PTDSS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lenz-Majewski hyperostotic dwarfism MIM#151050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6430 PTCH1 Zornitza Stark reviewed gene: PTCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holoprosencephaly 7, MIM# 610828; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6429 KBTBD2 Zornitza Stark gene: KBTBD2 was added
gene: KBTBD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KBTBD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KBTBD2 were set to 39313616
Phenotypes for gene: KBTBD2 were set to neurodevelopmental disorder MONDO:0700092, KBTBD2-related
Review for gene: KBTBD2 was set to GREEN
Added comment: 3 families - 2 compound hets and 1 hom

phenotypes include:
Microcephaly, hypotonia, failure to thrive, IUGR, delayed gross motor development, dysmorphism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6425 MAP2K1 Zornitza Stark Mode of pathogenicity for gene: MAP2K1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6421 MAP2K2 Zornitza Stark Mode of pathogenicity for gene: MAP2K2 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6418 MAT1A Zornitza Stark Phenotypes for gene: MAT1A were changed from to Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850; Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850; Disorders of the metabolism of sulphur amino acids
Intellectual disability syndromic and non-syndromic v0.6416 MAT1A Zornitza Stark Mode of inheritance for gene: MAT1A was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6413 MBOAT7 Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6406 MLC1 Zornitza Stark Phenotypes for gene: MLC1 were changed from to Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004)
Intellectual disability syndromic and non-syndromic v0.6403 MMAA Zornitza Stark Phenotypes for gene: MMAA were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100
Intellectual disability syndromic and non-syndromic v0.6400 MMAB Zornitza Stark Phenotypes for gene: MMAB were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110
Intellectual disability syndromic and non-syndromic v0.6397 MMADHC Zornitza Stark Phenotypes for gene: MMADHC were changed from to Homocystinuria, cblD type, variant 1 MIM#277410; Methylmalonic aciduria and homocystinuria, cblD type MIM#277410; Methylmalonic aciduria, cblD type, variant 2 MIM#277410; Disorders of cobalamin absorption, transport and metabolism
Intellectual disability syndromic and non-syndromic v0.6394 MUT Zornitza Stark Phenotypes for gene: MUT were changed from to Methylmalonic aciduria, mut(0) type, MIM# 251000
Intellectual disability syndromic and non-syndromic v0.6386 POLR3K Bryony Thompson gene: POLR3K was added
gene: POLR3K was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3K were set to https://doi.org/10.1155/2024/8807171; 30584594
Phenotypes for gene: POLR3K were set to POLR3-related leukodystrophy MONDO:0700282
Review for gene: POLR3K was set to GREEN
Added comment: 3 apparently unrelated cases (1 compound het & 2 homozygous for the same missense & supporting functional assays) with phenotypes consistent with POLR3-related leukodystrophy which includes ID and DD as part of the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6382 GFAP Bryony Thompson reviewed gene: GFAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301351; Phenotypes: Alexander disease MONDO:0008752; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6382 ATAD2B Zornitza Stark gene: ATAD2B was added
gene: ATAD2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATAD2B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATAD2B were set to 39313616
Phenotypes for gene: ATAD2B were set to neurodevelopmental disorder MONDO:0700092, ATAD2B-related
Review for gene: ATAD2B was set to AMBER
Added comment: 3 families including 2 siblings
1 fam is hom for a highly conserved missense

Amber because of the lack of specific phenotypes:
Abnormality of the nervous system and Abnormality of the eye
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6368 MTHFR Zornitza Stark Marked gene: MTHFR as ready
Intellectual disability syndromic and non-syndromic v0.6368 MTHFR Zornitza Stark Gene: mthfr has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6368 MTHFR Zornitza Stark Phenotypes for gene: MTHFR were changed from to Homocystinuria due to MTHFR deficiency MIM#236250; Disorders of folate metabolism and transport
Intellectual disability syndromic and non-syndromic v0.6367 MTHFR Zornitza Stark Publications for gene: MTHFR were set to
Intellectual disability syndromic and non-syndromic v0.6366 MTHFR Zornitza Stark Mode of inheritance for gene: MTHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6358 NKX2-1 Zornitza Stark Phenotypes for gene: NKX2-1 were changed from Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 to Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978
Intellectual disability syndromic and non-syndromic v0.6357 NKX2-1 Zornitza Stark Phenotypes for gene: NKX2-1 were changed from to Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978
Intellectual disability syndromic and non-syndromic v0.6352 NGLY1 Zornitza Stark reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24651605, 27388694, 32259258; Phenotypes: Congenital disorder of deglycosylation (OMIM 615273); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6350 NFIX Zornitza Stark Phenotypes for gene: NFIX were changed from to Sotos syndrome 2 (MIM#614753); Marshall-Smith syndrome, MIM# 602535
Intellectual disability syndromic and non-syndromic v0.6333 NALCN Zornitza Stark Phenotypes for gene: NALCN were changed from to Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266; Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419
Intellectual disability syndromic and non-syndromic v0.6331 NALCN Zornitza Stark Mode of inheritance for gene: NALCN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6318 SKI Zornitza Stark reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SKI-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6314 LRRC7 Zornitza Stark reviewed gene: LRRC7: Rating: GREEN; Mode of pathogenicity: None; Publications: 39256359; Phenotypes: neurodevelopmental disorder (MONDO:0700092), LRRC7-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6313 SECISBP2 Zornitza Stark Phenotypes for gene: SECISBP2 were changed from #609698 THYROID HORMONE METABOLISM, ABNORMAL to Thyroid hormone metabolism, abnormal, 1, MIM# 609698
Intellectual disability syndromic and non-syndromic v0.6310 SECISBP2 Zornitza Stark reviewed gene: SECISBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 39315526; Phenotypes: Thyroid hormone metabolism, abnormal, 1, MIM# 609698; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6310 FLVCR1 Bryony Thompson Phenotypes for gene: FLVCR1 were changed from Ataxia, posterior column, with retinitis pigmentosa, MIM#609033 to neurodevelopmental disorder MONDO:0700092, FLVCR1-related
Intellectual disability syndromic and non-syndromic v0.6307 FLVCR1 Bryony Thompson reviewed gene: FLVCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39306721; Phenotypes: neurodevelopmental disorder MONDO:0700092, FLVCR1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6307 LRRC7 Sangavi Sivagnanasundram gene: LRRC7 was added
gene: LRRC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LRRC7 were set to 39256359
Phenotypes for gene: LRRC7 were set to neurodevelopmental disorder (MONDO:0700092)
Review for gene: LRRC7 was set to GREEN
Added comment: Well established gene-disease association.
Neurodevelopmental disorder with a clinical spectrum - symptoms include ID, ADHD, aggression and in many cases, hyperphagia associate obesity.
Heterozygous missense and LoF variants have been reported and functional assays were conducted on missense and truncating variants that support LoF mechanism of disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6307 SHH Chirag Patel reviewed gene: SHH: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22791840, 19057928; Phenotypes: Holoprosencephaly 3 (MIM#142945); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6307 SKI Chirag Patel reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23023332, 23103230, 24736733, 30071989; Phenotypes: Shprintzen-Goldberg syndrome, MIM# 182212; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6307 SCO2 Chirag Patel reviewed gene: SCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10545952, 10749987, 18924171; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6307 NAGA Chirag Patel reviewed gene: NAGA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11313741, 31468281, 15619430, 8782044; Phenotypes: Kanzaki disease, MIM# 609242, Schindler disease, type I and type II 609241, alpha-N-acetylgalactosaminidase deficiency MONDO:0017779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6307 NAGLU Chirag Patel reviewed gene: NAGLU: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8650226; Phenotypes: Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6307 NALCN Chirag Patel reviewed gene: NALCN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25683120, 30167850, 23749988, 24075186; Phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266, Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NDUFA1 Chirag Patel reviewed gene: NDUFA1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29506883, 19185523, 17262856, 21596602; Phenotypes: Mitochondrial complex I deficiency, nuclear type 12 MIM#301020; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6304 NDUFS7 Chirag Patel reviewed gene: NDUFS7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22644603; Phenotypes: Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NDUFS8 Chirag Patel reviewed gene: NDUFS8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23430795, 9837812, 15159508, 22499348, 20818383, 20819849; Phenotypes: Mitochondrial complex I deficiency, nuclear type 2 MIM#618222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NDUFV1 Chirag Patel reviewed gene: NDUFV1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34807224; Phenotypes: Mitochondrial complex I deficiency, nuclear type 4 MIM#618225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NEU1 Chirag Patel reviewed gene: NEU1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8985184, 9054950, 11063730; Phenotypes: Sialidosis, type I and type II, MIM# 256550, MONDO:0009738; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NFIX Chirag Patel reviewed gene: NFIX: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33034087, 29897170, 30548146, 25118028; Phenotypes: Sotos syndrome 2 (MIM#614753), Marshall-Smith syndrome, MIM# 602535; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6304 NGLY1 Chirag Patel reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: Congenital disorder of deglycosylation (OMIM 615273); Phenotypes: PMID: 24651605, 27388694, 32259258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NKX2-1 Chirag Patel reviewed gene: NKX2-1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10931427, 27066577, 26839702, 26103969, 23911641, 11854319, 24714694; Phenotypes: Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978, Chorea, hereditary benign MIM#118700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6303 NPC1 Chirag Patel reviewed gene: NPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9211849, 11333381; Phenotypes: Niemann-Pick disease, type C1 and type D, MIM# 257220, MONDO:0009757; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 NPC2 Chirag Patel reviewed gene: NPC2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11125141, 17470133; Phenotypes: Niemann-pick disease, type C2, MIM# 607625, MONDO:0011873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MTHFR Chirag Patel commented on gene: MTHFR: Well-established gene-disease association (see OMIM entry). Homocystinuria due to MTHFR deficiency is classified as a metabolic disorder by NIH GARD (https://rarediseases.info.nih.gov/diseases/diseases-by-category/14/metabolic-disorders) and is an inborn error of folate metabolism. DD/ID can be seen in condition.
Intellectual disability syndromic and non-syndromic v0.6303 MTHFR Chirag Patel reviewed gene: MTHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7920641; Phenotypes: Homocystinuria due to MTHFR deficiency MIM#236250, Disorders of folate metabolism and transport; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MYO5A Chirag Patel reviewed gene: MYO5A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 32275080, 22711375, 25283056; Phenotypes: Griscelli syndrome, type 1 MIM#214450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 RAB27A Chirag Patel reviewed gene: RAB27A: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6303 MVK Chirag Patel reviewed gene: MVK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29047407, 26409462; Phenotypes: Hyper-IgD syndrome (MIM#260920), Mevalonic aciduria (MIM#610377); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MTFMT Chirag Patel reviewed gene: MTFMT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21907147, 23499752, 24461907, 22499348; Phenotypes: Combined oxidative phosphorylation deficiency 15, MIM# 614947, Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MRPS22 Chirag Patel reviewed gene: MRPS22: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29566152,17873122, 25663021, 28752220; Phenotypes: Combined oxidative phosphorylation deficiency 5 MIM#611719, Ovarian dysgenesis 7 MIM#618117; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MOCS2 Chirag Patel reviewed gene: MOCS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 10053004; Phenotypes: Molybdenum cofactor deficiency B MIM#252160, Disorders of molybdenum cofactor metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MUT Chirag Patel reviewed gene: MUT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116, 1977311, 11528502, 12948746; Phenotypes: Methylmalonic aciduria, mut(0) type, MIM# 251000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MMADHC Chirag Patel reviewed gene: MMADHC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116,27604308, 18385497; Phenotypes: Homocystinuria, cblD type, variant 1 MIM#277410, Methylmalonic aciduria and homocystinuria, cblD type MIM#277410, Methylmalonic aciduria, cblD type, variant 2 MIM#277410, Disorders of cobalamin absorption, transport and metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MMAB Chirag Patel reviewed gene: MMAB: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MMAA Chirag Patel reviewed gene: MMAA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MLC1 Chirag Patel reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11254442, 18757878, 16652334; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MKS1 Chirag Patel reviewed gene: MKS1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 17377820, 24886560, 19776033, 33193692, 27570071, 27377014, 18327255, 24608809; Phenotypes: Joubert syndrome 28, MIM# 617121, MONDO:0014928, Meckel syndrome 1, MIM# 249000, MONDO:0009571, Bardet-Biedl syndrome 13, MIM# 615990, MONDO:0014441; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MKKS Chirag Patel reviewed gene: MKKS: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10973251, 10802661, 26900326; Phenotypes: McKusick-Kaufman syndrome, MIM# 236700, Bardet-Biedl syndrome 6, MIM# 605231, Retinitis pigmentosa; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MBOAT7 Chirag Patel reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33335874, 32645526, 32744787, 31852446, 31282596, 30701556; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MAT1A Chirag Patel reviewed gene: MAT1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7560086; Phenotypes: Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850, Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850, Disorders of the metabolism of sulphur amino acids; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MAP2K2 Chirag Patel reviewed gene: MAP2K2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20358587, 16439621, 18042262; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6303 MAP2K1 Chirag Patel reviewed gene: MAP2K1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 16439621, 17551924, 18042262, 20301365; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6302 ZDHHC16 Ain Roesley gene: ZDHHC16 was added
gene: ZDHHC16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZDHHC16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZDHHC16 were set to 39313616
Phenotypes for gene: ZDHHC16 were set to neurodevelopmental disorder MONDO:0700092, ZDHHC16-related
Review for gene: ZDHHC16 was set to AMBER
gene: ZDHHC16 was marked as current diagnostic
Added comment: 6 families including a pair of siblings

Amber because 5 of the families had non specific phenotypes listed
Abnormality of:
the nervous system, metabolism/homeostasis, head/neck, immune system, the integument, the digestive system, the respiratory system, the endocrine system, Growth abnormality the skeletal system, the musculature, the eye

Specific HPOs were provided for one individual (homoyzygous for a canonical splice)

Abnormality of the face; Cerebellar hypoplasia; Developmental regression; Encephalopathy; Hyperreflexia; Hypertonia; Hypotonia; Inguinal hernia; Laryngomalacia; Microcephaly; Motor delay; Optic atrophy; Seizure; Spastic paraparesis; Spasticity; Talipes equinovarus; Umbilical hernia
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6300 EPB41L3 Bryony Thompson gene: EPB41L3 was added
gene: EPB41L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EPB41L3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EPB41L3 were set to 39292993
Phenotypes for gene: EPB41L3 were set to neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063
Review for gene: EPB41L3 was set to GREEN
Added comment: 6 cases from 5 unrelated consanguineous families (2nd & 3rd degree) with homozygous LoF variants and a neurodevelopmental condition, including ID and seizures. Epb41l3 shRNA-mediated downregulation in mouse oligodendroglia demonstrated impaired oligodendrocyte function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6299 GCH1 Bryony Thompson Phenotypes for gene: GCH1 were changed from to GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186
Intellectual disability syndromic and non-syndromic v0.6295 GCH1 Bryony Thompson reviewed gene: GCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22473768, 7869202; Phenotypes: GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6295 GAMT Bryony Thompson Phenotypes for gene: GAMT were changed from to guanidinoacetate methyltransferase deficiency MONDO:0012999
Intellectual disability syndromic and non-syndromic v0.6292 GAMT Bryony Thompson reviewed gene: GAMT: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301745; Phenotypes: guanidinoacetate methyltransferase deficiency MONDO:0012999; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6289 GALE Bryony Thompson reviewed gene: GALE: Rating: GREEN; Mode of pathogenicity: None; Publications: 21290786; Phenotypes: galactose epimerase deficiency MONDO:0009257; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6286 GALC Bryony Thompson reviewed gene: GALC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301416; Phenotypes: Krabbe disease MONDO:000949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6286 GABRB2 Bryony Thompson Phenotypes for gene: GABRB2 were changed from to epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631
Intellectual disability syndromic and non-syndromic v0.6283 GABRB2 Bryony Thompson reviewed gene: GABRB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 38996765; Phenotypes: epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6280 FUCA1 Bryony Thompson reviewed gene: FUCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33266441; Phenotypes: Fucosidosis MONDO:0009254; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6277 FOXRED1 Bryony Thompson reviewed gene: FOXRED1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31434271, 20818383, 20858599; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6274 FOXG1 Bryony Thompson reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571142, 19578037, 19564653, 28661489; Phenotypes: FOXG1 disorder MONDO:0100040; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6274 FKTN Bryony Thompson Phenotypes for gene: FKTN were changed from to Myopathy caused by variation in FKTN MONDO:0700067
Intellectual disability syndromic and non-syndromic v0.6271 FKTN Bryony Thompson reviewed gene: FKTN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301385; Phenotypes: Myopathy caused by variation in FKTN MONDO:0700067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6271 FKRP Bryony Thompson Phenotypes for gene: FKRP were changed from myopathy caused by variation in FKRP MONDO:0700066 to myopathy caused by variation in FKRP MONDO:0700066
Intellectual disability syndromic and non-syndromic v0.6270 FKRP Bryony Thompson Phenotypes for gene: FKRP were changed from to myopathy caused by variation in FKRP MONDO:0700066
Intellectual disability syndromic and non-syndromic v0.6267 FKRP Bryony Thompson reviewed gene: FKRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 33200426, 11053680, 12654965, 14652796, 15121789; Phenotypes: myopathy caused by variation in FKRP MONDO:0700066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6267 FIG4 Bryony Thompson Phenotypes for gene: FIG4 were changed from to Charcot-Marie-Tooth disease MONDO:0015626
Intellectual disability syndromic and non-syndromic v0.6264 FIG4 Bryony Thompson reviewed gene: FIG4: Rating: GREEN; Mode of pathogenicity: None; Publications: 32385905, 34122524, 36529678; Phenotypes: Charcot-Marie-Tooth disease MONDO:0015626; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6262 FBXL4 Bryony Thompson reviewed gene: FBXL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 28383868; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6258 FAT4 Bryony Thompson reviewed gene: FAT4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681106; Phenotypes: Hennekam syndrome MONDO:0016256, van Maldergem syndrome MONDO:0017813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6258 FAM20C Bryony Thompson Phenotypes for gene: FAM20C were changed from to lethal osteosclerotic bone dysplasia MONDO:0009821
Intellectual disability syndromic and non-syndromic v0.6255 FAM20C Bryony Thompson reviewed gene: FAM20C: Rating: GREEN; Mode of pathogenicity: None; Publications: 34360805; Phenotypes: lethal osteosclerotic bone dysplasia MONDO:0009821; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6252 FAM126A Bryony Thompson reviewed gene: FAM126A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301737; Phenotypes: hypomyelinating leukodystrophy 5 MONDO:0012514; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6249 ESCO2 Bryony Thompson reviewed gene: ESCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301332; Phenotypes: Roberts-SC phocomelia syndrome MONDO:0100253; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6249 INPP5K Sangavi Sivagnanasundram reviewed gene: INPP5K: Rating: GREEN; Mode of pathogenicity: None; Publications: 28190456, 28190459; Phenotypes: congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6249 IKBKG Sangavi Sivagnanasundram reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301645; Phenotypes: Incontinentia pigmenti MONDO:0010631; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6249 RAF1 Chirag Patel reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 17603483, 17603482, 31145547, 31030682, 29271604; Phenotypes: Noonan syndrome 5, MIM# 611553; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6249 RIT1 Chirag Patel reviewed gene: RIT1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 23791108, 25124994, 24939608, 27101134; Phenotypes: Noonan syndrome 8, MIM# 615355; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 RRAS2 Chirag Patel reviewed gene: RRAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6248 PTPN11 Chirag Patel reviewed gene: PTPN11: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 11992261,21533187, 24935154; Phenotypes: LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines), Metachondromatosis, 156250 AD, Noonan syndrome 1, 163950 AD, Leukemia, juvenile myelomonocytic, somatic, 607785; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 KRAS Chirag Patel reviewed gene: KRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 21797849, 16474404, 16474405, 16773572, 17056636; Phenotypes: Noonan syndrome 3, MIM# 609942, Cardiofaciocutaneous syndrome 2, MIM# 615278; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 NRAS Chirag Patel reviewed gene: NRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 19966803, 26467218, 28594414; Phenotypes: Noonan syndrome 6, MIM# 613224; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 NPHP1 Chirag Patel reviewed gene: NPHP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15138899, 32139166, 28347285, 8852662, 9856524; Phenotypes: Joubert syndrome 4, MIM# 609583, Nephronophthisis 1, juvenile, MIM# 256100, Senior-Loken syndrome-1, MIM# 266900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.6248 OTX2 Chirag Patel reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24167467, 25589041, 31969185,; Phenotypes: Microphthalmia, syndromic 5, MIM# 610125, Pituitary hormone deficiency, combined, 6, MIM# 613986, Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125, Otocephaly-dysgnathia complex; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 OPA3 Chirag Patel reviewed gene: OPA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25159689, 31119193, 31928268; Phenotypes: 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR, Optic atrophy 3 with cataract (MIM#165300), AD; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6248 OCLN Chirag Patel reviewed gene: OCLN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20727516, 32240828, 29192239, 28386946; Phenotypes: Pseudo-TORCH syndrome 1, MIM#251290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6245 ERCC8 Bryony Thompson reviewed gene: ERCC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301516; Phenotypes: Cockayne syndrome type 1 MONDO:0019569; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6242 ERCC6L2 Bryony Thompson reviewed gene: ERCC6L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36790458; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6242 ERCC6 Bryony Thompson Phenotypes for gene: ERCC6 were changed from to Cockayne spectrum with or without cerebrooculofacioskeletal syndrome MONDO:0100506
Intellectual disability syndromic and non-syndromic v0.6236 ERCC2 Bryony Thompson Phenotypes for gene: ERCC2 were changed from xeroderma pigmentosum group D MONDO:0010212 to xeroderma pigmentosum group D MONDO:0010212; trichothiodystrophy 1, photosensitive MONDO:0011125; cerebrooculofacioskeletal syndrome 2 MONDO:0012553
Intellectual disability syndromic and non-syndromic v0.6228 ELOVL4 Bryony Thompson Phenotypes for gene: ELOVL4 were changed from to congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760
Intellectual disability syndromic and non-syndromic v0.6222 DIAPH1 Bryony Thompson reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39076976, 24781755, 26463574, 33662367; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ERCC6L2 Ken Lee Wan reviewed gene: ERCC6L2: Rating: AMBER; Mode of pathogenicity: None; Publications: 24507776, 27185855, 28815563, 29633571; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ERCC3 Ken Lee Wan reviewed gene: ERCC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group B MONDO:0012531; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ERCC2 Ken Lee Wan reviewed gene: ERCC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group D MONDO:0010212, trichothiodystrophy 1, photosensitive MONDO:0011125, cerebrooculofacioskeletal syndrome 2 MONDO:0012553; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 EP300 Ken Lee Wan changed review comment from: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature, and intellectual disability (https://search.clinicalgenome.org/CCID:004751).

Mechanism of disease: loss of function; to: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature and intellectual disability (https://search.clinicalgenome.org/CCID:004751).

Mechanism of disease: loss of function
Intellectual disability syndromic and non-syndromic v0.6222 EP300 Ken Lee Wan reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rubinstein-Taybi syndrome MONDO:0019188; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ELOVL4 Ken Lee Wan reviewed gene: ELOVL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 37592902; Phenotypes: congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 IFT172 Sangavi Sivagnanasundram reviewed gene: IFT172: Rating: AMBER; Mode of pathogenicity: None; Publications: 24290075, 26763875; Phenotypes: Bardet-Biedl syndrome MONDO:0015229; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 IFIH1 Sangavi Sivagnanasundram changed review comment from: ID is a prominent feature of this condition in most cases and those affected will likely have severe intellectual and physical disability.

GoF is the mechanism of disease.; to: ID is a prominent feature of this condition in most cases and those affected will likely have severe intellectual and physical disability.

GoF is the mechanism of disease.

Classified as DEFINITIVE by ClinGen's Leukodystrophy and Leukoencephalopathy GCEP on 23/08/2024 - https://search.clinicalgenome.org/CCID:008354
Intellectual disability syndromic and non-syndromic v0.6222 IFIH1 Sangavi Sivagnanasundram reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 20301648, 25620204; Phenotypes: IFIH1-related type 1 interferonopathy MONDO:0700262; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6222 ERCC6 Mark Cleghorn reviewed gene: ERCC6: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301516; Phenotypes: Cockayne syndrome type B, Cerebrooculofacioskeletal syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 IDUA Sangavi Sivagnanasundram reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301341; Phenotypes: mucopolysaccharidosis type 1 MONDO:0001586; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 IDH2 Sangavi Sivagnanasundram reviewed gene: IDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20847235, 35359529; Phenotypes: mitochondrial disease MONDO:0044970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.6222 HTRA2 Sangavi Sivagnanasundram reviewed gene: HTRA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27208207, 27696117, 30114719, 32445293; Phenotypes: 3-methylglutaconic aciduria type 8 MONDO:0044723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HSPD1 Sangavi Sivagnanasundram reviewed gene: HSPD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 18571143, 27405012; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM #612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HSD17B10 Sangavi Sivagnanasundram reviewed gene: HSD17B10: Rating: GREEN; Mode of pathogenicity: None; Publications: 22132097, 17618155; Phenotypes: HSD10 mitochondrial disease MONDO:0010327; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6222 HPD Sangavi Sivagnanasundram reviewed gene: HPD: Rating: AMBER; Mode of pathogenicity: None; Publications: 31537781; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HMGCL Sangavi Sivagnanasundram reviewed gene: HMGCL: Rating: AMBER; Mode of pathogenicity: None; Publications: 36771238, 35646072; Phenotypes: 3-hydroxy-3-methylglutaric aciduria MONDO:0009520; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HLCS Sangavi Sivagnanasundram reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: 18974016, 18429047, 12124727; Phenotypes: holocarboxylase synthetase deficiency MONDO:0009666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HIBCH Sangavi Sivagnanasundram reviewed gene: HIBCH: Rating: GREEN; Mode of pathogenicity: None; Publications: 24299452, 30847210, 17160907, 26163321, 26026795, 31523596, 32022391, 24299452, 32677093; Phenotypes: 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603, Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HEXB Sangavi Sivagnanasundram reviewed gene: HEXB: Rating: GREEN; Mode of pathogenicity: None; Publications: 35420740; Phenotypes: Sandhoff disease MONDO:0010006; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HEXA Sangavi Sivagnanasundram reviewed gene: HEXA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301397; Phenotypes: Tay-Sachs disease MONDO:0010100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HESX1 Sangavi Sivagnanasundram reviewed gene: HESX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 19623216, 30888394; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HEPACAM Sangavi Sivagnanasundram reviewed gene: HEPACAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 21419380, 24202401, 27389245, 31372844, 21419380, 24202401, 27322623; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490, Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HCCS Sangavi Sivagnanasundram reviewed gene: HCCS: Rating: AMBER; Mode of pathogenicity: None; Publications: 18950397; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6222 HADHA Sangavi Sivagnanasundram reviewed gene: HADHA: Rating: AMBER; Mode of pathogenicity: None; Publications: 36063482; Phenotypes: long chain 3-hydroxyacyl-CoA dehydrogenase deficiency MONDO:0012173; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GTF2H5 Sangavi Sivagnanasundram reviewed gene: GTF2H5: Rating: AMBER; Mode of pathogenicity: None; Publications: 30359777, 24986372; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GRM1 Sangavi Sivagnanasundram reviewed gene: GRM1: Rating: AMBER; Mode of pathogenicity: None; Publications: 26308914, 22901947, 31319223, 36675067; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GNS Sangavi Sivagnanasundram reviewed gene: GNS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31536183, 25851924, 17998446, 6450420; Phenotypes: mucopolysaccharidosis type 3D MONDO:0009658; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GNPTAB Sangavi Sivagnanasundram reviewed gene: GNPTAB: Rating: ; Mode of pathogenicity: None; Publications: 20301728; Phenotypes: GNPTAB-mucolipidosis MONDO:0100122; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GNPAT Sangavi Sivagnanasundram reviewed gene: GNPAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843043, 19270340, 21990100; Phenotypes: glyceronephosphate O-acyltransferase deficiency MONDO:0100273; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GMPPB Sangavi Sivagnanasundram reviewed gene: GMPPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23768512, 26133662, 27147698; Phenotypes: myopathy caused by variation in GMPPB MONDO:0700084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GMPPA Sangavi Sivagnanasundram reviewed gene: GMPPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 31898852, 35607266; Phenotypes: alacrima, achalasia, and intellectual disability syndrome MONDO:0014219; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GM2A Sangavi Sivagnanasundram reviewed gene: GM2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33819415, 20301397; Phenotypes: Tay-Sachs disease AB variant MONDO:0010099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6219 DIAPH1 Zornitza Stark reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6219 EIF2AK3 Ken Lee Wan reviewed gene: EIF2AK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20202148; Phenotypes: Wolcott-Rallison syndrome MONDO:0009192; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6219 DYNC1H1 Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to dyneinopathy MONDO:1040031
Intellectual disability syndromic and non-syndromic v0.6217 DYNC1H1 Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism.

Mechanism of disease: gain of function
(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112)
Intellectual disability syndromic and non-syndromic v0.6215 DIAPH1 Ken Lee Wan changed review comment from: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development, and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632).

Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).; to: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632).

Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).
Intellectual disability syndromic and non-syndromic v0.6214 DNMT3B Ken Lee Wan changed review comment from: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692).

Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860).

Mechanism of disease: loss of function; to: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692).

Immunodeficiency, centromeric instability and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9 and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860).

Mechanism of disease: loss of function
Intellectual disability syndromic and non-syndromic v0.6214 DYNC1H1 Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112)
Intellectual disability syndromic and non-syndromic v0.6214 DYNC1H1 Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM#600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112)
Intellectual disability syndromic and non-syndromic v0.6214 DYNC1H1 Ken Lee Wan reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: dyneinopathy MONDO:1040031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6213 DNAJC19 Zornitza Stark Phenotypes for gene: DNAJC19 were changed from 3-methylglutaconic aciduria type 5 MONDO:0012435 to 3-methylglutaconic aciduria type 5 MONDO:0012435
Intellectual disability syndromic and non-syndromic v0.6212 DNAJC19 Zornitza Stark Phenotypes for gene: DNAJC19 were changed from to 3-methylglutaconic aciduria type 5 MONDO:0012435
Intellectual disability syndromic and non-syndromic v0.6207 DNMT3B Ken Lee Wan reviewed gene: DNMT3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6207 DNAJC19 Ken Lee Wan reviewed gene: DNAJC19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria type 5 MONDO:0012435; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6207 DIS3L2 Ken Lee Wan changed review comment from: Perlman syndrome is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649)

Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000).

PMID 16278893: 6 out of 22 patients have developmental delay

PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay.

PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay

Mechanism of disease causation: loss of function; to: DIS3L2 is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649)

Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000).

PMID 16278893: 6 out of 22 patients have developmental delay

PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay.

PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay

Mechanism of disease causation: loss of function
Intellectual disability syndromic and non-syndromic v0.6207 DIS3L2 Ken Lee Wan reviewed gene: DIS3L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16278893, 22306653, 28328139; Phenotypes: Perlman syndrome MONDO:0009965; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6207 DIAPH1 Ken Lee Wan reviewed gene: DIAPH1: Rating: AMBER; Mode of pathogenicity: None; Publications: 24781755, 26463574; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6206 RBSN Zornitza Stark reviewed gene: RBSN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6205 RNU2-2P Zornitza Stark gene: RNU2-2P was added
gene: RNU2-2P was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU2-2P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Phenotypes for gene: RNU2-2P were set to Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related
Review for gene: RNU2-2P was set to GREEN
Added comment: 15 individuals reported with de novo, recurrent variants in this gene at nucleotide positions 4 and 35. The disorder is characterized by intellectual disability, neurodevelopmental delay, autistic behavior, microcephaly, hypotonia, epilepsy and hyperventilation. All cases display a severe and complex seizure phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6195 CEP76 Mark Cleghorn gene: CEP76 was added
gene: CEP76 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038; Joubert syndrome; Bardet-Biedl syndrome; retinitis pigmentosa
Penetrance for gene: CEP76 were set to unknown
Review for gene: CEP76 was set to GREEN
Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago
ESHG presentation 4/6/24, unpublished

CEP76 associated with syndromic ciliopathy

CEP76 localizes to centrioles and basal body primary cilia
Role in normal centriolar duplication

Index case
Bardet Biedl syndrome
Compound heterozygous pLoF variants in CEP76

Via Gene matcher
7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum:
Obesity
Ocular phenotype
Structural brain anomalies
Renal?

3/7 families clinical Dx Joubert syndrome
1/7 BBS
1/7 GDD/ID NOS
2/7 retinitis pigmentosa (1 of these with learning difficulties)

Mixture of biallelic pLOF and missense variant

CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant

Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6195 EIF3I Mark Cleghorn gene: EIF3I was added
gene: EIF3I was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EIF3I were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: EIF3I were set to unknown
Review for gene: EIF3I was set to AMBER
Added comment: Marcello Scala, Genoa
ESHG presentation 4/6/24, unpublished

De novo EIF3I missense variants as a cause for novel NDD syndrome

EIF3 complex involved in regulating initiation of mRNA translation
Negative regulator of the TGF beta pathway

8 individuals from 8 families
Mod/severe GDD or ID
Short stature
Midline brain anomalies (hypoplasia/agenesis of corpus callosum and pituitary hypoplasia)
Frontal bossing, hypertelorism, long philtrum
All w rare de novo missense variants om EIF3I, clustering within highly conserved WD repeats

Functional studies
Transfected HEK293 cell studies suggested EIF3I protein from variant alleles (from patients above) had disrupted interaction with other EIF subunits, and cells had reduced protein synthesis overall
No animal models
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6191 DDHD2 Bryony Thompson reviewed gene: DDHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23486545, 23176823, 36090575, 26113134, 25417924; Phenotypes: hereditary spastic paraplegia 54 MONDO:0014018; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6189 DDC Bryony Thompson reviewed gene: DDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 37824694; Phenotypes: Aromatic L-amino acid decarboxylase deficiency MONDO:0012084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6189 FKBP4 Mark Cleghorn gene: FKBP4 was added
gene: FKBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: FKBP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FKBP4 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: FKBP4 were set to unknown
Review for gene: FKBP4 was set to AMBER
Added comment: Rebecca Yarwood, University of Manchester
ESHG presentation 4/6/24, unpublished

Bilalleic FKBP4 w NDD + DSD
Protein has functions in hormone receptor trafficking
FKPB4 highly expressed in stem cell and progenitor cells in gonad and neuronal degeneration

Index case
Severe GDD
abN external genitalia
CV AbN
FBBP4 p.E196*

Via GeneMatcher
7 families (12 individuals)

12/12 severe GDD/ID
9/10 microcephaly
11/12 external genital abnormalities (details not provided)

All w homozygous pLoF variants (mixture of canonical splice, frameshift, nonsense)
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6188 MED16 Mark Cleghorn gene: MED16 was added
gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: MED16 were set to unknown
Review for gene: MED16 was set to GREEN
Added comment: MED16
Charlotte Guillouet, Imagine institute Paris
ESHG presentation 4/6/24, unpublished

MED16 is part of tail of ‘mediator complex’
Plays a role in enhancer/promotor regions

Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders

Cases
index family
Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly
WES: biallelic MED16 p.Asp217Asn

Via genematcher
16 families total, 22 individuals, homozygous or compound het rare MED16 variants
Mixture of pLoF and missense variants

Motor delay in 16/17
DD or ID in 17/17
Speech delay in 15/15
6/19 ToF
7/19 other septal/aortic defects
6/18 deafness
11/18 microretognathia
6/17 cleft palate
8/19 preauricular tags
9/20 puffy eyelids
12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip)
7/20 corpus callosum anomalies

Not clear that functional work recapitulated phenotype as yet?
Immunofluroescence on HeLa cells transfected with variants observed ?conclusion
MED16 knockout mouse > growth delay, pre weaning lethality
MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6188 LARS2 Chirag Patel reviewed gene: LARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29205794, 32423379, 30737337, 26537577, 23541342; Phenotypes: Perrault syndrome 4, MIM# 615300, Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 LARGE1 Chirag Patel reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 12966029, 19067344, 17436019, 21248746, 19299310; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 LAMP2 Chirag Patel reviewed gene: LAMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 10972294; Phenotypes: Danon disease, MIM# 300257, MONDO:0010281; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 PARN Chirag Patel reviewed gene: PARN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25893599, 26342108; Phenotypes: Dyskeratosis congenita, autosomal recessive 6, MIM# 616353; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 PAX6 Chirag Patel reviewed gene: PAX6: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 26130484, 31700164; Phenotypes: Microphthalmia/coloboma 12, OMIM #120200; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6188 PAX8 Chirag Patel reviewed gene: PAX8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33272083, 9590296 11232006 15356023 15718293; Phenotypes: Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 PC Chirag Patel reviewed gene: PC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9585612, 12112657; Phenotypes: Pyruvate carboxylase deficiency - MIM#266150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6185 SLC6A3 Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6182 SRD5A3 Zornitza Stark reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323; Phenotypes: Congenital disorder of glycosylation, type Iq, MIM#612379, Kahrizi syndrome, MIM# 612713; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6179 SLC6A8 Zornitza Stark reviewed gene: SLC6A8: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 16738945; Phenotypes: Cerebral creatine deficiency syndrome 1, MIM# 300352; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6179 SPTBN2 Zornitza Stark Mode of inheritance for gene: SPTBN2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6178 SPTBN2 Zornitza Stark reviewed gene: SPTBN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23236289, 23838597, 22781464, 31617442, 31066025; Phenotypes: Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386, Spinocerebellar ataxia 5, MIM# 600224; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6175 ST3GAL3 Zornitza Stark reviewed gene: ST3GAL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23252400, 21907012, 31584066, 37938134; Phenotypes: Intellectual disability, autosomal recessive 12 MIM# 611090; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6175 SUCLG1 Zornitza Stark Phenotypes for gene: SUCLG1 were changed from Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400
Intellectual disability syndromic and non-syndromic v0.6174 SUCLG1 Zornitza Stark Phenotypes for gene: SUCLG1 were changed from to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400
Intellectual disability syndromic and non-syndromic v0.6170 SUCLG1 Zornitza Stark reviewed gene: SUCLG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33230783, 28358460; Phenotypes: Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6167 SURF1 Zornitza Stark reviewed gene: SURF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843204, 9837813; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6167 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Intellectual disability syndromic and non-syndromic v0.6163 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6158 TSEN2 Zornitza Stark reviewed gene: TSEN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23562994, 20952379; Phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6155 TTC19 Zornitza Stark changed review comment from: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances.

At least 4 unrelated families reported.; to: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances.

Included due to phenotypic overlap.

At least 4 unrelated families reported.
Intellectual disability syndromic and non-syndromic v0.6155 TTC19 Zornitza Stark reviewed gene: TTC19: Rating: GREEN; Mode of pathogenicity: None; Publications: 21278747, 23532514, 24368687, 24397319; Phenotypes: Mitochondrial complex III deficiency, nuclear type 2, MIM#615157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6153 TUBA1A Zornitza Stark reviewed gene: TUBA1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly 3, MIM# 611603; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6152 ZNRF3 Bryony Thompson gene: ZNRF3 was added
gene: ZNRF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNRF3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNRF3 were set to 39168120
Phenotypes for gene: ZNRF3 were set to Complex neurodevelopmental disorder MONDO:0100038
Review for gene: ZNRF3 was set to GREEN
Added comment: 12 individuals with ZNRF3 variants and various phenotypes. 8 individuals with de novo missense and neurodevelopment disorders (NDD), including cluster of variants in the RING ligase domain with macrocephalic NDD. Plus 4 individuals from 3 families with de novo truncating or de novo/inherited large in-frame deletion variants with non-NDD phenotypes, including heart, adrenal, or nephrotic problems. Overall, 4 individuals had congenital heart defects and 2 had microcephaly. Also, supporting in vitro functional assays.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6144 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6143 DARS2 Zornitza Stark Phenotypes for gene: DARS2 were changed from to Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105
Intellectual disability syndromic and non-syndromic v0.6134 GPN2 Mark Cleghorn gene: GPN2 was added
gene: GPN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: GPN2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPN2 were set to complex neurodevelopmental disorder MONDO:0100038; Perrault syndrome
Review for gene: GPN2 was set to AMBER
Added comment: GPN2
ESHG talk 2/6/24, unpublished
Thomas Smith, University of Manchester

Biallelic GPN2 proposed to cause Perrault syndrome (SNHL, ovarian dysfunction, NDD)
RNA polymerase assembly factor

4 families (14 affected individuals) w biallalic GPN2 rare missense variants
Segregated w phenotype
Fam 2 and 3 may be distantly related (leaving 3 distinct kindreds)

Clinical features
13/14 SNHL
3/4 families all females of adolescent age or older had primary ovarian insufficiency
4/4 GDD, ataxia (no data on family w 10 affected indiv.)

Some functional work, not conclusive
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6134 ATP6V1C1 Zornitza Stark gene: ATP6V1C1 was added
gene: ATP6V1C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP6V1C1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V1C1 were set to 39210597
Phenotypes for gene: ATP6V1C1 were set to neurodevelopmental disorder MONDO:0700092, ATP6V1C1-related
Review for gene: ATP6V1C1 was set to RED
Added comment: 1x de novo missense p.Glu289Lys (absent in v4 gnomad). Manual inspection of IGV found the dad was mosaic 7% VAF and he shared some of the clinical features (minor digit anomalies). Some functional studies using patient fibroblasts were performed, demonstrating similar effects as known pathogenic variants in ATP6V1B2. - lysosomal morphology - autophagic flux dysregulation - increased acidification of lysosome borderline red/amber
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6127 RFC4 Chirag Patel gene: RFC4 was added
gene: RFC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RFC4 were set to PMID: 39106866
Phenotypes for gene: RFC4 were set to RFC4-related multisystem disorder
Review for gene: RFC4 was set to GREEN
gene: RFC4 was marked as current diagnostic
Added comment: 9 affected individuals (aged birth to 47yrs) from 8 unrelated families with a multisystem disorder. Clinical features included: muscle weakness/myopathy (9/9), motor incoordination/gait disturbance (8/8), delayed gross motor development (6/9), dysarthria (5/5), peripheral neuropathy (3/3 adults), bilateral sensorineural hearing impairment (6/9), decreased body weight (8/9), short stature (5/9), microcephaly (4/9), respiratory issues/insufficiency (6/9), cerebellar atrophy (4/9), pituitary hypoplasia (3/9).

WES or WGS identified biallelic loss-of-function variants in RFC4 (3 frameshift, 2 splice site, 1 single AA duplication, 2 single AA deletions, 2 missense), and almost all are likely to disrupt the C-terminal domain indispensable for Replication factor C (RFC) complex formation. All variants segregated with the disease.

The RFC complex (with 5 subunits) is central to process of regulation of DNA replication, and it loads proliferating cell nuclear antigen onto DNA to facilitate the recruitment of replication and repair proteins and enhance DNA polymerase processivity. RFC1 is associated with CANVAS but the contributions of RFC2-5 subunits on human Mendelian disorders is unknown.

Analysis of a previously determined cryo-EM structure of RFC bound to proliferating cell nuclear antigen suggested that the variants disrupt interactions within RFC4 and/or destabilize the RFC complex. Cellular studies using RFC4-deficient HeLa cells and primary fibroblasts demonstrated decreased RFC4 protein, compromised stability of the other RFC complex subunits, and perturbed RFC complex formation. Additionally, functional studies of the RFC4 variants affirmed diminished RFC complex formation, and cell cycle studies suggested perturbation of DNA replication and cell cycle progression.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6126 LARP1 Sangavi Sivagnanasundram gene: LARP1 was added
gene: LARP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: LARP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LARP1 were set to 39182167
Phenotypes for gene: LARP1 were set to Neurodevelopmental disorder; MONDO:0700092
Review for gene: LARP1 was set to GREEN
Added comment: Seven unrelated probands (6 males and 1 female) with ASD or another variable NDD phenotype (ID, hypotonia, motor delay and/or ASD). Variants were showed to be de novo null variants or missense variants that resulted in haploinsufficiency.

Ex vivo (knockout CRISPR-Cas9) functional assay using lymphoblasts that was collected and immortilised from one proband was conducted to assess the functional impact of the LARP1 variant. The results showed a reduction in protein compared to WT causing reduced rates of aerobic respiration and glycolysis
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6124 PNPLA8 Chirag Patel gene: PNPLA8 was added
gene: PNPLA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PNPLA8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PNPLA8 were set to PMID: 39082157
Phenotypes for gene: PNPLA8 were set to PNPLA8-related neurological diseases
Review for gene: PNPLA8 was set to GREEN
gene: PNPLA8 was marked as current diagnostic
Added comment: Cohort analysis of clinical features of new and previously reported individuals with biallelic PNPLA8 variants (25 affected individuals across 20 families). They showed that PNPLA8-related neurological diseases manifest as a continuum ranging from variable developmental and/or degenerative epileptic-dyskinetic encephalopathy to childhood-onset neurodegeneration. Complete loss of PNPLA8 was associated with the more profound end of the spectrum. 13/19 individuals (info available) had developmental delay and/or severe intellectual disability.

Using cerebral organoids generated from human induced pluripotent stem cells, they found that loss of PNPLA8 led to developmental defects by reducing the number of basal radial glial cells and upper-layer neurons. Neural progenitor cells lacking PNPLA8 showed a reduced amount of lysophosphatidic acid, lysophosphatidylethanolamine and phosphatidic acid. They show that PNPLA8 is crucial to meet phospholipid synthetic needs and to produce abundant basal radial glial cells in human brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6123 MED22 Mark Cleghorn gene: MED22 was added
gene: MED22 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: MED22 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MED22 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: MED22 were set to unknown
Review for gene: MED22 was set to AMBER
Added comment: ESHG talk 2/6/24, unpublished
Elisa Cali, UCL

Recurrent homozygous MED22:c.397_399del (p.Glu133del) inframe variant in 8 individuals from 6 families w progressive NDD, microcepahly, cerebellar atrophy, dystonia, seizures

Rare in gnomad v4.1 (9 het alleles, no homozygotes)

Functional work on patient fibroblasts: quantity of protein comparable to controls, did not mentioned assays of protein function (?mechanism proposed)
Drosophilia heterozygous model with equivalent of p.Glu133del variant: structural anomalies, less movements, all died prior to pupae stage
Zebrafish: MED22 mutants less mobile, died prior to adulthood, reduced brain size
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 BICRA Mark Cleghorn reviewed gene: BICRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Siris syndrome-12, MIM#619325; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6123 SF3B1 Mark Cleghorn gene: SF3B1 was added
gene: SF3B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: SF3B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SF3B1 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: SF3B1 were set to unknown
Review for gene: SF3B1 was set to AMBER
Added comment: SF3B1
Delphine Bernard, University of Brest
ESHG talk 2/6/24, unpublished

De novo germline SF3B1 variants, proposed spliceosomopathy/NDD gene

SF3B1 is an RNA binding protein that stabilizes the U2 snRNP complex at branchpoint sequences
Somatic SF3B1 missense commonly occur in haematological malignancy (K700E recurrent)

25 patients with syndromic NDD + de novo heterozygous rare SF3B1 variants identified on WES, genematcher
13 missense (incl recurrent xxx and xxx) within HEAT domain
5 nonsense
4 splicing
1 frameshift

Patients w missense variants may have more severe phenotype incl mircocepahly, palate anomalies, cerebral anomalies, GI/cardiac anomalies

Cellular models of missense variants: erythroluekaemia K562, HEK293T
Suggest missense variants do not cause loss of function, but increase exon skipping and alternative 3’ splice sites
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 C12orf66 Mark Cleghorn gene: C12orf66 was added
gene: C12orf66 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: C12orf66 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C12orf66 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: C12orf66 were set to unknown
Review for gene: C12orf66 was set to AMBER
Added comment: KICS2 (previously known as C12ORF66)
Rebecca Buchert, Universitatklinikum Tubingen
ESHG talk 2/6/24, unpublished

Proposed ID + epilepsy gene

8 families w 11 affected individuals
Phenotypes: 11/11 ID, 9/11 epilepsy, 3/11 hearing impairment
3/8 homozygous missense variants (p.Asp296Glu, p.Tyr393Cys, p.Tyr393Cys), all highly conserved
1/8 compound het PTC (p.Lys262*) with 1.1Mb deletion
4/8 homozygous PTC (p.Glu3*, p.Gly79Valfs*18, p.Gly79Valfs*18, p.Lys260Asnfs*18)

Gene appears to be involved in mTOR pathway, and cilia function
mTORC1 activity in CRISPR-HEK293T cells – reduced activity in cells w variants above

Zebrafish model: otolith defects, ciliary dysfunction
?not clear if truly mimics phenotype observed in patient cohort described
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 REPS2 Mark Cleghorn gene: REPS2 was added
gene: REPS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: REPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: REPS2 were set to complex neurodevelopmental disorder MONDO:0100038; Cerebral palsy HP:0100021
Penetrance for gene: REPS2 were set to unknown
Review for gene: REPS2 was set to AMBER
Added comment: REPS2
Hao Hu, Guangzhou Women and Children’s MC
ESHG talk 1/6/24, unpublished

Proposed X-linked cerebral palsy + NDD gene

4 unrelated males with predicted deleterious hemizygous REPS2 variants, 2 PTC, 2 missense. 2 de novo, 2 maternally inherited
Phenotypes: 2 w CP + moderate ID/ASD, 2 w NDD NOS
Variants described:
c.1050_1052delGAA;p.K351del
c.1040T>C; p.I347T
c.962C>G; p.S321C
c.1736delA; p.N579Tfs*17

In vitro assay of above 4 variants suggest reduced REPS2 protein stability
Zebrafish model: REPS2 expressed in neuronal cells, REPS2 knock down have reduced motor activity and abN neuronal morphology
Mouse model hemizygous w one of above variants (not specified): reduced performance in cognitive tasks, abnormal neuronal migration pattern on post mortem examination
Mechanism may relate to dopamine signalling?
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 TTL Mark Cleghorn gene: TTL was added
gene: TTL was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: TTL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTL were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: TTL was set to AMBER
Added comment: TTL
Valentina Serpieri, University of Pavia
ESHG talk 1/6/24

FAM1 (Italy)
2 affected sisters born to consanguineous Pakistani parents
GDD, spastic tetraparesis, optic atrophy, brain anomalies resembling tubulinopathies (dysplasia of corpus callosum, basal ganglia, brainstem)
WES: homozygous TTL:c.1013G>A; p.Cys338Tyr in both affected sisters

Via genematcher
5 more families (9 individuals) w similar phenotypes and biallelic variants in TTL

FAM2 (Egypt): homozygous p.Arg46Pro
FAM3 (Egypt): homozygous p.Arg46Pro
FAM4 (Australia): homozygous p.Gln183Arg
FAM5 (France): homozygous p.Trp147*
FAM6 (Saudi Arabia): homozygous p.His243Tyr

TTL KO mice: death soon after birth, no overt malformations, but defects in organisation of cerebral layers

Functional work on patient fibroblasts
FAM1 – reduced quantity of TTL protein compared to control on Western blot, decreased function of TTL protein (increase in detyrosinated tubulin) compared to controls – infer LoF as mechanism
FAM3 – mentioned but no details
FAM4– mentioned but no details
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 DHTKD1 Sumudu Perera reviewed gene: DHTKD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 23141293, 37499576, 1112064, 6434826, 4442872, 4430147; Phenotypes: 2-aminoadipic 2-oxoadipic aciduria MIM#204750, Disorders of histidine, tryptophan or lysine metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6123 DCX Sumudu Perera edited their review of gene: DCX: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.6123 DARS2 Sumudu Perera reviewed gene: DARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17384640, 21815884, 20506600; Phenotypes: Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6123 DCX Sumudu Perera changed review comment from: Pathology:
PMID: 26743950 - DCX mutations usually cause anterior dominant lissencephaly in males and subcortical band heterotopia (SBH) in females

Phenotype:
Demelas et al. (2001) (PMID:11468322) demonstrated three brothers with phenotype of microcephaly, mild to moderate developmental delay, seizures and other neurologic abnormalities, as well as classic lissencephaly on MRI.

Lawrence et al. (2010) (PMID: 20726879) discuss 3 male members had severe epilepsy and intellectual disability; finding of missense mutation in DCX. Of note all 3 had been diagnosed with Lennox-Gastaut syndrome.

GeneReviews (PMID: 20301364): "Males with classic DCX-related lissencephaly typically have early and profound cognitive and language impairment, cerebral palsy, and epileptic seizures. The clinical phenotype in females with SBH varies widely with cognitive abilities that range from average or mild cognitive impairment to severe intellectual disability and language impairment."

Other papers:
1) Somatic mosaicism and variable penetrance - PMID: 12552055
2) Functional testing: PMID: 9489699; to: Pathology:
PMID: 26743950 - DCX mutations usually cause anterior dominant lissencephaly in males and subcortical band heterotopia (SBH) in females

Phenotype:
Demelas et al. (2001) (PMID:11468322) demonstrated three brothers with phenotype of microcephaly, mild to moderate developmental delay, seizures and other neurologic abnormalities, as well as classic lissencephaly on MRI.

Lawrence et al. (2010) (PMID: 20726879) discuss 3 male members had severe epilepsy and intellectual disability; finding of missense mutation in DCX. Of note all 3 had been diagnosed with Lennox-Gastaut syndrome.

GeneReviews (PMID: 20301364): "Males with classic DCX-related lissencephaly typically have early and profound cognitive and language impairment, cerebral palsy, and epileptic seizures. The clinical phenotype in females with SBH varies widely with cognitive abilities that range from average or mild cognitive impairment to severe intellectual disability and language impairment."

Other papers:
1) Somatic mosaicism and variable penetrance - PMID: 12552055
2) Functional testing: PMID: 9489699
Intellectual disability syndromic and non-syndromic v0.6123 DCX Sumudu Perera reviewed gene: DCX: Rating: ; Mode of pathogenicity: None; Publications: 26743950, 11468322, 20726879, 20301364, 12552055, 9489699; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6123 D2HGDH Sumudu Perera reviewed gene: D2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 15609246, 16081310, 31349060, 20020533, 38825343; Phenotypes: D-2-hydroxyglutaric aciduria MIM#600721; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6123 GTPBP1 Zornitza Stark Phenotypes for gene: GTPBP1 were changed from Neurodevelopmental disorder (MONDO#0700092), GTPBP1-related to Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888
Intellectual disability syndromic and non-syndromic v0.6122 GTPBP1 Zornitza Stark reviewed gene: GTPBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6122 CSNK1G1 Rylee Peters reviewed gene: CSNK1G1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 33009664; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CSNK1G-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6121 CSMD1 Krithika Murali gene: CSMD1 was added
gene: CSMD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD1 were set to PMID 38816421
Phenotypes for gene: CSMD1 were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: CSMD1 was set to GREEN
Added comment: PMID 38816421 Werren et al 2024 report 8 individuals from 6 families with biallelic missense CSMD1 variants identified through exome sequencing and subsequent gene-sharing efforts. Shared phenotypic features included: GDD, ID, microcephaly and polymicrogyria. Other features included dysmorphism, IUGR, hypotonia, arthrogryposis, seizures, opthalmological anomalies and other brain white matter anomalies Heterozygous parents were unaffected.

Loss of function is the postulated mechanism based on experimental data involving early-stage forebrain organoids differentiated from CSMD1 knockout human embryonic stem cells. ClinGen haploinsufficiency score of 1, however, this curation was last reviewed in 2018. This gene is within the scope of review for the ClinGen Autisim and ID GCEP.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6120 ZSCAN10 Zornitza Stark reviewed gene: ZSCAN10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Otofacial neurodevelopmental syndrome, MIM# 620910; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6117 CTDP1 Zornitza Stark Phenotypes for gene: CTDP1 were changed from to congenital cataracts-facial dysmorphism-neuropathy syndrome MONDO:0011402
Intellectual disability syndromic and non-syndromic v0.6109 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from to Methemoglobinemia MONDO:0001117
Intellectual disability syndromic and non-syndromic v0.6102 SOX9 Zornitza Stark changed review comment from: Agree ID typically not part of the phenotype. Note reports of milder cases and DD/ID reported in some survivors, therefore downgraded to Amber.; to: Agree ID typically not part of the phenotype. Note reports of milder cases and DD/ID reported in some survivors (this publication suggests >80%), therefore downgraded to Amber.
Intellectual disability syndromic and non-syndromic v0.6102 SOX9 Zornitza Stark reviewed gene: SOX9: Rating: AMBER; Mode of pathogenicity: None; Publications: 21373255; Phenotypes: campomelic dysplasia MONDO:0007251; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6101 GLS Zornitza Stark Phenotypes for gene: GLS were changed from Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412 to Epileptic encephalopathy, early infantile, 71, MIM# 618328; Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412
Intellectual disability syndromic and non-syndromic v0.6100 GLS Zornitza Stark Mode of inheritance for gene: GLS was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6099 SOX9 Ken Lee Wan reviewed gene: SOX9: Rating: RED; Mode of pathogenicity: None; Publications: 20301724, 26663529; Phenotypes: campomelic dysplasia MONDO:0007251; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6097 TBC1D7 Zornitza Stark edited their review of gene: TBC1D7: Added comment: PMID: 36669495 reports additional individuals with compound het variants identified via trio RNASeq.; Changed rating: GREEN; Changed publications: 24515783, 23687350, 36669495
Intellectual disability syndromic and non-syndromic v0.6096 CYB5R3 Ken Lee Wan reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 38303731; Phenotypes: Methemoglobinemia MONDO:0001117; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6096 CTSD Ken Lee Wan reviewed gene: CTSD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neuronal ceroid lipofuscinosis MONDO:0016295; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6096 CTSA Ken Lee Wan reviewed gene: CTSA: Rating: GREEN; Mode of pathogenicity: None; Publications: 23915561, 36713078; Phenotypes: Galactosialidosis MONDO:0009737; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6096 CTDP1 Ken Lee Wan reviewed gene: CTDP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301787; Phenotypes: congenital cataracts-facial dysmorphism-neuropathy syndrome MONDO:0011402; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6096 HDAC3 Zornitza Stark edited their review of gene: HDAC3: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, HDAC3-related
Intellectual disability syndromic and non-syndromic v0.6093 HDAC3 Zornitza Stark gene: HDAC3 was added
gene: HDAC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HDAC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HDAC3 were set to 39047730
Review for gene: HDAC3 was set to GREEN
Added comment: Six individuals with de novo missense variants in this gene and variable NDD phenotypes, including ID, seizures. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6090 SLC39A14 Zornitza Stark Phenotypes for gene: SLC39A14 were changed from to Hypermanganesemia with dystonia 2 (MIM# 617013)
Intellectual disability syndromic and non-syndromic v0.6089 COQ8A Ken Lee Wan reviewed gene: COQ8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31621627, 31741144; Phenotypes: coenzyme Q10 deficiency MONDO:0018151; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6085 COQ4 Zornitza Stark Phenotypes for gene: COQ4 were changed from Coenzyme Q10 deficiency, primary, 7, MIM# 616276; neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562 to Coenzyme Q10 deficiency, primary, 7, MIM# 616276; neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562
Intellectual disability syndromic and non-syndromic v0.6084 COQ4 Zornitza Stark Phenotypes for gene: COQ4 were changed from Coenzyme Q10 deficiency, primary, 7, MIM# 616276 to Coenzyme Q10 deficiency, primary, 7, MIM# 616276; neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562
Intellectual disability syndromic and non-syndromic v0.6081 COQ4 Ken Lee Wan reviewed gene: COQ4: Rating: GREEN; Mode of pathogenicity: None; Publications: 34656997; Phenotypes: mitochondrial disease MONDO:0044970, neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6081 COL4A2 Ken Lee Wan reviewed gene: COL4A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36324412, 39016117; Phenotypes: familial porencephaly MONDO:0020496; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6079 CLN8 Ken Lee Wan reviewed gene: CLN8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neuronal ceroid lipofuscinosis MONDO:0016295; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6078 LEO1 Zornitza Stark gene: LEO1 was added
gene: LEO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LEO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LEO1 were set to 38965372
Phenotypes for gene: LEO1 were set to neurodevelopmental disorder MONDO:0700092, LEO-1 related
Review for gene: LEO1 was set to AMBER
Added comment: cohort of individuals with delayed motor and speech development, ASD

8x de novo – 6x missense + 2x PTC
1x pat splice (father unaffected)
2x unknown_inh PTCs

Of the missense variants, G370E has 8 hets in gnomad v4

This gene is not constraint for LoF with 4 hets with an NMD variant in gnomad v4
3 of the missense are said to lie within a region of missense constraint, however this isn't the case in v4
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6077 CHD2 Zornitza Stark Phenotypes for gene: CHD2 were changed from Epileptic encephalopathy, childhood-onset (MIM # 615369) to Developmental and epileptic encephalopathy 94, MIM# 615369
Intellectual disability syndromic and non-syndromic v0.6075 CHD2 Zornitza Stark reviewed gene: CHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 94, MIM# 615369; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6075 CHD2 Ken Lee Wan reviewed gene: CHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26677509; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6074 RBBP5 Ain Roesley edited their review of gene: RBBP5: Changed phenotypes: neurodevelopmental disorder MONDO:0700092, RBBP5-related
Intellectual disability syndromic and non-syndromic v0.6073 PCBP2 Ain Roesley gene: PCBP2 was added
gene: PCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PCBP2 were set to 38965372
Phenotypes for gene: PCBP2 were set to neurodevelopmental disorder MONDO:0700092, PCBP2-related
Review for gene: PCBP2 was set to GREEN
gene: PCBP2 was marked as current diagnostic
Added comment: 3x individuals with de novo variants
Motor and speech delay and ASD
2x missense + 1x fs

There are 2 NMD variants with 9 and 8 hets respectively in gnomad v4, however the IGV looks to be low quality
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6070 SLC45A1 Zornitza Stark edited their review of gene: SLC45A1: Added comment: PMID 39003656: additional individual with compound het missense variants and supportive functional data.; Changed rating: GREEN; Changed publications: 28434495, 39003656
Intellectual disability syndromic and non-syndromic v0.6069 SRPK3 Zornitza Stark edited their review of gene: SRPK3: Changed publications: 39073169
Intellectual disability syndromic and non-syndromic v0.6068 SRPK3 Zornitza Stark gene: SRPK3 was added
gene: SRPK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRPK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: SRPK3 were set to 38429495; 39073169
Phenotypes for gene: SRPK3 were set to Neurodevelopmental disorder, MONDO:0700092, SRPK3-related
Review for gene: SRPK3 was set to GREEN
Added comment: PMID 39073169: 9 individuals from 5 unrelated families reported with 4 missense and 1 putative truncating variant and a neurodevelopmental phenotype. The 8 patients ascertained postnatally shared common clinical features including intellectual disability, agenesis of the corpus callosum, abnormal eye movement, and ataxia. A ninth case, ascertained prenatally, had a complex structural brain phenotype. Supportive animal model data (mouse and zebrafish).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6064 NDC1 Bryony Thompson gene: NDC1 was added
gene: NDC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDC1 were set to 39003500; 19782045
Phenotypes for gene: NDC1 were set to triple-A syndrome MONDO:0009279
Review for gene: NDC1 was set to GREEN
Added comment: 7 cases from 4 consanguineous families (3 different variants: 1 intronic variants that causes in-frame RNA splice impact, 2 missense) with a Triple-A-like syndrome (including ID and neuropathy). Supporting cellular localisation studies were conducted in patient cell lines with the splice variant. NDC1 is required to anchor ALADIN (encoded by AAAS, the gene that causes Triple-A syndrome) in the nuclear pore complex.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6063 SLC39A14 Kushani Jayasinghe reviewed gene: SLC39A14: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27231142, 29685658; Phenotypes: Hypermanganesemia with dystonia 2; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6062 CRNKL1 Mark Cleghorn gene: CRNKL1 was added
gene: CRNKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: CRNKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CRNKL1 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: CRNKL1 were set to Complete
Review for gene: CRNKL1 was set to GREEN
Added comment: Unpublished, presented at ESHG June 2024 - Louise Bicknell, University of Otago NZ
8 unrelated families via gene matcher with rare, de novo, missense variants in CRNKL1
severe microcephaly (all, -8 to -11 SD)
ID/epilepsy
pontocerebellar hypoplasia (6/8)
simplified gyration (8/8)
7 variants are missense at p.Arg267 residue
1 variant missense at p.Arg301
RNA-seq on patient fibroblasts - no alteration in gene expression
Zebrafish homolog of Arg267 and Arg301 - mimics observed phenotype (reduced brain development), increased in embryo apoptosis
RNQ seq on affected zebrafish embryos - transcriptome strongly disrupted
Splicing analysis in progress

CRKNL1 supports U6 structure in spliceosome
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6062 B9D1 Achchuthan Shanmugasundram reviewed gene: B9D1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 32622957; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6061 RNU4-2 Zornitza Stark edited their review of gene: RNU4-2: Changed publications: 38991538
Intellectual disability syndromic and non-syndromic v0.6060 FDXR Zornitza Stark Phenotypes for gene: FDXR were changed from Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717 to Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717
Intellectual disability syndromic and non-syndromic v0.6059 FDXR Zornitza Stark Phenotypes for gene: FDXR were changed from Auditory neuropathy and optic atrophy, MIM# 617717 to Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717
Intellectual disability syndromic and non-syndromic v0.6057 FDXR Zornitza Stark edited their review of gene: FDXR: Added comment: Multiple reports of individuals with extra-ocular features, including ID and regression.; Changed rating: GREEN; Changed publications: 30250212, 29040572, 33348459, 37046037, 37481223; Changed phenotypes: Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887, Auditory neuropathy and optic atrophy, MIM# 617717
Intellectual disability syndromic and non-syndromic v0.6057 RNU4-2 Zornitza Stark Phenotypes for gene: RNU4-2 were changed from Neurodevelopmental disorder, MONDO:0700092, RNU4-2 related to Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851
Intellectual disability syndromic and non-syndromic v0.6056 RNU4-2 Zornitza Stark edited their review of gene: RNU4-2: Changed phenotypes: Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851
Intellectual disability syndromic and non-syndromic v0.6055 SREBF2 Zornitza Stark gene: SREBF2 was added
gene: SREBF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SREBF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SREBF2 were set to 38847193
Phenotypes for gene: SREBF2 were set to Neurocutaneous syndrome, MONDO:0042983, SREBF2-related
Review for gene: SREBF2 was set to AMBER
Added comment: Two individuals with de novo missense variants, presenting with neurological, cutaneous and skeletal features; supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6051 PSMF1 Zornitza Stark gene: PSMF1 was added
gene: PSMF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMF1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMF1 were set to https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1
Phenotypes for gene: PSMF1 were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related
Review for gene: PSMF1 was set to GREEN
Added comment: 22 individuals from 15 families reported with a range of neurological phenotypes ranging from early-onset Parkinson's disease; childhood conditions typified by ID and a range of movement disorders; through to perinatal lethal presentations with arthrogryposis multiplex. Genotype-phenotype correlation: biallelic missense variants resulted in the milder phenotypes, while bi-allelic LoF variants in the more severe phenotypes. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6050 PSMC5 Rylee Peters reviewed gene: PSMC5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38776958, 38293138; Phenotypes: Neurodevelopmental disorder (MONDO#0700092), PSMC5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6049 VPS50 Ain Roesley reviewed gene: VPS50: Rating: GREEN; Mode of pathogenicity: None; Publications: 38876772; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis MIM#619685; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6048 PSMD11 Bryony Thompson gene: PSMD11 was added
gene: PSMD11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PSMD11 were set to 38866022; 30733659
Phenotypes for gene: PSMD11 were set to Neurodevelopmental disorder, MONDO:0700092, PSMD11-related
Review for gene: PSMD11 was set to GREEN
Added comment: PMID: 38866022 - 10 unrelated children with early-onset syndromic intellectual disability and neurodevelopmental delay with recurrent obesity. Cognitive impairment is recapitulated in a drosophila model. Loss of function is the mechanism of disease

PMID: 30733659 - 4 probands with ID and different 17q11.2 deletions spanning PSMD11
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6046 PAK2 Ain Roesley gene: PAK2 was added
gene: PAK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PAK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PAK2 were set to 33693784; 38894571; 38712026
Phenotypes for gene: PAK2 were set to Knobloch 2 syndrome MIM#618458
Review for gene: PAK2 was set to GREEN
gene: PAK2 was marked as current diagnostic
Added comment: total of 3 families including 2 siblings with intra-familial variability

Siblings' phenotypes:
Both had retinal detachment and interstitial parenchymal pulmonary changes on chest X-rays, but only one child had additional significant features such as cataract, posterior encephalocele, severe DD/ID with ASD, and epilepsy.

Other 2 pro bands:
GDD, delayed motor (but normal verbal) skills, hypotonia

Missense variants with in vitro functional demonstrating reduction in PAK2 auto phosphorylation
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6045 MTSS1L Ain Roesley Phenotypes for gene: MTSS1L were changed from ntellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086 to Intellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086
Intellectual disability syndromic and non-syndromic v0.6044 MTSS1L Ain Roesley Phenotypes for gene: MTSS1L were changed from Intellectual disability, MTSS2-related (MONDO#0001071) to ntellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086
Intellectual disability syndromic and non-syndromic v0.6042 MYH10 Zornitza Stark Phenotypes for gene: MYH10 were changed from Microcephaly; Intellectual Disability to AD complex neurodevelopmental disorder with or without congenital anomalies (MONDO:0100465)
Intellectual disability syndromic and non-syndromic v0.6038 AFF2 Zornitza Stark edited their review of gene: AFF2: Changed phenotypes: Intellectual disability, X-linked, FRAXE type 309548; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6038 RDH14 Zornitza Stark gene: RDH14 was added
gene: RDH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RDH14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RDH14 were set to 34848785
Phenotypes for gene: RDH14 were set to Neurodevelopmental disorder, MONDO:0700092, RDH14-related
Review for gene: RDH14 was set to RED
Added comment: Two related individuals with ID and cerebellar atrophy and homozygous LoF variant reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6033 SLC6A1 Zornitza Stark edited their review of gene: SLC6A1: Added comment: Haploinsufficiency established as the mechanism.; Changed publications: 29315614, 38781976
Intellectual disability syndromic and non-syndromic v0.6032 MSL2 Sangavi Sivagnanasundram reviewed gene: MSL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 38815585, 38702431; Phenotypes: MSL2-Related Developmental Disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6030 ANO4 Ain Roesley gene: ANO4 was added
gene: ANO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ANO4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANO4 were set to 38744284
Phenotypes for gene: ANO4 were set to neurodevelopmental disorder MONDO:0700092, ANO4-related
Review for gene: ANO4 was set to GREEN
gene: ANO4 was marked as current diagnostic
Added comment: aka TMEM16D

5x de novo + 2x inherited missense (73% penetrance + asymptomatic)

the ones with de novo variants:
all had ID, hypotonia
4x skeletal features (scoliosis, funnel chest, pet plants, hyper extensible joints)

all had epilepsy
all had abnormal MRI
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6025 ATXN7L3 Chirag Patel gene: ATXN7L3 was added
gene: ATXN7L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATXN7L3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATXN7L3 were set to PMID: 38753057
Phenotypes for gene: ATXN7L3 were set to Neurodevelopmental disorder, MONDO_0100500
Review for gene: ATXN7L3 was set to GREEN
gene: ATXN7L3 was marked as current diagnostic
Added comment: This study reports 9 unrelated individuals with de novo heterozygous variants in ATXN7L3 identified through WES testing and GeneMatcher. Core clinical features included: global motor and language developmental delay, hypotonia, and dysmorphic features (hypertelorism, epicanthal folds, blepharoptosis, small nose, small mouth, and low-set posteriorly rotated ears). Variable features included: feeding difficulties, seizures, mild periventricular leukomalacia, and structural cardiac abnormalities.

A recurrent nonsense variant [p.(Arg114Ter)] was found in 5/9 individuals. The other variants were 1 frameshift [p.(Ser112LysfsTer12)] and 3 missense variants [p.(Ile71Thr), p.(Ser92Arg), and p.(Leu106Pro)]. They investigated the effects of the recurrent nonsense variant [p.(Arg114Ter)] in fibroblasts of an affected individual. ATXN7L3 protein levels were reduced, and deubiquitylation was impaired (as indicated by an increase in histone H2Bub1 levels). This is consistent with the previous observation of increased H2Bub1 levels in Atxn7l3-null mouse embryos, which have developmental delay and embryonic lethality.

Pathogenic variants in deubiquitinating enzymes (DUBs) have been implicated in neurodevelopmental disorders (ND) and congenital abnormalities. ATXN7L3 is a component of the DUB module of the SAGA complex, and two other related DUB modules, and serves as an obligate adaptor protein of 3 ubiquitin-specific proteases (USP22, USP27X or USP51).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6022 FAM177A1 Chirag Patel gene: FAM177A1 was added
gene: FAM177A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FAM177A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM177A1 were set to PMID: 38767059, 25558065
Phenotypes for gene: FAM177A1 were set to Neurodevelopmental disorder, MONDO_0100500
Review for gene: FAM177A1 was set to GREEN
gene: FAM177A1 was marked as current diagnostic
Added comment: PMID: 38767059
5 individuals from 3 unrelated families reported with with biallelic loss of function variants in FAM177A1. Clinical features included: global developmental delay, intellectual disability, seizures, behavioural abnormalities, hypotonia, gait disturbance, and macrocephaly.

They showed that FAM177A1 localizes to the Golgi complex in mammalian and zebrafish cells. Intersection of the RNA-seq and metabolomic datasets from FAM177A1-deficient human fibroblasts and whole zebrafish larvae demonstrated dysregulation of pathways associated with apoptosis, inflammation, and negative regulation of cell proliferation.

PMID: 25558065
A study of 143 multiplex consanguineous families identified a homozygous frameshift variant in FAM177A1 in 1 family with 4 affected siblings with intellectual disability, dolicocephaly, obesity, and macrocephaly. The variant segregated with all 4 affected siblings and parents were confirmed heterozygous carriers.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6020 ERF Chirag Patel reviewed gene: ERF: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38824261; Phenotypes: Noonan syndrome-like with or without craniosynostosis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6019 PPFIA3 Zornitza Stark edited their review of gene: PPFIA3: Changed publications: 38723631
Intellectual disability syndromic and non-syndromic v0.6016 SSR4 Zornitza Stark reviewed gene: SSR4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type Iy, MIM# 300934; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6015 RELN Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly 2 (Norman-Roberts type), MIM# 257320; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6014 RELN Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6013 SLC35A1 Anissa Johnson Deleted their review
Intellectual disability syndromic and non-syndromic v0.6013 RELN Tashunka Taylor-Miller changed review comment from: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20)
Variant spectrum includes: loss of function, missense, splice-site variants.

MRI features include: anterior-predominant “thin”lisencephaly pachygyria with cerebellar hypoplasia
Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia.
Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile).; to: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20)
Variant spectrum includes: loss of function, missense, splice-site variants.

MRI features include: anterior-predominant “thin” lisencephaly pachygyria with cerebellar hypoplasia.
Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia.
Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile).
Intellectual disability syndromic and non-syndromic v0.6013 RELN Tashunka Taylor-Miller edited their review of gene: RELN: Changed publications: PMID: 35769015, PMID: 29671837
Intellectual disability syndromic and non-syndromic v0.6013 RELN Tashunka Taylor-Miller reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35769015, 29671837; Phenotypes: OMIM *600514, HP:0001339, DOID:0070338; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6007 DMD Zornitza Stark reviewed gene: DMD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Duchenne muscular dystrophy MIM#310200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6007 SSR4 Katie Thompson changed review comment from: Decipher - only disorder of glycosolation (XLR)
ORPHA:370927
OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females
Western blot showed complete loss of protein; to: Decipher - disorder of glycosolation (XLR), strong evidence
ORPHA:370927 GenCC strong. Not in gene2phenotype.
OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females
Western blot showed complete loss of protein. All variants caused loss of function mainly from premature termination.
Intellectual disability syndromic and non-syndromic v0.6004 COG7 Zornitza Stark reviewed gene: COG7: Rating: GREEN; Mode of pathogenicity: None; Publications: 15107842, 17356545, 28883096; Phenotypes: Congenital disorder of glycosylation, type IIe , MIM#608779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6004 SSR4 Katie Thompson changed review comment from: PMID: 24218363; 26264460
SSR4
Decipher - only disorder of glycosolation (XLR)
ORPHA:370927
OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females; to: Decipher - only disorder of glycosolation (XLR)
ORPHA:370927
OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females
Western blot showed complete loss of protein
Intellectual disability syndromic and non-syndromic v0.6001 SSR4 Katie Thompson reviewed gene: SSR4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24218363, 26264460; Phenotypes: intellectual disabilities, hypotonia, microcephaly, seizures, Feeding problems, Facial dysmorphism, Gastrointestinal abnormalities, Failure to thrive, strabismus; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6001 COG1 Zornitza Stark reviewed gene: COG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16537452, 19008299, 17904886, 11980916; Phenotypes: Congenital disorder of glycosylation, type IIg, MIM# 611209; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5999 COL4A1 Zornitza Stark Mode of inheritance for gene: COL4A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5998 SNAP29 Zornitza Stark Phenotypes for gene: SNAP29 were changed from to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528)
Intellectual disability syndromic and non-syndromic v0.5995 SNAP29 Zornitza Stark reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5993 GABRA4 Zornitza Stark reviewed gene: GABRA4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder MONDO:0700092, GABRA4-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5993 SNAP29 Gunjan Garg reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33977139, 30793783, 29051910; Phenotypes: cerebral dysgenesis, 609528, Global developmental delay, schizencephaly, polymicrogyria, intellectual disability, neurodevelopment delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5993 COL4A1 Hali Van Niel reviewed gene: COL4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30413629, 33912663, 36786861, 32042920; Phenotypes: COL4A1-related disorder MONDO:0800461, brain small vessel disease 1 with or without ocular anomalies MONDO:0008289, microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5991 CLN6 Zornitza Stark reviewed gene: CLN6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 6, MIM# 601780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5989 CLN3 Zornitza Stark reviewed gene: CLN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 3 MIM#204200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5987 CHD7 Zornitza Stark reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: CHARGE syndrome, MIM# 214800; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5985 CC2D2A Zornitza Stark reviewed gene: CC2D2A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: COACH syndrome 2, MIM# 619111, Joubert syndrome 9, 612285, Meckel syndrome 6, 612284; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5985 CBL Zornitza Stark Mode of pathogenicity for gene: CBL was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.5982 CACNA1A Zornitza Stark Phenotypes for gene: CACNA1A were changed from to developmental and epileptic encephalopathy, 42 MONDO:0014917
Intellectual disability syndromic and non-syndromic v0.5949 TBCE Zornitza Stark Phenotypes for gene: TBCE were changed from to Encephalopathy, progressive, with amyotrophy and optic atrophy MIM:617207; Hypoparathyroidism-retardation-dysmorphism syndrome MIM:241410
Intellectual disability syndromic and non-syndromic v0.5946 SLC25A1 Zornitza Stark Phenotypes for gene: SLC25A1 were changed from to Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072; Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596
Intellectual disability syndromic and non-syndromic v0.5943 SLC25A1 Zornitza Stark reviewed gene: SLC25A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072, Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5939 ROR2 Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Robinow syndrome, autosomal recessive, MIM#268310; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5939 SOX10 Zornitza Stark Phenotypes for gene: SOX10 were changed from to Peripheral demyelinating neuropathy Central demyelination, Waardenburg and Hirschsprung disease, OMIM #609136; Waardenburg syndrome, type 2E, with or without neurologic involvement (OMIM #611584)
Intellectual disability syndromic and non-syndromic v0.5933 SLC4A4 Zornitza Stark Phenotypes for gene: SLC4A4 were changed from to Renal tubular acidosis, proximal, with ocular abnormalities MIM#604278
Intellectual disability syndromic and non-syndromic v0.5928 SLX4 Zornitza Stark reviewed gene: SLX4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Fanconi anemia, complementation group P, MIM# 613951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5928 SCN8A Zornitza Stark Phenotypes for gene: SCN8A were changed from to Developmental and epileptic encephalopathy 13, MIM# 614558
Intellectual disability syndromic and non-syndromic v0.5925 THRA Zornitza Stark Marked gene: THRA as ready
Intellectual disability syndromic and non-syndromic v0.5925 THRA Zornitza Stark Gene: thra has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.5925 THRA Zornitza Stark Phenotypes for gene: THRA were changed from to Hypothyroidism congenital nongoitrous 6 (MIM 614450)
Intellectual disability syndromic and non-syndromic v0.5924 THRA Zornitza Stark Publications for gene: THRA were set to
Intellectual disability syndromic and non-syndromic v0.5923 THRA Zornitza Stark Mode of inheritance for gene: THRA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5919 SIX3 Zornitza Stark reviewed gene: SIX3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holoprosencephaly 2, autosomal dominant, MIM#157170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5915 SCN2A Zornitza Stark Phenotypes for gene: SCN2A were changed from to Developmental and epileptic encephalopathy 11, MIM# 613721
Intellectual disability syndromic and non-syndromic v0.5912 BMP4 Zornitza Stark Phenotypes for gene: BMP4 were changed from Microphthalmia, syndromic 6, MIM# 607932 to Microphthalmia, syndromic 6, MIM# 607932
Intellectual disability syndromic and non-syndromic v0.5911 BMP4 Zornitza Stark Phenotypes for gene: BMP4 were changed from to Microphthalmia, syndromic 6, MIM# 607932
Intellectual disability syndromic and non-syndromic v0.5908 BMP4 Zornitza Stark edited their review of gene: BMP4: Changed publications: 31053785
Intellectual disability syndromic and non-syndromic v0.5908 BMP4 Zornitza Stark reviewed gene: BMP4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Microphthalmia, syndromic 6, MIM# 607932; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5902 RBBP8 Zornitza Stark reviewed gene: RBBP8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Jawad syndrome, MIM#251255, Seckel syndrome 2, MIM#606744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5902 RBBP8 James The reviewed gene: RBBP8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:30561437, 34270086, 32379725; Phenotypes: 606744, 251255, 113705; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5902 CDON Hali Van Niel reviewed gene: CDON: Rating: GREEN; Mode of pathogenicity: None; Publications: 21802063, 26728615, 31502381, 32729136, 26529631; Phenotypes: holoprosencephaly 11 MONDO:0013642; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5898 SAMD9 Zornitza Stark reviewed gene: SAMD9: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: MIRAGE Syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5898 BMP4 Hali Van Niel reviewed gene: BMP4: Rating: AMBER; Mode of pathogenicity: None; Publications: 22581619, 31053785, 30568244, 18252212, 21340693, 34926457, 36140739, 37107605; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5890 SLC35A1 Zornitza Stark edited their review of gene: SLC35A1: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.5890 SLC35A1 Zornitza Stark reviewed gene: SLC35A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28856833, 23873973, 11157507; Phenotypes: Congenital disorder of glycosylation, type IIf, MIM# 603585; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5887 LRPPRC Zornitza Stark reviewed gene: LRPPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), MIM#220111; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5885 TREX1 Zornitza Stark Mode of inheritance for gene: TREX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5884 SERAC1 Zornitza Stark Phenotypes for gene: SERAC1 were changed from to 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL), MIM#614739
Intellectual disability syndromic and non-syndromic v0.5881 SERAC1 Zornitza Stark reviewed gene: SERAC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24741715, 37711114, 37090937, 28916646, 32684373; Phenotypes: 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL), MIM#614739; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 TREX1 Hali Van Niel changed review comment from: Established gene disease association with Aicardi-Goutières Syndrome
Heterogeneity with variable phenotype, ranges from preserved cognition to severe intellectual disability
TREX1-related Aicardi Goutières syndrome have higher impairment (31559893)
ID common presenting feature (PMID: 25604658); to: Established gene disease association with Aicardi-Goutières Syndrome
Heterogeneity with variable phenotype, ranges from preserved cognition to severe intellectual disability
TREX1-related Aicardi Goutières syndrome have higher impairment (PMID: 31559893)
ID common presenting feature (PMID: 25604658)
Intellectual disability syndromic and non-syndromic v0.5881 TREX1 Hali Van Niel edited their review of gene: TREX1: Changed publications: 25604658, 16845398, 17357087, 31559893
Intellectual disability syndromic and non-syndromic v0.5881 TREX1 Hali Van Niel reviewed gene: TREX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25604658, 16845398, 17357087; Phenotypes: Aicardi-Goutieres syndrome MONDO:0018866; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 LRPPRC Kirsty Choi reviewed gene: LRPPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21266382, 8392290, 8392291, 26510951; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), 220111, developmental delay, hypotonia, mild facial dysmorphism, chronic well-compensated metabolic acidosis, high mortality due to episodes of severe acidosis and coma, hypertension, cerebrospinal fluid lactate levels, decreased blood bicarbonate levels, microvesicular steatosis, psychomotor delay, ataxia, hypotonia, transient tachypnea of the newborn, poor sucking, tremor, hypoglycemia, seizures; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 SLC35A1 Anissa Johnson changed review comment from: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation".
AR inheritance.; to: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents, consanguineous, were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation".
AR inheritance.
Intellectual disability syndromic and non-syndromic v0.5881 SLC35A1 Anissa Johnson changed review comment from: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation".; to: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation".
AR inheritance.
Intellectual disability syndromic and non-syndromic v0.5881 SLC35A1 Anissa Johnson commented on gene: SLC35A1: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation".
Intellectual disability syndromic and non-syndromic v0.5881 SLC35A1 Anissa Johnson reviewed gene: SLC35A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23873973; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 LIG4 Santosh Varughese reviewed gene: LIG4: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 16088910, 9823897, 10911993, 15333585, 9809069, 12023982, 11040211, 15175260, 19451691, 17554302; Phenotypes: lIG4 syndrome, MULTIPLE MYELOMA, RESISTANCE TO; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 SAMD9 Raluca Rusu reviewed gene: SAMD9: Rating: RED; Mode of pathogenicity: Other; Publications: PMID: 27182967, 34659124, 32194975, 29175836, 37195360, 30900330, 37745698; Phenotypes: MIRAGE Syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5881 SCN2A sabitha sateesh reviewed gene: SCN2A: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 31230762, 31904126, 28256214, 31904120, 31924505, 31205438, 1325650, 17021166; Phenotypes: Intellectual disability, autism, motor delay, epileptic seizures, uncoordinated oral movements, gastrointestinal disturbances, sleep problems.; Mode of inheritance: Unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5881 SAMHD1 Reetoo Ramessur reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301648, 29239743, 25246298, 19525956, 21102625, 33307271, 35418820; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 SIX3 Laura Mazurkijevic reviewed gene: SIX3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20531442, 19346217, 20157829, 15635066; Phenotypes: Holoprosencephaly 2, autosomal dominant, MIM#157170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5881 THRA Hnin Aung changed review comment from: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed.

Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938).

Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].; to: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestations for truncating variants have been observed.

Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938).

Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].
Intellectual disability syndromic and non-syndromic v0.5881 THRA Hnin Aung changed review comment from: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed.

Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938).

Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].; to: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed.

Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938).

Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].
Intellectual disability syndromic and non-syndromic v0.5881 THRA Hnin Aung reviewed gene: THRA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22494134, 23940126, 24847461, 25670821, 26037512, 25621899, 27144938, 28856816, 30842990, 37469961; Phenotypes: Hypothyroidism congenital nongoitrous 6 (MIM 614450), Intellectual disability syndromic, Growth retardation, Facial dysmorphism, Constipation; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5881 SCN8A Tinashe Nhindiri reviewed gene: SCN8A: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 34353676, 38233770, 30171078; Phenotypes: Epileptic encephalopathy, Developmental delay, Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5881 SLX4 Lovepreet Gill reviewed gene: SLX4: Rating: RED; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: (PMID: 21240277, 21240275, 23093618, 26453996); Phenotypes: Franconia anemia, complementation group P; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5881 SLC4A4 Adam Ivey reviewed gene: SLC4A4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29914390, 11274232, 15930088; Phenotypes: OMIM:604278-RENAL TUBULAR ACIDOSIS, PROXIMAL, WITH OCULAR ABNORMALITIES AND IMPAIRED INTELLECTUAL DEVELOPMENT; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 SOX10 David Fairbairn changed review comment from: Main mutation mechanism: truncated proteins, potent dominant-negative activity and more severe phenotype only when escapes NMD. Decipher: SOX 10 copy number losses and gains associated with intellectual disability. PCWH Gene2Phenotype: monoallelic-altered gene product structure, DD definitive. Waardenburg syndrome, type 2E Gene2Phenotype: monoallelic-absent gene product, DD definitive. GenCC definitive. OMIM #609136: dominant-negative heterozygous SOX 10 variants in multiple (>3) unrelated cases resulting in neurologic features.; to: Main mutation mechanism: truncated proteins, potent dominant-negative activity and more severe phenotype only when escapes NMD. Decipher: SOX 10 copy number losses and gains associated with intellectual disability. PCWH Gene2Phenotype: monoallelic-altered gene product structure, DD definitive. Waardenburg syndrome, type 2E Gene2Phenotype: monoallelic-absent gene product, DD definitive. GenCC definitive. OMIM #609136: dominant-negative heterozygous SOX 10 variants in multiple (>3) unrelated cases resulting in neurologic features.
Intellectual disability syndromic and non-syndromic v0.5881 SOX10 David Fairbairn reviewed gene: SOX10: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10762540, 34667088, 38132479; Phenotypes: PCWH (Peripheral demyelinating neuropathy Central demyelination, Waardenburg and Hirschsprung disease) syndrome (OMIM #609136), Waardenburg syndrome, type 2E, with or without neurologic involvement (OMIM #611584); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.5881 ROR2 Shani Stuart reviewed gene: ROR2: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 33937263, 32954672, 32172608; Phenotypes: Intellectual disability; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 SLC25A1 Alyson Lewis reviewed gene: SLC25A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31527857, PMID: 26870663; Phenotypes: Impaired intellectual development, mild, Learning disabilities, Delayed motor development; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5881 TBCE Leanne Baxter reviewed gene: TBCE: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID:27666369: PMID:17699660: PMID:34356170: PMID: 34134906; Phenotypes: Encephalopathy, progressive, with amyotrophy and optic atrophy MIM:617207, Hypoparathyroidism-retardation-dysmorphism syndrome MIM:241410, Kenny-Caffey syndrome, type 1 MIM:244460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5880 SLC19A3 Zornitza Stark Phenotypes for gene: SLC19A3 were changed from to Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483
Intellectual disability syndromic and non-syndromic v0.5878 SLC19A3 Jane Lin changed review comment from: Rare disorder of thiamine metabolism and transport. Has well characterised gene-phenotype link in more than 3 families (multiple publications, in different subpopulations). Many symptoms in this disorder, for example confusion, seizures, ataxia, dystonia, supranuclear facial palsy, external ophthalmoplegia, and dysphagia. ID has been described as a sequela in many cases.; to: Rare disorder of thiamine metabolism and transport. Has well characterised gene-phenotype link for THMD2 in more than 3 families (multiple publications, in different subpopulations). Many CNS related symptoms in this disorder, for example confusion, seizures, ataxia, dystonia, supranuclear facial palsy, external ophthalmoplegia, and dysphagia. ID has been described as a sequela in many cases.
Intellectual disability syndromic and non-syndromic v0.5878 SLC19A3 Jane Lin reviewed gene: SLC19A3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15871139, PMID: 34276785, PMID: 23482991, PMID: 20065143; Phenotypes: # 607483 BASAL GANGLIA DISEASE, BIOTIN-THIAMINE RESPONSIVE (BBTGD), THIAMINE METABOLISM DYSFUNCTION SYNDROME 2; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5877 SASS6 Zornitza Stark gene: SASS6 was added
gene: SASS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: SASS6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SASS6 were set to 24951542; 30639237
Phenotypes for gene: SASS6 were set to Microcephaly 14, primary, autosomal recessive, MIM# 616402
Review for gene: SASS6 was set to GREEN
Added comment: At least 3 unrelated families reported, severe ID is part of the phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5873 SPECC1L Zornitza Stark reviewed gene: SPECC1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Teebi hypertelorism syndrome 1, MIM# 145420; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5873 SPECC1L Ibrahim El-Deek changed review comment from: There is paucity of literature directly linking SPECC1L variants to intellectual disability and developmental delay. However, Zhang et al. (PMID: 31953237) reviewed 33 patients from 14 families with SPECC1L variants, noting that the most common features were dysmorphic facial characteristics. Developmental delays were reported in 24.2% of patients (8/33), with some achieving normal development during childhood.; to: There is paucity of literature directly linking SPECC1L variants to intellectual disability and developmental delay. However, Zhang et al. (PMID: 31953237) reviewed 33 patients from 14 families with SPECC1L variants (including 10 missense point mutation and 1 deletion), noting that the most common features were dysmorphic facial characteristics. Developmental delays were reported in 24.2% of patients (8/33), with some achieving normal development during childhood.
Intellectual disability syndromic and non-syndromic v0.5873 SPECC1L Ibrahim El-Deek reviewed gene: SPECC1L: Rating: RED; Mode of pathogenicity: Other; Publications: 31953237, 30472488; Phenotypes: Teebi hypertelorism syndrome 1, Oblique Facial Clefting 1, Opitz GBBB syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5873 GABRA4 Adam Ivey gene: GABRA4 was added
gene: GABRA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABRA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRA4 were set to PMID: 38565639
Phenotypes for gene: GABRA4 were set to Developmental delay; Intellectual disability; Epileptic seizures
Penetrance for gene: GABRA4 were set to Complete
Review for gene: GABRA4 was set to GREEN
Added comment: Four unrelated individuals with unique de novo missense variants in the transmembrane domain of GABRA4 have developmental delay and varying degrees of intellectual disability (PMID: 38565639). These variants are not present in gnomAD and three of the four variants have pathogenic REVEL scores. Two of the GABRA4 variants were heterozygous, while the remaining two were mosaic.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5869 LAMC3 Zornitza Stark Mode of inheritance for gene: LAMC3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5867 LAMC3 Zornitza Stark reviewed gene: LAMC3: Rating: AMBER; Mode of pathogenicity: None; Publications: 38758065, 21572413; Phenotypes: complex neurodevelopmental disorder MONDO:0100038, Cortical malformations, occipital, MIM# 614115; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5867 MAGT1 Zornitza Stark Phenotypes for gene: MAGT1 were changed from Congenital disorder of glycosylation, type Icc, OMIM #301031; Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia, OMIM #300853 to X-linked intellectual disability MONDO:0100284; Congenital disorder of glycosylation, type Icc, OMIM #301031
Intellectual disability syndromic and non-syndromic v0.5865 MBTPS2 Zornitza Stark Phenotypes for gene: MBTPS2 were changed from to IFAP syndrome 1, with or without BRESHECK syndrome MONDO:0100213
Intellectual disability syndromic and non-syndromic v0.5862 MED12 Zornitza Stark Mode of inheritance for gene: MED12 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5854 MID1 Zornitza Stark Mode of inheritance for gene: MID1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5847 OFD1 Zornitza Stark Phenotypes for gene: OFD1 were changed from to ciliopathy MONDO:0005308
Intellectual disability syndromic and non-syndromic v0.5840 PORCN Zornitza Stark Mode of inheritance for gene: PORCN was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5833 SLC25A15 Zornitza Stark Phenotypes for gene: SLC25A15 were changed from to Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, MIM#238970
Intellectual disability syndromic and non-syndromic v0.5821 SHANK2 Zornitza Stark reviewed gene: SHANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 SHANK2 Aaron Meyers reviewed gene: SHANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20473310, 22346768, 20531469, 35456494, 32987185, 25188300, 22699619, 22699620; Phenotypes: Autism, susceptibility to, 17, MIM#613436, Autism spectrum disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 ZNF81 Sangavi Sivagnanasundram reviewed gene: ZNF81: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006590; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 ZNF674 Sangavi Sivagnanasundram reviewed gene: ZNF674: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006588; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 ZNF41 Sangavi Sivagnanasundram reviewed gene: ZNF41: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006585; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 ZDHHC15 Sangavi Sivagnanasundram reviewed gene: ZDHHC15: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006573; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 WAC Sangavi Sivagnanasundram reviewed gene: WAC: Rating: GREEN; Mode of pathogenicity: None; Publications: 26757981, https://search.clinicalgenome.org/CCID:006532; Phenotypes: DeSanto-Shinawi syndrome MONDO:0018760; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 TCF7L2 Sangavi Sivagnanasundram reviewed gene: TCF7L2: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006339; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 SLC6A4 Sangavi Sivagnanasundram changed review comment from: DISPUTED classification by ClinGen ID and Autism GCEP on 06/01/2021 due to variants association with ASD having high frequencies in gnomAD - https://search.clinicalgenome.org/CCID:006198; to: DISPUTED classification by ClinGen ID and Autism GCEP on 06/01/2021. Variants in this gene associated with ASD having high frequencies in gnomAD - https://search.clinicalgenome.org/CCID:006198
Intellectual disability syndromic and non-syndromic v0.5821 SLC6A4 Sangavi Sivagnanasundram reviewed gene: SLC6A4: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006198; Phenotypes: autism spectrum disorder MONDO:0005258; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 SLC25A15 Rajkumar Krishnaswamy changed review comment from: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported. ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in the childhood or as adult onset.; to: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Lethargy, feeding difficulties, seizures, pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported with various features exhibited at various stages of life e.g. neonates, infantile/childhood and adults.
ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in childhood or adults.
Intellectual disability syndromic and non-syndromic v0.5821 SHROOM4 Sangavi Sivagnanasundram reviewed gene: SHROOM4: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006141; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 SLC25A15 Rajkumar Krishnaswamy reviewed gene: SLC25A15: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 18978333, 25874378; Phenotypes: Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, 238970, hyperammonemia, lethargy, somnolence, refusal to feed, vomiting, tachypnea with respiratory alkalosis, seizures, protein intolerance, developmental delay, spasticity, intellectual disability / mental retardation, dysarthria, learning disabilities, spasticity, liver dysfunction; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram Deleted their review
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP.

SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117
Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116

LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions)

GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing.
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP.

SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117
Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116

LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions)

GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing.
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 PTCHD1 Sangavi Sivagnanasundram reviewed gene: PTCHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005921; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 PORCN Sangavi Sivagnanasundram reviewed gene: PORCN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301712; Phenotypes: focal dermal hypoplasia MONDO:0010592; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 PLP1 Sangavi Sivagnanasundram reviewed gene: PLP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: https://search.clinicalgenome.org/CCID:005834; Phenotypes: Pelizeaus-Merzbacher spectrum disorder MONDO:0010714; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 OFD1 Sangavi Sivagnanasundram reviewed gene: OFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24884629; Phenotypes: ciliopathy MONDO:0005308; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 OCRL Sangavi Sivagnanasundram reviewed gene: OCRL: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005696; Phenotypes: oculocerebrorenal syndrome MONDO:0010645; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 NSD1 Sangavi Sivagnanasundram reviewed gene: NSD1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005680; Phenotypes: Sotos syndrome MONDO:0019349; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 NDP Sangavi Sivagnanasundram edited their review of gene: NDP: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.5821 NDP Sangavi Sivagnanasundram reviewed gene: NDP: Rating: AMBER; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005574; Phenotypes: Norrie disease MONDO:0010691; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 MID1 Sangavi Sivagnanasundram reviewed gene: MID1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005386; Phenotypes: X-linked Opitz G/BBB syndrome MONDO:0010222; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 MED23 Sangavi Sivagnanasundram reviewed gene: MED23: Rating: GREEN; Mode of pathogenicity: None; Publications: 21868677, 25845469, 27311965, 27457812, 30847200, 31164858; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5821 MED13L Sangavi Sivagnanasundram reviewed gene: MED13L: Rating: GREEN; Mode of pathogenicity: None; Publications: 28645799, 29511999; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 MED12 Sangavi Sivagnanasundram reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005361; Phenotypes: MED12-related intellectual disability syndrome MONDO:0100000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 MBTPS2 Sangavi Sivagnanasundram reviewed gene: MBTPS2: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005345; Phenotypes: IFAP syndrome 1, with or without BRESHECK syndrome MONDO:0100213; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 MAN1B1 Sangavi Sivagnanasundram reviewed gene: MAN1B1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: MAN1B1-congenital disorder of glycosylation MONDO:0018349; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5821 MAGT1 Sangavi Sivagnanasundram reviewed gene: MAGT1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005319; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 LAMC3 Sangavi Sivagnanasundram reviewed gene: LAMC3: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005265; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 L1CAM Sangavi Sivagnanasundram reviewed gene: L1CAM: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005260; Phenotypes: L1 syndrome MONDO:0017140; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 KIRREL3 Sangavi Sivagnanasundram reviewed gene: KIRREL3: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005235; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 KATNAL2 Sangavi Sivagnanasundram reviewed gene: KATNAL2: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005176; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 KAT6B Sangavi Sivagnanasundram reviewed gene: KAT6B: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005174; Phenotypes: KAT6B-related multiple congenital anomalies syndrome MONDO:0036042; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 KAT6A Sangavi Sivagnanasundram reviewed gene: KAT6A: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005173; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 IGBP1 Sangavi Sivagnanasundram reviewed gene: IGBP1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005117; Phenotypes: corpus callosum agenesis-intellectual disability-coloboma-micrognathia syndrome MONDO:0010333; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 IDS Sangavi Sivagnanasundram reviewed gene: IDS: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005112; Phenotypes: mucopolysaccharidosis type 2 MONDO:0010674; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 HPRT1 Sangavi Sivagnanasundram reviewed gene: HPRT1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005082; Phenotypes: Lesch-Nyhan syndrome MONDO:0010298; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 HOXA1 Sangavi Sivagnanasundram reviewed gene: HOXA1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005077; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5821 HNRNPK Sangavi Sivagnanasundram reviewed gene: HNRNPK: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005073; Phenotypes: neurodevelopmental disorder-craniofacial dysmorphism-cardiac defect-hip dysplasia syndrome (Au-Kline syndrome) MONDO:0018681; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 GPC3 Sangavi Sivagnanasundram reviewed gene: GPC3: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004990; Phenotypes: Simpson-Golabi-Behmel syndrome MONDO:0010731; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 GDI1 Sangavi Sivagnanasundram reviewed gene: GDI1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004941; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 FTSJ1 Sangavi Sivagnanasundram reviewed gene: FTSJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004892; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5821 FMR1 Sangavi Sivagnanasundram reviewed gene: FMR1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004870; Phenotypes: fragile X syndrome MONDO:0010383; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5819 SPR Zornitza Stark Mode of inheritance for gene: SPR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5818 SPR Zornitza Stark reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5812 CASK Zornitza Stark Added comment: Comment when marking as ready: Microcephaly with pontine and cerebellar hypoplasia (MICPCH), generally associated with pathogenic loss-of-function variants in CASK
X-linked intellectual disability (XLID) with or without nystagmus, generally associated with hypomorphic CASK pathogenic variants
Intellectual disability syndromic and non-syndromic v0.5812 CASK Zornitza Stark Phenotypes for gene: CASK were changed from to FG syndrome 4 MIM#300422; Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749; Intellectual disability, with or without nystagmus MIM#300422
Intellectual disability syndromic and non-syndromic v0.5808 DHCR7 Zornitza Stark Phenotypes for gene: DHCR7 were changed from to Smith-Lemli-Opitz syndrome MONDO:0010035
Intellectual disability syndromic and non-syndromic v0.5799 FLNA Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5798 FLNA Sangavi Sivagnanasundram reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004863; Phenotypes: periventricular nodular heterotopia MONDO:0020341; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5798 FBN1 Sangavi Sivagnanasundram reviewed gene: FBN1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004823; Phenotypes: Shprintzen-Goldberg syndrome MONDO:0008426; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5798 DPP6 Sangavi Sivagnanasundram reviewed gene: DPP6: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004701; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5798 DKC1 Sangavi Sivagnanasundram reviewed gene: DKC1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004651; Phenotypes: DKC1-related disorder MONDO:0100152; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5798 DHCR7 Sangavi Sivagnanasundram reviewed gene: DHCR7: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004643; Phenotypes: Smith-Lemli-Opitz syndrome MONDO:0010035; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5798 CNTN6 Sangavi Sivagnanasundram reviewed gene: CNTN6: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004489; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5798 CLIC2 Sangavi Sivagnanasundram reviewed gene: CLIC2: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004469; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5798 CDH15 Sangavi Sivagnanasundram reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004393; Phenotypes: intellectual disability MONDO:0001071; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5798 CASK Sangavi Sivagnanasundram reviewed gene: CASK: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004345; Phenotypes: X-linked syndromic intellectual disability MONDO:0020119; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5798 BCORL1 Sangavi Sivagnanasundram reviewed gene: BCORL1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004254; Phenotypes: Shukla-Vernon syndrome MONDO:0026727; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5798 BAZ2B Sangavi Sivagnanasundram reviewed gene: BAZ2B: Rating: AMBER; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004237; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5798 AVPR1A Sangavi Sivagnanasundram reviewed gene: AVPR1A: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004223; Phenotypes: autism spectrum disorder MONDO:0005258; Mode of inheritance: Unknown
Intellectual disability syndromic and non-syndromic v0.5797 KDM5A Zornitza Stark edited their review of gene: KDM5A: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, KDM5A-related, El Hayek-Chahrour neurodevelopmental syndrome, MIM# 620820
Intellectual disability syndromic and non-syndromic v0.5797 ANKRD11 Sangavi Sivagnanasundram reviewed gene: ANKRD11: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 25413698, https://search.clinicalgenome.org/CCID:004133; Phenotypes: KBG syndrome MONDO:0007846; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5797 AGTR2 Sangavi Sivagnanasundram reviewed gene: AGTR2: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004075; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5797 MAST3 Sarah Leigh reviewed gene: MAST3: Rating: GREEN; Mode of pathogenicity: None; Publications: 35095415; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5797 SPR Amy Chiang edited their review of gene: SPR: Added comment: SPR has been classified to have definitive association with dopa-responsive dystonia (reviewed by the Aminoacidopathy Expert Panel on 06/04/2021).

Clinical phenotypes are mainly neuromuscular with characteristic features of axial hypotonia, dystonia, delayed psychomotor development, oculogyric crises, diurnal fluctuation with improvement after sleep; though cognitive impairment ranging from mild to severe levels have been reported in patients with sepiapterin reductase deficiency (PMID: 16049044, 17188538) - 7 Maltese patients with the same homozygous spice variants in SPR (founder effect due to relative small Maltese population); note there was no significant improvement in cognitive ability with L-dopa treatment in these patients despite improvement in their motor abilities (PMID: 16049044) - ? other causes to cognitive impairment in these patients other than SPR associated sepiapterin reductase deficiency

There are 271 SPR variants registered in ClinVar to date with only 1 submission from a research lab reported 2 affected individuals with intellectual disability + family history (ClinVar # 625209) - no publication available to verify, ? from BRIDGE consortium study: SPEED project cohort
A start loss variant detected in 5 affected individuals with ID & epilepsy from a Persian consanguineous family - LOD score = 4.027 (PMID: 29302074); Changed publications: PMID: 29302074, 16049044, 17188538; Changed phenotypes: MONDO #0012994, OMIM #612716, axial hypotonia, dystonia with diurnal fluctuation, oculogyric crises, delayed psychomotor development, sepiapterin reductase deficiency
Intellectual disability syndromic and non-syndromic v0.5796 SPR Amy Chiang changed review comment from: SPR has been classified to have definitive association with dopa-responsive dystonia. This was reviewed by the Aminoacidopathy Expert Panel on 06/04/2021.
There are 271 SPR variants registered in ClinVar to date with only 1 submission from a research lab reported 2 affected individuals with intellectual disability + family history (ClinVar # 625209) - no publication available to verify, ? from BRIDGE consortium study: SPEED project cohort
A start loss variant detected in 5 affected individuals with ID & epilepsy from a Persian consanguineous family - LOD score = 4.027 (PMID: 29302074); to: SPR has been classified to have definitive association with dopa-responsive dystonia. This was reviewed by the Aminoacidopathy Expert Panel on 06/04/2021.
There are 271 SPR variants registered in ClinVar to date with only 1 submission from a research lab reported 2 affected individuals with intellectual disability + family history (ClinVar # 625209) - no publication available to verify, ? from BRIDGE consortium study: SPEED project cohort
A start loss variant detected in 5 affected individuals with ID & epilepsy from a Persian consanguineous family - LOD score = 4.027 (PMID: 29302074)
Intellectual disability syndromic and non-syndromic v0.5796 SPR Amy Chiang reviewed gene: SPR: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 29302074; Phenotypes: dopa-responsive dystonia due to sepiapterin reductase deficiency, MONDO: 0012994, Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, OMIM: 612716; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5796 GLUL Zornitza Stark Phenotypes for gene: GLUL were changed from Developmental and epileptic encephalopathy, MONDO:0100062, GLUL-related; Glutamine deficiency, congenital MIM#610015 to Glutamine deficiency, congenital MIM#610015; Developmental and epileptic encephalopathy 116, MIM# 620806
Intellectual disability syndromic and non-syndromic v0.5795 GLUL Zornitza Stark edited their review of gene: GLUL: Changed phenotypes: Glutamine deficiency, congenital MIM#610015, Developmental and epileptic encephalopathy 116, MIM# 620806
Intellectual disability syndromic and non-syndromic v0.5794 DAGLA Zornitza Stark gene: DAGLA was added
gene: DAGLA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DAGLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DAGLA were set to 35737950
Phenotypes for gene: DAGLA were set to Neuroocular syndrome 2, paroxysmal type, MIM# 168885
Review for gene: DAGLA was set to GREEN
Added comment: 9 individuals from 8 families reported with daily paroxysmal spells characterized by eye deviation or nystagmus with abnormal head posturing apparent from birth or early infancy. The episodes tend to be triggered after sleeping, and most patients show improvement of the ocular symptoms over time. Affected individuals also have hypotonia, mild developmental delay, dysarthria, and gait ataxia; most have mildly impaired intellectual development. Seizures are not observed.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5792 CYHR1 Bryony Thompson reviewed gene: CYHR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 38641995; Phenotypes: neurodevelopmental disorder MONDO:0700092, ZTRAF1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5792 NOTCH3 Ain Roesley Phenotypes for gene: NOTCH3 were changed from neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, MIM#125310 to neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, MIM#125310
Intellectual disability syndromic and non-syndromic v0.5791 NOTCH3 Ain Roesley Phenotypes for gene: NOTCH3 were changed from Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, MIM#125310 to neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, MIM#125310
Intellectual disability syndromic and non-syndromic v0.5790 NOTCH3 Ain Roesley changed review comment from: Pre-print (https://sciprofiles.com/publication/view/62eb776390415f0166f73fae7cd172ed)

Review of research and diagnostic databases and literature review found 50 individuals from 31 families with biallelic variants.

13 PTCS (including splice) and 15 missense resulting in gain or loss of Cys residue.

AR PTCs are associated with early onset leukoencephalopathy including cognitive decline, dev delay/ID and dysmorphism

AR missense are associated with CADASIL-like phenotype; to: Pre-print (https://sciprofiles.com/publication/view/62eb776390415f0166f73fae7cd172ed)

Review of research and diagnostic databases and literature review found 50 individuals from 31 families with biallelic variants.

13 PTCS (including splice) and 15 missense resulting in gain or loss of Cys residue.

AR PTCs are associated with early onset leukoencephalopathy including cognitive decline, dev delay/ID and dysmorphism; seizures, spasticity, hypotonia, ataxia

AR missense are associated with CADASIL-like phenotype
Intellectual disability syndromic and non-syndromic v0.5790 NOTCH3 Ain Roesley reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5786 PRMT9 Chirag Patel gene: PRMT9 was added
gene: PRMT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRMT9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PRMT9 were set to PMID: 38561334
Phenotypes for gene: PRMT9 were set to Neurodevelopmental disorder, MONDO:0100500
Review for gene: PRMT9 was set to RED
Added comment: A homozygous variant (G189R) in PRMT9 is reported based on large WGS study in 136 consanguineous families - unclear if only found in 1 family and no clinical information on case(s).

PMRTs (protein arginine methyltransferases) catalyse post translational modification via arginine methylation. Functional studies showed that the G189R variant abolishes PRMT9's methyltransferase activity - specifically at the R508 residue of SF3B2 RNA (exclusively methylated by PRMT9) - and leads to heavy PRMT9 ubiquitination, and abnormal splicing activity of SF3B2. Knock out mouse model showed PRMT9 loss in excitatory neurons leads to aberrant synapse development and impaired learning and memory.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5785 OTUD7A Zornitza Stark Phenotypes for gene: OTUD7A were changed from Intellectual disability; Epilepsy to Neurodevelopmental disorder with hypotonia and seizures, MIM# 620790
Intellectual disability syndromic and non-syndromic v0.5784 OTUD7A Zornitza Stark edited their review of gene: OTUD7A: Changed phenotypes: Neurodevelopmental disorder with hypotonia and seizures, MIM# 620790
Intellectual disability syndromic and non-syndromic v0.5784 SLC35C1 Yixin JIANG reviewed gene: SLC35C1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33836758, 32313197, 34389986; Phenotypes: Congenital disorder of glycosylation, type IIc, MIM# 266265, MONDO:0009953; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5782 PTRH2 Bryony Thompson reviewed gene: PTRH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33092935, 37239392; Phenotypes: neurologic, endocrine, and pancreatic disease, multisystem, infantile-onset 1 MONDO:8000012; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5782 DMAP1 Ben Lundie reviewed gene: DMAP1: Rating: AMBER; Mode of pathogenicity: Other; Publications: ; Phenotypes: Unknown.; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5781 RNU4-2 Zornitza Stark changed review comment from: Emerging evidence that de novo variants in this gene cause ID.
Sources: Literature; to: Over 100 individuals with ID found to have de novo variants in this gene. Please note difficult to identify on ES.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5780 RNU4-2 Zornitza Stark edited their review of gene: RNU4-2: Changed publications: 38645094
Intellectual disability syndromic and non-syndromic v0.5780 MAB21L1 Zornitza Stark reviewed gene: MAB21L1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebellar, ocular, craniofacial, and genital syndrome MIM#618479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5779 FOSL2 Zornitza Stark reviewed gene: FOSL2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aplasia cutis-enamel dysplasia syndrome, MIM# 620789; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5779 ACBD6 Zornitza Stark Phenotypes for gene: ACBD6 were changed from Neurodevelopmental disorder (MONDO#0700092), ACBD6-related to Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785
Intellectual disability syndromic and non-syndromic v0.5778 ACBD6 Zornitza Stark reviewed gene: ACBD6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5777 STRA6 Zornitza Stark Phenotypes for gene: STRA6 were changed from to Matthew-Wood syndrome MONDO:0011010
Intellectual disability syndromic and non-syndromic v0.5773 SNF8 Zornitza Stark Phenotypes for gene: SNF8 were changed from Developmental and epileptic encephalopathy 115, MIM#620783 to Developmental and epileptic encephalopathy 115, MIM#620783; Neurodevelopmental disorder plus optic atrophy, MIM# 620784
Intellectual disability syndromic and non-syndromic v0.5772 SNF8 Zornitza Stark commented on gene: SNF8: Four individuals from 3 families with NDD plus OA, rather than DEE.
Intellectual disability syndromic and non-syndromic v0.5772 SNF8 Zornitza Stark edited their review of gene: SNF8: Changed phenotypes: Developmental and epileptic encephalopathy 115, MIM#620783, Neurodevelopmental disorder plus optic atrophy, MIM# 620784
Intellectual disability syndromic and non-syndromic v0.5771 NSUN6 Zornitza Stark reviewed gene: NSUN6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 82, MIM# 620779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5771 CAPRIN1 Zornitza Stark Phenotypes for gene: CAPRIN1 were changed from Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636 to Neurodevelopmental disorder with language impairment, autism, and attention deficit-hyperactivity disorder, MIM# 620782; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636
Intellectual disability syndromic and non-syndromic v0.5769 SNF8 Zornitza Stark Phenotypes for gene: SNF8 were changed from Neurodevelopmental disorder (MONDO:0700092), SNF8-related to Developmental and epileptic encephalopathy 115, MIM#620783
Intellectual disability syndromic and non-syndromic v0.5768 SNF8 Zornitza Stark reviewed gene: SNF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 115, MIM#620783; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5768 PURA Ain Roesley Phenotypes for gene: PURA were changed from Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) to Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158)
Intellectual disability syndromic and non-syndromic v0.5768 PURA Ain Roesley Phenotypes for gene: PURA were changed from Mental retardation, autosomal dominant 31, MIM# 616158 to Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158)
Intellectual disability syndromic and non-syndromic v0.5767 BANF1 Zornitza Stark gene: BANF1 was added
gene: BANF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BANF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BANF1 were set to 35982159
Phenotypes for gene: BANF1 were set to Neurodevelopmental disorder, MONDO:0700092, BANF1-related
Review for gene: BANF1 was set to RED
Added comment: Single individual reported with a de novo variant, p.Ala87Thr, and a neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5765 RNU4-2 Zornitza Stark gene: RNU4-2 was added
gene: RNU4-2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU4-2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RNU4-2 were set to Neurodevelopmental disorder, MONDO:0700092, RNU4-2 related
Review for gene: RNU4-2 was set to GREEN
Added comment: Emerging evidence that de novo variants in this gene cause ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5763 YKT6 Zornitza Stark gene: YKT6 was added
gene: YKT6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YKT6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YKT6 were set to 38522068
Phenotypes for gene: YKT6 were set to Syndromic disease, MONDO:0002254, YKT6-related
Review for gene: YKT6 was set to AMBER
Added comment: Two individuals homozygous for YKT6 [NM_006555.3:c.554A>G p.(Tyr185Cys)] exhibited normal prenatal course followed by failure to thrive, developmental delay and progressive liver disease. Haplotype analysis identified a shared homozygous region flanking the variant, suggesting a common ancestry. The third individual homozygous for YKT6 [NM_006555.3:c.191A>G p.(Tyr64Cys)] exhibited neurodevelopmental disorders and optic atrophy. Supportive functional data in Drosophila. Amber rating due to homozygous missense variants and founder effect in two of the families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5761 SEPHS1 Zornitza Stark gene: SEPHS1 was added
gene: SEPHS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SEPHS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SEPHS1 were set to 38531365
Phenotypes for gene: SEPHS1 were set to Neurodevelopmental disorder, MONDO:0700092, SEPHS1-related
Review for gene: SEPHS1 was set to GREEN
Added comment: Nine individuals from eight families with developmental delay, growth and feeding problems, hypotonia, and dysmorphic features, all with heterozygous missense variants in SEPHS1. Eight of these individuals had a recurrent variant at amino acid position 371 of SEPHS1 (p.Arg371Trp, p.Arg371Gln, and p.Arg371Gly); seven of these variants were known to be de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5760 GLUL Zornitza Stark Phenotypes for gene: GLUL were changed from to Developmental and epileptic encephalopathy, MONDO:0100062, GLUL-related; Glutamine deficiency, congenital MIM#610015
Intellectual disability syndromic and non-syndromic v0.5758 GLUL Zornitza Stark Mode of inheritance for gene: GLUL was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5757 GLUL Zornitza Stark reviewed gene: GLUL: Rating: GREEN; Mode of pathogenicity: None; Publications: 16267323, 21353613, 33150193; Phenotypes: Developmental and epileptic encephalopathy, MONDO:0100062, GLUL-related, Glutamine deficiency, congenital MIM#610015, disorder of amino acid metabolism; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5756 GTF3C5 Bryony Thompson gene: GTF3C5 was added
gene: GTF3C5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GTF3C5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF3C5 were set to 38520561; 35503477
Phenotypes for gene: GTF3C5 were set to neurodevelopmental disorder MONDO:0700092, GTF3C5-related
Review for gene: GTF3C5 was set to GREEN
gene: GTF3C5 was marked as current diagnostic
Added comment: 4 families/probands with syndromic ID. Loss of function is the expected
PMID: 38520561 - Biallelic variants identified (3 missense & 1 stopgain) in 4 individuals from 3 families presenting with multisystem developmental syndrome including the features: growth retardation, developmental delay, intellectual disability, dental anomalies, cerebellar malformations, delayed bone age, skeletal anomalies, and facial dysmorphism. Gene-disease relationship supported by: reduced protein expression in patient cells, yeast assays, and a zebrafish model
PMID: 35503477 - 1 proband with biallelic missense variants and hypomelanosis of Ito, seizures, growth retardation, abnormal brain MRI, developmental delay, and facial dysmorphism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5752 DISP1 Zornitza Stark Mode of inheritance for gene: DISP1 was changed from Other to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5750 DISP1 Zornitza Stark edited their review of gene: DISP1: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.5750 DISP1 Zornitza Stark edited their review of gene: DISP1: Added comment: PMID: 38529886
25 individuals from 20 unrelated families with a phenotype associated with mild holoprosencephaly (HPE).
A total of 23 different variants were identified in DISP1 (missense, frameshift and nonsense).
14 heterozygous individuals , 5 compound heterozygous individuals, 6 homozygous individuals (5 of the individuals were from 3 unrelated consanguineous families).

HPE phenotype was also seen prenatally as one of the reported monoallelic individuals was a fetus at 20+6 GW prior to passing due to MTP.; Changed publications: 19184110, 26748417, 23542665, 38529886; Changed phenotypes: Holoprosencephaly (MONDO:0016296), DISP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5746 DOCK4 Sangavi Sivagnanasundram changed review comment from: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities.

Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Two of the individuals are reportedly compound heterozygous.

Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).
Intellectual disability syndromic and non-syndromic v0.5746 DOCK4 Sangavi Sivagnanasundram changed review comment from: Well-established gene-disease association

7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities.

Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities.

Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).
Intellectual disability syndromic and non-syndromic v0.5745 FRYL Ain Roesley gene: FRYL was added
gene: FRYL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FRYL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FRYL were set to 38479391
Phenotypes for gene: FRYL were set to neurodevelopmental disorder MONDO:0700092, FRYL-related
Review for gene: FRYL was set to GREEN
gene: FRYL was marked as current diagnostic
Added comment: 14 individuals, all de novo except 1x duo testing (not present in tested father)
5x missense + 8x fs/stopgain + 1x canonical splice

13/13 with ID/DD (1x deceased)
4/14 seizures
7/14 with cardiac anomalies such as PDA, TOF, VSD, dextrocardia

1x also has a de novo fs variant in SF3B4
1x also has a de novo stop gain variant in SDHA

functional studies using flies were performed
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5743 KCNB2 Ain Roesley gene: KCNB2 was added
gene: KCNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNB2 were set to 38503299
Phenotypes for gene: KCNB2 were set to neurodevelopmental disorder MONDO:0700092, KCNB2-related
Review for gene: KCNB2 was set to GREEN
gene: KCNB2 was marked as current diagnostic
Added comment: 7 individuals, all missense
5 de novo + 1x inherited from father who has hypotonia + 1x from asymptomatic father

2/5 MRI anomalies
2/5 cardiac anomalies
2/7 urogenital anomalies
7/7 with ID
2/7 epilepsy
2/7 hypotonia
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5742 DOCK4 Sangavi Sivagnanasundram edited their review of gene: DOCK4: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.5741 PLXNB2 Chirag Patel gene: PLXNB2 was added
gene: PLXNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLXNB2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNB2 were set to PMID: 38458752
Phenotypes for gene: PLXNB2 were set to Amelogenesis imperfecta MONDO:0019507, PLXNB2 -related; Sensorineural hearing loss disorder MONDO:0020678, PLXNB2 -related
Review for gene: PLXNB2 was set to GREEN
gene: PLXNB2 was marked as current diagnostic
Added comment: 8 individuals from 6 families with core features of amelogenesis imperfecta and sensorineural hearing loss. Intellectual disability, ocular disease, ear developmental abnormalities and lymphoedema were also present in multiple cases. WES and WGS identified biallelic pathogenic variants in PLXNB2 (missense, nonsense, splice and a multiexon deletion variants). Variants segregated with disease.

PLXNB2 is a large transmembrane semaphorin receptor protein, and semaphorin-plexin signalling controls cellular interactions that are critical during development as well as in adult life stages. Plxnb2 expression was detected in differentiating ameloblasts in mice. Human phenotype overlaps with that seen in Plxnb2 knockout mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5738 CEP295 Chirag Patel gene: CEP295 was added
gene: CEP295 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CEP295 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP295 were set to PMID: 38154379
Phenotypes for gene: CEP295 were set to Seckel syndrome 11, OMIM # 620767
Review for gene: CEP295 was set to GREEN
gene: CEP295 was marked as current diagnostic
Added comment: 4 children from 2 unrelated families with Seckel-like syndrome - severe primary microcephaly, short stature, developmental delay, intellectual disability, facial deformities, and abnormalities of fingers and toes. WES identified biallelic pathogenic variants in CEP295 gene (p(Q544∗) and p(R1520∗); p(R55Efs∗49) and p(P562L)).

Patient-derived fibroblasts and CEP295-depleted U2OS and RPE1 cells were used to clarify the underlying mechanisms. Depletion of CEP295 resulted in a decrease in the numbers of centrioles and centrosomes and triggered p53-dependent G1 cell cycle arrest. Loss of CEP295 caused extensive primary ciliary defects in both patient-derived fibroblasts and RPE1 cells. The results from complementary experiments revealed that the wild-type CEP295, but not the mutant protein, can correct the developmental defects of the centrosome/centriole and cilia in the patient-derived skin fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5734 USP27X Zornitza Stark edited their review of gene: USP27X: Added comment: Ten additional individuals and further experimental data reported.; Changed rating: GREEN; Changed publications: 25644381, 38182161; Changed phenotypes: Intellectual disability, X-linked 105, MIM#300984
Intellectual disability syndromic and non-syndromic v0.5731 FEM1B Zornitza Stark edited their review of gene: FEM1B: Added comment: Five individuals reported now with same recurrent missense variant, NM_015322.5:c.377G>A NP_056137.1:p.(Arg126Gln). Affected individuals shared a severe neurodevelopmental disorder with behavioral phenotypes and a variable set of malformations, including brain anomalies, clubfeet, skeletal abnormalities, and facial dysmorphism. Overexpression of the the FEM1BR126Q variant but not FEM1B wild-type protein, during mouse brain development, resulted in delayed neuronal migration of the target cells.; Changed rating: GREEN; Changed publications: 31036916, 38465576; Changed phenotypes: Syndromic disease MONDO:0002254, FEM1B-related
Intellectual disability syndromic and non-syndromic v0.5729 USP14 Zornitza Stark gene: USP14 was added
gene: USP14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: USP14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: USP14 were set to 38469793; 35066879
Phenotypes for gene: USP14 were set to Syndromic disease MONDO:0002254, USP14-related
Review for gene: USP14 was set to AMBER
Added comment: AMBER rating as two of the families had affected fetuses, one had a severely affected newborn, and fourth had a progressive course: none fit well with ID, though there's likely to be a continuum.

PMID 35066879: 3 fetuses from 2 different branches of a consanguineous family, presenting with distal arthrogryposis, underdevelopment of the corpus callosum, and dysmorphic facial features. Exome sequencing identified a biallelic 4-bp deletion (c.233_236delTTCC; p.Leu78Glnfs*11) in USP14, and sequencing of family members showed segregation with the phenotype. Ubiquitin-specific protease 14 (USP14) encodes a major proteasome-associated deubiquitinating enzyme with an established dual role as an inhibitor and an activator of proteolysis, maintaining protein homeostasis. Usp14-deficient mice show a phenotype similar to lethal human multiple congenital contractures phenotypes, with callosal anomalies, muscle wasting, and early lethality, attributed to neuromuscular junction defects due to decreased monomeric ubiquitin pool. RT-qPCR experiment in an unaffected heterozygote revealed that mutant USP14 was expressed, indicating that abnormal transcript escapes nonsense-mediated mRNA decay.

PMID 38469793: biallelic USP14 variants in four individuals from three unrelated families: one fetus, a newborn with a syndromic NDD, and two siblings affected by a progressive neurological disease. Specifically, the two siblings from the latter family carried two compound heterozygous variants c.8T>C p.(Leu3Pro) and c.988C>T p.(Arg330*), while the fetus had a homozygous frameshift c.899_902del p.(Lys300Serfs*24) variant and the newborn patient harbored a homozygous frameshift c.233_236del p.(Leu78Glnfs*11) variant. The fetus and the newborn had extensive brain malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5728 DOCK4 Sangavi Sivagnanasundram reviewed gene: DOCK4: Rating: ; Mode of pathogenicity: None; Publications: PMID: 38526744; Phenotypes: DOCK4-related neurodevelopmental disorder (MONDO:0060490); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.5727 SLC32A1 Zornitza Stark Phenotypes for gene: SLC32A1 were changed from Generalized epilepsy with febrile seizures plus, type 12, MIM# 620755 to Generalized epilepsy with febrile seizures plus, type 12, MIM# 620755; Developmental and epileptic encephalopathy 114, MIM# 620774
Intellectual disability syndromic and non-syndromic v0.5726 SLC32A1 Zornitza Stark reviewed gene: SLC32A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 114, MIM# 620774; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5725 CRELD1 Zornitza Stark reviewed gene: CRELD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5725 SV2A Zornitza Stark Phenotypes for gene: SV2A were changed from Neurodevelopmental disorder, MONDO:0700092, SV2A-related to Neurodevelopmental disorder, MONDO:0700092, SV2A-related; Developmental and epileptic encephalopathy 113, MIM# 620772
Intellectual disability syndromic and non-syndromic v0.5724 SV2A Zornitza Stark reviewed gene: SV2A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 113, MIM# 620772; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5723 ZFHX3 Zornitza Stark edited their review of gene: ZFHX3: Added comment: Now published PMID 38412861; Changed publications: 38412861
Intellectual disability syndromic and non-syndromic v0.5723 SLC32A1 Zornitza Stark Phenotypes for gene: SLC32A1 were changed from developmental and epileptic encephalopathy MONDO:0100062, SLC32A1-related to Generalized epilepsy with febrile seizures plus, type 12, MIM# 620755
Intellectual disability syndromic and non-syndromic v0.5722 PTRHD1 Zornitza Stark Phenotypes for gene: PTRHD1 were changed from Parkinsonism; Intellectual disability to Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747
Intellectual disability syndromic and non-syndromic v0.5721 PTRHD1 Zornitza Stark edited their review of gene: PTRHD1: Changed phenotypes: Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747
Intellectual disability syndromic and non-syndromic v0.5721 SLC4A10 Zornitza Stark Phenotypes for gene: SLC4A10 were changed from Neurodevelopmental disorderMONDO:0700092, SLC4A10-related to Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746
Intellectual disability syndromic and non-syndromic v0.5720 SLC4A10 Zornitza Stark reviewed gene: SLC4A10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5718 NARS Zornitza Stark changed review comment from: AR disorder: assessed as LIMITED by ClinGen (borderline MODERATE).; to: Both MOIs assessed as MODERATE by ClinGen.
Intellectual disability syndromic and non-syndromic v0.5717 CELSR3 Crystle Lee gene: CELSR3 was added
gene: CELSR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELSR3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CELSR3 were set to PMID: 38429302
Phenotypes for gene: CELSR3 were set to Neurodevelopmental disorder (MONDO#0700092), CELSR3-related
Review for gene: CELSR3 was set to GREEN
Added comment: PMID: 38429302:12 affected individuals from 11 families reported with bi-allelic variants. Phenotype ranged from CNS anomalies (7/12), CNS and CAKUT (3/12) and CAKUT only (2/12). 8/12 has ID/DD. Only missense variants reported and 1 inframe variant. Functional studies done in zebrafish demonstrate similar structural anomalies of the developing pronephros and neuronal abnormalities to affected individuals
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5715 ZSCAN10 Rylee Peters gene: ZSCAN10 was added
gene: ZSCAN10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZSCAN10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZSCAN10 were set to PMID: 38386308
Phenotypes for gene: ZSCAN10 were set to Syndromic disease MONDO:0002254
Review for gene: ZSCAN10 was set to GREEN
Added comment: Bi-allelic ZSCAN10 loss-of-function variants were identified in seven affected individuals from five unrelated families with syndromic neurodevelopmental disorder.

Highly consistent phenotypic features include global developmental delay, behavioural abnormalities, and variable facial asymmetry with outer and inner ear malformations leading to profound SNHL.

Facial asymmetry was recapitulated in the Zscan10 mouse model along with inner and outer ear malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5715 SNF8 Elena Savva Phenotypes for gene: SNF8 were changed from Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia to Neurodevelopmental disorder (MONDO:0700092), SNF8-related
Intellectual disability syndromic and non-syndromic v0.5714 SLC12A9 Zornitza Stark gene: SLC12A9 was added
gene: SLC12A9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC12A9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC12A9 were set to 38334070
Phenotypes for gene: SLC12A9 were set to Neurodevelopmental disorder, MONDO:0700092, SLC12A9-related
Review for gene: SLC12A9 was set to GREEN
Added comment: Three individuals from unrelated families with bi-allelic LoF variants and a neurodevelopmental phenotype, skeletal abnormalities, brain abnormalities, hypopigmentation, dysmorphic features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5713 SNF8 Chern Lim edited their review of gene: SNF8: Changed phenotypes: Neurodevelopmental disorder (MONDO:0700092), SNF8-related
Intellectual disability syndromic and non-syndromic v0.5713 DIP2C Melanie Marty gene: DIP2C was added
gene: DIP2C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DIP2C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DIP2C were set to PMID: 38421105
Phenotypes for gene: DIP2C were set to Neurodevelopmental disorder (MONDO#0700092), DIP2C-related
Review for gene: DIP2C was set to GREEN
Added comment: PMID: 38421105 - Twenty three patients with het DIP2C variants (10 de novo).
All patients had developmental delays affecting expressive language and speech, most had mild dev delay and ID. Four patients had seizures. Additional phenotypic findings were non-specific but recurrent anomalies did include a high anterior hair-line, prominent forehead, and a broad nasal tip. Four patients had cardiac defects (hypertrophic cardiomyopathy, atrial septal defects,and bicuspid aortic valve)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5713 DENND5B Elena Savva Mode of pathogenicity for gene: DENND5B was changed from None to None
Intellectual disability syndromic and non-syndromic v0.5712 SNF8 Chern Lim gene: SNF8 was added
gene: SNF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNF8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNF8 were set to 38423010
Phenotypes for gene: SNF8 were set to Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia
Review for gene: SNF8 was set to GREEN
gene: SNF8 was marked as current diagnostic
Added comment: PMID: 38423010
- Nine individuals from six families presenting with a spectrum of neurodevelopmental/neurodegenerative features caused by bi-allelic variants in SNF8. In total, three putative LoF variants and four missense variants were identified.
- The phenotypic spectrum included four individuals with severe developmental and epileptic encephalopathy, massive reduction of white matter, hypo-/aplasia of the corpus callosum, neurodevelopmental arrest, and early death. A second cohort shows a milder phenotype with intellectual disability, childhood-onset optic atrophy, or ataxia. All mildly affected individuals shared the same hypomorphic variant, c.304G>A (p.Val102Ile) as compound heterozygous.
- Functional studies using fibroblasts derived from patients and zebrafish model showed LoF is the disease mech.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5711 POP1 Belinda Chong reviewed gene: POP1: Rating: AMBER; Mode of pathogenicity: None; Publications: 38351533; Phenotypes: Anauxetic dysplasia 2, MIM#617396; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5711 RREB1 Zornitza Stark gene: RREB1 was added
gene: RREB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RREB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RREB1 were set to 32938917; 38332451
Phenotypes for gene: RREB1 were set to Rasopathy, MONDO:0021060, RREB1-related
Review for gene: RREB1 was set to AMBER
Added comment: PMID 32938917: Single individual reported with Noonan syndrome-like features and a deletion encompassing RREB1. Overlapping deletions in publicly reported databases examined, and RREB1 postulated to be the key gene. Rreb1 hemizygous mice display orbital hypertelorism and age dependent cardiac hypertrophy. RREB1 recruits SIN3A and KDM1A to an RRE in target promoters in human and murine cells to control histone H3K4 methylation of MAPK pathway genes. In summary, single well phenotyped individual with a CNV and experimental data to support gene-disease association.

PMID 38332451: de novo LoF variant in an individual with phenotype consistent with the previous reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5709 FEZF2 Ain Roesley gene: FEZF2 was added
gene: FEZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FEZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FEZF2 were set to 38425142
Phenotypes for gene: FEZF2 were set to neurodevelopmental disorder MONDO:0700092, FEZF2-related
Review for gene: FEZF2 was set to GREEN
gene: FEZF2 was marked as current diagnostic
Added comment: - 7 indiv but 1 has whole gene deletion and 6x SNV (4x PTCs and 2x same missense Arg344Cys)
- of the 6x SNV, 4x de novo + 1x from affected father
- all have ID/ASD
- 1x seizures
- 1x hypotonia
- 1x motor coordination disorder
- 2x enuresis after 7yo
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5708 ZFX Zornitza Stark Phenotypes for gene: ZFX were changed from X-linked neurodevelopmental disorder with recurrent facial gestalt to Neurodevelopmental disorder, MONDO:0700092, ZFX-related
Intellectual disability syndromic and non-syndromic v0.5706 ZFX Sarah Leigh gene: ZFX was added
gene: ZFX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZFX was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: ZFX were set to 26350204; 26740508; 38325380
Phenotypes for gene: ZFX were set to X-linked neurodevelopmental disorder with recurrent facial gestalt
Review for gene: ZFX was set to GREEN
Added comment: To date, germline variants in ZFX have not been associated with a phenotype in OMIM or Gen2Phen.
A single ZFX variant has been associated with a neurodevelopmental disorder, that has a Rett syndrome-like phenotype disorder, in a 14 year old male. The ZFX variant was allelic with another X-linked variant in SHROOM4. These variants were inherited from the mother, who had random X inactivation pattern (PMID: 26740508).
PMID: 38325380 reports 11 ZFX variants in 18 subjects from 16 unrelated families (14 males and 4 females) with an X-linked neurodevelopmental disorder with recurrent facial gestalt. Seven variants were truncating and the remaining were missense variants within the Zinc finger array. In the pedigree of family 6 (figure 3, PMID: 38325380), it was apparent that there were female carriers of the ZFX variant (GRCh38 chrX: 24229396A>G, c.2438A>G, p.Tyr774Cys) with hyperparathyroidism and two affected males and one affected female, with the neurodevelopmental disorder. It appeared that skewed X-inactivation in the female carriers was responsible for the different phenotypic features. The association between ZFX variants and a novel neurodevelopmental disorder, was further supported by functional studies showing altered transcriptional activity in missense variants and altered behavior in a zebrafish loss-of-function model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5706 PI4K2A Zornitza Stark Phenotypes for gene: PI4K2A were changed from complex neurodevelopmental disorder with motor features, PI4K2A-related, MONDO:0100516 to Neurodevelopmental disorder with hyperkinetic movements, seizures and structural brain abnormalities, MIM# 620732
Intellectual disability syndromic and non-syndromic v0.5705 CBL Hali Van Niel reviewed gene: CBL: Rating: GREEN; Mode of pathogenicity: None; Publications: 20694012, 20543203, 11315197; Phenotypes: CBL-related disorder MONDO:0013308; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 CACNA1A Hali Van Niel reviewed gene: CACNA1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 27476654, 33985586; Phenotypes: developmental and epileptic encephalopathy, 42 MONDO:0014917; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 C12orf65 Hali Van Niel reviewed gene: C12orf65: Rating: GREEN; Mode of pathogenicity: None; Publications: 24284555, 20598281, 23188110, 24080142, PMID: 3479531; Phenotypes: hereditary spastic paraplegia 55 MONDO:0014020; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BTD Hali Van Niel reviewed gene: BTD: Rating: GREEN; Mode of pathogenicity: None; Publications: 7550325, 9375914, 37751899, 32741581; Phenotypes: biotinidase deficiency MONDO:0009665; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BSCL2 Hali Van Niel reviewed gene: BSCL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 12362029, 26072926, 28916377; Phenotypes: congenital generalized lipodystrophy type 2 MONDO:0010020; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BCS1L Hali Van Niel reviewed gene: BCS1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 9777342, 17314340, 11528392, 30582773, 30582773, 25914718; Phenotypes: Bjornstad syndrome MONDO:0009872; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BCKDHB Hali Van Niel reviewed gene: BCKDHB: Rating: GREEN; Mode of pathogenicity: None; Publications: 7672509, 11509994, 14742428; Phenotypes: maple syrup urine disease type 1B MONDO:0023692; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BCKDHA Hali Van Niel reviewed gene: BCKDHA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7883996, 7672509, 34288399; Phenotypes: maple syrup urine disease type 1A MONDO:0023691; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BBS2 Hali Van Niel reviewed gene: BBS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 11285252, 11567139; Phenotypes: Bardet-Biedl syndrome 2 MONDO:0014432; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BBS12 Hali Van Niel reviewed gene: BBS12: Rating: GREEN; Mode of pathogenicity: None; Publications: 17160889, 20827784; Phenotypes: Bardet-Biedl syndrome 12 MONDO:0014440; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BBS10 Hali Van Niel reviewed gene: BBS10: Rating: GREEN; Mode of pathogenicity: None; Publications: 16582908, 20805367, 27245532; Phenotypes: Phenotype: Bardet-Biedl syndrome 10 MONDO:0014438; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5705 BBS1 Hali Van Niel reviewed gene: BBS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12118255, 12677556, 12567324; Phenotypes: Bardet-Biedl syndrome 1 MONDO:0008854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5704 PUM1 Zornitza Stark Phenotypes for gene: PUM1 were changed from Spinocerebellar ataxia 47, MIM#617931; intellectual disability; epilepsy to Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719
Intellectual disability syndromic and non-syndromic v0.5703 PUM1 Zornitza Stark edited their review of gene: PUM1: Changed phenotypes: Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719
Intellectual disability syndromic and non-syndromic v0.5703 PUM1 Zornitza Stark edited their review of gene: PUM1: Changed phenotypes: Spinocerebellar ataxia 47, MIM#617931, Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719
Intellectual disability syndromic and non-syndromic v0.5700 HMBS Zornitza Stark edited their review of gene: HMBS: Changed publications: 15534187, 34089223; Changed phenotypes: Encephalopathy, porphyria-related MIM#620704, Leukoencephalopathy, porphyria-related, MIM#620711
Intellectual disability syndromic and non-syndromic v0.5700 HMBS Zornitza Stark gene: HMBS was added
gene: HMBS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: HMBS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HMBS were set to 15534187
Phenotypes for gene: HMBS were set to Encephalopathy, porphyria-related MIM#620704; Leukoencephalopathy, porphyria-related, MIM#620711
Review for gene: HMBS was set to GREEN
Added comment: Several families reported with encephalopathy/leukoencephalopathy and ballelic variants in this gene.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5699 DDX3X Abhijit Kulkarni edited their review of gene: DDX3X: Changed publications: PMID: 32135084, 32852922
Intellectual disability syndromic and non-syndromic v0.5699 DDX3X Abhijit Kulkarni changed review comment from: Genotype-Phenotype Correlations

Females. Affected females with a subset of missense variants generally are more severely affected than those with truncating variants [Lennox et al 2020].

Polymicrogyria has been associated with missense or in-frame deletions [Lennox et al 2020].

Males. While all affected males have had missense DDX3X variants (see Table 6), their female relatives who are heterozygous for the same DDX3X variant do not manifest an atypical neurodevelopmental phenotype.; to: Genotype-Phenotype Correlations

Females. Affected females with a subset of missense variants generally are more severely affected than those with truncating variants PMID: 32135084

Polymicrogyria has been associated with missense or in-frame deletions PMID: 32135084

Males. While all affected males have had missense DDX3X variants , their female relatives who are heterozygous for the same DDX3X variant do not manifest an atypical neurodevelopmental phenotype.
Intellectual disability syndromic and non-syndromic v0.5698 FBXO31 Lucy Spencer reviewed gene: FBXO31: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 45 (MIM#615979); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5698 TET3 Elena Savva Phenotypes for gene: TET3 were changed from Intellectual disability; dysmorphic features; abnormal growth; movement disorders to Beck-Fahrner syndrome MIM#618798
Intellectual disability syndromic and non-syndromic v0.5695 NDUFB9 Zornitza Stark edited their review of gene: NDUFB9: Added comment: PMID: 38129218: Thr144Met, listed as ACMG-P, hom in 1x pt with mito complex I deficiency and leukodystrophy, no functional studies, both parents are het. However, this variant has 2 homozygotes in gnomADv4, so unlikely pathogenic.; Changed publications: 22200994, 38129218
Intellectual disability syndromic and non-syndromic v0.5693 CSTF2 Zornitza Stark edited their review of gene: CSTF2: Changed phenotypes: Intellectual developmental disorder, X-linked 113, MIM# 301116
Intellectual disability syndromic and non-syndromic v0.5692 ASCC3 Zornitza Stark gene: ASCC3 was added
gene: ASCC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: ASCC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ASCC3 were set to 21937992; 35047834
Phenotypes for gene: ASCC3 were set to Intellectual developmental disorder, autosomal recessive 81, MIM# 620700
Review for gene: ASCC3 was set to GREEN
Added comment: Combined neuromuscular and neurobehavioral phenotype.

11 individuals from 7 unrelated families with homozygous (missense) or compound heterozygous variants (missense with a presumed LoF variant or 2 missense, no biallelic LoF) with a neurologic phenotype that ranges from severe developmental delay to muscle fatigue
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5688 HNRNPC Zornitza Stark edited their review of gene: HNRNPC: Changed phenotypes: intellectual developmental disorder-74, MIM#620688
Intellectual disability syndromic and non-syndromic v0.5687 WDR44 Zornitza Stark gene: WDR44 was added
gene: WDR44 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR44 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: WDR44 were set to 38191484
Phenotypes for gene: WDR44 were set to Ciliopathy, MONDO:0005308, WDR44-related
Review for gene: WDR44 was set to GREEN
Added comment: 11 male patients with 6 missense and 1 nonsense variant in WDR44 displaying a wide range of cognitive impairment and variable congenital anomalies associated with primary cilium dysfunction. All patients had learning difficulties with 8 labelled as intellectually disabled (mild-moderate). Other clinical features included anomalies of craniofacial, musculoskeletal, brain, renal and cardiac development.
WDR44 is a negative regulator of ciliogenesis. Increased binding is hypothesised to underlie the pathogenicity of WDR44 variants identified in this cohort. Functional data supported impaired ciliogenesis initiation in patient fibroblasts and a zebrafish model. A zebrafish model recapitulated the human phenotype when morphants expressed WDR44 L668S, D669N, S764F, G782C, H839R, and R733* variants. Of note, D648G or N840S did not recapitulate the phenotype in the zebrafish model.
The studies supported a GoF mechanism, but the authors could not rule out that LoF of WDR44 contributes to the ciliopathy-like phenotype observed, because protein expression data was only available for a limited number of patients.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5685 ACACA Zornitza Stark gene: ACACA was added
gene: ACACA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ACACA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ACACA were set to 34552920; 10677481; 16717184; 36709796
Phenotypes for gene: ACACA were set to Acetyl-CoA carboxylase deficiency, MIM# 613933
Review for gene: ACACA was set to AMBER
Added comment: Two families with molecular testing, missense variants, supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5683 SP9 Suliman Khan gene: SP9 was added
gene: SP9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SP9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SP9 were set to PMID: 38288683
Phenotypes for gene: SP9 were set to neurodevelopmental disorder MONDO:0700092
Review for gene: SP9 was set to GREEN
Added comment: PMID: 38288683: reported 5 unrelated patients with de novo heterozygous variants (missense and PTV) in SP9 gene. In silico and in vitro studies suggested a novel form of interneuronopathy with variable severity depending on the presence of loss or gain of function variants. Patients with loss-of-function variants had ID, ASD, and epilepsy, whereas missense variants in the second C2H2 binding domain result in hypomorphic and neomorphic DNA binding functions that cause severe epileptic encephalopathy. The author suggested a novel form of interneuronopathy with variable severity depending on the presence of loss or gain of function variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5682 CAMK2D Elena Savva gene: CAMK2D was added
gene: CAMK2D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAMK2D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CAMK2D were set to PMID: 38272033
Phenotypes for gene: CAMK2D were set to Neurodevelopmental disorder (MONDO#0700092), CAMK2D-related
Review for gene: CAMK2D was set to GREEN
Added comment: PMID: 38272033
- 8 patients (5/8 de novo) with mostly missense and a single splice site variant, ages range from 5 weeks to 20 years old
- Most variants functionally shown to have a GOF mechanism causing addition DCM phenotype, LOF is only neurological
- Phenotypes include dev delay (mild-severe) (7/7 patients), skeletal anomalies (7/8, scoliosis, kyphosis, involving spine/hands/feet/palate), DCM (6/8), seizures (3/8), visual anomalies (astigmatism, cortical vision impairment, myopia, strabismus 5/5), enlarged brain ventricles (3/5)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5679 RBMX Zornitza Stark edited their review of gene: RBMX: Added comment: PMID 37277488: In-frame deletion reported in a large multiplex Swedish family; Changed publications: 25256757, 34260915, 37277488; Changed phenotypes: Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238, Gustavson syndrome, MIM# 309555
Intellectual disability syndromic and non-syndromic v0.5675 POLR1A Zornitza Stark Mode of inheritance for gene: POLR1A was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5674 POLR1A Zornitza Stark reviewed gene: POLR1A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 27, MIM# 620675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5674 ATP6V0A1 Elena Savva Phenotypes for gene: ATP6V0A1 were changed from Developmental and epileptic encephalopathy 104 MIM#619970; Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 to Developmental and epileptic encephalopathy 104 MIM#619970; Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971
Intellectual disability syndromic and non-syndromic v0.5673 ATP6V0A1 Elena Savva Phenotypes for gene: ATP6V0A1 were changed from Developmental and epileptic encephalopathy 104 MIM#619970; Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 to Developmental and epileptic encephalopathy 104 MIM#619970; Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971
Intellectual disability syndromic and non-syndromic v0.5673 ATP6V0A1 Elena Savva Phenotypes for gene: ATP6V0A1 were changed from Neurodevelopmental disorder, MONDO:0700092, ATP6V0A1-related to Developmental and epileptic encephalopathy 104 MIM#619970; Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971
Intellectual disability syndromic and non-syndromic v0.5666 PPFIA3 Zornitza Stark gene: PPFIA3 was added
gene: PPFIA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPFIA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPFIA3 were set to 37034625
Phenotypes for gene: PPFIA3 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related
Review for gene: PPFIA3 was set to GREEN
Added comment: 19 individuals with mono-allelic variants presenting with features including developmental delay, intellectual disability, hypotonia, micro/macrocephaly, autism, and epilepsy.

One individual with compound het variants: insufficient evidence for bi-allelic variants causing disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5661 MAX Rylee Peters gene: MAX was added
gene: MAX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAX were set to 38141607
Phenotypes for gene: MAX were set to Syndromic disease (MONDO:0002254), MAX-related
Review for gene: MAX was set to GREEN
Added comment: Three individuals who each share a recurrent de novo germline variant in the MAX gene, resulting in a p.Arg60Gln substitution in the loop of the b-HLH-LZ domain.

Affected individuals have a complex disorder consisting primarily of macrocephaly, polydactyly, and delayed ophthalmic development. Other phenotypes reported include intellectual disability, perianal abscesses, pectus carinatum, hypospadias, renal agenesis, single umbilical artery, flattened thoracic vertebrae.

Functional analysis of the p.Arg60Gln variant shows a significant increase in CCND2 protein and a more efficient heterodimerization with c-Myc resulting in an increase in transcriptional activity of c-Myc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 ZRSR2 Chris Ciotta gene: ZRSR2 was added
gene: ZRSR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZRSR2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ZRSR2 were set to PMID: 38158857
Phenotypes for gene: ZRSR2 were set to Orofacialdigital syndrome MONDO:0015375, ZRSR2-related
Review for gene: ZRSR2 was set to GREEN
Added comment: Oral-facial-digital (OFD) syndrome with brain anomalies ranging from alobar holoprosencephaly to pituitary anomalies.
Six unrelated families with two truncating variants and functional studies:
- p.(Gly404GlufsTer23): detected in one family with 2x affected males
- p.(Arg403GlyfsTer24): 5 unrelated families, both de novo and inherited
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 BORCS8 Lauren Rogers changed review comment from: 3 unrelated families with five affected children with homozygous or compound heterozygous loss of function missense and PTC variants.

HEK293T cells show the missense variants are expressed at normal levels but exhibit reduced assembly with other BORC subunits and reduced ability to drive lysosome distribution. The BORCS8 PTC frameshift variant is expressed at lower levels and is completely incapable of assembling with other BORC subunits and promoting lysosome distribution. Zebrafish KO of the orthologous brocs8 causes decreased brain and eye size, neuromuscular anomalies and impaired locomotion, recapitulating some of the key traits of the human disease.
Sources: Literature; to: 3 unrelated families with five affected children with homozygous or compound heterozygous loss of function missense and PTC variants. 5/5 hypotonia, failure to thrive, global developmental delay, profound intellectual disability, muscle weakness and atrophy, dysmorphic features. 3/5 with microcephaly, 3/5 with seizures, 4/5 with spasticity, 3/5 with scoliosis, 4/4 with optic atrophy.

HEK293T cells show the missense variants are expressed at normal levels but exhibit reduced assembly with other BORC subunits and reduced ability to drive lysosome distribution. The BORCS8 PTC frameshift variant is expressed at lower levels and is completely incapable of assembling with other BORC subunits and promoting lysosome distribution. Zebrafish KO of the orthologous brocs8 causes decreased brain and eye size, neuromuscular anomalies and impaired locomotion, recapitulating some of the key traits of the human disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 SOX8 Paul De Fazio changed review comment from: Proband presented to genetics clinic at 27 years of age with BMI -3.4SD, height -2.7SD, head circumference -1.8SD. She had mild intellectual delay and clinical features of a congenital, nonprogressive myopathy with moderate proximal and distal weakness. X-rays showed skeletal dysplasia, including cervical thoracic scoliosis and lumbar scoliosis. She was reported as having had weakness at birth with poor suck, micrognathia, hypotonia, and talipes. She was documented to have significant motor delay as a child. MRI of the brain demonstrated large posterior fossa CSF spaces.

Biallelic SOX8 variants biallelic (NM_014587.3:c.422+5G>C; c.583dup p.(His195ProfsTer11)) were identified by WGS. The +5 variant was shown to affect splicing, while the frameshift variant resulted in production of low-level truncated protein (not NMD predicted).
Sources: Literature; to: Proband presented to genetics clinic at 27 years of age with BMI -3.4SD, height -2.7SD, head circumference -1.8SD. She had mild intellectual delay and clinical features of a congenital, nonprogressive myopathy with moderate proximal and distal weakness. X-rays showed skeletal dysplasia, including cervical thoracic scoliosis and lumbar scoliosis. She was reported as having had weakness at birth with poor suck, micrognathia, hypotonia, and talipes. She was documented to have significant motor delay as a child. MRI of the brain demonstrated large posterior fossa CSF spaces.

Biallelic SOX8 variants biallelic (NM_014587.3:c.422+5G>C; c.583dup p.(His195ProfsTer11)) were identified by WGS. The +5 variant was shown to affect splicing, while the frameshift variant resulted in production of low-level truncated protein (not NMD predicted). Functional studies on patient fibroblasts showed misregulation of downstream SOX8 targets.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 CACHD1 Suliman Khan gene: CACHD1 was added
gene: CACHD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CACHD1 were set to PMID: 38158856
Phenotypes for gene: CACHD1 were set to syndromic complex neurodevelopmental disorder MONDO:0800439
Penetrance for gene: CACHD1 were set to unknown
Review for gene: CACHD1 was set to GREEN
Added comment: PMID: 38158856 - Six affected individuals from four unrelated families with homozygous CACHD1 variants (3 splice, 2 frameshift and 1 nonsense variant). Excluding the two fatal cases, all other were affected by syndromic neurodevelopmental abnormalities, multiple organ systems featuring global impairment of psychomotor development, dysmorphic facial features, genitourinary abnormalities, oculo-auricular and congenital malformation. Seizure was reported in one case. Whole exome sequencing identified bi-allelic loss of function variants in the CACHD1 gene. In vitro human neural models of CACHD1 depletion displayed dysregulated of Wnt signaling in the developing brain.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 SOX8 Paul De Fazio gene: SOX8 was added
gene: SOX8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SOX8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SOX8 were set to https://www.neurology.org/doi/full/10.1212/NXG.0000000000200088
Phenotypes for gene: SOX8 were set to Neurodevelopmental disorder (MONDO:0700092), SOX8-related
Review for gene: SOX8 was set to RED
gene: SOX8 was marked as current diagnostic
Added comment: Proband presented to genetics clinic at 27 years of age with BMI -3.4SD, height -2.7SD, head circumference -1.8SD. She had mild intellectual delay and clinical features of a congenital, nonprogressive myopathy with moderate proximal and distal weakness. X-rays showed skeletal dysplasia, including cervical thoracic scoliosis and lumbar scoliosis. She was reported as having had weakness at birth with poor suck, micrognathia, hypotonia, and talipes. She was documented to have significant motor delay as a child. MRI of the brain demonstrated large posterior fossa CSF spaces.

Biallelic SOX8 variants biallelic (NM_014587.3:c.422+5G>C; c.583dup p.(His195ProfsTer11)) were identified by WGS. The +5 variant was shown to affect splicing, while the frameshift variant resulted in production of low-level truncated protein (not NMD predicted).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 BORCS8 Lauren Rogers gene: BORCS8 was added
gene: BORCS8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BORCS8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BORCS8 were set to 38128568
Phenotypes for gene: BORCS8 were set to Neurodevelopmental disorder (MONDO#0700092), BORCS8-related
Review for gene: BORCS8 was set to GREEN
Added comment: 3 unrelated families with five affected children with homozygous or compound heterozygous loss of function missense and PTC variants.

HEK293T cells show the missense variants are expressed at normal levels but exhibit reduced assembly with other BORC subunits and reduced ability to drive lysosome distribution. The BORCS8 PTC frameshift variant is expressed at lower levels and is completely incapable of assembling with other BORC subunits and promoting lysosome distribution. Zebrafish KO of the orthologous brocs8 causes decreased brain and eye size, neuromuscular anomalies and impaired locomotion, recapitulating some of the key traits of the human disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5659 GTPBP1 Lucy Spencer gene: GTPBP1 was added
gene: GTPBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GTPBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTPBP1 were set to 38118446
Phenotypes for gene: GTPBP1 were set to Neurodevelopmental disorder (MONDO#0700092), GTPBP1-related
Review for gene: GTPBP1 was set to GREEN
Added comment: PMID: 38118446- Cohort of individuals with variants in GTPBP2 (which has been previously described) and GTPBP1 (new) who have an identical neurodevelopmental syndrome. 4 homozygous individuals from 3 consanguineous families. 2 families have different NMD-predicted nonsense variants and the third has a missense, all are absent from gnomad v4.

The shared cardinal features of GTPBP1 and 2 related disease are microcephaly, profound neurodevelopmental impairment, and distinctive craniofacial features. Epilepsy was present in 10 of 20 individuals but its not clear if those individuals had GTPBP1 or 2 variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5659 PUS3 Zornitza Stark Phenotypes for gene: PUS3 were changed from Mental retardation, autosomal recessive 55, MIM# 617051 to Neurodevelopmental disorder with microcephaly and gray sclerae, MIM# 617051
Intellectual disability syndromic and non-syndromic v0.5658 PUS3 Zornitza Stark edited their review of gene: PUS3: Changed phenotypes: Neurodevelopmental disorder with microcephaly and gray sclerae, MIM# 617051
Intellectual disability syndromic and non-syndromic v0.5654 PRICKLE2 Zornitza Stark reviewed gene: PRICKLE2: Rating: AMBER; Mode of pathogenicity: None; Publications: 34092786, 21276947, 26942291, 26942292; Phenotypes: Neurodevelopmental disorder MONDO:0700092, PRICKLE2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5653 ERI1 Zornitza Stark reviewed gene: ERI1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hoxha-Aliu syndrome, MIM# 620662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5653 ALG8 Rylee Peters reviewed gene: ALG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 35716054; Phenotypes: Congenital disorder of glycosylation, type Ih, MIM# 608104; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5653 PDE2A Lauren Rogers reviewed gene: PDE2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 32467598, 29392776, 37317634; Phenotypes: Intellectual developmental disorder with paroxysmal dyskinesia or seizures MIM#619150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5653 RAP1B Zornitza Stark Phenotypes for gene: RAP1B were changed from Syndromic disease, MONDO:0002254, RAP1B-related to Thrombocytopenia 1 with multiple congenital anomalies and dysmorphic facies, MIM# 620654
Intellectual disability syndromic and non-syndromic v0.5652 RAP1B Zornitza Stark edited their review of gene: RAP1B: Changed phenotypes: Thrombocytopenia 1 with multiple congenital anomalies and dysmorphic facies, MIM# 620654
Intellectual disability syndromic and non-syndromic v0.5652 GPT2 Zornitza Stark Phenotypes for gene: GPT2 were changed from Mental retardation, autosomal recessive 49, MIM#616281 to Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281
Intellectual disability syndromic and non-syndromic v0.5650 RAP1GDS1 Zornitza Stark edited their review of gene: RAP1GDS1: Changed phenotypes: Alfadhel syndrome, MIM# 620655
Intellectual disability syndromic and non-syndromic v0.5650 CASP2 Zornitza Stark Phenotypes for gene: CASP2 were changed from neurodevelopmental disorder MONDO:0700092, CASP2-related to Intellectual developmental disorder, autosomal recessive 80, with variant lissencephaly, MIM# 620653
Intellectual disability syndromic and non-syndromic v0.5649 CASP2 Zornitza Stark reviewed gene: CASP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 80, with variant lissencephaly, MIM# 620653; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5649 CAPRIN1 Zornitza Stark Phenotypes for gene: CAPRIN1 were changed from Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636 to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636
Intellectual disability syndromic and non-syndromic v0.5648 CAPRIN1 Zornitza Stark Phenotypes for gene: CAPRIN1 were changed from Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092 to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636
Intellectual disability syndromic and non-syndromic v0.5647 CAPRIN1 Zornitza Stark reviewed gene: CAPRIN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 36136249; Phenotypes: Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5646 MANF Zornitza Stark gene: MANF was added
gene: MANF was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: MANF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MANF were set to 26077850; 33500254; 34815294
Phenotypes for gene: MANF were set to Diabetes, deafness, developmental delay, and short stature syndrome, MIM# 620651
Review for gene: MANF was set to AMBER
Added comment: Two individuals reported with homozygous variants. Mouse model recapitulates deafness phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5642 GCDH Zornitza Stark reviewed gene: GCDH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Glutaric aciduria, type I MIM#231670; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5641 PRPF19 Zornitza Stark gene: PRPF19 was added
gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRPF19 were set to 37962958
Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related
Review for gene: PRPF19 was set to GREEN
Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5641 PRPF19 Zornitza Stark gene: PRPF19 was added
gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRPF19 were set to 37962958
Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related
Review for gene: PRPF19 was set to GREEN
Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5635 FUK Zornitza Stark Added comment: Comment when marking as ready: Promoted to Green with the additional cases.
Intellectual disability syndromic and non-syndromic v0.5631 SV2A Karina Sandoval gene: SV2A was added
gene: SV2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SV2A was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: SV2A were set to PMID: 37985816
Phenotypes for gene: SV2A were set to Epilepsy, MONDO:0005027; microcephaly MONDO:0001149; intellectual disability MONDO:0001071
Review for gene: SV2A was set to AMBER
Added comment: Monoallelic variants cause epilepsy. Biallelic variant in this 5yo with p.Arg289Ter and another 5yo from another paper with homozygous p.Arg383Gln, reported to cause severe phenotype of drug-resistant epileptic encephalopathy with microcephaly, DD, movement disorder and growth retardation.
This paper references 5 other families with both AR & AD
Family #1 – p.Arg383Gln, AR, 2 affected in family, parents healthy carriers
Family #2 – p.Arg570Cys, AD, 2 affected, inherited from affected mother (in gnomAD v2 1 het, absent from gnomAD v3)
Family #3 – p.Gly660Arg, AD, de novo
Family #4 – p.Gly660Arg, AD, segregated in 11 family members
Family #5 (this study) – p.Arg289Ter, AR, parents and 2 sibs asymptomatic carriers
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5631 FUK Lisa Norbart reviewed gene: FUK: Rating: AMBER; Mode of pathogenicity: None; Publications: (PMID: 35718084, 36426412); Phenotypes: Congenital disorder of glycosylation with defective fucosylation 2 (MIM#618324); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5631 CRELD1 Naomi Baker gene: CRELD1 was added
gene: CRELD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CRELD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRELD1 were set to PMID: 37947183
Phenotypes for gene: CRELD1 were set to Neurodevelopmental disorder (MONDO:0700092), CRELD1-related
Review for gene: CRELD1 was set to GREEN
Added comment: Publication reports 18 individuals from 14 unrelated families affected by biallelic recessive variants in CRELD1, presenting with early-onset neurodevelopmental features, most notably hypotonia and epilepsy, with developmental plateauing and slowly progressive nonneurologic medical complexities in survivors, including cardiac rhythm disturbances and frequent infections. Most individuals have a missense variant in trans with a putative null allele. Four variants were re-current: p.(Cys192Tyr) in 10 families, p.(Gln320Argfs) in 5 families, p.(Ala377Thrfs) in 2 families, and p.(Met369Val) also in 2 families. Some functional studies also reported (Xenopus tropicalis).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5629 DDX17 Elena Savva Gene: ddx17 has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers reviewed gene: PLA2G16: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37919452; Phenotypes: Lipodystrophy (MONDO:0006573); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers Deleted their review
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers reviewed gene: PLA2G16: Rating: ; Mode of pathogenicity: None; Publications: PMID: 37919452; Phenotypes: Lipodystrophy (MONDO:0006573); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers Deleted their review
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers reviewed gene: PLA2G16: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37919452; Phenotypes: Lipodystrophy (MONDO:0006573); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers Deleted their review
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers gene: PLA2G16 was added
gene: PLA2G16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLA2G16 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PLA2G16 were set to PMID: 37919452
Phenotypes for gene: PLA2G16 were set to Lipodystrophy (MONDO:0006573)
Added comment: 7 patients from 4 unrelated consanguineous families with homozygous loss of function PTC variants. Features: 4/7 metabolic features, 6/7 neurological/skeletal features, 3/7 Psychomotor retardation/intellectual disability, 5/7 demyelinating peripheral neuropathy.

Null mouse and patient derived white adipose tissue showed enrichment of arachidonic acid-containing membrane phospholipids and a strong decrease in PPARγ. CRISPR–Cas9-mediated PLAAT3 inactivation in human adipose stem cells induced insulin resistance, altered adipocyte differentiation with decreased lipid droplet formation and reduced the expression of adipogenic and mature adipocyte markers, including PPARγ.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5628 MARK4 Rylee Peters changed review comment from: Missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother.

Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway.
Sources: Literature; to: Heterozygous missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother.

Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5627 DDX17 Melanie Marty gene: DDX17 was added
gene: DDX17 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DDX17 were set to https://www.medrxiv.org/search/DDX17
Phenotypes for gene: DDX17 were set to Neurodevelopmental disorder (MONDO#0700092), DDX17-related
Review for gene: DDX17 was set to GREEN
Added comment: https://www.medrxiv.org/search/DDX17 (pre-print)
11 patients with het de novo variants in DDX17 (5 NMD, 6 missense). Patient's phenotype included mild-moderate intellectual disability, delayed speech and language development and global developmental delay. 64% had dysmorphic facial features. Some patients also have gross and fine motor delay, generalized hypotonia, stereotypy, and evidence of autism spectrum disorder.

Knockdown of Ddx17 in newborn mice showed impaired axon outgrowth and reduced axon outgrowth and branching was observed in primary cortical neurons in vitro. This result was replicated in Crispant Xenopus tadpoles, which had clear functional neural defects and showed an impaired neurobehavioral phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5627 MARK4 Rylee Peters gene: MARK4 was added
gene: MARK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MARK4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MARK4 were set to PMID: 38041405
Phenotypes for gene: MARK4 were set to neurodevelopmental disorder (MONDO:0700092), MARK4-related
Mode of pathogenicity for gene: MARK4 was set to Other
Review for gene: MARK4 was set to AMBER
gene: MARK4 was marked as current diagnostic
Added comment: Missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother.

Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5627 SEL1L Sarah Pantaleo gene: SEL1L was added
gene: SEL1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SEL1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SEL1L were set to PMID: 37943610; PMID: 37943617
Phenotypes for gene: SEL1L were set to Neurodevelopmental disorder, MONDO:0700092, SEL1L-related
Penetrance for gene: SEL1L were set to Complete
Review for gene: SEL1L was set to GREEN
Added comment: Wang paper PMID: 37943610

SEL1L protein is involved in the SEL1L-HRD1 endoplasmic reticulum (ER)-associated degradation.

Report two biallelic missense variants in SEL1L in six children from three independent families presenting with developmental delay, intellectual disability, microcephaly, facial dysmorphisms, hypotonia and/or ataxia (termed ERAD-associated neurodevelopment disorder with onset in infancy (ENDI). The variants were hypomorphic and impaired ERAD function.

Identified by WES. Parents heterozygous and asymptomatic. P.(Gly585Asp) in Patient 1, p.(Met528Arg) in Patients 2 and 3 (siblings).

All variants cause substrate accumulation. The extent of substrate accumulation in knockin cells was modest compared to those in knockout cells, pointing to a hypomorphic nature.

They also had a variant in HRD1.



Weis paper PMID: 37943617

Third variant p.(Cys141Tyr), biallelic, causing premature death in five patients from a consanguineous family with early-onset neurodevelopmental disorders and agammaglobulinaemia due to severe SEL1L-HRD1 ERAD dysfunction.

This variant appears to have a more severe outcome, exhibiting B cell depletion and agammaglobulinaemia, causing the most severe dysfunction among all of the variants described by this group so far. They postulate that functionality of SEL1L-HRD1 ERAD is inversely correlated with disease severity in humans.

Their symptoms were dev delay, neurological disorder and agammaglobulinaemia in childhood. Along with severe axial hypotonia, short stature and microcephaly.

“Not a complete loss-of-function variant”.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5624 RBFOX1 Dean Phelan reviewed gene: RBFOX1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37962958; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), RBFOX1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5624 PPID Elena Savva gene: PPID was added
gene: PPID was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPID was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PPID were set to 37977818
Phenotypes for gene: PPID were set to Stutter disorder, (MONDO:0000723), PPID-related
Review for gene: PPID was set to RED
Added comment: PMID: 37977818 - a large family (10 affected confirmed to have the variant) with stuttering/language disorder and a het missense (p.(Pro270Ser)). Mouse K/I model showed microstructural changes in the corticospinal tract
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5622 GRIA3 Zornitza Stark Mode of inheritance for gene: GRIA3 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5621 GRIA3 Zornitza Stark reviewed gene: GRIA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 38038360; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5621 TRAPPC4 Zornitza Stark Phenotypes for gene: TRAPPC4 were changed from intellectual disability; epilepsy; spasticity; microcephaly to Neurodevelopmental disorder with epilepsy, spasticity, and brain atrophy, MIM# 618741
Intellectual disability syndromic and non-syndromic v0.5620 TRAPPC4 Zornitza Stark edited their review of gene: TRAPPC4: Changed phenotypes: Neurodevelopmental disorder with epilepsy, spasticity, and brain atrophy, MIM# 618741
Intellectual disability syndromic and non-syndromic v0.5619 WBP4 Zornitza Stark reviewed gene: WBP4: Rating: GREEN; Mode of pathogenicity: None; Publications: 37963460; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, WBP4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5618 WNK3 Zornitza Stark reviewed gene: WNK3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Prieto syndrome, MIM# 309610; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5618 WDR11 Elena Savva Mode of inheritance for gene: WDR11 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5616 DOT1L Zornitza Stark gene: DOT1L was added
gene: DOT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DOT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DOT1L were set to 37827158
Phenotypes for gene: DOT1L were set to Neurodevelopmental disorder, MONDO:0700092, DOT1L-related
Mode of pathogenicity for gene: DOT1L was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: DOT1L was set to GREEN
Added comment: Nine individuals reported with seven de novo missense variants.

All had DD/ID and variable patterns of associated congenital anomalies.

Variants demonstrated to be GoF and lead to increased H3K79 methylation levels in flies and human cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5615 PBX1 Zornitza Stark Phenotypes for gene: PBX1 were changed from to Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, OMIM #617641
Intellectual disability syndromic and non-syndromic v0.5613 PBX1 Chirag Patel reviewed gene: PBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, OMIM #617641; Phenotypes: Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, OMIM #617641; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5612 KCNJ11 Chirag Patel reviewed gene: KCNJ11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5611 KCNA3 Zornitza Stark reviewed gene: KCNA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 37964487; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, KCNA3-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5606 VCP Manny Jacobs gene: VCP was added
gene: VCP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: VCP were set to PMID: 37883978
Phenotypes for gene: VCP were set to Neurodevelopmental disorder (MONDO: 0700092)
Review for gene: VCP was set to GREEN
Added comment: 13 unrelated individuals with childhood onset ID/DD disorder including macrocephaly, hypotonia and dysmorphic features. Non-specific / mild MRI findings.
12 de novo - 1 inherited
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5603 AGPAT3 Ee Ming Wong changed review comment from: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa
- All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant
- Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis
- KO AGPAT3 mouse demonstrated impaired neuronal migration
Sources: Literature; to: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa
- All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant
- Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis
- KO AGPAT3 mouse demonstrated impaired neuronal migration
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5602 SGSM3 Dean Phelan gene: SGSM3 was added
gene: SGSM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SGSM3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SGSM3 were set to PMID: 37833060
Phenotypes for gene: SGSM3 were set to Neurodevelopmental disorder (MONDO:0700092), SGSM3-related
Review for gene: SGSM3 was set to GREEN
Added comment: PMID: 37833060
- 13 patients from 8 families of Ashkenazi Jewish origin all had the same homozygous frameshift variant (c.981dup). Predicted to cause NMD. The variant co-segregated with disease in all available family members. The affected individuals displayed mild global developmental delay and mild to moderate intellectual disability. Additional prevalent phenotypes observed included hypotonia, behavioural challenges and short stature. Considered a founder variant (1 in 52 Ashkenazi Jews carry the variant). Also present in other populations but no homozygotes in gnomAD.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5602 AGPAT3 Ee Ming Wong gene: AGPAT3 was added
gene: AGPAT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AGPAT3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AGPAT3 were set to PMID: 37821758
Phenotypes for gene: AGPAT3 were set to Neurodevelopmental disorder (MONDO#0700092), AGPAT3-related
Review for gene: AGPAT3 was set to GREEN
gene: AGPAT3 was marked as current diagnostic
Added comment: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa
- All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant
- Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis
- KO AGPAT3 mouse demonstrated impaired neuronal migration
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5601 DLG2 Elena Savva gene: DLG2 was added
gene: DLG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DLG2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DLG2 were set to PMID: 37860969
Phenotypes for gene: DLG2 were set to Intellectual disability (MONDO#0001071), DLG2-related
Review for gene: DLG2 was set to AMBER
Added comment: PMID: 37860969 - 13 patients from 10 families with neurodevelopmental disorders, dysmorphic features and intragenic deletions including both exonic (minimal affect all transcripts) and UTR regions.
Majority of variants were inherited, some de novo. But many NMD PTCs in gnomAD (some looking messy, in noncanonical transcript etc.)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5599 CASP2 Ain Roesley gene: CASP2 was added
gene: CASP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CASP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CASP2 were set to 37880421
Phenotypes for gene: CASP2 were set to neurodevelopmental disorder MONDO:0700092, CASP2-related
Penetrance for gene: CASP2 were set to Complete
Review for gene: CASP2 was set to GREEN
gene: CASP2 was marked as current diagnostic
Added comment: 7 patients from 5 families
4 families hom for PTCs, 1 family Chet for splice+PTC
RNA studies done for the splice to indicate usage of 2 cryptic splice donor sites

5/5 have ID/dev delay
1/5 has seizures
2/5 hypotonia
3/5 lissencephaly (pachygyria and cortical thickening)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5598 ELP1 Sarah Pantaleo gene: ELP1 was added
gene: ELP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ELP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ELP1 were set to PMID: 36864284
Phenotypes for gene: ELP1 were set to Neurodevelopmental disorder, MONDO:0700092, ELP1-related
Review for gene: ELP1 was set to RED
Added comment: “A novel ELP1 mutation impairs the function of the Elongator complex and causes a severe neurodevelopment disorder”.

The Elongator complex is suggested to play a role in NDDs, given that patient-derived mutations in its ELP2, ELP3, ELP4 and ELP6 subunits have been associated with these disorders.

Pathogenic variants in ELP1 have been previously found in familial dysautonomia and medulloblastoma, with no link to NDDs affecting primarily the central nervous system.

Clinical investigation included patient history and physical, neurological and MRI. A novel homozygous likely pathogenic ELP1 variant was identified by WGS (absent from gnomAD). Functional studies included in silico analysis of the mutated ELP1 in the context of the holo-complex, production and purification of the ELP1 harbouring the identified mutation and in vitro analyses.

Report a novel missense mutation in the ELP1 identified in two siblings with ID and GDD (both less than 10 years old). The mutation is shown to perturb the ability of ELP123 to bind tRNAs and compromises the function of the Elongator in vitro and in human cells.

Both sibling are non-verbal and had severe ID/GDD. MRI revealed white matter lesions with enlarged perivascular spaces, suggestive of an inflammatory reaction associate with demyelination. WGS identified c.2444A>C; p.(Lys815Thr), homozygous in both siblings. Consanguineous family. Parents heterozygous and asymptomatic. Carry out significant functional studies.

Conclude that screening for ELP1 mutations “may be beneficial”.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5598 AXIN1 Zornitza Stark Phenotypes for gene: AXIN1 were changed from Syndromic disease, (MONDO:0002254), AXIN1-related to Craniometadiaphyseal osteosclerosis with hip dysplasia, MIM# 620558
Intellectual disability syndromic and non-syndromic v0.5597 AXIN1 Zornitza Stark reviewed gene: AXIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniometadiaphyseal osteosclerosis with hip dysplasia, MIM# 620558; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5596 KDM5B Lauren Rogers reviewed gene: KDM5B: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder (MONDO#0700092), KDM5B-related, Intellectual developmental disorder, autosomal recessive 65 (MIM#618109); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5595 PTPN4 Bryony Thompson changed review comment from: >3 unrelated probands and supporting mouse model
PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity
PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder
PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines
DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo.
Sources: Literature; to: >3 unrelated probands and supporting mouse model
PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity
PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder
PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines
PMID: 34527963 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5595 PTPN4 Bryony Thompson edited their review of gene: PTPN4: Changed publications: 17953619, 25424712, 30238967, 34527963
Intellectual disability syndromic and non-syndromic v0.5592 COG3 Zornitza Stark reviewed gene: COG3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type IIbb, MIM# 620546; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5591 ZFHX3 Chirag Patel edited their review of gene: ZFHX3: Added comment: 41 patients with protein truncating variants (PTVs) or (partial) deletions of ZFHX3. Presentations included (mild) ID and/or behavioural problems, postnatal growth retardation, feeding difficulties, dysmorphism (rarely cleft palate). Nuclear abundance of ZFHX3 increases during human brain development and neuronal differentiation in neural stem cells and SH-SY5Y cells, ZFHX3 interacts with the chromatin remodelling BRG1/Brm-associated factor complex and the cleavage and polyadenylation complex. ZFHX3 haploinsufficiency associates with a specific DNA methylation profile in leukocyte-derived DNA, and participates in chromatin remodelling and mRNA processing.; Changed rating: GREEN; Changed publications: PMID: 37292950; Changed phenotypes: Neurodevelopmental disorder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Set current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5591 KDM2B Ain Roesley edited their review of gene: KDM2B: Changed phenotypes: neurodevelopmental disorder MONDO#0700092, KDM2B-related
Intellectual disability syndromic and non-syndromic v0.5588 B4GALNT1 Zornitza Stark reviewed gene: B4GALNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 26, autosomal recessive (MIM #609195); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5588 AUH Zornitza Stark Phenotypes for gene: AUH were changed from to 3-methylglutaconic aciduria, type I, MIM# 250950
Intellectual disability syndromic and non-syndromic v0.5586 AUH Zornitza Stark reviewed gene: AUH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria, type I, MIM# 250950; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5584 ATP6V0A2 Zornitza Stark reviewed gene: ATP6V0A2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cutis laxa, autosomal recessive, type IIA, MIM# 219200, Wrinkly skin syndrome, MIM#278250; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5582 ATR Zornitza Stark reviewed gene: ATR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Seckel syndrome 1, MIM# 210600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5580 ATP6V1B2 Zornitza Stark reviewed gene: ATP6V1B2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Zimmermann-Laband syndrome 2, MIM# 616455; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5578 ATP6AP2 Zornitza Stark commented on gene: ATP6AP2: These two conditions likely represent a spectrum of severity for a single disorder. ID is a feature of both.
Intellectual disability syndromic and non-syndromic v0.5578 ATP6AP2 Zornitza Stark reviewed gene: ATP6AP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type IIr MIM#301045 Intellectual developmental disorder, X-linked, syndromic, Hedera type MIM#300423; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5578 KCNH5 Zornitza Stark Phenotypes for gene: KCNH5 were changed from Neurodevelopmental disorder MONDO#0700092, KCNH5-related to Developmental and epileptic encephalopathy 112, MIM# 620537
Intellectual disability syndromic and non-syndromic v0.5576 KCNH5 Zornitza Stark reviewed gene: KCNH5: Rating: GREEN; Mode of pathogenicity: None; Publications: 36307226; Phenotypes: Developmental and epileptic encephalopathy 112, MIM# 620537; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5574 ETS1 Zornitza Stark edited their review of gene: ETS1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, ETS1-related
Intellectual disability syndromic and non-syndromic v0.5573 EPHA7 Zornitza Stark edited their review of gene: EPHA7: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092,EPHA7-related
Intellectual disability syndromic and non-syndromic v0.5572 ELMOD1 Zornitza Stark edited their review of gene: ELMOD1: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092,ELMOD1-related
Intellectual disability syndromic and non-syndromic v0.5571 EEF1D Zornitza Stark edited their review of gene: EEF1D: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related
Intellectual disability syndromic and non-syndromic v0.5567 ATP13A2 Zornitza Stark reviewed gene: ATP13A2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Kufor-Rakeb syndrome, MIM# 606693; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5565 BRAF Zornitza Stark Mode of pathogenicity for gene: BRAF was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.5561 SMARCA4 Zornitza Stark Mode of pathogenicity for gene: SMARCA4 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.5554 SMC1A Zornitza Stark Mode of inheritance for gene: SMC1A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5551 SMARCB1 Zornitza Stark Mode of pathogenicity for gene: SMARCB1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.5549 SMARCB1 Kaitlyn Dianna Weldon reviewed gene: SMARCB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23556151; Phenotypes: Coffin-Siris syndrome MONDO:0015452; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5549 SMC1A Kaitlyn Dianna Weldon reviewed gene: SMC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301283; Phenotypes: Cornelia de Lange syndrome 2 MONDO:0010370; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5549 SMC3 Kaitlyn Dianna Weldon reviewed gene: SMC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301283; Phenotypes: Cornelia de Lange syndrome 3 MONDO:0012555; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5549 SMARCB1 Claire Fryer-Smith reviewed gene: SMARCB1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 22426308, 29907796, 3175698; Phenotypes: Coffin-Siris syndrome 3 (MIM# 614608); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5549 SMARCA4 Claire Fryer-Smith changed review comment from: Coffin-Siris syndrome is a congenital malformation syndrome characterized by developmental delay, intellectual disability, coarse facial features, feeding difficulties, and hypoplastic or absent fifth fingernails and fifth distal phalanges.

Missense and an in-frame deletion in SCARCA4 have been observed across 15 CSS patients in the literature (22426308, 23637025, 23929686), suggesting a dominant negative GoF effect.

LoF variants in SMARCA4 result in Rhabdoid tumor predisposition syndrome, which does not exhibit ID.; to: Coffin-Siris syndrome is a congenital malformation syndrome characterized by developmental delay, intellectual disability, coarse facial features, feeding difficulties, and hypoplastic or absent fifth fingernails and fifth distal phalanges.

Missense and an in-frame deletion in SMARCA4 have been observed across 15 CSS patients in the literature (22426308, 23637025, 23929686), suggesting a dominant negative GoF effect.

LoF variants in SMARCA4 result in Rhabdoid tumor predisposition syndrome, which does not exhibit ID.
Intellectual disability syndromic and non-syndromic v0.5549 SMARCA4 Claire Fryer-Smith reviewed gene: SMARCA4: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 22426308, 23929686, 23637025; Phenotypes: Coffin-Siris syndrome 4 (MIM# 614609); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5549 BRAF Claire Fryer-Smith reviewed gene: BRAF: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 10610177, 16474404, 19206169; Phenotypes: Cardiofaciocutaneous syndrome (MIM# 115150), Noonan syndrome (MIM# 613706), LEOPARD syndrome (MIM# 613707); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5549 STXBP1 Zornitza Stark Phenotypes for gene: STXBP1 were changed from to developmental and epileptic encephalopathy, 4 MONDO:0012812
Intellectual disability syndromic and non-syndromic v0.5543 TMEM70 Zornitza Stark Phenotypes for gene: TMEM70 were changed from to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM# 614052
Intellectual disability syndromic and non-syndromic v0.5541 FH Claire Fryer-Smith reviewed gene: FH: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31746132, 29052812, 21560188; Phenotypes: Fumarase deficiency (MIM# 606812); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5540 TMEM70 Zornitza Stark reviewed gene: TMEM70: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM# 614052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5534 TMCO1 Zornitza Stark Phenotypes for gene: TMCO1 were changed from to Craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development 1, MIM# 213980; cerebrofaciothoracic dysplasia MONDO:0008952
Intellectual disability syndromic and non-syndromic v0.5528 STRA6 Kaitlyn Dianna Weldon reviewed gene: STRA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273977; Phenotypes: Matthew-Wood syndrome MONDO:0011010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5528 TBC1D24 Zornitza Stark Phenotypes for gene: TBC1D24 were changed from to Developmental and epileptic encephalopathy 16, MIM# 615338; DOORS syndrome, MIM# 220500
Intellectual disability syndromic and non-syndromic v0.5525 TAZ Zornitza Stark Phenotypes for gene: TAZ were changed from to Barth syndrome MONDO:0010543
Intellectual disability syndromic and non-syndromic v0.5524 STXBP1 Kaitlyn Dianna Weldon reviewed gene: STXBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27905812; Phenotypes: developmental and epileptic encephalopathy, 4 MONDO:0012812; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5519 TANGO2 Zornitza Stark Phenotypes for gene: TANGO2 were changed from to Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, MIM# 616878; metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration MONDO:0014812
Intellectual disability syndromic and non-syndromic v0.5516 NF1 Claire Fryer-Smith changed review comment from: NF1 shows a high degree of phenotypic variability. Intellectual disability has been shown to occur in 4%-8% of cases, typically appearing in childhood and persisting through life (PMID: 23931823, 10762507).; to: NF1 shows a high degree of phenotypic variability. Intellectual disability has been shown to occur in 4%-8% of cases, typically appearing in childhood and persisting through life (PMID: 23931823, 10762507).
Intellectual disability syndromic and non-syndromic v0.5516 NF1 Claire Fryer-Smith reviewed gene: NF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23931823, 10762507; Phenotypes: Neurofibromatosis, type 1 (MIM#162200); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5516 SUOX Kaitlyn Dianna Weldon reviewed gene: SUOX: Rating: GREEN; Mode of pathogenicity: None; Publications: 28933809; Phenotypes: isolated sulfite oxidase deficiency MONDO:0010089; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5516 SYN1 Zornitza Stark Phenotypes for gene: SYN1 were changed from to X-linked complex neurodevelopmental disorder MONDO:0100148; epilepsy, X-linked 1, with variable learning disabilities and behavior disorders MONDO:0010339
Intellectual disability syndromic and non-syndromic v0.5514 SYN1 Kaitlyn Dianna Weldon reviewed gene: SYN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148, epilepsy, X-linked 1, with variable learning disabilities and behavior disorders MONDO:0010339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5514 MYCN Naomi Baker commented on gene: MYCN: Three individuals now reported with gain-of-function missense variants (identical variant in two individuals). Clinical presentation includes megalencephaly, hypoplastic corpus callosum, postaxial polydactyly, intellectual disability and motor delay. Knock-in mouse model showed morphological manifestations in multiple tissues including digits, female reproductive system and kidney.
Intellectual disability syndromic and non-syndromic v0.5513 MYCN Naomi Baker reviewed gene: MYCN: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID:37710961; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), MYCN-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5512 MAST4 Ain Roesley gene: MAST4 was added
gene: MAST4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAST4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAST4 were set to 36910266; 33057194
Phenotypes for gene: MAST4 were set to neurodevelopmental disorder MONDO:0700092, MAST4-related
Penetrance for gene: MAST4 were set to Complete
Review for gene: MAST4 was set to GREEN
gene: MAST4 was marked as current diagnostic
Added comment: PMID: 36910266 - 4 families with 4 affecteds, all de novo missense

2x borderline microcephaly (-2SD)
2x gross motor delay
2x dysmorphism
4x ID + seizures
3x abnormal brain MRI findings

PMID: 33057194 - 5x de novos, 4x missense + 1x PTC
Cohort of individuals with severe developmental disorder
individual phenotypic information not provided


Recurrent variants are Thr1471Ile (3x) and Ser1181Phe)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5509 ATP2B2 Andrew Fennell gene: ATP2B2 was added
gene: ATP2B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP2B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP2B2 were set to PMID: 37675773
Phenotypes for gene: ATP2B2 were set to Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related
Mode of pathogenicity for gene: ATP2B2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: ATP2B2 was set to GREEN
Added comment: 7 unrelated individuals reported with a variable phenotype including dystonia, ataxia, intellectual disability, behavioural symptoms, and seizures.

All patients have either missense variants or frameshift variants in the penultimate exon not expected to lead to NMD. This is in contrast to patients with isolated deafness previously reported to have nonsense, frameshift, or splice-site variants outside of this region.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5509 ZBTB47 Elena Savva gene: ZBTB47 was added
gene: ZBTB47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZBTB47 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ZBTB47 were set to 37743782
Phenotypes for gene: ZBTB47 were set to Neurodevelopmental disorder (MONDO#0700092), ZBTB47-related
Review for gene: ZBTB47 was set to GREEN
Added comment: PMID 37743782:
- 5 patients with de novo missense, 4/5 have a recurring p.Gly477Lys. Probands have intellectual disability (5/5), seizures (5/5), hypotonia (5/5), gait abnormalities, and variable movement abnormalities (5/5).
- Missense variants are positioned close to His and Cys residues involved in forming C2H2 zinc fingers.
- No functional studies performed
- Minimal PTCs in gnomAD
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5508 TANGO2 Kaitlyn Dianna Weldon reviewed gene: TANGO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29369572; Phenotypes: obsolete metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration MONDO:0014812; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5508 TAT Kaitlyn Dianna Weldon reviewed gene: TAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 28255985; Phenotypes: tyrosinemia type II MONDO:0010160; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5508 TAZ Kaitlyn Dianna Weldon reviewed gene: TAZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 25299040; Phenotypes: Barth syndrome MONDO:0010543; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5508 TBC1D24 Kaitlyn Dianna Weldon reviewed gene: TBC1D24: Rating: GREEN; Mode of pathogenicity: None; Publications: 25719194; Phenotypes: familial infantile myoclonic epilepsy MONDO:0011506, DOORS syndrome MONDO:0009079; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5508 TCF4 Kaitlyn Dianna Weldon reviewed gene: TCF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22934316; Phenotypes: Pitt-Hopkins syndrome MONDO:0012589; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5508 TMCO1 Kaitlyn Dianna Weldon reviewed gene: TMCO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1204988, 1640432, 15326640, 20018682; Phenotypes: obsolete cerebrofaciothoracic dysplasia MONDO:0008952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5508 TMEM216 Kaitlyn Dianna Weldon reviewed gene: TMEM216: Rating: GREEN; Mode of pathogenicity: None; Publications: 20036350; Phenotypes: Joubert syndrome 2 MONDO:0011963; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5508 TMEM240 Kaitlyn Dianna Weldon reviewed gene: TMEM240: Rating: GREEN; Mode of pathogenicity: None; Publications: 25070513; Phenotypes: spinocerebellar ataxia type 21 MONDO:0011833; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5508 TMEM70 Kaitlyn Dianna Weldon reviewed gene: TMEM70: Rating: GREEN; Mode of pathogenicity: None; Publications: 18953340; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5507 ATRX Zornitza Stark Mode of inheritance for gene: ATRX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5506 ATRX Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ATR-X-related syndrome MONDO:0016980; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5504 DDX23 Zornitza Stark edited their review of gene: DDX23: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, DDX23-related
Intellectual disability syndromic and non-syndromic v0.5504 CSNK1G1 Zornitza Stark Phenotypes for gene: CSNK1G1 were changed from Global developmental delay; Intellectual disability; Autism; Seizures; Abnormality of the face; Abnromality of limbs to Neurodevelopmental disorder, MONDO:0700092, CSNK1G-related
Intellectual disability syndromic and non-syndromic v0.5495 TSFM Zornitza Stark reviewed gene: TSFM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 3, MIM#610505; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5495 TSHB Zornitza Stark Phenotypes for gene: TSHB were changed from to Central congenital hypothyroidism Orphanet:226298
Intellectual disability syndromic and non-syndromic v0.5492 TSHB Zornitza Stark reviewed gene: TSHB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Central congenital hypothyroidism Orphanet:226298; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5492 SNAPC4 Zornitza Stark Phenotypes for gene: SNAPC4 were changed from Neurodevelopmental disorder (MONDO#0700092), SNAPC4-related to Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515
Intellectual disability syndromic and non-syndromic v0.5491 TSEN54 Kaitlyn Dianna Weldon reviewed gene: TSEN54: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301773; Phenotypes: pontocerebellar hypoplasia type 2A MONDO:0010190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5491 TSFM Kaitlyn Dianna Weldon reviewed gene: TSFM: Rating: GREEN; Mode of pathogenicity: None; Publications: 25037205, 33816677, 31451716, 22499341; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5491 TSHB Kaitlyn Dianna Weldon reviewed gene: TSHB: Rating: GREEN; Mode of pathogenicity: None; Publications: 15292359, 27362444; Phenotypes: Central congenital hypothyroidism Orphanet:226298; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5490 CNTN6 Zornitza Stark edited their review of gene: CNTN6: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CNTN6-related
Intellectual disability syndromic and non-syndromic v0.5489 CNTN3 Zornitza Stark edited their review of gene: CNTN3: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CNTN3-related
Intellectual disability syndromic and non-syndromic v0.5487 CMAS Zornitza Stark edited their review of gene: CMAS: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CMAS-related
Intellectual disability syndromic and non-syndromic v0.5481 BLOC1S1 Zornitza Stark edited their review of gene: BLOC1S1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, BLOC1S1-related
Intellectual disability syndromic and non-syndromic v0.5480 ASTN2 Zornitza Stark gene: ASTN2 was added
gene: ASTN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ASTN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ASTN2 were set to 28940097; 34412080; 27138430
Phenotypes for gene: ASTN2 were set to Neurodevelopmental disorder, MONDO:0700092, ASTN2-related
Review for gene: ASTN2 was set to AMBER
Added comment: Candidate gene reported by Anazi et al; rare CNVs also reported; other circumstantial evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5479 TTC37 Kaitlyn Dianna Weldon reviewed gene: TTC37: Rating: GREEN; Mode of pathogenicity: None; Publications: 29334452; Phenotypes: trichohepatoenteric syndrome 1 MONDO:0024541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5479 MCCC1 Bryony Thompson Phenotypes for gene: MCCC1 were changed from to 3-Methylcrotonyl-CoA carboxylase 1 deficiency MIM#210200; Organic acidurias
Intellectual disability syndromic and non-syndromic v0.5475 MCCC1 Bryony Thompson reviewed gene: MCCC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 36822454, 31730530; Phenotypes: 3-Methylcrotonyl-CoA carboxylase 1 deficiency MIM#210200, Organic acidurias; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5474 AKAP6 Zornitza Stark edited their review of gene: AKAP6: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, AKAP6-related
Intellectual disability syndromic and non-syndromic v0.5472 ACTL6A Zornitza Stark edited their review of gene: ACTL6A: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, ACTL6A-related
Intellectual disability syndromic and non-syndromic v0.5472 TUBB3 Zornitza Stark Phenotypes for gene: TUBB3 were changed from to complex cortical dysplasia with other brain malformations 1 MONDO:0013541
Intellectual disability syndromic and non-syndromic v0.5466 TH Zornitza Stark Marked gene: TH as ready
Intellectual disability syndromic and non-syndromic v0.5466 TH Zornitza Stark Gene: th has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.5466 TH Zornitza Stark Phenotypes for gene: TH were changed from to Segawa syndrome, recessive MIM#605407
Intellectual disability syndromic and non-syndromic v0.5465 TH Zornitza Stark Publications for gene: TH were set to
Intellectual disability syndromic and non-syndromic v0.5464 TH Zornitza Stark Mode of inheritance for gene: TH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5463 TH Zornitza Stark Tag treatable tag was added to gene: TH.
Intellectual disability syndromic and non-syndromic v0.5461 TUBG1 Zornitza Stark Phenotypes for gene: TUBG1 were changed from to complex cortical dysplasia with other brain malformations 4 MONDO:0014171
Intellectual disability syndromic and non-syndromic v0.5458 TWIST1 Zornitza Stark Phenotypes for gene: TWIST1 were changed from to Saethre-Chotzen syndrome MONDO:0007042
Intellectual disability syndromic and non-syndromic v0.5455 UBA5 Zornitza Stark Phenotypes for gene: UBA5 were changed from to Epileptic encephalopathy, early infantile, 44 (MIM#617132)
Intellectual disability syndromic and non-syndromic v0.5438 SCAF4 Zornitza Stark reviewed gene: SCAF4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fliedner-Zweier syndrome, MIM#620511; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5435 WDR45 Zornitza Stark Phenotypes for gene: WDR45 were changed from to X-linked complex neurodevelopmental disorder MONDO:0100148; neurodegeneration with brain iron accumulation 5 MONDO:0010476
Intellectual disability syndromic and non-syndromic v0.5433 WDR45 Zornitza Stark Mode of inheritance for gene: WDR45 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5426 WWOX Zornitza Stark Phenotypes for gene: WWOX were changed from to developmental and epileptic encephalopathy, 28 MONDO:0014533; autosomal recessive spinocerebellar ataxia 12 MONDO:0013687
Intellectual disability syndromic and non-syndromic v0.5420 TUBB2B Zornitza Stark Phenotypes for gene: TUBB2B were changed from to Cortical dysplasia, complex, with other brain malformations 7 MIM#610031
Intellectual disability syndromic and non-syndromic v0.5399 TUBB3 Kaitlyn Dianna Weldon reviewed gene: TUBB3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20829227; Phenotypes: complex cortical dysplasia with other brain malformations 1 MONDO:0013541; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 TUBB4A Kaitlyn Dianna Weldon reviewed gene: TUBB4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 37529938, 35661708, 27538619, 24526230; Phenotypes: hypomyelinating leukodystrophy 6 MONDO:0012905, torsion dystonia 4 MONDO:0007493; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5399 TH Claire Fryer-Smith reviewed gene: TH: Rating: GREEN; Mode of pathogenicity: None; Publications: 22815559, 11196107, 10585338; Phenotypes: Segawa syndrome, recessive MIM#605407; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 PTEN Claire Fryer-Smith reviewed gene: PTEN: Rating: GREEN; Mode of pathogenicity: None; Publications: 21194675, 1859181, 23470840; Phenotypes: Cowden syndrome 1 MIM#158350, Lhermitte-Duclos disease MIM#158350, Macrocephaly/autism syndrome MIM#605309, Prostate cancer, somatic MIM#176807; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 TUBG1 Kaitlyn Dianna Weldon reviewed gene: TUBG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29706637, 23603762; Phenotypes: complex cortical dysplasia with other brain malformations 4 MONDO:0014171, lissencephaly spectrum disorders MONDO:0018838; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 TWIST1 Kaitlyn Dianna Weldon reviewed gene: TWIST1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301368; Phenotypes: Saethre-Chotzen syndrome MONDO:0007042; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 UBA5 Kaitlyn Dianna Weldon reviewed gene: UBA5: Rating: GREEN; Mode of pathogenicity: None; Publications: 33811063; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 UBE3A Kaitlyn Dianna Weldon reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301323; Phenotypes: Angelman syndrome MONDO:0007113; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.5399 SDHA Claire Fryer-Smith reviewed gene: SDHA: Rating: GREEN; Mode of pathogenicity: None; Publications: 1492653, 23322652; Phenotypes: Cardiomyopathy, dilated, 1GG MIM#613642, Mitochondrial complex II deficiency, nuclear type 1 MIM#252011, Neurodegeneration with ataxia and late-onset optic atrophy MIM#619259, Paragangliomas MIM#614165; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 VLDLR Kaitlyn Dianna Weldon reviewed gene: VLDLR: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301729; Phenotypes: cerebellar ataxia, intellectual disability, and dysequilibrium syndrome 1 MONDO:0024542; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 VPS13B Kaitlyn Dianna Weldon reviewed gene: VPS13B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301655; Phenotypes: Cohen syndrome MONDO:0008999; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 VRK1 Kaitlyn Dianna Weldon reviewed gene: VRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19646678; Phenotypes: pontocerebellar hypoplasia type 1A MONDO:0011866; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 WDR45 Kaitlyn Dianna Weldon reviewed gene: WDR45: Rating: GREEN; Mode of pathogenicity: None; Publications: 28211668; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148, neurodegeneration with brain iron accumulation 5 MONDO:0010476; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5399 WDR73 Kaitlyn Dianna Weldon reviewed gene: WDR73: Rating: GREEN; Mode of pathogenicity: None; Publications: 26123727; Phenotypes: Galloway-Mowat syndrome 1 MONDO:0033005; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 SMAD4 Claire Fryer-Smith reviewed gene: SMAD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843046, 22243968, 7296942, 8261650; Phenotypes: Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome MIM#175050, Myhre syndrome MIM#139210, Pancreatic cancer, somatic MIM#260350, Polyposis, juvenile intestinal MIM#174900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 WWOX Kaitlyn Dianna Weldon reviewed gene: WWOX: Rating: GREEN; Mode of pathogenicity: None; Publications: 25411445, 24369382; Phenotypes: developmental and epileptic encephalopathy, 28 MONDO:0014533, autosomal recessive spinocerebellar ataxia 12 MONDO:0013687; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 XRCC4 Claire Fryer-Smith reviewed gene: XRCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25872942, 25839420, 18695064; Phenotypes: Short stature, microcephaly, and endocrine dysfunction MIM#616541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 XRCC4 Kaitlyn Dianna Weldon reviewed gene: XRCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25728776; Phenotypes: short stature, microcephaly, and endocrine dysfunction MONDO:0014686; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 TUBB2B Claire Fryer-Smith reviewed gene: TUBB2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 11425694, 23001566, 19465910, 22333901; Phenotypes: Cortical dysplasia, complex, with other brain malformations 7 MIM#610031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 ZDHHC9 Kaitlyn Dianna Weldon reviewed gene: ZDHHC9: Rating: GREEN; Mode of pathogenicity: None; Publications: 17436253; Phenotypes: Syndromic X-linked intellectual disability Raymond type MONDO:0010427; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5399 ZFYVE26 Kaitlyn Dianna Weldon reviewed gene: ZFYVE26: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301682; Phenotypes: hereditary spastic paraplegia 15 MONDO:0010044; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 ZIC2 Kaitlyn Dianna Weldon reviewed gene: ZIC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21940735; Phenotypes: holoprosencephaly 5 MONDO:0012322; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 TSC1 Claire Fryer-Smith reviewed gene: TSC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10533067, 18830229, 15798777, 17304050; Phenotypes: Tuberous sclerosis-1 MIM#191100; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 TSC2 Claire Fryer-Smith reviewed gene: TSC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14985384, 10533067, 10205261, 17304050; Phenotypes: Tuberous sclerosis-2 MIM#613254; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 NR2F2 Achchuthan Shanmugasundram reviewed gene: NR2F2: Rating: GREEN; Mode of pathogenicity: None; Publications: 37500725; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5399 GABBR1 Zornitza Stark Phenotypes for gene: GABBR1 were changed from Neurodevelopmental disorder, GABBR1-related, MONDO:0700092 to Neurodevelopmental disorder with language delay and variable cognitive abnormalities, MIM#620502
Intellectual disability syndromic and non-syndromic v0.5394 FTCD Bryony Thompson Added comment: Comment on list classification: According to IEMbase this gene is associated with a benign form of disorder of folate metabolism with no clinical significance
Intellectual disability syndromic and non-syndromic v0.5391 COL4A3BP Zornitza Stark Mode of pathogenicity for gene: COL4A3BP was changed from to Other
Intellectual disability syndromic and non-syndromic v0.5390 COL4A3BP Ee Ming Wong changed review comment from: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo.
- Several variants transfected into HeLa cells demonstrated gain of CERT activity
- CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT; to: - current HGNC symbol: CERT1
- Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo.
- Several variants transfected into HeLa cells demonstrated gain of CERT activity
- CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT
Intellectual disability syndromic and non-syndromic v0.5390 COL4A3BP Ee Ming Wong changed review comment from: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo.
- Several variants transfected into HeLa cells demonstrated gain of CERT activity
- CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity,
which was corrected by pharmacological inhibition of CERT; to: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo.
- Several variants transfected into HeLa cells demonstrated gain of CERT activity
- CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT
Intellectual disability syndromic and non-syndromic v0.5390 COL4A3BP Ee Ming Wong changed review comment from: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo.
- Several variants transfected into HeLa cells demonstrated gain of CERT activity
- CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity,
which was corrected by pharmacological inhibition of CERT; to: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo.
- Several variants transfected into HeLa cells demonstrated gain of CERT activity
- CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity,
which was corrected by pharmacological inhibition of CERT
Intellectual disability syndromic and non-syndromic v0.5390 COL4A3BP Ee Ming Wong reviewed gene: COL4A3BP: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 36976648; Phenotypes: Intellectual developmental disorder 34 (MIM#616351); Mode of inheritance: None; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5390 RAB5C Rylee Peters changed review comment from: 12 individuals with nine different heterozygous de novo variants in RAB5C.
9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe).
All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD).
Sources: Literature; to: 12 individuals with nine different heterozygous de novo variants in RAB5C.
9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe).
All have mild to severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5387 RAB5C Rylee Peters gene: RAB5C was added
gene: RAB5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB5C were set to PMID: 37552066
Phenotypes for gene: RAB5C were set to Neurodevelopmental disorder MONDO:0700092, RAB5C-related
Penetrance for gene: RAB5C were set to Complete
Review for gene: RAB5C was set to GREEN
gene: RAB5C was marked as current diagnostic
Added comment: 12 individuals with nine different heterozygous de novo variants in RAB5C.
9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe).
All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5387 AXIN1 Elena Savva gene: AXIN1 was added
gene: AXIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AXIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AXIN1 were set to PMID: 37582359
Phenotypes for gene: AXIN1 were set to Syndromic disease, (MONDO:0002254), AXIN1-related
Review for gene: AXIN1 was set to GREEN
Added comment: PMID: 37582359
- four families (7 individuals) with three homozygous truncating variants.
- all variant shown to result in reduced protein, though 1/3 would be NMD predicted
- Probands had macrocephaly (4/6), GDD (3/7), hip dysplasia (5/6), cardiac anomalies eg. VSD/ASD (3/7), cranial hyperostosis and vertebral endplate sclerosis
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5385 PPP1R3F Andrew Fennell gene: PPP1R3F was added
gene: PPP1R3F was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP1R3F was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PPP1R3F were set to 37531237
Phenotypes for gene: PPP1R3F were set to Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related
Review for gene: PPP1R3F was set to GREEN
Added comment: 13 unrelated hemizygous individuals reported with functional evidence
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5383 ATM Zornitza Stark edited their review of gene: ATM: Added comment: Progressive cerebellar dysfunction. Intellectual ability is typically normal. However, learning can be impaired due to motor and speech difficulties.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.5383 ATM Zornitza Stark reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ataxia-telangiectasia, MIM#208900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5383 SOX11 Zornitza Stark Phenotypes for gene: SOX11 were changed from Coffin-Siris syndrome 9, OMIM # 615866 to Intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, MIM# 615866
Intellectual disability syndromic and non-syndromic v0.5381 SOX11 Zornitza Stark reviewed gene: SOX11: Rating: GREEN; Mode of pathogenicity: None; Publications: 29459093, 24886874, 33086258, 33785884, 35642566, 35341651; Phenotypes: Intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, MIM# 615866; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5379 ATP5O Zornitza Stark gene: ATP5O was added
gene: ATP5O was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ATP5O was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP5O were set to 35621276; 34954817
Phenotypes for gene: ATP5O were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359
Review for gene: ATP5O was set to GREEN
Added comment: Three unrelated families reported. Presenting features included DD, hypotonia, seizures.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5377 HIKESHI Zornitza Stark gene: HIKESHI was added
gene: HIKESHI was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: HIKESHI was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HIKESHI were set to 34111619; 26545878
Phenotypes for gene: HIKESHI were set to Leukodystrophy, hypomyelinating, 13, MIM# 616881
Review for gene: HIKESHI was set to GREEN
Added comment: Over 10 individuals reported with recurrent homozygous c.160G>C;p.(Val54Leu) variant, high carrier frequency in the Ashkenazi Jewish population. Optic atrophy reported in several.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5373 FAM111A Zornitza Stark reviewed gene: FAM111A: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Kenny-Caffey syndrome, type 2, MIM# 127000; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5372 RAP1B Zornitza Stark edited their review of gene: RAP1B: Changed phenotypes: Syndromic disease, MONDO:0002254, RAP1B-related
Intellectual disability syndromic and non-syndromic v0.5367 ASS1 Zornitza Stark reviewed gene: ASS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Citrullinemia MIM#215700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5365 ASPA Zornitza Stark reviewed gene: ASPA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Canavan disease MIM#271900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5363 ARX Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5363 ARV1 Zornitza Stark Phenotypes for gene: ARV1 were changed from to Developmental and epileptic encephalopathy 38, MIM# 617020
Intellectual disability syndromic and non-syndromic v0.5360 ARV1 Zornitza Stark reviewed gene: ARV1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35227294, 27270415, 25558065; Phenotypes: Developmental and epileptic encephalopathy 38, MIM# 617020; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5357 UBAP2L Zornitza Stark Phenotypes for gene: UBAP2L were changed from Neurodevelopmental disorder, MONDO:0700092, UBAP2L-related; Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system to Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494; Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system
Intellectual disability syndromic and non-syndromic v0.5356 UBAP2L Zornitza Stark edited their review of gene: UBAP2L: Changed phenotypes: Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494
Intellectual disability syndromic and non-syndromic v0.5353 AP3B1 Zornitza Stark reviewed gene: AP3B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10024875, 11809908, 14566336; Phenotypes: Hermansky-Pudlak syndrome 2, MIM# 608233, MONDO:0011997; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5353 AMT Zornitza Stark Phenotypes for gene: AMT were changed from to Glycine encephalopathy MIM#605899
Intellectual disability syndromic and non-syndromic v0.5351 AMT Zornitza Stark reviewed gene: AMT: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Glycine encephalopathy MIM#605899; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5350 ALDH18A1 Zornitza Stark Mode of inheritance for gene: ALDH18A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5349 ALDH18A1 Zornitza Stark reviewed gene: ALDH18A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 9B, autosomal recessive, MIM# 616586; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5349 AIFM1 Zornitza Stark Phenotypes for gene: AIFM1 were changed from to Combined oxidative phosphorylation deficiency 6, 300816; Cowchock syndrome, 310490; Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232
Intellectual disability syndromic and non-syndromic v0.5347 AIFM1 Zornitza Stark reviewed gene: AIFM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 6, 300816, Cowchock syndrome, 310490, Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5345 ADSL Zornitza Stark reviewed gene: ADSL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adenylosuccinase deficiency, MIM# 103050; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5342 ADGRG1 Zornitza Stark reviewed gene: ADGRG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16240336; Phenotypes: Polymicrogyria, bilateral frontoparietal 606854; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5341 NEUROG1 Zornitza Stark gene: NEUROG1 was added
gene: NEUROG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NEUROG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NEUROG1 were set to 23419067; 26077850; 33439489; 36647078
Phenotypes for gene: NEUROG1 were set to Cranial dysinnervation disorder, congenital, with absent corneal reflex and developmental delay, OMIM:620469
Review for gene: NEUROG1 was set to GREEN
Added comment: There are four unrelated cases reported with global developmental delay/ intellectual disability.

PMID:23419067 - A homozygous micro deletion of NEUROG1 was identified in a six year-old boy presenting with profound sensorineural deafness, balance disorder, severe disorder of oral motor function, and mild global developmental delay. His IQ was normal.

PMID:26077850 - A homozygous NEUROG1 variant (p.Arg116Leu) was identified in a 12 year-old boy presented with syndromic corneal opacity, mild intellectual disability and absent corneal reflex.

PMID:33439489 - A homozygous loss-of-function variant (p.Glu68Ter) was identified in a 12 year-old boy presenting with hypotonia, global developmental delay, sensorineural hearing loss, and keratoconjunctivitis due to lack of corneal reflex. This patient had a global IQ of 62 at the age of ten.

PMID:36647078 - A female proband was identified with a novel homozygous truncating frameshift variant (p.Thr78ProfsTer122 and was reported with profound global developmental delay, autism spectrum disorder, hearing loss, corneal opacity and no eye blinking. Her sister also had a similar, but less severe phenotype and also harboured the same variant at homozygous state.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5340 SRSF1 Zornitza Stark Phenotypes for gene: SRSF1 were changed from Neurodevelopmental disorder, SRSF1-related MONDO:0700092 to Neurodevelopmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 620489
Intellectual disability syndromic and non-syndromic v0.5339 SRSF1 Zornitza Stark reviewed gene: SRSF1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 620489; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5337 FBXO31 Ain Roesley reviewed gene: FBXO31: Rating: AMBER; Mode of pathogenicity: None; Publications: 35019165, 24623383; Phenotypes: intellectual developmental disorder 45 (MIM#615979); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5337 ACTB Zornitza Stark Phenotypes for gene: ACTB were changed from Baraitser-Winter syndrome 1, MIM# 243310; ACTB-related neurodevelopment disorder to Baraitser-Winter syndrome 1, MIM# 243310; Thrombocytopenia 8, with dysmorphic features and developmental delay, MIM# 620475; ACTB-related neurodevelopment disorder
Intellectual disability syndromic and non-syndromic v0.5336 ACTB Zornitza Stark edited their review of gene: ACTB: Changed phenotypes: Baraitser-Winter syndrome 1 243310, ACTB-related neurodevelopment disorder, Thrombocytopenia 8, with dysmorphic features and developmental delay, MIM# 620475
Intellectual disability syndromic and non-syndromic v0.5336 ATP6V0C Zornitza Stark Phenotypes for gene: ATP6V0C were changed from Epilepsy; Intellectual Disability; microcephaly to Epilepsy, early-onset, with or without developmental delay, MIM#620465; Epilepsy; Intellectual Disability; microcephaly
Intellectual disability syndromic and non-syndromic v0.5333 HNRNPC Zornitza Stark gene: HNRNPC was added
gene: HNRNPC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HNRNPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HNRNPC were set to 37541189
Phenotypes for gene: HNRNPC were set to Neurodevelopmental disorder (MONDO:0700092), HNRNPC-related
Review for gene: HNRNPC was set to GREEN
Added comment: 13 individuals with global developmental delay, intellectual disability, behavioral abnormalities, and subtle facial dysmorphology with heterozygous HNRNPC germline variants. Five had an identical in-frame deletion of nine amino acids in the extreme C terminus.

Supportive functional data; haploinsufficiency is the mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5332 PSMC3 Zornitza Stark Mode of inheritance for gene: PSMC3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5331 PSMC3 Zornitza Stark Mode of inheritance for gene: PSMC3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5330 PSMC3 Zornitza Stark Phenotypes for gene: PSMC3 were changed from Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354 to neurodevelopmental disorder, MONDO:0700092, PSMC3-related; Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354
Intellectual disability syndromic and non-syndromic v0.5325 EMC1 Zornitza Stark Mode of inheritance for gene: EMC1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5324 PSMC3 Achchuthan Shanmugasundram reviewed gene: PSMC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 37256937; Phenotypes: neurodevelopmental disorder, MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5324 EMC1 Chern Lim reviewed gene: EMC1: Rating: ; Mode of pathogenicity: None; Publications: 35234901, 26942288; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5323 AQP4 Zornitza Stark Phenotypes for gene: AQP4 were changed from ?Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448 to Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448
Intellectual disability syndromic and non-syndromic v0.5317 AQP4 Lucy Spencer gene: AQP4 was added
gene: AQP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AQP4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AQP4 were set to 37143309
Phenotypes for gene: AQP4 were set to ?Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448
Review for gene: AQP4 was set to AMBER
Added comment: PMID: 37143309
Cohort patients with an MRI based diagnosis of megalencephalic leukoencephalopathy with subcortical cysts (MLC). Missense variant in AQP4 seen homozygous in 2 siblings and het in the parents. Patients had macrocephaly, developmental delay, hypotonia, epilepsy, and cognitive deficit.

Western blots on generated MDCK cell lines showed no detectable expression of AQP4 protein from the cells with the patients variant. Immunofluorescence also showed no membrane expression. Overexpression studies in HEK293T cells showed WT was seen as mainly monomers or dimers where as variant protein formed large aggregates- likely due to the saturation of protein degradation pathways because of the overexpression.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5317 PHF5A Daniel Flanagan gene: PHF5A was added
gene: PHF5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PHF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHF5A were set to PMID: 37422718
Phenotypes for gene: PHF5A were set to Neurodevelopmental disorder (MONDO#0700092), PHF5A-related
Review for gene: PHF5A was set to GREEN
Added comment: Nine subjects with congenital malformations, including hypospadias, growth abnormalities, and developmental delay who had de novo PHF5A variants. Prenatally, six subjects had intrauterine growth retardation. All subjects had motor and speech delay and developmental delay. Congenital abnormalities comprised hypospadias in three of four male subjects, and heart defects (3/9), inguinal hernia (3/9), and sacral dimple (3/9). Six of the nine subjects had short stature. Craniofacial dysmorphism is variable in the nine subjects, high forehead and preauricular skin tag(s) in five subjects.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5316 EZH1 Dean Phelan reviewed gene: EZH1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 37433783; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), EZH1-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5313 GPRC5B Lucy Spencer gene: GPRC5B was added
gene: GPRC5B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GPRC5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GPRC5B were set to PMID: 37143309
Phenotypes for gene: GPRC5B were set to Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447
Review for gene: GPRC5B was set to GREEN
Added comment: PMID: 37143309
Cohort of 5 patients with an MRI based diagnosis of megalencephalic leukoencephalopathy with subcortical cysts (MLC). 3 unrelated patients had variants in GPRC5B, 2 have the same inframe dup Ile175dup and the third has an in frame dup of Ala177. All 3 were de novo and unaffected siblings did not have the variants. All patients have macrocephaly, delayed motor development, spasticity, ataxia and dystonia, seizures, all had varying degrees of cognitive deficits. MRI showed MLC, abnormal and swollen cerebral white matter.

Patient cell lines showed reduced regulatory volume decrease, and western blot showed a strong increase in GRPC5B levels in patient lymphoblasts. Together, these findings indicate disturbed volume regulation in lymphoblasts from patients with GPRC5B variants, potentially due to increased GPRC5B levels. Transfected cells caused increased volume-regulated anion channel activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5313 NAA30 Sarah Pantaleo edited their review of gene: NAA30: Changed phenotypes: neurodevelopmental disorder, MONDO:0700092, NAA30-related
Intellectual disability syndromic and non-syndromic v0.5313 SLC4A10 Krithika Murali gene: SLC4A10 was added
gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC4A10 were set to PMID: 37459438
Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related
Review for gene: SLC4A10 was set to GREEN
Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder.

Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies.

Isolated seizures was reported in 2/10 cases.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5312 SLC4A10 Krithika Murali gene: SLC4A10 was added
gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC4A10 were set to PMID: 37459438
Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related
Review for gene: SLC4A10 was set to GREEN
Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder.

Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies.

Isolated seizures was reported in 2/10 cases.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5311 NAA30 Sarah Pantaleo gene: NAA30 was added
gene: NAA30 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAA30 was set to Unknown
Publications for gene: NAA30 were set to PMID: 37387332
Penetrance for gene: NAA30 were set to unknown
Review for gene: NAA30 was set to RED
Added comment: Report a de novo heterozygous NAA30 nonsense variant c.244C>T, p.(Gln82*) in a 5yo boy with GDD, ASD, hypotonia, seizures, tracheal cleft and recurrent respiratory infections. Seizures resolved after two weeks of life. Family history of ASD in older sister. Epilepsy in mother, childhood onset.

Biochemical studies performed to assess the functional impact of the premature stop codon on catalytic activity. The variant was found to completely disrupt N-terminal acetyltransferase activity using an in vitro acetylation assay.

Variant de novo, “in a gene sensitive to loss of heterozygosity”. Limitation of study - have not established whether this gene variant acts in a dominant or recessive manner.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5310 KDM4B Sarah Pantaleo reviewed gene: KDM4B: Rating: ; Mode of pathogenicity: None; Publications: PMID: 37526414; Phenotypes: Intellectual developmental disorder, autosomal dominant 65, MIM#619320; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5310 EZH1 Dean Phelan gene: EZH1 was added
gene: EZH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EZH1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5310 EIF4A2 Zornitza Stark Phenotypes for gene: EIF4A2 were changed from Neurodevelopmental disorder (MONDO:0700092), EIF4A2-related to Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455
Intellectual disability syndromic and non-syndromic v0.5308 TMEM63B Zornitza Stark gene: TMEM63B was added
gene: TMEM63B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM63B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TMEM63B were set to 37421948
Phenotypes for gene: TMEM63B were set to developmental and epileptic encephalopathy, MONDO:0100062, TMEM63B-related
Review for gene: TMEM63B was set to GREEN
Added comment: 17 unrelated individuals with severe early-onset developmental and epileptic encephalopathy (DEE), intellectual disability, and severe motor and cortical visual impairment were identified with ten distinct heterozygous variants inTMEM63B. The variants occurred de novo in 16/17 individuals for whom parental DNA was available and either missense or in-frame. All individuals had global developmental delay, with moderate-to-profound intellectual disability and severe motor impairment. All individuals had early-onset drug-resistant epilepsy, whose onset ranged from birth to 3 years but occurred within the first year in 14/17 (82%) and in the first month of life in 6/17 (35%).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5307 DHX9 Zornitza Stark Added comment: Comment when marking as ready: LoF variants caused mild NDD phenotypes and nuclear localization signal (NLS) missense variants caused severe NDD. CMT2-associated missense variants caused aberrant nucleolar DHX9 accumulation, a phenomenon previously associated with cellular stress.
Intellectual disability syndromic and non-syndromic v0.5306 DHX9 Zornitza Stark gene: DHX9 was added
gene: DHX9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DHX9 were set to 37467750
Phenotypes for gene: DHX9 were set to Neurodevelopmental disorder, MONDO:0700092, DHX9-related
Review for gene: DHX9 was set to GREEN
Added comment: PMID:37467750 - 17 unrelated individuals were identified with de novo, ultra-rare, heterozygous missense or loss-of-function DHX9 variants, of which 14 individuals were reported with a neurodevelopmental disorder (NDD) and three were reported with Charcot-Marie-Tooth disease (CMT). All 14 cases with NDD had developmental delay, of which eight were reported with intellectual disability (4 severe, 1 moderate, 3 mild). Two cases did not have ID, one had borderline ID and three cases were too young (0-5 years old). The three cases with CMT presented with adult-onset axonal neuropathy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5298 TEFM Zornitza Stark gene: TEFM was added
gene: TEFM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TEFM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TEFM were set to 36823193
Phenotypes for gene: TEFM were set to Combined oxidative phosphorylation deficiency 58, MIM# 620451
Review for gene: TEFM was set to GREEN
Added comment: Seven individuals from 5 families reported. Presentation predominantly with encephalopathy, seizures and ID, in addition to lactic acidosis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5295 TSPOAP1 Zornitza Stark reviewed gene: TSPOAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dystonia 22, MIM# 620453; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5294 TAF4 Zornitza Stark edited their review of gene: TAF4: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 73, MIM# 620450
Intellectual disability syndromic and non-syndromic v0.5290 DENND5B Zornitza Stark Phenotypes for gene: DENND5B were changed from Neurodevelopmental disorder with white matter anomalies to Neurodevelopmental disorder with white matter anomalies, MONDO:0700092, DENND5B-related
Intellectual disability syndromic and non-syndromic v0.5288 HCN2 Zornitza Stark Phenotypes for gene: HCN2 were changed from Febrile seizures, familial, 2 MIM#602477; Generalized epilepsy with febrile seizures plus, type 11 MIM#602477; {Epilepsy, idiopathic generalized, susceptibility to, 17} MIM#602477; Neurodevelopmental disorder (MONDO#0700092), HCN2-related to Neurodevelopmental disorder (MONDO#0700092), HCN2-related
Intellectual disability syndromic and non-syndromic v0.5286 TTI1 Zornitza Stark Phenotypes for gene: TTI1 were changed from Neurodevelopmental disorder, MONDO:0700092, TTI1-related to Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445
Intellectual disability syndromic and non-syndromic v0.5282 WBP4 Chirag Patel gene: WBP4 was added
gene: WBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: WBP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WBP4 were set to Neurodevelopmental disorder
Review for gene: WBP4 was set to GREEN
gene: WBP4 was marked as current diagnostic
Added comment: ESHG 2023:
11 individuals from 8 families with homozygous LOF variants in WBP4 gene (4 different variants). Presentation of severe DD and ID, hypotonia, abnormal outer ears, and varying congenital anomalies. WBP4 is spliceosome protein which binds/interacts with SNRNP200. In vivo and in vitro studies previously showed WBP4 enhances splicing and regulates alternative splicing. Patient fibroblasts showed loss of expression of WBP4. RNA sequencing analysis showed abnormal splicing patterns. Proposed spliceosomopathy.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5280 KDM2A Chirag Patel gene: KDM2A was added
gene: KDM2A was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: KDM2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KDM2A were set to Neurodevelopmental disorder
Review for gene: KDM2A was set to GREEN
gene: KDM2A was marked as current diagnostic
Added comment: ESHG 2023:
14 patients with de novo HTZ variants in KDM2A (5 x truncating, 9 x missense)
Presentation with DD, ID (mild), seizures, growth retardation, and dysmorphism.

Functional studies:
-patient blood showed aberrant genome wide methylation profile - potential episignature
-HEK293T cells showed altered subcellular localisation of KDM2A
-Drosophila models showed variants caused neurotoxicity
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5278 PIP5K1C Chirag Patel gene: PIP5K1C was added
gene: PIP5K1C was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: PIP5K1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PIP5K1C were set to Neurodevelopmental disorder and microcephaly
Review for gene: PIP5K1C was set to GREEN
gene: PIP5K1C was marked as current diagnostic
Added comment: ESHG 2023:
9 unrelated patients with de novo missense variants in PIP5K1C (3 x recurrent variants).
Presentation with DD/ID (mod-profound), microcephaly, seizures, visual impairment, and dysmorphism.

PIP5K1C is one of the phosphoinositolides, which control membrane composition of organelles and varying cellular processes. Patient fibroblasts showed increased PI(4,5)P2 levels, altered PI(4,5)P2 composition of early endosomes, and impaired endocytosis trafficking. Drosophila models showed microcephaly and ocular phenotype.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5276 NSUN6 Chirag Patel reviewed gene: NSUN6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5275 INTS13 Chirag Patel gene: INTS13 was added
gene: INTS13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: INTS13 were set to PMID: 36229431
Phenotypes for gene: INTS13 were set to Oral-facial-digital syndrome
Review for gene: INTS13 was set to GREEN
Added comment: 2 families with 4 affected individuals with Oral-facial-digital (OFD) phenotype. Homozygosity mapping and WES found 2 homozygous variants in INTS13 gene. This is a subunit of the Integrator complex, which associates with RNA Polymerase II and cleaves nascent RNA to modulate gene expression. Variants segregated with disease. Depletion of INTS13 disrupts ciliogenesis in human cultured cells and causes dysregulation of a broad collection of ciliary genes. Knockdown in Xenopus embryos leads to motile cilia anomalies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5273 DCAF15 Chirag Patel gene: DCAF15 was added
gene: DCAF15 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: DCAF15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DCAF15 were set to Cornelia de Lange syndrome
Review for gene: DCAF15 was set to AMBER
Added comment: ESHG 2023:
3 unrelated cases with CdLS (1 x TOP with MCA, 1 x death @20mths, 1 x living child)
Features suggestive of CdLS - DD, microcephaly, CHD, dysmorphism, visual/hearing impairment.

WES identified recurrent de novo variant (p.Ser470Phe) in DCAF15 gene. This mediates ubiquitination and degradation of target proteins, and interacts with cohesin complex members (SMC1/SMC3).

Protein analysis from individuals showed increased accumulation of ubiquitination-modified proteins and SM3 (GOF mechanism). EpiSign analysis showed same DNA methylation pattern as other CdLS cases/genes. Zebrafish model showed reduced body length, reduced head size, reduced oligodendrocytes, heart defect, aberrant motor neurons, and abnormal response to visual/auditory stimuli.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5271 CYHR1 Chirag Patel gene: CYHR1 was added
gene: CYHR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: CYHR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYHR1 were set to Neurodevelopmental disorder and microcephaly
Review for gene: CYHR1 was set to AMBER
gene: CYHR1 was marked as current diagnostic
Added comment: ESHG 2023:
5 individuals from 3 families with biallelic LOF variants in CYHR1 (aka ZTRAF1). Presentation with microcephaly, hypotonia, DD, and ID. Expression studies showed mislocalisation of CYHR1. Mutant fibroblasts showed increased lysosomal markers and upregulated lysosomal proteins, leading to impaired autophagy. Zebrafish KO however did not show a phenotype.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5270 GPATCH11 Chirag Patel gene: GPATCH11 was added
gene: GPATCH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: GPATCH11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPATCH11 were set to Leber congenital amaurosis and developmental delay
Review for gene: GPATCH11 was set to GREEN
gene: GPATCH11 was marked as current diagnostic
Added comment: ESHG 2023:
3 families with 8 individuals with leber congenital amaurosis, developmental delay, language disorder, and behavioural issues.
GPATCH11 localises to nucleus and basal body of primary cilium (similar to other LCA genes).
Biallelic variants found in GPATCH11 - 1 splice variant common to all 3 families (1 other variant in 3rd family). Splice variant leads to loss of exon 4 (mRNA studies).
Mouse models showed i) abnormal rod/cone responses on ERG; ii) decreased outer nuclear layer in retina, and iii) abnormal associate/episodic memory
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5267 KCNA3 Chirag Patel gene: KCNA3 was added
gene: KCNA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: KCNA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNA3 were set to Neurodevelopmental disorder
Review for gene: KCNA3 was set to GREEN
gene: KCNA3 was marked as current diagnostic
Added comment: ESHG 2023:
10 individuals with de novo missense variants in KCNA3 (K+ channel)
Variable electrophysiology studies of effect of variants (5 x LOF, 4 x GOF, 1 no change)
Presentation: abnormal speech development (8/8), ID (6/8), epilepsy (5/8), and ASD (7/8)
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5265 FSD1L Chirag Patel gene: FSD1L was added
gene: FSD1L was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: FSD1L was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FSD1L were set to Neurodevelopmental disorder
Review for gene: FSD1L was set to GREEN
gene: FSD1L was marked as current diagnostic
Added comment: ESHG 2023:
8 families with biallelic missense/nonsense variants
Presentation only described 1 family/2 affecteds with DD, ID, spastic paraparesis, epilepsy, corpus callosum hypoplasia, and optic nerve hypoplasia

Functional assays:
-reduced expression of FSD1L in mature neurons (RNA studies)
-very low % mature neurons (neuronal differentiation)
-reduced neuronal migration
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5263 DENND5B Chirag Patel gene: DENND5B was added
gene: DENND5B was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: DENND5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DENND5B were set to Neurodevelopmental disorder with white matter anomalies
Review for gene: DENND5B was set to GREEN
gene: DENND5B was marked as current diagnostic
Added comment: ESHG 2023:
7 patients/7 families with de novo DENND5B variants (6 missense, 1 splice)
DD/ID (mod/profound)(7/7), white matter anomalies (6/7) hypotonia, epilepsy (3/7)

DENND5B acts as:
-GEF for activation of RAB proteins which are involved in membrane trafficking and neurotransmitter release
-regulator of lipid absorption and homeostasis

Functional studies showed loss of expression of DENND5B in fibroblasts, abnormal vesicle trafficking, and impaired lipid uptake and intracellular distribution
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5260 DMAP1 Chirag Patel gene: DMAP1 was added
gene: DMAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: DMAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DMAP1 were set to Neurodevelopmental disorder
Review for gene: DMAP1 was set to GREEN
gene: DMAP1 was marked as current diagnostic
Added comment: ESHG 2023:
9 patients/8 families with bilallelic variants in DMAP1 (3 missense, 7 LOF)
All with DD, speech delay, hypotonia, and ID
Some with epilepsy (4/6), FTT (4/5), and brain malformations (3/5)
Drosophila showed abnormal behaviour pattern and bang sensitivity
Specific methylation episignature also seen
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5258 ITFG2 Chirag Patel reviewed gene: ITFG2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5258 HCN2 Elena Savva gene: HCN2 was added
gene: HCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: HCN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: HCN2 were set to Febrile seizures, familial, 2 MIM#602477; Generalized epilepsy with febrile seizures plus, type 11 MIM#602477; {Epilepsy, idiopathic generalized, susceptibility to, 17} MIM#602477; Neurodevelopmental disorder (MONDO#0700092), HCN2-related
Review for gene: HCN2 was set to AMBER
Added comment: ICG 2023 conference
- cohort of 20 individuals where >80% had a form of intellectual disability (half were severe) and/or seizures. Some had isolated intellectual disability, especially those with a recurring de novo p.E478del.
- Patients were both mono- and biallelic.
- Monoallelic individuals had de novo missense and an inframe deletion. Biallelic individuals had a mix of missense and PTC
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5256 ZMYM3 Zornitza Stark reviewed gene: ZMYM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 112, MIM# 301111; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5255 SART3 Krithika Murali Gene: sart3 has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.5254 RPH3A Elena Savva Gene: rph3a has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.5254 SART3 Daniel Flanagan edited their review of gene: SART3: Changed phenotypes: Neurodevelopmental disorder (MONDO#0700092), SART3-related, 46,XY disorder of sex development (MONDO:0020040), SART3-related
Intellectual disability syndromic and non-syndromic v0.5252 SART3 Daniel Flanagan gene: SART3 was added
gene: SART3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SART3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SART3 were set to PMID: 37296101
Phenotypes for gene: SART3 were set to Neurodevelopmental disorder (MONDO#0700092), SART3-related, with 46,XY gonadal dysgenesis
Review for gene: SART3 was set to GREEN
Added comment: Nine individuals from six families presenting with intellectual disability, global developmental delay, a subset of brain anomalies, together with gonadal dysgenesis in 46,XY individuals. Additionally, two individuals had seizures and two had epileptiform activity reported on EEG.

Human induced pluripotent stem cells carrying patient variants in SART3 show disruption to multiple signalling pathways, upregulation of spliceosome components and demonstrate aberrant gonadal and neuronal differentiation in vitro.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5251 ERI1 Elena Savva gene: ERI1 was added
gene: ERI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ERI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERI1 were set to 37352860
Phenotypes for gene: ERI1 were set to Intellectual disability (MONDO#0001071), ERI1-related
Review for gene: ERI1 was set to GREEN
Added comment: PMID: 37352860 - 8 individuals from 7 unrelated families
- Patients with biallelic missense show a MORE severe spondyloepimetaphyseal dysplasia, syndactyly, brachydactyly/clinodactyly/camptodactyly
- Patients with biallelic null/whole gene deletion had mild ID and digit anomalies including brachydactyly/clinodactyly/camptodactyly
- Patient chet for a missense and PTC variant has a blended phenotype with short stature, syndactyly, brachydactyly/clinodactyly/camptodactyly, mild ID and failure to thrive

- Missense variants were functionally shown to not be able to rescue 5.8S rRNA processing in KO HeLa cells
- K/O mice had neonatal lethality with growth defects, brachydactyly. Skeletal-specific K/O had mild platyspondyly, had more in keeping with patients with null variants than missense

More severe phenotype hypothesised due to "exonuclease-dead proteins may compete for the target RNA molecules with other exonucleases that have functional redundancy
with ERI1, staying bound to those RNA molecules"
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5250 RPH3A Lucy Spencer gene: RPH3A was added
gene: RPH3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RPH3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RPH3A were set to 37403762; 29441694
Phenotypes for gene: RPH3A were set to Neurodevelopmental disorder (MONDO#0700092), RPH3A-related
Review for gene: RPH3A was set to GREEN
Added comment: PMID: 37403762- 6 patients with RPH3A variant. All 6 have ID, 4 have epilepsy, 2 with obesity, 1 with dysmorphic features. All 6 have missense variants, 3 shown to be de novo, the other 3 parents were not available for testing. I patient also had language and motor impairment, breathing issues and mixed hypo/hypertonia- he also had variants in CUL4B, PRKAG2, SCN4A, none of these genes cause seizures (which he had).

Patch clamp studies on 2 of the missense showed they increased either the number of NMDA receptors on neuron membrane surface or increased their conductance. Study suggests that the variants interrupt the normal role of RPH3A activity at the synaptic NMDAR complex which is needed for the induction of synaptic plasticity and NMDAR-dependant behaviours

Also previously 1 biallelic patient was reported, PMID: 29441694- 1 girl with learning disabilities, tremors, ataxia, hyperglycemia and muscle fatigability. Chet for 2 RPH3A missense. Functional analysis showed strong and marginal impairment of protein binding for each variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5250 DRG1 Dean Phelan gene: DRG1 was added
gene: DRG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DRG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DRG1 were set to PMID: 37179472
Phenotypes for gene: DRG1 were set to Neurodevelopmental disorder (MONDO:0700092), DRG1-related
Review for gene: DRG1 was set to GREEN
Added comment: PMID: 37179472
- Biallelic variants were identified in four affected individuals from three distinct families with neurodevelopmental disorder with global developmental delay, primary microcephaly, short stature and craniofacial anomalies. Functional studies show the variants result in a loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5250 INTS11 Zornitza Stark Phenotypes for gene: INTS11 were changed from intellectual disability, MONDO:0001071 to Neurodevelopmental disorder with motor and language delay, ocular defects, and brain abnormalities, MIM# 620428
Intellectual disability syndromic and non-syndromic v0.5247 GCSH Zornitza Stark Phenotypes for gene: GCSH were changed from Glycine encephalopathy MIM#605899; neurodevelopmental disorder MONDO#0700092, GCHS-related to Multiple mitochondrial dysfunctions syndrome 7, MIM# 620423
Intellectual disability syndromic and non-syndromic v0.5245 RHOBTB2 Zornitza Stark Mode of inheritance for gene: RHOBTB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5244 RHOBTB2 Zornitza Stark edited their review of gene: RHOBTB2: Added comment: PMID 37165955: 16 individuals with de novo heterozygous missense variants in the BTB domain region and a severe DEE as previously reported. In addition, 6 individuals with de novo missense variants in the GTPase domain and a more variable neurodevelopmental phenotypes with or without epilepsy. In contrast to variants in the BTB domain region, variants in the GTPase domain do not impair proteasomal degradation of RHOBTB2 in vitro, indicating different functional consequences.
In addition, 9 families with observed bi-allelic splice-site and truncating variants with variable neurodevelopmental phenotypes, indicating that complete loss of RHOBTB2 is pathogenic as well.; Changed publications: 29768694, 29276004, 37165955; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5241 NSUN6 Elena Savva Gene: nsun6 has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.5239 UNC79 Elena Savva Gene: unc79 has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.5239 NSUN6 Michelle Torres gene: NSUN6 was added
gene: NSUN6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSUN6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSUN6 were set to 37226891
Phenotypes for gene: NSUN6 were set to neurodevelopmental disorder MONDO:0700092, NSUN6-related
Review for gene: NSUN6 was set to AMBER
Added comment: Three unrelated consanguineous families with developmental delay, intellectual disability, motor delay, and behavioral anomalies. WES detected homozygous variants:
- p.(Leu9Glufs*3): even though authors say is is predicted to cause NMD, it actually is NMD escape. No further studies were performed. A deceased affected sibling and parents were NOT tested.
- p.(Asp323Asn): Shown to result in a misfolded protein. Methylation assay showed mutant could not catalyze m5C deposition in transcribed tRNACys and tRNAThr substrates in vitro. One of the parents and both unaffected siblings were shown to be carriers.
- p.(Glu441Profs*15): truncation (full protein is 470aa) which would result in loss of residues involved in recognition and methylation. Shown to result in a misfolded protein. Parents were shown carriers.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5239 UNC79 Krithika Murali edited their review of gene: UNC79: Changed phenotypes: Neurodevelopmental disorderMONDO:0700092
Intellectual disability syndromic and non-syndromic v0.5239 UNC79 Krithika Murali gene: UNC79 was added
gene: UNC79 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UNC79 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UNC79 were set to PMID:37183800
Phenotypes for gene: UNC79 were set to Complex neurodevelopmental disorder - MONDO:0100038
Review for gene: UNC79 was set to AMBER
Added comment: PMID:37183800 Bayat et al 2023 report 6 unrelated patients with heterozygous NMD-predicted LoF variants in UNC79 - x1 canonical splice site variant, x5 nonsense/frameshift. 5 were confirmed de novo, 1 not identified in mother - father unavailable for testing. All variants absent in gnomAD and v2 pLI score for UNC79 is 1.

Patients with UNC79 variants were identified through GeneMatcher or an international network of Epilepsy and Genetics departments. x1 patient underwent duo exome sequencing, remaining had trio exome sequencing - no other causative variants identified.

Phenotypic features included:
- 4/6 autistic features
- 5/6 patients mild-moderate ID
- 4/6 behavioural issues (aggression, stereotypies)
- 4/6 epilepsy (focal to bilateral tonic-clonic seizures)
- 5/6 hypotonia

unc79 knockdown drosophila flies exhibited significantly higher rate of seizure-like behaviour than controls. unc79 haploinsufficiency shown to lead to significant reduction in protein levels of both unc79 and unc80 in mouse brains. Unc79 haploinsufficiency associated with deficiency in hippocampal-dependent learning and memory in mice.

Authors have reviewed their own evidence in relation to the gene-disease criteria detailed by Strande et al 2017 and note that their clinical and experimental data provides moderate-level evidence supporting the association between UNC79 and a neurodevelopment disorder including ASD.

Amber association favoured due to clinical phenotypic range reported between affected individuals and their lack of specificity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5234 ACBD6 Lucy Spencer gene: ACBD6 was added
gene: ACBD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ACBD6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ACBD6 were set to 36457943; 21937992; 35446914
Phenotypes for gene: ACBD6 were set to Neurodevelopmental disorder (MONDO#0700092), ACBD6-related
Review for gene: ACBD6 was set to GREEN
Added comment: PMID: 36457943
2 siblings with a neurodevelopmental disorder: severely delayed development, obesity, pancytopenia, diabetes, liver cirrhosis, intravertebral disc herniation, mild brain atrophy. Consanguineous family both siblings found to have a homozygous frameshift.

This paper also mentioned 3 other reported variants in 6 individuals (only 3 unrelated) all homozygous, 2 frameshift, 1 canonical splice. All reported to have a neurodevelopmental disorder, some with limited information but one family also has obesity, spasticity, and dysmorphism. PMIDs: 21937992, 35446914
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5234 POU3F2 Sarah Pantaleo commented on gene: POU3F2: Both loss of function and gain of function demonstrated
Intellectual disability syndromic and non-syndromic v0.5234 U2AF2 Paul De Fazio edited their review of gene: U2AF2: Changed publications: 34112922, 37092751, 36747105, 37134193
Intellectual disability syndromic and non-syndromic v0.5234 POU3F2 Sarah Pantaleo gene: POU3F2 was added
gene: POU3F2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POU3F2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: POU3F2 were set to PMID: 37207645
Phenotypes for gene: POU3F2 were set to Autism spectrum disorder, NDD, and adolescent-onset obesity
Penetrance for gene: POU3F2 were set to unknown
Mode of pathogenicity for gene: POU3F2 was set to Other
Review for gene: POU3F2 was set to GREEN
Added comment: We associate ultra-rare variants in POU3F2, encoding a central nervous system transcription factor, with syndromic obesity and neurodevelopment delay in 12 individuals. Demonstrate variant pathogenicity through in vitro analysis. Used exome sequencing, GeneMatcher and Genomics England 100,000 Genomes Project rare disease database.

Both truncating and missense variants in over 10 individuals sharing autism spectrum disorder, NDD, and adolescent-onset obesity (may have had other features eg. CAKUT in 2 individuals, diabetes in two) . Affected individuals presented with low-to-normal birth weight and infantile feeding difficulties but developed insulin resistance and hyperplasia during childhood. With the exception of an early truncating variant, the variants showed adequate nuclear translocation but overall disturbed DNA-binding ability and promoter activation.

Variants absent from population and clinical databases. Almost all constituted putatively non-inherited de novo variants (8/10).

Functional studies provide evidence for loss of function in eight and gain of function in one obesity-associated POU3F2 variant. One variant did not impact POU3F2-promoter activation, leaving the possibility for further path-mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5234 U2AF2 Paul De Fazio edited their review of gene: U2AF2: Changed rating: GREEN; Changed phenotypes: Neurodevelopmental disorder, U2AF2-related (MONDO:0700092); Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.5234 U2AF2 Paul De Fazio reviewed gene: U2AF2: Rating: ; Mode of pathogenicity: None; Publications: 34112922,37092751,36747105,37134193; Phenotypes: ; Mode of inheritance: None; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5234 MAP4K4 Zornitza Stark Phenotypes for gene: MAP4K4 were changed from to RASopathy, MONDO:0021060, MAP4K4-related
Intellectual disability syndromic and non-syndromic v0.5230 MAP4K4 Zornitza Stark commented on gene: MAP4K4: 26 individuals from 21 families reported with Rasopathy-like phenotype, comprising ID/DD, dysmorphic features and congenital anomalies.
Intellectual disability syndromic and non-syndromic v0.5230 MAP4K4 Zornitza Stark edited their review of gene: MAP4K4: Changed rating: GREEN; Changed publications: 37126546; Changed phenotypes: RASopathy, MONDO:0021060, MAP4K4-related; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5230 MCM6 Suliman Khan gene: MCM6 was added
gene: MCM6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MCM6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MCM6 were set to PMID: 37198333
Phenotypes for gene: MCM6 were set to Neurodevelopmental disorder, MONDO:0700092, MCM6-related
Review for gene: MCM6 was set to GREEN
Added comment: PMID: 37198333 reported 5 unrelated families with de novo variants in MCM6 gene. Two patients with the same missense variant p.(Cys158Tyr) in zinc finger domain presented with intra-uterine growth retardation, short stature, congenital microcephaly, endocrine features, developmental delay and urogenital anomalies.

In other three unrelated individuals different de novo missense variants were identified in the oligo nucleotide binding (OB)-fold domain. These patients had variable neurodevelopmental features including autism spectrum disorder, developmental delay, and epilepsy.

The clinical features and functional defects related to the zinc binding residue resembled those observed in syndromes related to other MCM components and DNA replication factors (Meier–Gorlin syndrome and Seckel syndrome), while de novo OB-fold domain missense variants were associated with more variable neurodevelopmental phenotypes (PMID: 37198333).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5229 TPR Zornitza Stark edited their review of gene: TPR: Changed phenotypes: Intellectual developmental disorder, autosomal recessive 79, MIM# 620393
Intellectual disability syndromic and non-syndromic v0.5229 UNC13A Ain Roesley Phenotypes for gene: UNC13A were changed from Congenital myasthenia; dyskinesia; autism; developmental delay to Congenital myasthenia; dyskinesia; autism; developmental delay; neurodevelopmental disorder MONDO#0700092, UNC13A-related
Intellectual disability syndromic and non-syndromic v0.5228 UNC13A Ain Roesley reviewed gene: UNC13A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO#0700092, UNC13A-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5228 ZNF292 Michelle Torres reviewed gene: ZNF292: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 64, MIM#619188; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5228 ESAM Zornitza Stark Phenotypes for gene: ESAM were changed from Neurodevelopmental disorder (MONDO#0700092), ESAM-related to Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371
Intellectual disability syndromic and non-syndromic v0.5227 ESAM Zornitza Stark reviewed gene: ESAM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5226 SLITRK2 Zornitza Stark reviewed gene: SLITRK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 111, MIM# 301107; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5222 CNOT9 Zornitza Stark Mode of inheritance for gene: CNOT9 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5220 LHX2 Manny Jacobs reviewed gene: LHX2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37057675; Phenotypes: Neurodevelopmental disorder (MONDO: 0700092); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5220 CNOT9 Karina Sandoval edited their review of gene: CNOT9: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5219 CNOT9 Karina Sandoval gene: CNOT9 was added
gene: CNOT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CNOT9 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: CNOT9 were set to PMID: 37092538
Phenotypes for gene: CNOT9 were set to neurodevelopmental disorder, MONDO:0700092
Review for gene: CNOT9 was set to GREEN
Added comment: 7 individuals with de novo variants. In silico predictions of functional relevance. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include.

Symptoms: Neuro dev disorder. ID, Epilepsy. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include muscular hypotonia, facial dysmorphism, and behavioral abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5219 CBX1 Daniel Flanagan gene: CBX1 was added
gene: CBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CBX1 were set to PMID: 37087635
Phenotypes for gene: CBX1 were set to Neurodevelopmental disorder (MONDO#0700092), CBX1-related
Review for gene: CBX1 was set to GREEN
Added comment: Three different de novo missense variants identified in three unrelated individuals with developmental delay, hypotonia, autistic features, and variable dysmorphic features such as broad forehead and head circumference above average. Mutant mice displayed increased latency-to-peak response, suggesting the possibility of synaptic delay or myelination deficits. Functional studies confirmed the reduction of mutant HP1β binding to heterochromatin.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5216 INTS11 Melanie Marty gene: INTS11 was added
gene: INTS11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: INTS11 were set to PMID: 37054711
Phenotypes for gene: INTS11 were set to Global developmental delay; launguage delay; intellectual disability; impaired motor development; brain atrophy
Review for gene: INTS11 was set to GREEN
Added comment: PMID: 37054711 - 15 individuals from 10 unrelated families with bi-allelic variants in INTS11 with global developmental and language delay, intellectual disability, impaired motor development, and brain atrophy.

Functional studies in Drosophila showed that dIntS11 (fly ortholog of INTS11) is essential and expressed in the central nervous systems in a subset of neurons and most glia in larval and adult stages.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5216 SRSF1 Paul De Fazio edited their review of gene: SRSF1: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.5216 SRSF1 Paul De Fazio gene: SRSF1 was added
gene: SRSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRSF1 were set to 37071997
Phenotypes for gene: SRSF1 were set to Neurodevelopmental disorder, SRSF1-related MONDO:0700092
Review for gene: SRSF1 was set to GREEN
gene: SRSF1 was marked as current diagnostic
Added comment: 17 individuals from 16 families reported with mostly de novo variants. Variants were a mixture of missense, nonsense/frameshift (both NMD-predicted and not NMD-predicted) and microdeletions. In one family, only one parent was available for testing. In another family, 2 affected siblings had the variant but the variant was not identified in either parent suggesting germline mosaicism.

Functional testing of a subset of variants in Drosophila supported pathogenicity in most, but 2 missense variants showed no functional effect and were classified VUS. Episignature analysis (EpiSign) on patient DNA from blood showed a specific DNA methylation signature in patients with the variants classified pathogenic but not those classified VUS.

Phenotypes included mainly neurological abnormalities (mild to moderate ID/dev delay, motor delay, speech delay, and behavioural disorders) and facial dysmorphisms.

Other features included hypotonia (11/16), variable brain abnormalities on MRI (6/12), variable cardiac malformations (6/14). urogenital malformations e.g. hypospadias, cryptorchidism (6/13), scoliosis (5/17) and/or variable other skeletal abnormalities (10/17).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5216 POLR1A Elena Savva gene: POLR1A was added
gene: POLR1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: POLR1A were set to PMID: 37075751
Phenotypes for gene: POLR1A were set to Acrofacial dysostosis, Cincinnati type MIM#616462
Review for gene: POLR1A was set to GREEN
Added comment: PMID: 37075751 - >10 patients with developmental delay
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5215 SLC30A9 Lucy Spencer gene: SLC30A9 was added
gene: SLC30A9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC30A9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC30A9 were set to 37041080
Phenotypes for gene: SLC30A9 were set to Birk-Landau-Perez syndrome (MIM#617595)
Review for gene: SLC30A9 was set to GREEN
Added comment: PMID:37041080 - 2 families previously reported and this paper describes 4 more with biallelic SLC30A9 variants. Original 2 families: 6 affected members all hom for Ala350del, and 1 affected member chet for 2 frameshifts. 4 families from this paper: 2 families have the same homozygous missense (Gly418Val), family 3 has 4 affected sibs hom for Ala350del, family 4 1 affected chet for a frameshift and a synonymous. So 2 fams homs for Ala350del and 2 fams hom for Gly418Val.
All have Brik-Landau-Perez syndrome: all with ID, movement disorder and dystonia, and many with oculomotor apraxia, renal abnormalitie, ptosis, some had hearing impairment.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5214 GATAD2A Bryony Thompson gene: GATAD2A was added
gene: GATAD2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GATAD2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GATAD2A were set to https://doi.org/10.1016/j.xhgg.2023.100198; 17565372
Phenotypes for gene: GATAD2A were set to Neurodevelopmental disorder, MONDO:0700092, GATAD2A-related
Review for gene: GATAD2A was set to GREEN
Added comment: https://doi.org/10.1016/j.xhgg.2023.100198 - Five unrelated individuals with a neurodevelopmental disorder identified with 3 missense & 2 LoF (4 de novo & 1 unknown inheritance). The shared clinical features with variable expressivity include global developmental delay (4/4), craniofacial dysmorphism (3/5), structural brain defects (2/3), musculoskeletal anomalies (3/5), vision/hearing defects (2/3), gastrointestinal/renal defects (2/3). Loss of function is the expected mechanism of disease. In vitro assays of one of the missense variants (p.Cys420Tyr) demonstrates disruption of GATAD2A integration with CHD3, CHD4, and CHD5
PMID: 17565372 - null mouse model is embryonic lethal.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5212 KDM5A Zornitza Stark gene: KDM5A was added
gene: KDM5A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KDM5A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: KDM5A were set to 21937992; 33350388
Phenotypes for gene: KDM5A were set to Neurodevelopmental disorder MONDO:0700092, KDM5A-related
Review for gene: KDM5A was set to GREEN
Added comment: PMID:21937992 reported a family with recessive missense KDM5A variant presenting with an undefined developmental disorder characterised with intellectual disability and facial dysmorphisms.

PMID:33350388 reported nine patients from seven unrelated families identified with variants in KDM5A, of which three unrelated patients harboured heterozygous variants, while six patients from four unrelated families had homozygous variants. These patients presented with autism spectrum disorder (ASD) and a spectrum of neurodevelopmental phenotypes including intellectual disability, lack of speech, developmental delay and motor impairment.

In addition, loss of KDM5A has resulted in repetitive behaviors, sociability deficits, cognitive dysfunction, and abnormal dendritic morphogenesis in mice.

This gene has already been associated with phenotype in Gene2Phenotype (biallelic inheritance with 'limited' rating), but not in OMIM.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5210 DNM1 Zornitza Stark Phenotypes for gene: DNM1 were changed from Developmental and epileptic encephalopathy 31, OMIM:616346 to Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346; Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352
Intellectual disability syndromic and non-syndromic v0.5209 DNM1 Zornitza Stark edited their review of gene: DNM1: Changed phenotypes: Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346, Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352
Intellectual disability syndromic and non-syndromic v0.5208 DNAH14 Elena Savva reviewed gene: DNAH14: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5208 RFX7 Zornitza Stark Phenotypes for gene: RFX7 were changed from ID, ASD, ADHD to Intellectual developmental disorder, autosomal dominant 71, with behavioral abnormalities, MIM# 620330
Intellectual disability syndromic and non-syndromic v0.5207 MED11 Zornitza Stark Phenotypes for gene: MED11 were changed from neurodevelopmental disorder MONDO#0700092, MED11-related to Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327
Intellectual disability syndromic and non-syndromic v0.5206 MED11 Zornitza Stark reviewed gene: MED11: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5206 WARS Zornitza Stark Phenotypes for gene: WARS were changed from Neurodevelopmental disorder (MONDO:0700092), WARS-related to Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317
Intellectual disability syndromic and non-syndromic v0.5205 WARS Zornitza Stark reviewed gene: WARS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5204 C16orf62 Chirag Patel reviewed gene: C16orf62: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36113987; Phenotypes: Ritscher-Schinzel syndrome-3 (RTSC3), MIM#619135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5203 ROBO1 Zornitza Stark reviewed gene: ROBO1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurooculorenal syndrome, MIM# 620305; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5202 CAMSAP1 Zornitza Stark Phenotypes for gene: CAMSAP1 were changed from lissencephaly spectrum disorders (MONDO:0018838), CAMSAP1-related to Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316
Intellectual disability syndromic and non-syndromic v0.5201 CAMSAP1 Zornitza Stark reviewed gene: CAMSAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5201 YWHAE Yetong Chen gene: YWHAE was added
gene: YWHAE was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YWHAE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: YWHAE were set to 36999555
Phenotypes for gene: YWHAE were set to Neurodevelopmental disorder, MONDO:0700092
Review for gene: YWHAE was set to GREEN
Added comment: PMID 36999555 reports 6 patients with YWHAE variants (1 intragenic deletion and 5 large deletions encompassing YWHEA but not PAFAH1B1) who have mild to severe intellectual disability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5199 RNH1 Zornitza Stark reviewed gene: RNH1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNH1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5198 CRIPT Karina Sandoval commented on gene: CRIPT: PMID: 37013901 identified 6 individuals with Rothmund-Thomson syndrome characterised by poikiloderma, sparse hair, small stature, skeletal defects, cancer, cataracts, resembling features of premature aging. Two new variants identified and 4 were already published. 5 were hom, 1 was chet, all with different variants.
All CRIPT individuals fulfilled the diagnostic criteria for RTS, and additionally had neurodevelopmental delay and seizures.

CRIPT-deficient fibroblasts showed an unremarkable mitotic progression and unremarkable number of mitotic errors,

c.132del p.(Ala45Glyfs*82), hom
c.227G>A, p.(Cys76Tyr), hom
c.133_134insGG,p.(Ala45Glyfs*82),hom
c.141del p.(Phe47Leufs*84), hom
c.8G>A p.(Cys3Tyr), 1,331 bp del exon 1, chet
c.7_8del; p.(Cys3Argfs*4), hom
Intellectual disability syndromic and non-syndromic v0.5198 CRIPT Karina Sandoval gene: CRIPT was added
gene: CRIPT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRIPT were set to PMID: 37013901
Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789) : Rothmund-Thomson syndrome MONDO:0010002
Review for gene: CRIPT was set to GREEN
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5196 SNAPC4 Ee Ming Wong changed review comment from: - Ten individuals from eight families with neurodevelopmental disorder found to be compound heterozygous for variants in SNAPC4
- Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice
- Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts
Sources: Literature; to: - Ten individuals from eight families with neurodevelopmental disorder found to be biallelic for variants in SNAPC4
- Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice
- Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 RNH1 Krithika Murali edited their review of gene: RNH1: Changed rating: RED
Intellectual disability syndromic and non-syndromic v0.5195 SNAPC4 Ee Ming Wong gene: SNAPC4 was added
gene: SNAPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNAPC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNAPC4 were set to 36965478
Phenotypes for gene: SNAPC4 were set to Neurodevelopmental disorder (MONDO#0700092), SNAPC4-related
Review for gene: SNAPC4 was set to GREEN
gene: SNAPC4 was marked as current diagnostic
Added comment: - Ten individuals from eight families with neurodevelopmental disorder found to be compound heterozygous for variants in SNAPC4
- Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice
- Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 MKL2 Dean Phelan gene: MKL2 was added
gene: MKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MKL2 were set to PMID: 37013900
Phenotypes for gene: MKL2 were set to Neurodevelopmental disorder (MONDO:0700092), MKL2-related
Mode of pathogenicity for gene: MKL2 was set to Other
Review for gene: MKL2 was set to AMBER
Added comment: PMID: 37013900
- de novo missense variants in MKL2 (now known as MRTFB) were identified in two patients with mild dysmorphic features, intellectual disability, global developmental delay, speech apraxia, and impulse control issues. Functional studies in a Drosophila model suggest a gain of function disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 RNH1 Krithika Murali gene: RNH1 was added
gene: RNH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNH1 were set to PMID: 36935417
Phenotypes for gene: RNH1 were set to RNH1-related disorder
Review for gene: RNH1 was set to AMBER
Added comment: PMID: 36935417 report two siblings from a consanguineous Somali family with homozygous RNH1 splice site variant (c.615-2A>C) with congenital cataracts, global developmental delay, hypotonia, seizures (focal and generalised) and regression in the context of infection. RT-PCR and RNASeq of skeletal muscle supported exon 7 skipping with an in-frame deletion involving 57 amino acids with reduced expression on Western blot analysis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 ESAM Chern Lim gene: ESAM was added
gene: ESAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ESAM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ESAM were set to 36996813
Phenotypes for gene: ESAM were set to Neurodevelopmental disorder (MONDO#0700092), ESAM-related
Review for gene: ESAM was set to GREEN
gene: ESAM was marked as current diagnostic
Added comment: PMID 36996813:
- Thirteen affected individuals, including four fetuses, from eight unrelated families, with homozygous loss-of-function-type variants in ESAM – 2 of the variants are frameshifts, 1x nonsense, 1x canonical splice.
- Affected individuals have profound global developmental delay/unspecified intellectual disability, epilepsy, absent or severely delayed speech, varying degrees of spasticity, ventriculomegaly, and ICH/cerebral calcifications, the latter being also observed in the fetuses.
- One of the frameshift variant c.115del (p.Arg39Glyfs*33), was detected in six individuals from four unrelated families from the same geographic region in Turkey (southeastern Anatolia), suggesting a founder effect.
- The c.451+1G>A variant was detected in three individuals from two independent families with the same ethnic origin (Arab Bedouin)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5194 NCAPG2 Zornitza Stark reviewed gene: NCAPG2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Khan-Khan-Katsanis syndrome, MIM# 618460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5193 SLC31A1 Zornitza Stark edited their review of gene: SLC31A1: Changed phenotypes: Neurodegeneration and seizures due to copper transport defect, MIM# 620306
Intellectual disability syndromic and non-syndromic v0.5193 SCN1B Sangavi Sivagnanasundram Deleted their review
Intellectual disability syndromic and non-syndromic v0.5193 SCN1B Sangavi Sivagnanasundram reviewed gene: SCN1B: Rating: AMBER; Mode of pathogenicity: None; Publications: 9697698, 17020904, 12011299; Phenotypes: Generalized epilepsy with febrile seizures plus, type 1 (MONDO:0018214, MIM 604233); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.5193 AGO1 Zornitza Stark Phenotypes for gene: AGO1 were changed from Intellectual disability; autism to Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292
Intellectual disability syndromic and non-syndromic v0.5192 AGO1 Zornitza Stark edited their review of gene: AGO1: Changed phenotypes: Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292
Intellectual disability syndromic and non-syndromic v0.5192 TAB2 Lucy Spencer gene: TAB2 was added
gene: TAB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAB2 were set to 35971781
Phenotypes for gene: TAB2 were set to Congenital heart defects, multiple types, 2 MONDO:0014000
Review for gene: TAB2 was set to GREEN
Added comment: PMID: 35971781 - expansion of the phenotype, 14 patients with TAB2 variants 6 have dev delay and 4 are also listed as having ID along with other phenotype features associated with this gene.

Note- there is a previous review of this paper in the mendeilome as amber
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5192 UBE3C Zornitza Stark Phenotypes for gene: UBE3C were changed from Neurodevelopmental disorder, MONDO:0700092, UBE3C-related to Neurodevelopmental disorder with absent speech and movement and behavioral abnormalities, MIM# 620270
Intellectual disability syndromic and non-syndromic v0.5191 UBE3C Zornitza Stark edited their review of gene: UBE3C: Changed phenotypes: Neurodevelopmental disorder with absent speech and movement and behavioral abnormalities, MIM# 620270
Intellectual disability syndromic and non-syndromic v0.5191 HECTD4 Zornitza Stark Phenotypes for gene: HECTD4 were changed from Neurodevelopmental disorder, MONDO:0700092, HECTD4-related to Neurodevelopmental disorder with seizures, spasticity, and complete or partial agenesis of the corpus callosum, MIM# 620250
Intellectual disability syndromic and non-syndromic v0.5190 HECTD4 Zornitza Stark edited their review of gene: HECTD4: Changed phenotypes: Neurodevelopmental disorder with seizures, spasticity, and complete or partial agenesis of the corpus callosum, MIM# 620250
Intellectual disability syndromic and non-syndromic v0.5190 Zornitza Stark removed gene:MTSS1 from the panel
Intellectual disability syndromic and non-syndromic v0.5189 DPYSL2 Zornitza Stark Phenotypes for gene: DPYSL2 were changed from intellectual disability, MONDO:0001071; Aplasia/Hypoplasia of the corpus callosum, HP:0007370 to intellectual disability, MONDO:0001071, DPYSL2-related
Intellectual disability syndromic and non-syndromic v0.5184 YWHAZ Achchuthan Shanmugasundram gene: YWHAZ was added
gene: YWHAZ was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YWHAZ was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: YWHAZ were set to 36001342
Phenotypes for gene: YWHAZ were set to Intellectual disability, MONDO:0001071
Review for gene: YWHAZ was set to RED
Added comment: PMID:36001342 reported one large three-generation family with intellectual disability and global developmental delay, where all affected members were identified with a heterozygous missense variant (c.147A>T/ p.Lys49Asn) in YWHAZ gene. Although there were 10 other rare variants located in 10 genes (ARHGAP4, AGPS, APOL3, CES3, DACT2, ECH1, FAM71E2, KREMEN1, YWHAZ, ZFYVE26) that co-segregated with the ID/GDD phenotype were identified in the family, they were either not present in all affected members or present in unaffected members.

In addition, computational modeling and knockdown/ knockin studies with Drosophila also confirmed the role of this YWHAZ variant in intellectual disability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5183 RRAS2 Elena Savva gene: RRAS2 was added
gene: RRAS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RRAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RRAS2 were set to PMID: 31130282; 31130285
Phenotypes for gene: RRAS2 were set to Noonan syndrome 12 MIM#618624
Mode of pathogenicity for gene: RRAS2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: RRAS2 was set to AMBER
Added comment: Gene has an established GOF mechanism

PMID: 31130282 - 3/9 individuals had mild learning difficulties or mild GDD

PMID: 31130285 - 1/3 individuals had mild ID, 1/3 had severe ID, 1/3 normal
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5182 RBSN Achchuthan Shanmugasundram gene: RBSN was added
gene: RBSN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RBSN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RBSN were set to 25233840; 29784638; 35652444
Phenotypes for gene: RBSN were set to intellectual disability, MONDO:0001071
Review for gene: RBSN was set to GREEN
Added comment: This gene should be rated GREEN as bi-allelic variants in RBSN has been associated with a phenotype encompassing developmental delay and intellectual disability from four unrelated families.

PMID:25233840 reported a 6.5 year old female patient with a homozygous missense variant c.1273G > A (p.Gly425Arg) and her clinical presentation included intractable seizures, developmental delay, microcephaly, dysostosis, osteopenia, craniofacial dysmorphism, macrocytosis and megaloblastoid erythropoiesis.

PMID:29784638 reported three siblings with homozygous variant c.289G>C (p.Gly97Arg) in RBSN. The proband presented global developmental delay, had complete 46,XY male-to-female sex reversal and died at age 20 months after multiple infections. The other 2 affected siblings underwent unrelated-donor bone marrow or stem cell transplantation at 8 and 6.5 months of age, respectively. Both have severe intellectual disability and are nonambulatory and nonverbal.

PMID:35652444 reported two unrelated families (three siblings from a family of Iranian descent identified with homozygous variant c.547G>A (p.Gly183Arg) and four members from a family of indigenous Cree descent identified with homozygous variant c.538C>G (p.Arg180Gly)) with overlapping phenotypes including developmental delay, intellectual disability, distal motor axonal neuropathy and facial dysmorphism.

This gene has not yet been associated with any phenotypes either in OMIM or in Gene2Phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5182 CTR9 Achchuthan Shanmugasundram changed review comment from: PMID:35717577 reported two additional unrelated cases with non-synonymous heterozygous CTR9 variants (p.Glu15Asp and p.Pro25Arg) and they presented with macrocephaly, motor delay, and intellectual disability. In addition, functional studies in also showed that knockout/ over-expression of CTR9 variants caused motor defects and enlargement of telencephalon (homologous to the mammalian cerebrum).; to: PMID:35717577 reported two additional unrelated cases with non-synonymous heterozygous CTR9 variants (p.Glu15Asp and p.Pro25Arg) and they presented with macrocephaly, motor delay, and intellectual disability. In addition, functional studies in zebrafish also showed that knockout/ over-expression of CTR9 variants caused motor defects and enlargement of telencephalon (homologous to the mammalian cerebrum).
Intellectual disability syndromic and non-syndromic v0.5182 DPYSL2 Achchuthan Shanmugasundram gene: DPYSL2 was added
gene: DPYSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPYSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DPYSL2 were set to 27249678; 35861646
Phenotypes for gene: DPYSL2 were set to intellectual disability, MONDO:0001071; Aplasia/Hypoplasia of the corpus callosum, HP:0007370
Review for gene: DPYSL2 was set to AMBER
Added comment: This gene should be rated AMBER, as it has been associated with intellectual disability (ID) from two unrelated cases displaying monoallelic variants in DPYSL2/ CRMP2, and supported by functional studies. However, the evidence is not sufficient for green rating as there are variants reported in other (but different) genes in the two patients.

PMID:35861646 reported two cases identified with heterozygous variants (patient1: c.1693C>T (p.Arg565Cys); patient 2: c.42C>A (p.Ser14Arg). These patients had overlapping phenotypes including dysmorphic features, severe global developmental delay and hypoplasia of the corpus callosum. In addition, patient 2 was bed-ridden and could not roll out and had a history of myoclonic seizures and status epilepticus.

It should be noted that patient 1 is compound heterozygous for 2 missense variants in the EFCAB5 gene and was hemizygous for a maternally inherited missense variant in the GPKOW gene and patient 2 had 1 de novo missense variant in the COBLL1 gene and was compound heterozygous for 2 missense variants in the POTEF gene. The severity of the phenotypes between the two cases differs significantly and the additional variants may have possibly contributed to this phenotype.

Brain-specific Crmp2 knockout mice display neuronal development deficits and behavioural impairments associated with hypoplasia of the corpus callosum. In addition, functional studies performed in zebrafish and cell lines that the CRMP2 variants lead to the loss-of-function of CRMP2 protein and can cause intellectual disability.

This gene has not yet been associated with relevant phenotypes either in OMIM or in Gene2Phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5182 CTR9 Achchuthan Shanmugasundram reviewed gene: CTR9: Rating: ; Mode of pathogenicity: None; Publications: 35717577; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5181 AMOTL1 Lucy Spencer gene: AMOTL1 was added
gene: AMOTL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AMOTL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AMOTL1 were set to 36751037
Phenotypes for gene: AMOTL1 were set to Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related
Review for gene: AMOTL1 was set to GREEN
Added comment: PMID: 36751037- 16 individuals from 12 families with orofacial clefting syndrome and het variants in AMOTL1. Many in 1 hotspot: 5 individuals from 3 families have R157C, 6 individuals from another 4 families have R157H, 1 has P160L, and another has Q161R. Out of this hostpaot- 1 with P368A, 1 with E507K, 1 with E579K. 7 are de novo. All but 2 have clefting, 7 are dysmorphic, 5 have hearing loss, 9 have CHD, 7 have tall stature, 6 have dev delay. Other features include liver disease, myopia, scoliosis and immune involvement.

Another 2 families have been previously reported (described in the panelapp review in mendeliome) with variants in this hotspot 1 has 2 individuals with R157C, the other has 1 individual with P160L. All hotspot are absent from gnomad v2.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5180 SLC35B2 Zornitza Stark gene: SLC35B2 was added
gene: SLC35B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC35B2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC35B2 were set to 35325049
Phenotypes for gene: SLC35B2 were set to Leukodystrophy, hypomyelinating, 26, with chondrodysplasia, MIM# 620269
Review for gene: SLC35B2 was set to AMBER
Added comment: 2 x individuals with homozygous variants (c.1218_1220del and c.1224_1225del) in SLC35B2. Phenotypes included pre- and postnatal growth retardation, scoliosis, severe motor and intellectual disabilities and hypomyelinating leukodystrophy. Functional analysis on patient cells showed that the variants result in a decreased expression of mRNA and affect protein subcellular localization leading to functional impairment of the protein.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5179 EMC1 Achchuthan Shanmugasundram reviewed gene: EMC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35234901; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5177 ATG4D Zornitza Stark reviewed gene: ATG4D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, ATG4D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5177 ROBO1 Achchuthan Shanmugasundram gene: ROBO1 was added
gene: ROBO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ROBO1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ROBO1 were set to 28286008; 30692597; 35227688; 35348658
Phenotypes for gene: ROBO1 were set to intellectual disability, MONDO:0001071
Review for gene: ROBO1 was set to GREEN
Added comment: Comment on gene classification: This gene should be rated green as this gene has been associated with intellectual disability from six unrelated cases. However, the MOI should be set as "BIALLELIC, autosomal or pseudoautosomal" as five of these cases were reported with biallelic variants and only one case was reported with monoallelic variant.

PMID:28286008 reported a boy with compound heterozygous variants that was presented with developmental delay in 13 months and had severe intellectual disability and hyperactivity at nine years of age. He was nonverbal and wheelchair dependent because of spastic diplegia and ataxia.

PMID:30692597 reported a five year old boy identified with a homozygous ROBO1 variant who had combined pituitary hormone deficiency, psychomotor developmental delay, severe intellectual disability, sensorineural hearing loss, strabismus and characteristic facial features.

PMID:35227688 reported eight patients including the boy reported in PMID:30692597. Of the other seven patients, three were presented with intellectual disability. Of these three patients, two harboured compound heterozygous and one harboured homozygous variants.

PMID:35348658 reported a patient identified with monoallelic de novo variant (p.D422G) who presented with early-onset epileptic encephalopathy and had severe developmental delay.

This gene has not yet been associated with any phenotypes in OMIM or Gene2Phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5177 ATG4D Suliman Khan gene: ATG4D was added
gene: ATG4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATG4D was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATG4D were set to PMID: 36765070
Phenotypes for gene: ATG4D were set to neurodevelopmental disorder; Abnormal facial shape
Penetrance for gene: ATG4D were set to unknown
Review for gene: ATG4D was set to GREEN
Added comment: PMID: 36765070 reported three individuals from two unrelated families with a neurodevelopmental disorder characterized by speech and motor impairment with a similar facial gestalt comprising almond-shaped eyes, depressed nasal bridge, and a prominent Cupid’s bow with variable disease severity and progression. NGS analysis revealed bi-allelic loss-of-function variants in ATG4D gene. Based on the clinical, bioinformatic, and functional data, the author concluded that bi-allelic loss-of-function variants in ATG4D contribute to the pathogenesis of syndromic neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5175 PPM1K Zornitza Stark edited their review of gene: PPM1K: Added comment: PMID: 36706222 reported a patient with MSUD with mild findings and elevated BCAA levels carrying a novel homozygous start-loss variant in PPM1K.; Changed rating: AMBER; Changed publications: 23086801, 36706222
Intellectual disability syndromic and non-syndromic v0.5170 JPH3 Zornitza Stark Mode of inheritance for gene: JPH3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5168 JPH3 Zornitza Stark reviewed gene: JPH3: Rating: AMBER; Mode of pathogenicity: None; Publications: 36273396; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, JPH3-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5168 ATP9A Zornitza Stark Phenotypes for gene: ATP9A were changed from Neurodevelopmental delay; Postnatal microcephaly; Failure to thrive; Gastrointestinal symptoms to Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242
Intellectual disability syndromic and non-syndromic v0.5167 ATP9A Zornitza Stark edited their review of gene: ATP9A: Changed phenotypes: Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242
Intellectual disability syndromic and non-syndromic v0.5167 GOLGA2 Zornitza Stark Phenotypes for gene: GOLGA2 were changed from Neuromuscular disorder to Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240
Intellectual disability syndromic and non-syndromic v0.5165 GOLGA2 Zornitza Stark edited their review of gene: GOLGA2: Added comment: Third family reported.; Changed publications: 34424553; Changed phenotypes: Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5165 RAB39B Achchuthan Shanmugasundram reviewed gene: RAB39B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20159109, 25434005, 11050621, 29152164, 32873259, 34761259; Phenotypes: Intellectual developmental disorder, X-linked 72, OMIM:300271, Waisman syndrome, OMIM:311510; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5165 WDR11 Zornitza Stark reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 78, MIM# 620237; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5165 TRPM3 Zornitza Stark Phenotypes for gene: TRPM3 were changed from Neurodevelopmental disorder, MONDO:0700092, TRPM3-related to Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224
Intellectual disability syndromic and non-syndromic v0.5164 TRPM3 Zornitza Stark edited their review of gene: TRPM3: Changed phenotypes: Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224
Intellectual disability syndromic and non-syndromic v0.5163 WDR5 Bryony Thompson edited their review of gene: WDR5: Changed publications: 36408368
Intellectual disability syndromic and non-syndromic v0.5159 OGDH Zornitza Stark gene: OGDH was added
gene: OGDH was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: OGDH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OGDH were set to 36520152; 32383294
Phenotypes for gene: OGDH were set to Oxoglutarate dehydrogenase deficiency, MIM# 203740
Review for gene: OGDH was set to GREEN
Added comment: 6 individuals reported with bi-allelic variants in this gene and DD.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5158 CCDC84 Lucy Spencer gene: CCDC84 was added
gene: CCDC84 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC84 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC84 were set to 34009673
Phenotypes for gene: CCDC84 were set to Mosaic variegated aneuploidy syndrome 4 (MIM#620153)
Review for gene: CCDC84 was set to AMBER
Added comment: PMID: 34009673- patients with constitutional mosaic aneuploidy were found to have biallelic mutations in CENATAC(CCDC84). 2 adult siblings with mosaic aneuploidies, microcephaly, dev delay, and maculopathy. Both chet for a missense and a splice site deletion- but the paper days these both result in the creation of a novel splice site that leads to frameshifts and loss of the c-terminal 64 amino acids.

Gene is shown to be part of a spliceosome. CENATAC depletion or expression of disease mutants resulted in retention of introns in ~100 genes enriched for nucleocytoplasmic transport and cell cycle regulation, and caused chromosome segregation errors.

Functional analysis in CENATAC-depleted HeLa cells demonstrated chromosome congression defects and subsequent mitotic arrest, which could be fully rescued by wildtype but not mutant CENATAC. Expression of the MVA-associated mutants exacerbated the phenotype, suggesting that the mutant proteins dominantly repress the function of any residual wildtype protein.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5158 TTI1 Ee Ming Wong reviewed gene: TTI1: Rating: GREEN; Mode of pathogenicity: None; Publications: DOI:https://doi.org/10.1016/j.ajhg.2023.01.006; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TTI1-related to; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5158 NAE1 Zornitza Stark Phenotypes for gene: NAE1 were changed from Neurodevelopmental disorder, MONDO:0700092, NAE1-related to Neurodevelopmental disorder with dysmorphic facies and ischiopubic hypoplasia, MIM# 620210
Intellectual disability syndromic and non-syndromic v0.5157 NAE1 Zornitza Stark edited their review of gene: NAE1: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and ischiopubic hypoplasia, MIM# 620210
Intellectual disability syndromic and non-syndromic v0.5157 TCEAL1 Zornitza Stark Phenotypes for gene: TCEAL1 were changed from Neurodevelopmental disorder, MONDO:0700092, TCEAL1-related; hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features to Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094
Intellectual disability syndromic and non-syndromic v0.5156 TCEAL1 Zornitza Stark reviewed gene: TCEAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5156 FGF13 Zornitza Stark Phenotypes for gene: FGF13 were changed from Developmental and epileptic encephalopathy 90, MIM# 301058; Intellectual disability; epilepsy to Developmental and epileptic encephalopathy 90, MIM# 301058; Intellectual developmental disorder, X-linked 110, MIM# 301095
Intellectual disability syndromic and non-syndromic v0.5154 FGF13 Zornitza Stark edited their review of gene: FGF13: Added comment: PMID 34184986: 3 individuals reported with moderate to severe ID and maternally inherited 5' variant c.-32C-G; Changed publications: 33245860, 34184986; Changed phenotypes: Developmental and epileptic encephalopathy 90, MIM# 301058, Intellectual developmental disorder, X-linked 110, MIM# 301095
Intellectual disability syndromic and non-syndromic v0.5154 ZNF668 Zornitza Stark Phenotypes for gene: ZNF668 were changed from DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism to Neurodevelopmental disorder with poor growth, large ears, and dysmorphic facies, MIM# 620194
Intellectual disability syndromic and non-syndromic v0.5152 SMC5 Zornitza Stark edited their review of gene: SMC5: Changed phenotypes: Atelis syndrome 2, MIM# 620185
Intellectual disability syndromic and non-syndromic v0.5151 SLF2 Zornitza Stark edited their review of gene: SLF2: Changed phenotypes: Atelis syndrome 1, MIM# 620184
Intellectual disability syndromic and non-syndromic v0.5150 NAE1 Zornitza Stark gene: NAE1 was added
gene: NAE1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAE1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAE1 were set to 36608681
Phenotypes for gene: NAE1 were set to Neurodevelopmental disorder, MONDO:0700092, NAE1-related
Review for gene: NAE1 was set to GREEN
Added comment: Four individuals reported with bi-allelic variants and intellectual disability, ischiopubic hypoplasia, stress-mediated lymphopenia and neurodegeneration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5148 TRPC5 Zornitza Stark gene: TRPC5 was added
gene: TRPC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRPC5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890
Phenotypes for gene: TRPC5 were set to Neurodevelopmental disorder, MONDO:0700092, TRPC5-related
Review for gene: TRPC5 was set to AMBER
Added comment: PMID: 36323681; Leitão E. et al. (2022) Nat Commun.13(1):6570:
Missense variant NM_012471.2:c.523C>T, p.(Arg175Cys in three brothers with intellectual disability (ID) and autistic spectrum disorder (ASD), inherited from an asymptomatic mother and absent in the maternal grandparents.
Whole cell patch clamp studies of HEK293 created by site-directed mutagenesis showed increased current of this calcium channel (constitutively opened).
(This variant is absent in gnomAD v2.1.1).

Also, the nonsense variant, c.965G> A, p.(Trp322*) was found in a high functioning ASD male (maternally inherited), NMD-predicted.

Other papers and TRPC5 variants that were cited to associate this gene with X-linked ID and/or ASD include:
PMID: 24817631; Mignon-Ravix, C. et al. (2014) Am. J.Med. Genet. A 164A: 1991–1997: A hemizygous 47-kb deletion in Xq23 including exon 1 of the TRPC5 gene. He had macrocephaly, delayed psychomotor development, speech delay, behavioural problems, and autistic features. Maternally inherited, and a family history compatible with X-linked inheritance (i.e., maternal great uncle was also affected, although not tested).

In addition, PMID: 36323681; Leitão E. et al. (2022) cites papers with the variants p.(Pro667Thr), p.(Arg71Gln) and p.(Trp225*).
NB. p.(Pro667Thr) is absent in gnomAD (v2.1.1), p.(Arg71Gln) is also absent (the alternative variant p.(Arg71Trp) is present once as heterozygous only). p.(Trp225*) is absent, and it should be noted that PTCs / LoF variants are very rare (pLI = 1).

However, looking further into the three references, the evidence is not as clear or as accurate as was stated.

The missense variant c.1999C>A, p.(Pro667Thr), was stated as de novo, but was actually maternally inherited but was still considered a candidate for severe intellectual disability (shown in the Appendix, Patient 93, with severe speech delay, autism spectrum disorder and Gilles de la Tourette). This patient also has a de novo MTF1 variant. Reference: PMID: 23033978; de Ligt, J. et al. (2012) N. Engl. J. Med. 367: 1921–1929).

Missense variant (de novo): c.212G>A, p.(Arg71Gln), was found as part of the Deciphering Developmental Disorders (DDD) study and is shown in individual 164 in Supplementary Table 2 of PMID: 33504798; Martin, HC. et al. (2021) Nat. Commun.12: 627. Also displayed in DECIPHER (DDD research variant) with several phenotype traits, but ID and ASD are not specifically mentioned.

Nonsense variant: c.674G>A. p.(Trp225*) was stated as de novo but was inherited (reference PMID: 28191890; Kosmicki, JA. et al. (2017) Nat. Genet. 49: 504–510. Supplement Table 7). This was a study of severe intellectual delay, developmental delay / autism. (NB. The de novo p.(Arg71Gln) variant from the DDD study is also listed (subject DDD 342 in Supplement 4 / Table 2).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5145 SLC31A1 Zornitza Stark reviewed gene: SLC31A1: Rating: RED; Mode of pathogenicity: None; Publications: 36562171; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5139 CDK16 Belinda Chong changed review comment from: Total of 3 families with ID 1 with ASD.
PMID 36323681:
Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity.
A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance.

PMID 31981491:
In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD.

PMID 25644381:
Single family described in this manuscript describing multiple candidate genes for XLID.; to: 3 families with ID 1 with ASD.
PMID 36323681:
Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity.
A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance.

PMID 31981491:
In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD.

PMID 25644381:
Single family described in this manuscript describing multiple candidate genes for XLID.
Intellectual disability syndromic and non-syndromic v0.5139 CDK16 Belinda Chong changed review comment from: Total of 3 families with ID i with ASD.
PMID 36323681:
Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity.
A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance.

PMID 31981491:
In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD.

PMID 25644381:
Single family described in this manuscript describing multiple candidate genes for XLID.; to: Total of 3 families with ID 1 with ASD.
PMID 36323681:
Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity.
A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance.

PMID 31981491:
In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD.

PMID 25644381:
Single family described in this manuscript describing multiple candidate genes for XLID.
Intellectual disability syndromic and non-syndromic v0.5138 CDK16 Belinda Chong commented on gene: CDK16: Total of 3 families with ID i with ASD.
PMID 36323681:
Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity.
A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance.

PMID 31981491:
In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD.

PMID 25644381:
Single family described in this manuscript describing multiple candidate genes for XLID.
Intellectual disability syndromic and non-syndromic v0.5138 CDK16 Belinda Chong reviewed gene: CDK16: Rating: GREEN; Mode of pathogenicity: None; Publications: 36323681, 31981491, 25644381; Phenotypes: Neurodevelopmental disorder (MONDO#0700092) CDK16-related; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5134 EIF4A2 Dean Phelan gene: EIF4A2 was added
gene: EIF4A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: EIF4A2 were set to PMID: 36528028
Phenotypes for gene: EIF4A2 were set to Neurodevelopmental disorder (MONDO:0700092), EIF4A2-related
Mode of pathogenicity for gene: EIF4A2 was set to Other
Review for gene: EIF4A2 was set to GREEN
Added comment: PMID: 36528028
- EIF4A2 variants were observed in 15 individuals from 14 families. Affected individuals had a range of symptoms including global developmental delay (9/15), ID (7/15), epilepsy (11/15) and structural brain alterations (10/15). Monoallelic and biallelic variants were reported and functional studies showed both LOF and GOF disease mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5134 TRA2B Elena Savva gene: TRA2B was added
gene: TRA2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRA2B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TRA2B were set to PMID: 36549593
Phenotypes for gene: TRA2B were set to Neurodevelopmental disorder, TRA2B-related (MONDO#0700092)
Review for gene: TRA2B was set to GREEN
Added comment: PMID: 36549593
- 12 individuals with ID and dev delay. Additional features include infantile spams 6/12, hypotonia 12/12, dilated brain ventricles 6/12, microcephaly 5/12
- All variants result in the loss of 1/2 transcripts (start-losses or PTCs upstream of a second translation start position). Shorter transcript expression is increased, longer transcript expression is decreased.
- Apparently het mice K/O are normal, but complete K/O cannot develop embryonically.
- DN mechanism suggested
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5133 ZMYM3 Belinda Chong reviewed gene: ZMYM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 36586412, 24721225; Phenotypes: Neurodevelopmental disorders (NDDs); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5132 BUB1 Zornitza Stark reviewed gene: BUB1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Primary microcephaly-30 (MCPH30), MIM#620183; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5129 CLDN5 Zornitza Stark reviewed gene: CLDN5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Syndromic disorder, MONDO:0002254, CLDN5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5127 SETD2 Zornitza Stark edited their review of gene: SETD2: Added comment: PMID 32710489: 12 unrelated patients, ranging from 1 month to 12 years of age, with a multisystemic neurodevelopmental disorder associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740W).

Key clinical features: severely impaired global development apparent from infancy, feeding difficulties with failure to thrive, small head circumference, and dysmorphic facial features. Affected individuals have impaired intellectual development and hypotonia; they do not achieve walking or meaningful speech. Other neurologic findings may include seizures, hearing loss, ophthalmologic defects, and brain imaging abnormalities. There is variable involvement of other organ systems, including skeletal, genitourinary, cardiac, and possibly endocrine.

Further 3 unrelated patients identified with mild to moderately impaired intellectual development associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740Q).

These are distinct clinically from Luscan-Lumish syndrome, which is characterised by overgrowth.; Changed publications: 29681085, 32710489; Changed phenotypes: Luscan-Lumish syndrome, MIM#616831, Rabin-Pappas syndrome,MIM# 620155, Intellectual developmental disorder, autosomal dominant 70, MIM# 620157
Intellectual disability syndromic and non-syndromic v0.5127 CLDN5 Suliman Khan gene: CLDN5 was added
gene: CLDN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLDN5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CLDN5 were set to PMID: 36477332
Phenotypes for gene: CLDN5 were set to seizures; developmental delay; microcephaly; brain calcifications
Penetrance for gene: CLDN5 were set to Complete
Mode of pathogenicity for gene: CLDN5 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: CLDN5 was set to GREEN
Added comment: PMID: 36477332 identified de novo heterozygous missense variants in CLDN5 in fifteen unrelated patients who presented with a shared constellation of features including developmental delay, seizures (primarily infantile onset focal epilepsy), microcephaly and a recognizable pattern of pontine atrophy and brain calcifications.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5124 BUB1B Zornitza Stark reviewed gene: BUB1B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mosaic variegated aneuploidy syndrome 1, MIM# 257300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5124 BUB1B Liyan Song reviewed gene: BUB1B: Rating: AMBER; Mode of pathogenicity: None; Publications: 21190457, 15475955, 15098245; Phenotypes: Mosaic variegated aneuploidy syndrome 1, MIM: #257300, Premature chromatid separation trait, MIM: #176430; Mode of inheritance: Other
Intellectual disability syndromic and non-syndromic v0.5124 KIF26A Zornitza Stark Phenotypes for gene: KIF26A were changed from Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156 to Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156
Intellectual disability syndromic and non-syndromic v0.5124 KIF26A Zornitza Stark Phenotypes for gene: KIF26A were changed from Cerebral malformation MONDO:0016054, KIF26-related to Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156
Intellectual disability syndromic and non-syndromic v0.5123 KIF26A Zornitza Stark edited their review of gene: KIF26A: Changed phenotypes: Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156
Intellectual disability syndromic and non-syndromic v0.5123 CACNA2D1 Zornitza Stark Phenotypes for gene: CACNA2D1 were changed from Developmental and epileptic encephalopathy disorder MONDO:0100062 CACNA2D1-related to Developmental and epileptic encephalopathy 110, MIM# 620149
Intellectual disability syndromic and non-syndromic v0.5122 CACNA2D1 Zornitza Stark reviewed gene: CACNA2D1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 110, MIM# 620149; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5121 FZR1 Zornitza Stark gene: FZR1 was added
gene: FZR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: FZR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FZR1 were set to 34788397
Phenotypes for gene: FZR1 were set to Developmental and epileptic encephalopathy 109, MIM# 620145
Review for gene: FZR1 was set to GREEN
Added comment: Four unrelated individuals reported with de novo missense variants in this gene. Affected individuals had developmental delay before and concurrent with the onset of seizures. Features included impaired intellectual development with poor speech, ataxic gait, coordination problems, and behavioral abnormalities. Drosophila model supports gene-disease association.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5117 ELP2 Zornitza Stark reviewed gene: ELP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual disability, autosomal recessive 58 MONDO:0014996; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5117 AMER1 Zornitza Stark Phenotypes for gene: AMER1 were changed from to Osteopathia striata with cranial sclerosis, OMIM:300373
Intellectual disability syndromic and non-syndromic v0.5115 AMER1 Zornitza Stark Mode of inheritance for gene: AMER1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5111 DLD Zornitza Stark reviewed gene: DLD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dihydrolipoamide dehydrogenase deficiency MIM#246900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5099 ALMS1 Zornitza Stark reviewed gene: ALMS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alstrom syndrome, MIM# 203800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5096 B3GLCT Zornitza Stark Phenotypes for gene: B3GLCT were changed from to Peters Plus Syndrome (MIM 261540); Peters anomaly; Growth retardation; Brachydactyly; ID
Intellectual disability syndromic and non-syndromic v0.5079 NLGN4X Krithika Murali reviewed gene: NLGN4X: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:26350204, PMID:14963808, PMID:12669065, PMID:23352163, PMID:28263302, PMID:16648374; Phenotypes: Intellectual developmental disorder, X-linked - MIM#300495; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5079 CENPF Mark Williams reviewed gene: CENPF: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35488810, 31953238, 26820108; Phenotypes: Stromme syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 ELP2 Renee Crooks changed review comment from: Phenotype of Intellectual Disability has been observed in the PMIDs listed above in the following forms;
-spastic diplegia
-cortico-cerebullar
-nodular heterotopia
-epilepsy
-severe motor development delay
-short stature
-neuropsychiatric problems
-choreoathetosis
-nystagmus; to: Phenotype of Intellectual Disability has been observed in the PMIDs listed above in the following forms;
-spastic diplegia
-cortico-cerebullar
-nodular heterotopia
-epilepsy
-severe motor development delay
-short stature
-neuropsychiatric problems
-choreoathetosis
-nystagmus

NB - review submit by Renée Crooks ( aka using google account as Lee Ren)
Intellectual disability syndromic and non-syndromic v0.5079 ELP2 Renee Crooks reviewed gene: ELP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33510603: 33976153: 33393008: 34653680: 25847581; Phenotypes: Intellectual Diability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 AMER1 Deepak Subramanian reviewed gene: AMER1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19079258, 22987541, 23401208, 28497491, 32879452, 35186393, 20950377, 22043478; Phenotypes: Osteopathia striata with cranial sclerosis, OMIM:300373, Osteopathia striata-cranial sclerosis syndrome, ORPHA:2780, Intellectual disability, HP:0001249; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5079 DLD Philip Adam Harraka reviewed gene: DLD: Rating: GREEN; Mode of pathogenicity: None; Publications: 34745891, 33092611, 8968745; Phenotypes: Dihydrolipoamide dehydrogenase deficiency, hepatic and neurological disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 DHCR24 Nicolle Hua reviewed gene: DHCR24: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 11519011, 24961299, 29175559, 21559050, 12457401, 21671375; Phenotypes: Desmosterolosis, MIM# 602398; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 DOCK8 Shannon Nicolson reviewed gene: DOCK8: Rating: RED; Mode of pathogenicity: None; Publications: 18060736, 29930340, 29191242, 33455084, 32978894, 25435912; Phenotypes: MIM#614113 intellectual developmental disorder, autosomal dominant 2; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5079 CDC42 Lorraine Skalicka reviewed gene: CDC42: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29925821, 26708094, 26386261, 29394990; Phenotypes: Takenouchi-Kosaki syndrome, Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5079 ALMS1 Christa Whelan reviewed gene: ALMS1: Rating: RED; Mode of pathogenicity: None; Publications: MIM # 203800, 27142762, 25846608, 18154657, 25296579, 17146208, 17940554, 22043170, 31889847, 2231654, 8418611, 8181924, 8556827, 9663233, 25864795, 8556827, 11941369.; Phenotypes: Alström Syndrome (multisystemic), characterized by progressive cone-rod dystrophy leading to blindness, sensorineural hearing loss, childhood obesity associated with hyperinsulinemia, and type 2 diabetes mellitus, Dilated cardiomyopathy occurs in approximately 70% of patients during infancy or adolescence, Renal failure, pulmonary, hepatic, and urologic dysfunction are often observed, and systemic fibrosis develops with age MIM# 203800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 BLM Ken Lee Wan reviewed gene: BLM: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5079 B3GLCT Jessica Wright reviewed gene: B3GLCT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301637, 16909395, 17032646, 18199743, 25544610; Phenotypes: Peters Plus Syndrome (MIM 261540), Peters anomaly, Growth retardation, Brachydactyly, ID; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 AP1S1 Gemma O'Farrell changed review comment from: Publications support gene-disease association. AP1S1 associated with MENDIK syndrome of which intellectual disability and global developmental delay are part of the phenotype. Functional data available.

OMIM: 603531

AP1S1 variant described in French-Canadian (Quebec) families with MENDIK (founder variant; splice variant, leading to PTC) different AS1P1 variant (insertion) described in Sephardic-Jewish child with mental retardation and a Turkish child with intellectual disability and MENDIK.; to: Publications support gene-disease association. AP1S1 associated with MENDIK syndrome of which intellectual disability and global developmental delay are part of the phenotype. Functional data available.

OMIM: 603531

AP1S1 variant described in French-Canadian (Quebec) families with MENDIK (founder variant; splice variant, leading to PTC) different AS1P1 variant (insertion) described in Sephardic-Jewish child with mental retardation and a Turkish child with intellectual disability and MENDIK.
Intellectual disability syndromic and non-syndromic v0.5079 AP1S1 Gemma O'Farrell reviewed gene: AP1S1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30244301, 24754424, 19057675, 23423674; Phenotypes: MENDIK syndrome, mental retardation, enteropathy, deafness, peripheral neuropathy, ichthyosis and keratoderma; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 ASAH1 Jacqueline Montgomery reviewed gene: ASAH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32875576; Phenotypes: Farber lipogranulomatosis MIM #228000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5079 DPM1 Sindhu V changed review comment from: More than 3 unrelated families with consistent phenotype of developmental delay, hypotonia , seizures, (acquired) microcephaly, vision impairment with/without elevated CK and cerebellar signs. Molecular evidence of biallelic involvement with missense, deletion and splice site variants as contributory mechanisms. Quantification of isoform consistent with CDG 1E pattern.; to: More than 3 unrelated families with consistent phenotype of developmental delay, hypotonia , seizures, (acquired) microcephaly, vision impairment with/without elevated CK and cerebellar signs. Molecular evidence of biallelic involvement with missense, deletion and splice site variants as contributory mechanisms. Quantification of isoform consistent with CDG 1E pattern.
Intellectual disability syndromic and non-syndromic v0.5079 DPM1 Sindhu V reviewed gene: DPM1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10642602, 23856421, 16641202, 15669674, 10642597; Phenotypes: Acquired microcephaly, developmental delay, epilepsy, strabismus, hypotonia, cortical vision impairment, elevated creatine kinase, growth failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5076 BCKDK Zornitza Stark changed review comment from: At least 5 unrelated families reported. ID if untreated. Treatment available.; to: At least 5 unrelated families reported. ID/autism/seizures are part of the phenotype.

Treatment available: Branched-chain amino acid supplementation: improves psychomotor/cognitive development/IQ; improves behavioural/psychiatric disturbance(s); improves systemic manifestations
Intellectual disability syndromic and non-syndromic v0.5076 BCKDK Zornitza Stark reviewed gene: BCKDK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Branched-chain ketoacid dehydrogenase kinase deficiency MIM#614923; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5070 DAG1 Zornitza Stark Phenotypes for gene: DAG1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9
Intellectual disability syndromic and non-syndromic v0.5067 DAG1 Zornitza Stark reviewed gene: DAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5067 BCKDK Savige Judy reviewed gene: BCKDK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:16875466, PMID: 22956686; Phenotypes: Intellectual disability, autism, epilepsy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5067 AHI1 Caleb Cartagena reviewed gene: AHI1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15322546, 16453322, 21937992; Phenotypes: Joubert Syndrome 3 OMIM #608629; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5067 CEP41 Mitchell O'Brien reviewed gene: CEP41: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22246503; Phenotypes: Joubert syndrome 15, MIM# 614464; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5067 DAG1 Nicholas Clark reviewed gene: DAG1: Rating: AMBER; Mode of pathogenicity: None; Publications: (PMID: 25934851, 29337005, 24052401, 21388311, 25503980, 30450679, 12140559, 21388311); Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5067 BOLA3 Zornitza Stark Phenotypes for gene: BOLA3 were changed from to Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia (MMDS2, OMIM #614299)
Intellectual disability syndromic and non-syndromic v0.5064 BOLA3 Zornitza Stark reviewed gene: BOLA3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia (MMDS2, OMIM #614299); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5064 BOLA3 Layla Zhu reviewed gene: BOLA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24334290, PMID: 29654549, PMID: 21944046, PMID: 22562699, PMID: 26741492, PMID: 24334290; Phenotypes: multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia (MMDS2, OMIM #614299); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5062 CBS Zornitza Stark reviewed gene: CBS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Homocystinuria (MIM# 236200); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5062 BOLA3 Layla Zhu Deleted their review
Intellectual disability syndromic and non-syndromic v0.5062 BOLA3 Layla Zhu reviewed gene: BOLA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29654549; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5060 CBS Lloyd Pereira changed review comment from: Listed in OMIM with a strong disease association (MIM #236200 homocysteinuria).

Multiple experimental and clinical studies demonstrate link between CBS and homocysteinuria (see below):

Multiple LOF variants classified as pathogenic or likely pathogenic in ClinVar and reported in the literature in multiple homozygote and compound heterozygote individuals affected with homocystinuria, e.g. c.19dup p.(Gln7fs) (PMID: 25218699; 12124992) and c.919G>A p.(Gly307Ser) (PMID: 7506602, 7581402, 8744616, 9889017, 23733603).

Multiple CBS variants reported in CBS deficiency (PMID: 12124992).

ClinGen classify as definitive for Homocysteinuria. Clingen states- Twenty-one unique variants were curated (missense, nonsense, frameshift, and splice site) in 15 probands from 8 publications, and three of these probands each had two affected siblings in whom CBS variants were identified (PMID 1301198, 10408774, 7762555, 12815602, 16307898, 25455305, 26667307, 29508359). Gene-disease relationship is supported by the biochemical function of CBS, which is consistent with the biochemical features in patients with homocystinuria (including elevated plasma total homocysteine and methionine) (PMID 13654400, 15890029), functional studies in yeast, bacteria, and cultured cells, including chaperone studies in fibroblasts from patients with homocystinuria (PMID 9590298, 25331909), as well as the biochemical and clinical features of mouse models (PMID 18987302) and enzyme replacement studies in mice (PMID 29398487).

Recent review reports on role of CBS in down syndrome (PMID: 31955501). However, caveat that multiple genes are associated with down syndrome. Not a strong body of research available linking CBS variants and down syndrome.; to: Listed in OMIM with a strong disease association (MIM #236200 homocysteinuria).

Multiple experimental and clinical studies demonstrate link between CBS and homocysteinuria (see below):

Multiple LOF variants classified as pathogenic or likely pathogenic in ClinVar and reported in the literature in multiple homozygote and compound heterozygote individuals affected with homocystinuria, e.g. c.19dup p.(Gln7fs) (PMID: 25218699; 12124992) and c.919G>A p.(Gly307Ser) (PMID: 7506602, 7581402, 8744616, 9889017, 23733603).

Multiple CBS variants reported in CBS deficiency (PMID: 12124992).

ClinGen classify as definitive for Homocysteinuria. Clingen states- Twenty-one unique variants were curated (missense, nonsense, frameshift, and splice site) in 15 probands from 8 publications, and three of these probands each had two affected siblings in whom CBS variants were identified (PMID 1301198, 10408774, 7762555, 12815602, 16307898, 25455305, 26667307, 29508359). Gene-disease relationship is supported by the biochemical function of CBS, which is consistent with the biochemical features in patients with homocystinuria (including elevated plasma total homocysteine and methionine) (PMID 13654400, 15890029), functional studies in yeast, bacteria, and cultured cells, including chaperone studies in fibroblasts from patients with homocystinuria (PMID 9590298, 25331909), as well as the biochemical and clinical features of mouse models (PMID 18987302) and enzyme replacement studies in mice (PMID 29398487).

Recent review reports on role of CBS in down syndrome (PMID: 31955501). However, caveat that multiple genes are associated with down syndrome. Not a strong body of research available linking CBS variants and down syndrome.
Intellectual disability syndromic and non-syndromic v0.5060 TCEAL1 Melanie Marty edited their review of gene: TCEAL1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, TCEAL1-related, hypotonia, abnormal gait, developmental delay, intellectual disability, autism, dysmorphic facial features
Intellectual disability syndromic and non-syndromic v0.5060 CBS Lloyd Pereira reviewed gene: CBS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Homocysteinuria B6-responsive and nonresponsive types, Thrombosis hyperhomocysteinemic.; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5060 GABRA3 Zornitza Stark Phenotypes for gene: GABRA3 were changed from Epilepsy, intellectual disability, dysmorphic features, to Epilepsy, X-linked 2, with or without impaired intellectual development and dysmorphic features, MIM# 301091
Intellectual disability syndromic and non-syndromic v0.5058 ARF3 Zornitza Stark Phenotypes for gene: ARF3 were changed from Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system to Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Intellectual disability syndromic and non-syndromic v0.5057 ARF3 Zornitza Stark Phenotypes for gene: ARF3 were changed from Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system to Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Intellectual disability syndromic and non-syndromic v0.5053 TCEAL1 Melanie Marty gene: TCEAL1 was added
gene: TCEAL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TCEAL1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: TCEAL1 were set to PMID: 36368327
Phenotypes for gene: TCEAL1 were set to hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features.
Review for gene: TCEAL1 was set to GREEN
Added comment: 7 individuals (males and females) with de novo variants involving TCEAL1 with an X-linked
dominant neurodevelopmental syndrome. Individuals had hypotonia, abnormal gait, developmental delay/intellectual disability especially affecting expressive language, autistic-like behavior, and mildly dysmorphic facial features. Additional features included strabismus, refractive errors, variable nystagmus, gastroesophageal reflux, constipation, dysmotility, recurrent infections, seizures, and structural brain anomalies.

1 additional male individual with a maternally inherited missense variant (unaffected mother), which was considered a VUS. This individual had hypertonia and spasticity without syndromic features.

4 PTCs, 2 CNVs, 2 missense reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5053 ARF3 Dean Phelan reviewed gene: ARF3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36369169, 34346499; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5053 EPRS Lucy Spencer gene: EPRS was added
gene: EPRS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EPRS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EPRS were set to 29576217, 36411955
Phenotypes for gene: EPRS were set to Leukodystrophy, hypomyelinating, 15 (MIM#617951)
Review for gene: EPRS was set to GREEN
Added comment: 5 patients across 2 papers, with delayed development (3/5) and/or regression, ataxia, dystonia, hypomyelinating leukodystrophy or periventricular white matter, 2 with epilepsy, 3 with optic atrophy, 2 with deafness, 2 with micrcephaly, 1 noted to have some facial dysmorphism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5053 GABRA3 Sarah Pantaleo gene: GABRA3 was added
gene: GABRA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABRA3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: GABRA3 were set to PMID: 29053855
Phenotypes for gene: GABRA3 were set to Epilepsy, intellectual disability, dysmorphic features,
Penetrance for gene: GABRA3 were set to Incomplete
Review for gene: GABRA3 was set to GREEN
Added comment: Six variants in GABRA3 encoding the alpha3-subunit of the GABA(A) receptor.
Five missense variants and one micro duplication were detected in four families and two sporadic cases presenting with a range of epileptic seizure types, a varying degree of intellectual disability and developmental delay, sometimes with dysmorphic features or nystagmus.
The variants co-segregated mostly but not completely with the phenotype in the families, indicating in some cases incomplete penetrance, involvement of other genes, or presence of phenocopies.
Overall, males were more severely affected and there were three asymptomatic female mutation carriers compared to only one male without a clinical phenotype.
Mechanism suggested - three detected missense variants are localised in the extracellular GABA-binding NH2-terminus, one in the M2-M3 linker and one in the M4 transmembrane segment of the alpha3-subunit. Functional studies in Xenopus leaves oocytes revealed a variable but significant reduction of GABA-evoked anion currents for all mutants compared to wild-type receptors. The degree of current reduction correlated partially with the phenotype.
Results reveal that rare loss-of-function variants in GABRA3 increase the risk for a varying combination of epilepsy, intellectual disability/developmental delay and dysmorphic features, presenting in some pedigrees with an X-linked inheritance pattern.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5052 FEM1C Paul De Fazio gene: FEM1C was added
gene: FEM1C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FEM1C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FEM1C were set to 36336956; 28135719; 33398170; 33398168
Phenotypes for gene: FEM1C were set to Neurodevelopmental disorder, FEM1C-related MONDO:0700092
Review for gene: FEM1C was set to GREEN
gene: FEM1C was marked as current diagnostic
Added comment: PMID:36336956 describes a 9-year-old boy with severe DD, lack of speech, pyramidal signs, and limb ataxia who had a de novo missense variant Asp126His in FEM1C ascertained by WES. The equivalent variant introduced into the nematode C.elegans resulted in disabled locomotion caused by synaptic abnormalities and not muscle dysfunction.

An alternate change Asp126Val was reported in the DDD study de novo in a patient with uncharacterised developmental delay (PMID:28135719).

The Asp126 residue (but not either of the variants above specifically) was shown to be functionally important by in vitro studies (PMID:33398170;33398168). The residue is highly conserved and located in a region of missense constraint.

Borderline green, 2 patients and an animal model. Note all evidence points to the Asp126 residue being of specific importance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5050 KDM2B Ain Roesley gene: KDM2B was added
gene: KDM2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KDM2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KDM2B were set to 36322151
Phenotypes for gene: KDM2B were set to neurodevelopmental disorder MONDO#070009, KDM2B-related
Review for gene: KDM2B was set to GREEN
gene: KDM2B was marked as current diagnostic
Added comment: 27 individuals from 22 families were recruited
13 SNV classified LP/P, all de novo except 2 familial cases
5 variants were classified as VUS if more than 1 het is present in gnomAD or does result in a KDM2B-specific episignature (therefore suggesting normal function)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5049 MAN2A2 Zornitza Stark gene: MAN2A2 was added
gene: MAN2A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAN2A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAN2A2 were set to 36357165
Phenotypes for gene: MAN2A2 were set to Congenital disorder of glycosylation, MONDO:0015286, MAN2A2-reated
Review for gene: MAN2A2 was set to RED
Added comment: Single consanguineous family reported with homozygous truncating variant in two brothers with ID. Supportive biochemical data only
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5045 CDK10 Zornitza Stark reviewed gene: CDK10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Al Kaissi syndrome MIM#617694; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5042 EXOSC3 Zornitza Stark reviewed gene: EXOSC3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pontocerebellar hypoplasia, type 1B, MIM# 614678; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5041 ARPC4 Zornitza Stark gene: ARPC4 was added
gene: ARPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARPC4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARPC4 were set to 35047857
Phenotypes for gene: ARPC4 were set to Developmental delay, language impairment, and ocular abnormalities, MIM# 620141
Review for gene: ARPC4 was set to GREEN
Added comment: 7 affected individuals from 6 families (gonadal mosaicism was confirmed in the mother of the 2 affected siblings) with a recurrent missense variant (NM_005718.4:c.472C>T; p.R158C). 6/7 affected individuals had microcephaly. The variant was associated with a decreased amount of F-actin in cells from two affected individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods.
Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration, with functional effects of the mutation reproduced with knocked down endogenous expression of exosc3 in zebrafish embryos and subsequent rescue of the phenotype by co-injection with wild-type zebrafish exosc3 mRNA.
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang Deleted their comment
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang edited their review of gene: EXOSC3: Added comment: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; Changed phenotypes: Cerebellar atrophy, Developmental delay, Lower motor neuron degeneration, Upper motor neuron features, Spasticity/hyperreflexia (+/-)
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy. Variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment (to varying degrees) reported in all cases across various severity.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang reviewed gene: EXOSC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 22544365, 23975261, 25149867, 23284067; Phenotypes: 23284067, 25149867; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5040 CDK10 Lyndon Gallacher reviewed gene: CDK10: Rating: ; Mode of pathogenicity: None; Publications: 28886341; Phenotypes: Severe growth retardation, spine malformation, facial dysmorphisms, developmental delay, intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5039 DOCK8 Chirag Patel reviewed gene: DOCK8: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 29930340; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5038 HECTD4 Zornitza Stark reviewed gene: HECTD4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, HECTD4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5037 UBE3C Zornitza Stark reviewed gene: UBE3C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, UBE3C-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5036 KIF26A Zornitza Stark reviewed gene: KIF26A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral malformation MONDO:0016054, KIF26-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5035 UBE3C Chirag Patel gene: UBE3C was added
gene: UBE3C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE3C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBE3C were set to PMID: 36401616
Phenotypes for gene: UBE3C were set to Neurodevelopmental disorder overlapping Angelman syndrome, no OMIM#
Review for gene: UBE3C was set to GREEN
Added comment: 3 patients/2 families with syndromic neurodevelopmental, seizure, and movement disorders and neurobehavioral phenotypes. WES found bi-allelic variants in UBE3C. The RNA studies in some patients with LoF variants provided evidence for the LoF effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5033 HECTD4 Chirag Patel gene: HECTD4 was added
gene: HECTD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HECTD4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HECTD4 were set to PMID: 36401616
Phenotypes for gene: HECTD4 were set to Neurodevelopmental disorder overlapping Angelman syndrome, no OMIM#
Review for gene: HECTD4 was set to GREEN
Added comment: 7 patients/5 families with syndromic neurodevelopmental, seizure, and movement disorders and neurobehavioral phenotypes. WES found bi-allelic variants in HECTD4. The RNA studies in some patients with LoF variants provided evidence for the LoF effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5031 KIF26A Chirag Patel gene: KIF26A was added
gene: KIF26A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KIF26A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF26A were set to PMID: 36228617
Phenotypes for gene: KIF26A were set to Congenital brain malformations, no OMIM #
Review for gene: KIF26A was set to GREEN
Added comment: 5 unrelated patients with biallelic loss-of-function variants in KIF26A (found through WES), exhibiting a spectrum of congenital brain malformations (schizencephaly, corpus callosum anomalies, polymicrgyria, and ventriculomegaly). Combining mice and human iPSC-derived organoid models, they discovered that loss of KIF26A causes excitatory neuron-specific defects in radial migration, localization, dendritic and axonal growth, and apoptosis, offering a convincing explanation of the disease etiology in patients. Single-cell RNA sequencing in KIF26A knockout organoids revealed transcriptional changes in MAPK, MYC, and E2F pathways.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5029 SPTAN1 Zornitza Stark edited their review of gene: SPTAN1: Added comment: Another 21 individuals reported in PMID 36331550; some had DEE and others had isolated ID.; Changed publications: 20493457, 22258530, 32811770, 36331550
Intellectual disability syndromic and non-syndromic v0.5028 TBC1D2B Chirag Patel reviewed gene: TBC1D2B: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36029130; Phenotypes: Neurodevelopmental disorder with seizures and gingival overgrowth, OMIM #619323; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5026 SPTBN5 Zornitza Stark reviewed gene: SPTBN5: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SPTBN5-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.5025 MTSS1 Zornitza Stark reviewed gene: MTSS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 36067766; Phenotypes: Intellectual disability, MTSS1-related (MONDO#0001071); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5025 TPR Zornitza Stark gene: TPR was added
gene: TPR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TPR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TPR were set to 34494102
Phenotypes for gene: TPR were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, TPR-related
Review for gene: TPR was set to RED
Added comment: Two siblings harbouring variants c.6625C>T/ p.Arg2209Ter (identified in heterozygous state in both siblings and father) and c.2610 + 5G > A (identified in heterozygous state in both siblings and mother) were reported with ataxia, microcephaly and severe intellectual disability. Functional analyses in patient fibroblasts provide evidence that the variants affect TPR splicing, reduce steady-state TPR levels, abnormal nuclear pore composition and density, and altered global RNA distribution.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5023 SMC5 Zornitza Stark gene: SMC5 was added
gene: SMC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SMC5 were set to 36333305
Phenotypes for gene: SMC5 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID
Review for gene: SMC5 was set to GREEN
Added comment: Four individuals from three families with a chromosome breakage disorder and bi-allelic variants in this gene. However, three of the individuals had the same homozygous missense variant. Evidence for functional impact of the variant was limited. However, zebrafish model recapitulated the phenotype and was not rescued by the introduction of this variant, arguing for functional effect. Borderline Amber/Green.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5021 SLF2 Zornitza Stark gene: SLF2 was added
gene: SLF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLF2 were set to 36333305
Phenotypes for gene: SLF2 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID
Review for gene: SLF2 was set to GREEN
Added comment: Seven individuals from 6 families with a chromosome breakage disorder and bi-allelic variants in this gene (LoF). Functional data including zebrafish model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5020 SPTBN5 Chern Lim reviewed gene: SPTBN5: Rating: ; Mode of pathogenicity: Other; Publications: 36117916, 36238261; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5020 MAST3 Zornitza Stark Phenotypes for gene: MAST3 were changed from Developmental and epileptic encephalopathy to Developmental and epileptic encephalopathy 108, MIM#620115
Intellectual disability syndromic and non-syndromic v0.5019 MAST3 Zornitza Stark edited their review of gene: MAST3: Changed phenotypes: Developmental and epileptic encephalopathy 108, MIM#620115
Intellectual disability syndromic and non-syndromic v0.5019 CACNA1I Zornitza Stark Phenotypes for gene: CACNA1I were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with variable intellectual disability and speech impairment, with or without seizures (NEDISS), MIM#620114
Intellectual disability syndromic and non-syndromic v0.5018 FRA10AC1 Zornitza Stark Phenotypes for gene: FRA10AC1 were changed from Neurodevelopmental disorder, MONDO:0700092, FRA10AC1-related to Neurodevelopmental disorder with growth retardation, dysmorphic facies, and corpus callosum abnormalities, MIM# 620113
Intellectual disability syndromic and non-syndromic v0.5017 FRA10AC1 Zornitza Stark edited their review of gene: FRA10AC1: Changed phenotypes: Neurodevelopmental disorder with growth retardation, dysmorphic facies, and corpus callosum abnormalities, MIM# 620113
Intellectual disability syndromic and non-syndromic v0.5016 WDR5 Bryony Thompson gene: WDR5 was added
gene: WDR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR5 were set to DOI:https://doi.org/10.1016/j.xhgg.2022.100157
Phenotypes for gene: WDR5 were set to Neurodevelopmental disorder MONDO:0700092, WDR5-related
Mode of pathogenicity for gene: WDR5 was set to Other
Review for gene: WDR5 was set to GREEN
Added comment: Six different missense variants were identified (de novo) in 11 affected individuals with neurodevelopmental disorders, with a broad spectrum of additional features, including epilepsy, aberrant growth parameters, skeletal and cardiac abnormalities. 9/11 probands have ID. In vivo and in vitro functional suggest that loss-of-function is not the mechanism of disease. The mechanism of disease is yet to be established.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5015 JARID2 Zornitza Stark Phenotypes for gene: JARID2 were changed from Intellectual disability to Developmental delay with variable intellectual disability and dysmorphic facies (DIDDF), MIM#620098
Intellectual disability syndromic and non-syndromic v0.5014 JARID2 Zornitza Stark edited their review of gene: JARID2: Changed phenotypes: Developmental delay with variable intellectual disability and dysmorphic facies (DIDDF), MIM#620098
Intellectual disability syndromic and non-syndromic v0.5013 PI4K2A Seb Lunke gene: PI4K2A was added
gene: PI4K2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4K2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4K2A were set to 30564627; 35880319; 19581584
Phenotypes for gene: PI4K2A were set to complex neurodevelopmental disorder with motor features, PI4K2A-related, MONDO:0100516
Review for gene: PI4K2A was set to GREEN
Added comment: Two reportedly unrelated, consanguine families with the same hom stop mutation in PI4K2A, p.(Arg309Ter). Probands with seizures, developmental delay, hypotonia/dystonia, myoclonus and developmental delay. MRI showed extensive brain abnormalities including dysgenesis of the corpus callosum, ventriculomegaly, and white matter volume loss.

Functional studies showed cellular mislocalisation of the Arg309Ter truncated protein construct compared to WT and an missense control.

An earlier paper from 2018 described two additional probands with a different stop mutation, p.(Ser22Ter), and overlapping phenotypic presentation.

in 2011, a Pi4k2a knock-out mouse model was described. "Knock-out animals initially appeared normal but later develop a progressive neurological dis-ease characterized by tremor, limb weakness, urinary incontinence and premature mortality. Histological analysis revealed massive axonal degeneration in the spinal cord in the descending corticospinal tracts."
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5011 CAMSAP1 Naomi Baker gene: CAMSAP1 was added
gene: CAMSAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAMSAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CAMSAP1 were set to 36283405
Phenotypes for gene: CAMSAP1 were set to lissencephaly spectrum disorders (MONDO:0018838), CAMSAP1-related
Review for gene: CAMSAP1 was set to GREEN
Added comment: Five unrelated families with bi-allelic loss-of-function variants. Clinical features of the syndrome include a characteristic craniofacial appearance, primary microcephaly, lissencephaly, agenesis or severe hypogenesis of the corpus callosum, severe neurodevelopmental delay, cortical visual impairment, and seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5010 MYCBP2 Zornitza Stark Phenotypes for gene: MYCBP2 were changed from neurodevelopmental spectrum disorder with corpus callosum defects to Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related; corpus callosum abnormalities
Intellectual disability syndromic and non-syndromic v0.5008 MYCBP2 Suliman Khan edited their review of gene: MYCBP2: Changed phenotypes: intellectual disability, epilepsy, autistic features and callosum abnormalities,
Intellectual disability syndromic and non-syndromic v0.5008 MYCBP2 Zornitza Stark edited their review of gene: MYCBP2: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related, corpus callosum abnormalities
Intellectual disability syndromic and non-syndromic v0.5008 MYCBP2 Zornitza Stark reviewed gene: MYCBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36200388; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related, corpus callosum abnormalitie; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5008 KLHL20 Dean Phelan gene: KLHL20 was added
gene: KLHL20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KLHL20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KLHL20 were set to PMID: 36214804
Phenotypes for gene: KLHL20 were set to Neurodevelopmental disorder (MONDO:0700092), KLHL20-related
Review for gene: KLHL20 was set to GREEN
Added comment: PMID: 36214804
- 14 patients with de novo missense variants in KLHL20. The patients had mild to severe ID, febrile seizures or epilepsy, autism spectrum disorder, hyperactivity and subtle dysmorphic facial features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5008 MYCBP2 Suliman Khan gene: MYCBP2 was added
gene: MYCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MYCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYCBP2 were set to PMID: 36200388
Phenotypes for gene: MYCBP2 were set to neurodevelopmental spectrum disorder with corpus callosum defects
Penetrance for gene: MYCBP2 were set to Complete
Review for gene: MYCBP2 was set to GREEN
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5008 FRMD5 Zornitza Stark Phenotypes for gene: FRMD5 were changed from Neurodevelopmental disorder MONDO:0700092, FRMD5-related to Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094
Intellectual disability syndromic and non-syndromic v0.5007 FRMD5 Zornitza Stark edited their review of gene: FRMD5: Changed phenotypes: Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094
Intellectual disability syndromic and non-syndromic v0.5007 OTC Zornitza Stark Phenotypes for gene: OTC were changed from to Ornithine transcarbamylase deficiency, MIM#311250
Intellectual disability syndromic and non-syndromic v0.5005 OTC Zornitza Stark reviewed gene: OTC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ornithine transcarbamylase deficiency, MIM#311250; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.5005 LETM1 Zornitza Stark Phenotypes for gene: LETM1 were changed from Mitochondrial disease MONDO#0044970, LETM1-related to Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089
Intellectual disability syndromic and non-syndromic v0.5004 LETM1 Zornitza Stark reviewed gene: LETM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5004 HNRNPH1 Zornitza Stark Phenotypes for gene: HNRNPH1 were changed from HNRNPH1 ‐related syndromic intellectual disability to Neurodevelopmental disorder with craniofacial dysmorphism and skeletal defects, MIM# 620083
Intellectual disability syndromic and non-syndromic v0.5003 HNRNPH1 Zornitza Stark reviewed gene: HNRNPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with craniofacial dysmorphism and skeletal defects, MIM# 620083; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5000 AKT3 Zornitza Stark reviewed gene: AKT3: Rating: GREEN; Mode of pathogenicity: None; Publications: 22729224, 22729223, 35665751, 34354878, 32446860, 31441589; Phenotypes: Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2, MIM# 615937; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5000 TMEM147 Zornitza Stark Phenotypes for gene: TMEM147 were changed from Neurodevelopmental disorder (MONDO:0700092), TMEM147-related to Neurodevelopmental disorder with facial dysmorphism, absent language, and pseudo-Pelger-Huet anomaly, MIM# 620075
Intellectual disability syndromic and non-syndromic v0.4999 TMEM147 Zornitza Stark reviewed gene: TMEM147: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with facial dysmorphism, absent language, and pseudo-Pelger-Huet anomaly, MIM# 620075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4999 PSMC1 Zornitza Stark Phenotypes for gene: PSMC1 were changed from spastic paraplegia; severe developmental delay; severe intellectual disability; hearing loss; micropenis; undescended testes; Syndromic disease MONDO:0002254, PSMC1-related to Neurodevelopmental disorder with poor growth, spastic tetraplegia, and hearing loss , MIM# 620071
Intellectual disability syndromic and non-syndromic v0.4998 PSMC1 Zornitza Stark reviewed gene: PSMC1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, spastic tetraplegia, and hearing loss , MIM# 620071; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4998 HNRNPR Zornitza Stark Phenotypes for gene: HNRNPR were changed from Intellectual disability; seizures; dysmorphic features to Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073
Intellectual disability syndromic and non-syndromic v0.4997 HNRNPR Zornitza Stark edited their review of gene: HNRNPR: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073
Intellectual disability syndromic and non-syndromic v0.4997 FGF14 Zornitza Stark Phenotypes for gene: FGF14 were changed from to Spinocerebellar ataxia 27, MIM# 609307; Vestibulocerebellar disorder with predominant ocular signs, MIM# 193003
Intellectual disability syndromic and non-syndromic v0.4995 FGF14 Zornitza Stark edited their review of gene: FGF14: Changed phenotypes: Spinocerebellar ataxia 27, MIM# 609307, Vestibulocerebellar disorder with predominant ocular signs, MIM# 193003
Intellectual disability syndromic and non-syndromic v0.4994 HEATR3 Zornitza Stark reviewed gene: HEATR3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Diamond-Blackfan anaemia 21, MIM# 620072; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4994 ETHE1 Zornitza Stark Tag treatable tag was added to gene: ETHE1.
Intellectual disability syndromic and non-syndromic v0.4992 FRMD5 Zornitza Stark edited their review of gene: FRMD5: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, FRMD5-related
Intellectual disability syndromic and non-syndromic v0.4992 FRMD5 Zornitza Stark edited their review of gene: FRMD5: Changed publications: 36206744
Intellectual disability syndromic and non-syndromic v0.4991 FRMD5 Zornitza Stark gene: FRMD5 was added
gene: FRMD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FRMD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Review for gene: FRMD5 was set to GREEN
Added comment: Eight individuals reported with missense variants in this gene, de novo in 6 where parents were available. Clinical presentation was with ID, seizures, ataxia. Fly model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4988 GIGYF1 Elena Savva reviewed gene: GIGYF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35917186; Phenotypes: Autism, Intellectual disability, GIGYF1-related (MONDO#0001071); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4988 HECW2 Zornitza Stark Mode of inheritance for gene: HECW2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4987 HECW2 Zornitza Stark changed review comment from: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease)
PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease.
PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head.; to: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease)
PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease.
PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head.

Association with bi-allelic variants is AMBER.
Intellectual disability syndromic and non-syndromic v0.4987 HECW2 Zornitza Stark edited their review of gene: HECW2: Added comment: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease)
PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease.
PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head.; Changed publications: 29807643, 29395664, 27334371, 27389779, 35753050, 35487419; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4987 DPH5 Zornitza Stark edited their review of gene: DPH5: Changed publications: 35482014
Intellectual disability syndromic and non-syndromic v0.4986 DPH5 Zornitza Stark gene: DPH5 was added
gene: DPH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPH5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DPH5 were set to Neurodevelopmental disorder with short stature, prominent forehead, and feeding difficulties 620070
Review for gene: DPH5 was set to GREEN
Added comment: 5 individuals from 3 unrelated families reported with severe ID, feeding difficulties, dysmorphic features and congenital anomalies, though there was no consistent pattern to these.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4983 ADGRL1 Zornitza Stark reviewed gene: ADGRL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay, behavioral abnormalities, and neuropsychiatric disorders, MIM# 620065; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4980 GABRG1 Zornitza Stark Phenotypes for gene: GABRG1 were changed from to Developmental and epileptic encephalopathy MONDO:0100062
Intellectual disability syndromic and non-syndromic v0.4976 DEPDC5 Dean Phelan reviewed gene: DEPDC5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36067010, 32848577; Phenotypes: Neurodevelopmental disorder, DEPDC5-related, MONDO:0700092; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4975 GABBR1 Zornitza Stark gene: GABBR1 was added
gene: GABBR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABBR1 were set to 36103875
Phenotypes for gene: GABBR1 were set to Neurodevelopmental disorder, GABBR1-related, MONDO:0700092
Review for gene: GABBR1 was set to GREEN
Added comment: Four individuals with de novo variants in this gene and varying severity of DD/ID, seizures and hypotonia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4974 LETM1 Ee Ming Wong gene: LETM1 was added
gene: LETM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LETM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LETM1 were set to 36055214
Phenotypes for gene: LETM1 were set to Mitochondrial disease MONDO#0044970, LETM1-related
Review for gene: LETM1 was set to GREEN
gene: LETM1 was marked as current diagnostic
Added comment: -18 affected individuals from 11 unrelated families harbouring ultra-rare bi-allelic missense and loss-of-function LETM1 variants
-Most of the affected individuals (14/18, 78%) had an infantile-onset disease manifestation,
and 4/18 (22%) presented first symptoms between the ages of 1.5 and 2 years
-Variant types included missense, frameshift, stop loss, in-frame deletion and splice defect
-From biochemical and morphological studies, bi-allelic LETM1 variants are associated with defective mitochondrial K efflux, swollen mitochondrial matrix structures, and loss of important mitochondrial oxidative phosphorylation protein components
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4973 MED11 Ain Roesley gene: MED11 was added
gene: MED11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED11 were set to 36001086
Phenotypes for gene: MED11 were set to neurodevelopmental disorder MONDO#0700092, MED11-related
Review for gene: MED11 was set to GREEN
gene: MED11 was marked as current diagnostic
Added comment: 7 affected from 5 families (3x consang) with the same recurrent variant of p.(Arg109*).

Protein truncating, NOT NMD as proven by RT-PCR and western blot. Zebrafish knockout model recapitulates key clinical phenotypes

NO evidence of founder effect from haplotype analysis

7/7 cerebral dysgyria, cortical atrophy
5/7 limb contracture
4/7 epilepsy
3/7 families with IUGR
3/7 GDD
3/7 hearing loss
3/7 undescended testis
2/7 nystagmus
1/7 congenital cataract
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4973 MED11 Ain Roesley gene: MED11 was added
gene: MED11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED11 were set to 36001086
Phenotypes for gene: MED11 were set to neurodevelopmental disorder MONDO#0700092, MED11-related
Review for gene: MED11 was set to GREEN
gene: MED11 was marked as current diagnostic
Added comment: 7 affected from 5 families (3x consang) with the same recurrent variant of p.(Arg109*).

Protein truncating, NOT NMD as proven by RT-PCR and western blot. Zebrafish knockout model recapitulates key clinical phenotypes

NO evidence of founder effect from haplotype analysis

7/7 cerebral dysgyria, cortical atrophy
5/7 limb contracture
4/7 epilepsy
3/7 families with IUGR
3/7 GDD
3/7 hearing loss
3/7 undescended testis
2/7 nystagmus
1/7 congenital cataract
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4970 GABRG1 Anna Ritchie reviewed gene: GABRG1: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 36121006; Phenotypes: Developmental and epileptic encephalopathy MONDO:0100062; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4969 ATP6V0C Naomi Baker reviewed gene: ATP6V0C: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:36074901; Phenotypes: neurodevelopmental disorder (MONDO:0700092), ATP6V0C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4968 SLC32A1 Lucy Spencer gene: SLC32A1 was added
gene: SLC32A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SLC32A1 were set to 36073542
Phenotypes for gene: SLC32A1 were set to developmental and epileptic encephalopathy MONDO:0100062, SLC32A1-related
Review for gene: SLC32A1 was set to GREEN
Added comment: PMID: 36073542- 4 patients with de novo missense. All have moderate to severe ID or developmental delay and seizures. 3 have a movement disorder. Developmental delay appears to be a new association for this gene described in this paper.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4966 GCSH Ain Roesley Phenotypes for gene: GCSH were changed from Glycine encephalopathy, MIM#605899 to Glycine encephalopathy MIM#605899; neurodevelopmental disorder MONDO#0700092, GCHS-related
Intellectual disability syndromic and non-syndromic v0.4966 MTSS1 Elena Savva Deleted their review
Intellectual disability syndromic and non-syndromic v0.4965 GCSH Ain Roesley reviewed gene: GCSH: Rating: GREEN; Mode of pathogenicity: None; Publications: 36190515; Phenotypes: Glycine encephalopathy MIM#605899, neurodevelopmental disorder MONDO#0700092, GCHS-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4965 MTSS1 Elena Savva gene: MTSS1 was added
gene: MTSS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MTSS1 were set to PMID: 36067766
Phenotypes for gene: MTSS1 were set to Intellectual disability, MTSS1-related (MONDO#0001071)
Review for gene: MTSS1 was set to GREEN
Added comment: Alt gene name: MTSS2

Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals.
- Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms.
- Overexpression supports a DN mechanism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4964 MTSS1L Elena Savva gene: MTSS1L was added
gene: MTSS1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTSS1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MTSS1L were set to PMID: 36067766
Phenotypes for gene: MTSS1L were set to Intellectual disability, MTSS2-related (MONDO#0001071)
Review for gene: MTSS1L was set to GREEN
Added comment: Alt gene name: MTSS2

Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals.
- Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms.
- Overexpression supports a DN mechanism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4963 NAPB Paul De Fazio gene: NAPB was added
gene: NAPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAPB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAPB were set to 26235277; 28097321; 33189936
Phenotypes for gene: NAPB were set to Developmental and epileptic encephalopathy 107 MIM#620033
Review for gene: NAPB was set to GREEN
gene: NAPB was marked as current diagnostic
Added comment: PMID 26235277: homozygous nonsense variant identified in a 6 year old girl by trio WES with early-onset epileptic encephalopathy characterised by multifocal seizures and profound GDD

PMID 28097321: exome sequencing in 152 consanguineous families with at least one member affected with ID. Homozygous nonsense variant identified in a patient with profound ID, seizures, feeding difficulties in infancy, muscularhypotonia, microcephaly, and impaired vision

PMID 33189936: homozygous canonical splice variant identified by trio exome sequencing in two siblings with seizures, intellectual disability and global developmental delay, microcephaly (<-3SD), and muscular hypotonia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4962 RABGAP1 Zornitza Stark gene: RABGAP1 was added
gene: RABGAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RABGAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RABGAP1 were set to 36083289
Phenotypes for gene: RABGAP1 were set to Neurodevelopmental disorder, RABGAP1-related,MONDO:0700092
Review for gene: RABGAP1 was set to GREEN
Added comment: 5 individuals from three families reported with ID, microcephaly, SNHL and seizures. Mouse model recapitulated the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4959 NSD2 Zornitza Stark edited their review of gene: NSD2: Added comment: PMID 36189577: two individuals reported with a GoF variant, p.Glu1099Lys, and a distinct phenotype: intellectual disability, coarse/ square facial gestalt, abnormalities of the hands, and organomegaly.; Changed publications: 30345613, 31171569, 36189577; Changed phenotypes: Rauch-Steindl syndrome, MIM# 619695, Microcephaly, intellectual disability, Neurodevelopmental disorder, NSD2-associated, GoF, MONDO:0700092
Intellectual disability syndromic and non-syndromic v0.4959 FOSL2 Krithika Murali gene: FOSL2 was added
gene: FOSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FOSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOSL2 were set to 36197437
Phenotypes for gene: FOSL2 were set to Neurodevelopmental disorder, MONDO:0700092, FOSL2-related
Review for gene: FOSL2 was set to GREEN
Added comment: PMID 36197437 Cospain et al 2022 report 11 individuals from 10 families with heterozygous PTC variants in exon 4/4 of the FOSL2 gene. All variants were predicted to escape NMD resulting in a truncated protein, with the truncation occurring proximal to the C-terminal domain (supportive functional studies).

In 10/11 families the variant occurred de novo in a single affected proband. In one family with 2 affected siblings, the variant was present in the siblings but absent in the unaffected parent likely due to gonadal mosaicism.

Clinical features included:
- Cutis aplasia congenital of the scalp (10/11)
- Tooth enamel hypoplasia and discolouration (8/9)
- Multiple other ectodermal features also noted e.g. small brittle nails, hypotrichosis/hypertrichosis, lichen sclerosis
- 5 individuals had cataracts (mostly bilateral, congenital/early childhood onset)
- 6/9 IUGR
- 5/9 postnatal growth restriction
- 7/9 developmental delay/ID (mild to severe)
- 5/7 ADHD/ASD
- 2/9 seizures
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4959 KCNK3 Krithika Murali reviewed gene: KCNK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 36195757; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, KCNK3-related, developmental delay with sleep apnoea (DDSA); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4959 DOHH Zornitza Stark Phenotypes for gene: DOHH were changed from Neurodevelopmental disorder, DOHH-related (MONDO#0700092) to Neurodevelopmental disorder with microcephaly, cerebral atrophy, and visual impairment, MIM# 620066
Intellectual disability syndromic and non-syndromic v0.4958 DOHH Zornitza Stark reviewed gene: DOHH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, cerebral atrophy, and visual impairment, MIM# 620066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4958 DPH2 Zornitza Stark Phenotypes for gene: DPH2 were changed from Diphthamide-deficiency syndrome to Developmental delay with short stature, dysmorphic facial features, and sparse hair 2, MIM# 620062; Diphthamide-deficiency syndrome
Intellectual disability syndromic and non-syndromic v0.4957 DPH2 Zornitza Stark reviewed gene: DPH2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay with short stature, dysmorphic facial features, and sparse hair 2, MIM# 620062; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4955 ARG1 Zornitza Stark reviewed gene: ARG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Argininaemia MIM#207800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4953 PAH Zornitza Stark reviewed gene: PAH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Phenylketonuria, MIM#261600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4953 MMACHC Zornitza Stark Phenotypes for gene: MMACHC were changed from to Methylmalonic aciduria and homocystinuria, cblC type, MIM#277400
Intellectual disability syndromic and non-syndromic v0.4951 MMACHC Zornitza Stark reviewed gene: MMACHC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Methylmalonic aciduria and homocystinuria, cblC type, MIM#277400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4949 DBT Zornitza Stark reviewed gene: DBT: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Maple syrup urine disease, type II (MIM#248600); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4947 ATP7A Zornitza Stark reviewed gene: ATP7A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Menkes disease MIM#309400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4946 PDCD6IP Zornitza Stark reviewed gene: PDCD6IP: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Microcephaly 29, primary, autosomal recessive, MIM# 620047; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4944 ARSA Zornitza Stark reviewed gene: ARSA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Metachromatic leukodystrophy, MIM# 250100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4941 ALDH7A1 Zornitza Stark reviewed gene: ALDH7A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33200442; Phenotypes: Epilepsy, pyridoxine-dependent, MIM# 266100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4939 PTPA Konstantinos Varvagiannis changed review comment from: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below.

There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID.

Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports.

------

Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants.

These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation.

Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies.

Role of the gene:
As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders.

Variant studies:
Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt.

Drosophila / animal models:
Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment.
Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice.
Sources: Literature; to: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below.

There is currently no associated phenotype in OMIM, G2P, PanelApp UK or SysID.

Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports.

------

Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants.

These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation.

Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies.

Role of the gene:
As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders.

Variant studies:
Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt.

Drosophila / animal models:
Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment.
Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4939 PTPA Konstantinos Varvagiannis gene: PTPA was added
gene: PTPA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTPA were set to 36073231
Phenotypes for gene: PTPA were set to Intellectual disability; Parkinsonism
Penetrance for gene: PTPA were set to Complete
Review for gene: PTPA was set to AMBER
Added comment: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below.

There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID.

Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports.

------

Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants.

These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation.

Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies.

Role of the gene:
As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders.

Variant studies:
Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt.

Drosophila / animal models:
Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment.
Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4936 PPP2R5C Teresa Zhao reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 25972378; Phenotypes: Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4936 CACNA1C Zornitza Stark Phenotypes for gene: CACNA1C were changed from to Neurodevelopmental disorder with hypotonia, language delay, and skeletal defects with or without seizures, MIM# 620029
Intellectual disability syndromic and non-syndromic v0.4935 CACNA1C Zornitza Stark reviewed gene: CACNA1C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia, language delay, and skeletal defects with or without seizures, MIM# 620029; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4935 UFSP2 Zornitza Stark Phenotypes for gene: UFSP2 were changed from Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus to Developmental and epileptic encephalopathy 106, MIM# 620028; Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus
Intellectual disability syndromic and non-syndromic v0.4934 UFSP2 Zornitza Stark edited their review of gene: UFSP2: Changed phenotypes: Developmental and epileptic encephalopathy 106, MIM# 620028, Abnormal muscle tone, Seizures, Global developmental delay, Delayed speech and language development, Intellectual disability, Strabismus
Intellectual disability syndromic and non-syndromic v0.4934 TRAPPC10 Zornitza Stark Phenotypes for gene: TRAPPC10 were changed from neurodevelopmental disorder (MONDO:0700092), TRAPPC10-related to Neurodevelopmental disorder with microcephaly, short stature, and speech delay, MIM# 620027
Intellectual disability syndromic and non-syndromic v0.4933 TRAPPC10 Zornitza Stark reviewed gene: TRAPPC10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, short stature, and speech delay, MIM# 620027; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4932 UBAP2L Zornitza Stark Phenotypes for gene: UBAP2L were changed from Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system to Neurodevelopmental disorder, MONDO:0700092, UBAP2L-related; Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system
Intellectual disability syndromic and non-syndromic v0.4929 UBAP2L Zornitza Stark reviewed gene: UBAP2L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, UBAP2L-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4929 CHKA Zornitza Stark Phenotypes for gene: CHKA were changed from Neurodevelopmental disorder, MONDO:0700092; Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature to Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023
Intellectual disability syndromic and non-syndromic v0.4928 CHKA Zornitza Stark reviewed gene: CHKA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4928 CAPRIN1 Konstantinos Varvagiannis reviewed gene: CAPRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35979925, 35977029, 28135719, 31398340, https://doi.org/10.1101/2021.12.20.21267194; Phenotypes: Global developmental delay, Delayed speech and language development, Intellectual disability, Autistic behavior, Seizures; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4928 UBAP2L Konstantinos Varvagiannis gene: UBAP2L was added
gene: UBAP2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBAP2L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: UBAP2L were set to 35977029
Phenotypes for gene: UBAP2L were set to Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system
Penetrance for gene: UBAP2L were set to unknown
Review for gene: UBAP2L was set to GREEN
Added comment: Based on Jia et al (2022 - PMID: 35977029) speech, motor delay as well as ID are observed in individuals harboring de novo pLoF variants in UBAP2L. The gene encodes a regulator of the stress granule (SG) assembly. Extensive evidence is provided on the effect of variants as well as the role of UBAP2L and other genes for components and/or regulation of SG in pathogenesis of NDDs. Among others a Ubap2l htz deletion mouse model (behavioral and cognitive impairment, abnormal cortical development due to impaired SG assembly, etc). Data from 26 previous studies, aggregating 40,853 probands with NDDs (mostly DD/ID, also ASD) suggest enrichment for DNMs in UBAP2L or other genes previously known and further shown to be important for SG formation (incl. G3BP1/G3BP2, CAPRIN1).

Details provided below.

Not associated with any phenotype in OMIM, G2P or SysNDD.

--------

Jia et al (2022 - PMID: 35977029) describe 12 affected individuals with heterozygous de novo pLoF variants in UBAP2L.

Phenotype: Features included hypotonia, speech (11/11) and motor delay (8/12), ID (8/10 with formal evaluation), variable behavioral concerns (ADHD 5/11, ASD in 4/10, etc). Seizures were reported in 7/12 with 3/10 having a formal diagnosis of epilepsy. Few had microcephaly (3/10). Facial dysmorphisms were common (9/9) and included abnormal palpebral fissures, deep prominent concha, high broad forehead, hypertelorism, thin upper lip and mild synophrys (each in 4 or less individuals). Short stature or skeletal alterations were described in some (4/10 each).

Role of the gene: UBAP2L encodes an essential regulator of stress granule assembly. Stress granules are membraneless cytoplasmic compartments in eukaryotic cells, induced upon a variety of stressors and playing a role in regulation of gene expression.

Variants identified : 9 nonsense/frameshift UBAP2L variants and 3 splicing ones were reported, in all cases as de novo events, upon trio/quad exome sequencing. All were absent from gnomAD. There were no other causative variants.

Variant effect/studies (NM_014847.4 / NP_055662.3) :
- Minigene assays revealed that the 3 splice variants all resulted in out-of-frame exon skipping.
- In patient fibroblasts one of these splice variants was demonstrated to result to reduced protein levels.
- 8 of the 9 nonsense/frameshift variants were predicted to result to NMD.
- 1 nonsense variant (c.88C>T/p.Q30*) was shown to result to decreased protein expression in patient fibroblasts, with detection of the protein using an antibody for the C terminus but not the N terminus. Protein N-terminal sequencing confirmed that the protein lacked the N terminus, with utilization of an alternative start site (11 codons downstream).
- Generation of HeLa UBAP2L KO cell lines resulted in significant reduction of SG numbers which was also the case for 4 variants studied, under stress conditions.
- The protein has a DUF domain (aa 495-526) known to mediate interaction of UBAP2L with G3BP1 (a stress granule marker) with deletions of this domain leading to shuttling of UBAP2L from the cytoplasm to the nucleus. Truncating variants upstream of the DUF domain were shown to result in nuclear localization.

Mouse model :
- The authors generated Ubap2l KO model with hmz deletion of Ubap2l resulting in a lethal phenotype (2.6% survived) and htz deletion leading to behavioral issues (low preference for social novelty, anxious-like behaviors) and cognitive impairment.
- Ubap2l haploinsufficiency resulted in abnormal cortical development and lamination with reduction of neural progenitor proliferation.
- Ubap2l deficiency was shown to impair SG assembly during cortical development both under physiological stress conditions or upon utilization of an oxidative stress inducer.

Additional evidence of UBAP2L and SG overall in pathogenesis of NDDs:
- Based on DNMs from 40,853 individuals with NDDs from 26 studies (9,228 with ASD, 31,625 with DD/ID) the authors demonstrate significant excess of DNM in 31 genes encoding SG components, regulators or both, the latter being the case for UBAP2L and 2 further genes (G3BP1 and G3BP2 - both with crucial roles in SG assembly).
- Excess dn splice-site (N=3) and missense (N=5) variants in G3BP1 were observed in the above cohort [c.95+1G>A, c.353+1G>T, c.539+1G>A / p.S208C, R320C, V366M].
- Excess dn missense (N=7) variants in G3BP2 were observed in the above cohort [p.R13W, D151N, E158K, L209P, E399D, K408E, R438C].
- Generation of G3BP1 or G3BP2 KO HeLa cell lines and immunofluorescence upon use of oxidative stress inducer revealed significant reduction of stress granules.
- Generation of HeLa cell lines for 5 G3BP1 mutants (R78C*, R132I*, S208C*, R320C*, V366M) and 7 G3BP2 mutants (p.R13W*, D151N*, E158K, L209P*, E399D, K408E, R438C) revealed that several (those in asterisk) resulted in significantly fewer SG formation under oxidative stress compared to WT while the subcellular distribution of the proteins under stress was identical to WT.
- Among the identified genes for SG enriched for DNMs, CAPRIN1 was implicated in previous publications as a NDD risk gene with 3 dn missense SNVs reported (p.I373K, p.Q446H, p.L484P). CAPRIN1 binding to G3BP1/2 has been shown to promote SG formation. Significant reduction of SG was observed in CAPRIN1 KO HeLa lines. p.I373K abolished interaction with G3BP1/2 and disrupted SG formation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4927 PPFIBP1 Zornitza Stark Phenotypes for gene: PPFIBP1 were changed from Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related to Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024
Intellectual disability syndromic and non-syndromic v0.4926 PPFIBP1 Zornitza Stark edited their review of gene: PPFIBP1: Changed phenotypes: Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024
Intellectual disability syndromic and non-syndromic v0.4925 PDZD8 Zornitza Stark gene: PDZD8 was added
gene: PDZD8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PDZD8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDZD8 were set to 35227461
Phenotypes for gene: PDZD8 were set to Intellectual developmental disorder with autism and dysmorphic facies, MIM# 620021
Review for gene: PDZD8 was set to GREEN
Added comment: Four individuals from two unrelated families, Drosophila and mouse models support gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4924 SLC31A1 Daniel Flanagan gene: SLC31A1 was added
gene: SLC31A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SLC31A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC31A1 were set to PMID: 35913762
Phenotypes for gene: SLC31A1 were set to Neurodevelopmental disorder, SLC31A1-related (MONDO#0700092)
Review for gene: SLC31A1 was set to RED
Added comment: SLC31A1 is also referred to as CTR1.
Monozygotic twins with hypotonia, global developmental delay, seizures, and rapid brain atrophy, consistent with profound central nervous system copper deficiency. Homozygous for a novel missense variant (p.(Arg95His)) in copper transporter CTR1, both parents heterozygous. A mouse knock-out model of CTR1 deficiency resulted in prenatal lethality.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4915 LGI3 Zornitza Stark reviewed gene: LGI3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LGI3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4915 TMEM147 Naomi Baker gene: TMEM147 was added
gene: TMEM147 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM147 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM147 were set to PMID: 36044892
Phenotypes for gene: TMEM147 were set to Neurodevelopmental disorder (MONDO:0700092), TMEM147-related
Review for gene: TMEM147 was set to GREEN
Added comment: PMID: 36044892; Twelve different variants reported in 23 affected individuals from 15 unrelated families with biallelic variants. All individuals had global developmental delay and intellectual disability. Consistent facial dysmorphisms included coarse facies, prominent forehead, board depressed nasal root, tented mouth, long smooth philtrum, and low-set ears. In vitro studies of missense variants demonstrated accelerated protein degradation via the autophagy-lysosomal pathway, while analysis of primary fibroblasts and granulocytes provided functional evidence of ER and nuclear envelope dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4915 SARS Ee Ming Wong reviewed gene: SARS: Rating: RED; Mode of pathogenicity: Other; Publications: 36041817; Phenotypes: neurodevelopmental disorder MONDO#070009, SARS1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4915 COX11 Chern Lim gene: COX11 was added
gene: COX11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COX11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COX11 were set to 36030551
Phenotypes for gene: COX11 were set to Mitochondrial disease (MONDO:0044970), COX11-related
Review for gene: COX11 was set to GREEN
gene: COX11 was marked as current diagnostic
Added comment: PMID: 36030551
- Biallelic variants in COX11 associated with infantile-onset mitochondrial encephalopathies in two unrelated consanguineous families, one with homozygous missense variant, another with homozygous frameshift variant.
- Functional studies supported pathogenicity of the missense variant, and showed that mutant COX11 fibroblasts had decreased ATP levels which could be rescued by CoQ10.
- RNA studies suggested the mutant transcript with p.(Val12Glyfs*21) is not degraded by nonsense mediated decay.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4915 LGI3 Melanie Marty edited their review of gene: LGI3: Changed phenotypes: Global developmental delay, Intellectual disability, Distal deformities, Diminished reflexes, Facial myokymia, Hyporeflexia/areflexia
Intellectual disability syndromic and non-syndromic v0.4915 TMEM163 Teresa Zhao gene: TMEM163 was added
gene: TMEM163 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM163 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TMEM163 were set to PMID: 35953447
Phenotypes for gene: TMEM163 were set to Hypomyelinating leukodystrophy
Review for gene: TMEM163 was set to GREEN
Added comment: Four unrelated families with a hypomyelinating leukodystrophy phenotype. Genomic testing identified three distinct heterozygous missense variants in TMEM163 with two unrelated individuals sharing the same de novo variant.

All have global developmental delay, three of them have seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4913 GRIN2A Zornitza Stark Mode of inheritance for gene: GRIN2A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4912 NOTCH1 Chern Lim changed review comment from: PMID: 35947102:
- Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1.
- Missense and small inframe insertion variants in the negative regulatory region.
Sources: Literature; to: PMID: 35947102:
- Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1.
- Other clinical features include intellectual disability, spasticity and etc. Childhood onset in most individuals however 15y and 40y reported in two individuals.
- Missense and small inframe insertion variants in the negative regulatory region.
Intellectual disability syndromic and non-syndromic v0.4912 CEP104 Belinda Chong reviewed gene: CEP104: Rating: GREEN; Mode of pathogenicity: None; Publications: 34196201, 35359234; Phenotypes: CEP104 Neurodevelopmental disorder, MONDO:0014770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4912 NOTCH1 Chern Lim gene: NOTCH1 was added
gene: NOTCH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NOTCH1 were set to 35947102
Phenotypes for gene: NOTCH1 were set to Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related
Mode of pathogenicity for gene: NOTCH1 was set to Other
Review for gene: NOTCH1 was set to GREEN
gene: NOTCH1 was marked as current diagnostic
Added comment: PMID: 35947102:
- Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1.
- Missense and small inframe insertion variants in the negative regulatory region.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4912 LGI3 Melanie Marty changed review comment from: Six individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3.
Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons.
Sources: Literature; to: Sixteen individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3.
Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4912 LGI3 Melanie Marty gene: LGI3 was added
gene: LGI3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LGI3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LGI3 were set to PMID: 35948005
Phenotypes for gene: LGI3 were set to Global developmental delay; Intellectual disability; Distal deformities; Diminished reflexes; Facial myokymia; Hyporeflexia/areflexi
Review for gene: LGI3 was set to GREEN
Added comment: Six individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3.
Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4912 GRIN2A Teresa Zhao reviewed gene: GRIN2A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35983985; Phenotypes: Epilepsy, focal, with speech disorder and with or without mental retardation (MIM#245570); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4912 CAPRIN1 Paul De Fazio gene: CAPRIN1 was added
gene: CAPRIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAPRIN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CAPRIN1 were set to 35979925
Phenotypes for gene: CAPRIN1 were set to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092
Review for gene: CAPRIN1 was set to GREEN
gene: CAPRIN1 was marked as current diagnostic
Added comment: 12 individuals reported with ID and language impairment. Other features included seizures (4 individuals), hands and feet malformations (5 individuals), breathing problems (6 individuals), ocular problems (4 individuals) and hearing problems (3 individuals).

All of the variants were nonsense (NMD-predicted) or splicing variants. 10 were de novo, 1 was inherited from an affected father. Functional studies supported pathogenicity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4906 CCDC82 Zornitza Stark reviewed gene: CCDC82: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CCDC82-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4905 LNPK Chirag Patel reviewed gene: LNPK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35599435; Phenotypes: Neurodevelopmental disorder with epilepsy and hypoplasia of the corpus callosum, MIM# 618090; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4904 CCDC82 Chirag Patel gene: CCDC82 was added
gene: CCDC82 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC82 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC82 were set to PMID: 35373332, 35118659, 27457812
Phenotypes for gene: CCDC82 were set to Intellectual disability and spastic paraparesis, no OMIM #
Review for gene: CCDC82 was set to GREEN
Added comment: 4 consanguineous families with 9 affected individuals with developmental delay/intellectual disability, and 2 families had spasticity and 1 had epilepsy. WES identified 3 homozgyous truncating variants, segregating with disease and parents as carriers. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4902 FBXW7 Zornitza Stark edited their review of gene: FBXW7: Changed phenotypes: Developmental delay, hypotonia, and impaired language, MIM# 620012
Intellectual disability syndromic and non-syndromic v0.4901 ACADS Zornitza Stark changed review comment from: Definitive by ClinGen. Metabolic decompensation. DD/ID is a feature.; to: Definitive by ClinGen. However, largely just causes a biochemical abnormality, and association with clinical disease is debated. DD/ID reported.
Intellectual disability syndromic and non-syndromic v0.4901 ACADS Zornitza Stark edited their review of gene: ACADS: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.4898 ZMYND8 Zornitza Stark Phenotypes for gene: ZMYND8 were changed from Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures to Neurodevelopmental disorder, MONDO:0700092, ZMYND8-related; Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures
Intellectual disability syndromic and non-syndromic v0.4895 TAF4 Konstantinos Varvagiannis reviewed gene: TAF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 35904126; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4895 ZMYND8 Konstantinos Varvagiannis gene: ZMYND8 was added
gene: ZMYND8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZMYND8 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ZMYND8 were set to 35916866; 32530565
Phenotypes for gene: ZMYND8 were set to Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures
Penetrance for gene: ZMYND8 were set to unknown
Review for gene: ZMYND8 was set to GREEN
Added comment: Dias et al (2022 - PMID: 35916866) describe the phenotype of 11 unrelated individuals with monoallelic de novo (or suspected de novo) missense (N=9) or truncating (N=2) ZMYND8 variants. One of these subjects was previously reported by Suzuki et al (2020 - PMID: 32530565).

Features included speech delay/language difficulties (9/11), motor delay (9/11), ID (in 10/11 - profound in 1, moderate in 2), CHD (7/11 - PDA, VSD, ASD, pulmonary stenosis, etc), hearing or vision impairment (7/11). Seizures were reported in few (in text 5/11, table 2/11). Variable non-familial facial features were present in (9/11).

As the authors discuss, ZMYND8 encodes a multidomain protein playing a role in transcription regulation, chromatin remodeling, regulation of super enhancers, DNA damage response/tumor suppression.

The protein is broadly expressed in brain and shows highest expression in early development.

Molecular modeling and/or a yeast two-hybrid system were suggestive of disrupted interaction of ZMYND8 with Drebrin (missense variants in PWWP domain) or GATAD2A (variants in MYND domain).

Neuronal Zmynd8 knockdown in Drosophila resulted in deficits in habituation learning.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4894 ADAR Zornitza Stark Mode of inheritance for gene: ADAR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4893 ADAR Zornitza Stark reviewed gene: ADAR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 6, MIM# 615010; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4891 ACTG1 Zornitza Stark reviewed gene: ACTG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Baraitser-Winter syndrome 2, MIM#614583; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4888 ACTB Zornitza Stark reviewed gene: ACTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 29220674; Phenotypes: Baraitser-Winter syndrome 1 243310, ACTB-related neurodevelopment disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4885 ACO2 Zornitza Stark reviewed gene: ACO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22405087, 25351951, 30689204, 32519519, 25351951; Phenotypes: Infantile cerebellar-retinal degeneration, MIM#614559; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4883 ABCD1 Zornitza Stark reviewed gene: ABCD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adrenoleukodystrophy, MIM# 300100; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4881 ACADS Zornitza Stark reviewed gene: ACADS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Acyl-CoA dehydrogenase, short-chain, deficiency of, MIM# 201470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4879 ACADM Zornitza Stark reviewed gene: ACADM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Acyl-CoA dehydrogenase, medium chain, deficiency of, MIM# 201450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4877 PAX5 Zornitza Stark Mode of inheritance for gene: PAX5 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4876 PAX5 Zornitza Stark reviewed gene: PAX5: Rating: AMBER; Mode of pathogenicity: None; Publications: 35947077; Phenotypes: Neurodevelopmental disorder MONDO:0700092, PAX5-related, Hypogammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4876 SMG9 Zornitza Stark Phenotypes for gene: SMG9 were changed from Heart and brain malformation syndrome, MIM# 616920 to Heart and brain malformation syndrome, MIM# 616920; Neurodevelopmental disorder with intention tremor, pyramidal signs, dyspraxia, and ocular anomalies, MIM# 619995
Intellectual disability syndromic and non-syndromic v0.4874 SMG9 Zornitza Stark edited their review of gene: SMG9: Added comment: PMID 35087184: 5 individuals from 3 unrelated Finnish families reported with same homozygous missense variant (founder effect) and predominantly neurological phenotype. Uncertain if this is a distinct disorder or part of a spectrum with the previously reported cases.; Changed publications: 27018474, 31390136, 35087184; Changed phenotypes: Heart and brain malformation syndrome, MIM# 616920, Neurodevelopmental disorder with intention tremor, pyramidal signs, dyspraxia, and ocular anomalies, MIM# 619995
Intellectual disability syndromic and non-syndromic v0.4874 THUMPD1 Zornitza Stark edited their review of gene: THUMPD1: Changed phenotypes: Neurodevelopmental disorder with speech delay and variable ocular anomalies, MIM# 619989; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4874 TAF4 Ee Ming Wong reviewed gene: TAF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 33875846, 28191890, 35904126; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TAF4-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4873 SPTBN5 Ee Ming Wong gene: SPTBN5 was added
gene: SPTBN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPTBN5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SPTBN5 were set to 35782384
Phenotypes for gene: SPTBN5 were set to Neurodevelopmental disorder, MONDO:0700092, SPTBN5-related
Review for gene: SPTBN5 was set to GREEN
gene: SPTBN5 was marked as current diagnostic
Added comment: - Four probands from unrelated families (1x Pakistani and 3x Italian) with de novo heterozygous SPTBN5 variants
- 3x missense variants and 1x LoF variant were reported
- Phenotypes include intellectual disability (mild to severe), aggressive tendencies and variable features such as craniofacial and physical dysmorphisms, autistic behavior, and
gastroesophageal reflux
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4872 PSMC1 Hazel Phillimore gene: PSMC1 was added
gene: PSMC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMC1 were set to PMID: 35861243
Phenotypes for gene: PSMC1 were set to spastic paraplegia; severe developmental delay; severe intellectual disability; hearing loss; micropenis; undescended testes; Syndromic disease MONDO:0002254, PSMC1-related
Review for gene: PSMC1 was set to RED
Added comment: Homozygosity mapping on one large consanguineous Bedouin kindred showed three affected children (out of the ten) to be homozygous for NM_002802.3:c.983T>C; p.(Ile328Thr).

Drosophila rescue experiments were carried out. Transgenic studies using drosophila with the silenced ortholog Rpt2 gene were rescued by the human wild-type PSMC1.

Three of the ten offspring of healthy consanguineous parents of Bedouin Israeli ancestry were affected with a similar phenotype of failure to thrive, developmental delay and severe intellectual disability, spastic tetraplegia with central hypotonia, chorea, as well as hearing loss. None of the three achieved verbal communication or ambulation (sitting / standing) at any age. They had mild dysmorphism of borderline dolichocephaly and microcephaly, prominent bushy eyebrows, flat midface, long nasal bridge and micrognathia. All three had micropenis with undescended testes. One of the affected (as a toddler) underwent thorough endocrinological analysis: testosterone and gonadotropin levels were low.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4871 SARS Ain Roesley reviewed gene: SARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 35790048; Phenotypes: neurodevelopmental disorder MONDO#070009, SARS1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4870 BICD2 Lucy Spencer reviewed gene: BICD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 35896821; Phenotypes: Neurodevelopmental disorder (MONDO#0700092), BICD2-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4868 C18orf32 Naomi Baker gene: C18orf32 was added
gene: C18orf32 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C18orf32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C18orf32 were set to PMID:35107634
Phenotypes for gene: C18orf32 were set to Neurodevelopmental disorder (MONDO:0700092), C18orf32-related
Review for gene: C18orf32 was set to RED
Added comment: Two siblings reported as affected, although sequencing only performed in one sibling, with homozygous loss-of-function variant identified. Clinical presentation included developmental delay, recurrent lower respiratory tract infections, sparse rough hair, roving eye movements, hypotonia, bilateral ankle contractures and inverted nipples.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4867 WARS Anna Ritchie gene: WARS was added
gene: WARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WARS were set to PMID: 35815345; 35790048
Phenotypes for gene: WARS were set to Neurodevelopmental disorder (MONDO:0700092), WARS-related
Review for gene: WARS was set to GREEN
Added comment: At least seven affected individuals from four families with biallelic variants, showing varying
severities of developmental delay, intellectual disability and microcephaly. Hearing impairment and, as well as brain anomalies, skeletal system, movement/gait, and behaviour were variable features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4867 PPFIBP1 Ee Ming Wong reviewed gene: PPFIBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35830857; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4867 SLITRK2 Paul De Fazio gene: SLITRK2 was added
gene: SLITRK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLITRK2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: SLITRK2 were set to 35840571
Phenotypes for gene: SLITRK2 were set to Neurodevelopmental disorder, SLITRK2-related MONDO:0700092
Review for gene: SLITRK2 was set to GREEN
gene: SLITRK2 was marked as current diagnostic
Added comment: 6 missense variants and 1 nonsense variant (NOT NMD-predicted, single-exon gene) reported in 7 males and 1 female with neurodevelopmental disorders. Phenotypes included dev delay, mild to severe ID, delayed or absent speech, seizures and brain MRI anomalies (in some patients).

The nonsense variant was identified in two affected brothers but not in the mother, suggesting it was de novo in the maternal germline. The variant in the one affected female was de novo. All other variants in hemizygous males were inherited from an unaffected mother. In one case, the variant was also identified in the unaffected grandmother.

Functional studies showed some but not all variants displayed impaired membrane transport and impaired excitatory synapse-promoting effects. Conditional knockout mice exhibited impaired long-term memory and abnormal gait.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4865 DOHH Daniel Flanagan gene: DOHH was added
gene: DOHH was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: DOHH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DOHH were set to PMID: 35858628
Phenotypes for gene: DOHH were set to Neurodevelopmental disorder, DOHH-related (MONDO#0700092)
Review for gene: DOHH was set to GREEN
Added comment: Bi-allelic missense and truncating DOHH variants segregating with disease in five affected individuals from four unrelated families. Clinical features were developmental delay and/or intellectual disability (5/5), microcephaly (5/5), visual impairment (nystagmus (3/5), strabismus (3/5), and cortical visual impairment (1/5)) and congenital heart malformations (3/5 individuals).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4865 ADGRL1 Elena Savva gene: ADGRL1 was added
gene: ADGRL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADGRL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ADGRL1 were set to PMID: 35907405
Phenotypes for gene: ADGRL1 were set to Neurodevelopmental disorder, ADGRL1-related (MONDO#0700092)
Review for gene: ADGRL1 was set to GREEN
Added comment: PMID: 35907405 - 9 patients w/ ADHD (3/9), autism (4/9), mild-moderate ID (5/9) and epilepsy (2/9) and facial dysmorphism (7/9). Variants include missense (4) and PTCs (5), and were either de novo (7/9) or inherited from parents with learning difficulties/ID (2/9).

Functional studies on both PTCs and missense variants show significant reductions in calcium signalling and surface protein.

Het null mouse model shows neurological and developmental abnormalities, with hom null mice non-viable.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4864 TAF8 Zornitza Stark Phenotypes for gene: TAF8 were changed from Neurodevelopmental disorder, MONDO:0700092, TAF8-related to Neurodevelopmental disorder with severe motor impairment, absent language, cerebral hypomyelination, and brain atrophy, MIM# 619972
Intellectual disability syndromic and non-syndromic v0.4863 TAF8 Zornitza Stark edited their review of gene: TAF8: Changed phenotypes: Neurodevelopmental disorder with severe motor impairment, absent language, cerebral hypomyelination, and brain atrophy, MIM# 619972
Intellectual disability syndromic and non-syndromic v0.4861 POU3F3 Zornitza Stark reviewed gene: POU3F3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Snijders Blok-Fisher syndrome MIM#618604; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4860 TMEM63C Zornitza Stark reviewed gene: TMEM63C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 87, autosomal recessive, MIM# 619966; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4859 ARFGEF1 Zornitza Stark edited their review of gene: ARFGEF1: Changed phenotypes: Developmental delay, impaired speech, and behavioral abnormalities, MIM# 619964
Intellectual disability syndromic and non-syndromic v0.4856 HIST1H4E Zornitza Stark reviewed gene: HIST1H4E: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Tessadori-van Haaften neurodevelopmental syndrome 3, MIM# 619950; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4854 KMT2B Zornitza Stark changed review comment from: ID described as part of the phenotype in some patients.; to: Childhood-onset dystonia: ID described as part of the phenotype in some patients.
Intellectual disability syndromic and non-syndromic v0.4854 KMT2B Zornitza Stark edited their review of gene: KMT2B: Added comment: Nine individuals reported in PMID 33150406 with heterozygous variants in this gene and intellectual disability, speech delay, microcephaly, growth delay, feeding problems, and dysmorphic features, including epicanthic folds, posteriorly rotated ears, syndactyly/clinodactyly of toes, and fifth finger clinodactyly, normal MRIs and NO dystonia.; Changed publications: 33150406; Changed phenotypes: Dystonia 28, childhood-onset 617284, MONDO:0015004, Intellectual developmental disorder, autosomal dominant 68, MIM# 619934
Intellectual disability syndromic and non-syndromic v0.4853 LMAN2L Zornitza Stark reviewed gene: LMAN2L: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal recessive, 52 OMIM #616887, Intellectual developmental disorder, autosomal dominant 69 , MIM# 617863; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4853 PLXNA1 Zornitza Stark reviewed gene: PLXNA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4853 PLXNA1 Zornitza Stark Phenotypes for gene: PLXNA1 were changed from Neurodevelopmental disorder with cerebral and eye anomalies to Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955
Intellectual disability syndromic and non-syndromic v0.4849 PABPC1 Elena Savva gene: PABPC1 was added
gene: PABPC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PABPC1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PABPC1 were set to PMID: 35511136
Phenotypes for gene: PABPC1 were set to Neurodevelopmental disorder, PABPC1-related (MONDO#0700092)
Review for gene: PABPC1 was set to GREEN
Added comment: PMID: 35511136 - 4 probands with an overlapping phenotype of DD, expressive speech delay, and autistic features and heterozygous de novo variants that cluster in the PABP domain of PABPC1.
Electroporation of mouse embryo brains showed that Pabpc1 knockdown decreases the proliferation of neural progenitor cells. Wild-type Pabpc1 could rescue this disturbance, whereas 3 of the 4 variants did not.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4846 CHMP3 Chern Lim gene: CHMP3 was added
gene: CHMP3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHMP3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHMP3 were set to PMID: 35710109
Phenotypes for gene: CHMP3 were set to Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related
Review for gene: CHMP3 was set to AMBER
gene: CHMP3 was marked as current diagnostic
Added comment: PMID: 35710109
- Single large family with consanguinity, homozygous missense variant in 5 affected individuals with intellectual and progressive motor disabilities, seizures and spastic quadriplegia.
- Functional studies showed reduced CHMP3 protein in patient's fibroblasts, lenti-rescue study showed improved cellular phenotypes associated with impaired autophagy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4844 ACOX1 Alison Yeung Mode of inheritance for gene: ACOX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4843 ACOX1 Alison Yeung reviewed gene: ACOX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32169171, 17458872; Phenotypes: Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470, Mitchell syndrome, MIM# 618960; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4843 WNK3 Lucy Spencer gene: WNK3 was added
gene: WNK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WNK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: WNK3 were set to 35678782
Phenotypes for gene: WNK3 were set to Neurodevelopmental disorder, WNK3-related (MONDO#0700092)
Review for gene: WNK3 was set to GREEN
Added comment: 6 maternally inherited hemizygous variants, 3 missense, 2 canonical splice, and a nonsense. Seen in 14 individuals from 6 families, all 14 are male who inherited hemizygous variants from their unaffected heterozygous mothers. The variants cosegregated with disease in 3 families with multiple affected individuals. All 14 patients have ID, 11 have speech delay, 10 have facial abnormalities, 5 have seizures, 6 with microcephaly and 7 with anomalies in brain imaging.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4840 MAL Zornitza Stark gene: MAL was added
gene: MAL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAL were set to 35217805
Phenotypes for gene: MAL were set to Leukodystrophy MONDO:0019046, MAL-related
Review for gene: MAL was set to AMBER
Added comment: Single family with two affected siblings reported, with homozygous missense variant, some functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4839 TAF8 Zornitza Stark changed review comment from: Further 7 individuals reported from 4 families, three of which were consanguineous.

Clinical features included severe psychomotor retardation with almost absent development, feeding problems, microcephaly, growth retardation, spasticity and epilepsy.

Five had the previously reported c.781-1G > A variant in homozygous state. This is likely to be a founder variant.

One family with different compound heterozygous variants.; to: Further 7 individuals reported from 4 families, three of which were consanguineous.

Clinical features included severe psychomotor retardation with almost absent development, feeding problems, microcephaly, growth retardation, spasticity and epilepsy.

Five had the previously reported c.781-1G > A variant in homozygous state. Unclear if this is a founder variant, families of different ethnicities.

One family with different compound heterozygous variants.
Intellectual disability syndromic and non-syndromic v0.4835 TAF8 Zornitza Stark edited their review of gene: TAF8: Changed publications: 35759269
Intellectual disability syndromic and non-syndromic v0.4835 TAF8 Zornitza Stark reviewed gene: TAF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TAF8-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4834 KCNK9 Zornitza Stark edited their review of gene: KCNK9: Added comment: Additional 47 individuals reported with 15 variants, including another hotspot at p.Arg131.; Changed publications: 28333430, 27151206, 24980697, 18678320, 35698242
Intellectual disability syndromic and non-syndromic v0.4833 TSPAN7 Zornitza Stark edited their review of gene: TSPAN7: Added comment: Two families reported with LoF variants and ID: Abidi FE et al. 2002 Jun (PMID:12070254); Zemni R et al. 2000 Feb (PMID:10655063) Assessed as MODERATE by ClinGen.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.4832 TSPAN7 Zornitza Stark edited their review of gene: TSPAN7: Changed rating: RED
Intellectual disability syndromic and non-syndromic v0.4831 GRIA1 Zornitza Stark changed review comment from: Single individual reported with bi-allelic LoF variant.; to: Single individual reported with bi-allelic LoF variant. RED/AMBER for bi-allelic variants.
Intellectual disability syndromic and non-syndromic v0.4831 GRIA1 Zornitza Stark Mode of inheritance for gene: GRIA1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4829 GRIA1 Zornitza Stark edited their review of gene: GRIA1: Added comment: Single individual reported with bi-allelic LoF variant.; Changed publications: 35675825; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 76, MIM# 619931
Intellectual disability syndromic and non-syndromic v0.4828 GRIA1 Zornitza Stark edited their review of gene: GRIA1: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 67, MIM# 619927
Intellectual disability syndromic and non-syndromic v0.4828 NR4A2 Zornitza Stark Phenotypes for gene: NR4A2 were changed from Intellectual disability; rolandic epilepsy; autism to Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911
Intellectual disability syndromic and non-syndromic v0.4826 KCNC2 Zornitza Stark gene: KCNC2 was added
gene: KCNC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: KCNC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNC2 were set to 32392612; 31972370; 35314505
Phenotypes for gene: KCNC2 were set to Developmental and epileptic encephalopathy 103, MIM# 619913
Review for gene: KCNC2 was set to GREEN
Added comment: More than 10 unrelated families reported. ID ranges from mild to severe.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4824 ATP2B1 Zornitza Stark reviewed gene: ATP2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 66, MIM# 619910; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4823 PRDM13 Zornitza Stark edited their review of gene: PRDM13: Added comment: Note only single family reported with MIM#619761. The two disorders likely represent a continuum of severity.; Changed phenotypes: Pontocerebellar hypoplasia, type 17, MIM# 619909, Cerebellar dysfunction, impaired intellectual development, and hypogonadotropic hypogonadism, MIM# 619761
Intellectual disability syndromic and non-syndromic v0.4823 TIAM1 Zornitza Stark Phenotypes for gene: TIAM1 were changed from Neurodevelopmental disorder, TIAM1-related, MONDO:0700092 to Neurodevelopmental disorder with language delay and seizures, MIM# 619908
Intellectual disability syndromic and non-syndromic v0.4820 IREB2 Zornitza Stark edited their review of gene: IREB2: Added comment: Additional individual reported in PMID 35602653; Changed publications: 30915432, 31243445, 11175792, 35602653
Intellectual disability syndromic and non-syndromic v0.4819 RMND1 Belinda Chong reviewed gene: RMND1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26395190; Phenotypes: Combined oxidative phosphorylation deficiency 11 MIM#614922; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4818 PAN2 Naomi Baker gene: PAN2 was added
gene: PAN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PAN2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PAN2 were set to PMID:35304602; 29620724
Phenotypes for gene: PAN2 were set to Syndromic disease MONDO:0002254
Review for gene: PAN2 was set to GREEN
Added comment: PMID:35304602 reports five individuals from 3 families with biallelic (homozygous) loss-of-function variants. Clinical presentation incudes mild-moderate intellectual disability, hypotonia, sensorineural hearing loss, EEG abnormalities, congenital heart defects (tetralogy of Fallot, septal defects, dilated aortic root), urinary tract malformations, ophthalmological anomalies, short stature with other skeletal anomalies, and craniofacial features including flat occiput, ptosis, long philtrum, and short neck.

PMID:29620724 reports one individual with biallelic (homozygous) loss-of-function variant who presented with global developmental delay, mild hypotonia, craniosynostosis, severe early-onset scoliosis, imperforate anus, and double urinary collecting system.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4814 PRPF8 Krithika Murali gene: PRPF8 was added
gene: PRPF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRPF8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRPF8 were set to 35543142
Phenotypes for gene: PRPF8 were set to Intellectual disability; epilepsy; Retinitis pigmentosa 13 - MIM#600059
Review for gene: PRPF8 was set to GREEN
Added comment: PMID 35543142 O'Grady et al 2022 report 14 unrelated individuals with heterozygous PRPF8 variants and ID, dymorphic features and epilepsy (7/14). Short stature, abnormal gait and cardiac anomalies also reported. 11 variants identified were de novo, 1 variant - maternal mosaicism, 1 variant - duo sequencing (not identified in mother, father could not be sequenced). 1 individual did not have parental testing. Cardiac anomalies varied and included benign cardiac tumour, dilated cardiomyopathy, dilated aortic root (COL5A2 VUS also identified), bicuspid aortic valve, cardiac arrest, self-resolving ASD/VSD.

Heterozygous PRPF8 variants previously associated with retinitis pigmentosa. 1 out of the 14 individuals in this cohort had a diagnosis of RP. RP variants noted to cluster in the C'terminal MPN domain. The individual with RP in this paper had a variant in the preceding RNAase H homology domain near the C-terminus. Not all of the individuals in this paper had formal ophthalmological examination
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4814 BUB1 Paul De Fazio gene: BUB1 was added
gene: BUB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BUB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BUB1 were set to 35044816; 19772675; 19117986; 23209306
Phenotypes for gene: BUB1 were set to Neurodevelopmental disorder, BUB1-related MONDO:0700092; Intellectual disability and microcephaly
Review for gene: BUB1 was set to GREEN
gene: BUB1 was marked as current diagnostic
Added comment: 2 unrelated patients with ID, microcephaly, short stature, dysmorphic features reported with biallelic variants:

P1 (3yo male): homozygous start-loss variant (2 hets and 0 hom in gnomAD). Functional testing showed a small amount of full-length protein was translated, and BUB1 recruitment to kinetochores was nearly undetectable.
P2 (16yo female): compound heterozygous for a canonical splice variant (1 het and no hom in gnomAD) and an NMD-predicted frameshift variant (absent from gnomAD). The splice variant was shown to result in an in-frame deletion of 54 amino acids in the kinase domain. P2 cells have reduced protein levels but essentially no kinase activity.

BUB1 patient cells have impaired mitotic fidelity.

Homozygous Bub1 disruption in mice is embryonic lethal (PMID:19772675). A hypomorphic mouse is viable with increased tumourigenesis with ageing and aneuploidy (PMID:19117986). A kinase-dead mouse does not show increased tumourigenesis but does have a high frequency of aneuploid cells (PMID:23209306)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4814 SEMA6B Dean Phelan gene: SEMA6B was added
gene: SEMA6B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SEMA6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SEMA6B were set to PMID: 35604360
Phenotypes for gene: SEMA6B were set to Intellectual disability, MONDO:0001071, SEMA6B related
Penetrance for gene: SEMA6B were set to Complete
Review for gene: SEMA6B was set to GREEN
Added comment: PMID: 35604360
- 14 heterozygous variants were observed in 16 unrelated individuals referred for intellectual disability. Majority of the variants 9/14 were PTCs in the last exon and predicted to escape NMD. Functional studies of selected variants and shRNA knock down studies showed mislocalisation and abnormal protein function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4813 HEATR3 Chern Lim gene: HEATR3 was added
gene: HEATR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HEATR3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HEATR3 were set to PMID: 35213692
Phenotypes for gene: HEATR3 were set to Bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability; Diamond Blackfan anaemia MONDO:0015253, HEATR3 related
Review for gene: HEATR3 was set to AMBER
gene: HEATR3 was marked as current diagnostic
Added comment: PMID: 35213692:
- 4 unrelated individuals with biallelic HEATR3 variants (missense and splice site variants), exhibiting bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability.
- Functional analysis showed HEATR3 variants destabilised the protein, resulting in a reduction of nuclear uL18 and impaired ribosome biogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4811 SRRM2 Michelle Torres reviewed gene: SRRM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 35567594; Phenotypes: neurodevelopmental disorder MONDO:0700092 SRRM2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4808 TCTN2 Zornitza Stark reviewed gene: TCTN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21565611, 25118024; Phenotypes: Joubert syndrome 24, MIM# 616654 MONDO:0014724; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4807 PRDM13 Zornitza Stark reviewed gene: PRDM13: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebellar dysfunction, impaired intellectual development, and hypogonadotropic hypogonadism, MIM# 619761; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4806 HIST1H4J Zornitza Stark reviewed gene: HIST1H4J: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Tessadori-van Haaften neurodevelopmental syndrome 2 , MIM# 619759; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4804 MMGT1 Zornitza Stark edited their review of gene: MMGT1: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, MMGT1-related
Intellectual disability syndromic and non-syndromic v0.4798 PLCH1 Zornitza Stark edited their review of gene: PLCH1: Changed phenotypes: Holoprosencephaly 14, MIM# 619895
Intellectual disability syndromic and non-syndromic v0.4798 SLC38A3 Zornitza Stark Phenotypes for gene: SLC38A3 were changed from developmental epileptic encephalopathy, SLC38A3-related MONDO:0100062 to Developmental and epileptic encephalopathy 102, MIM# 619881
Intellectual disability syndromic and non-syndromic v0.4797 SLC38A3 Zornitza Stark reviewed gene: SLC38A3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 102, MIM# 619881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4797 COPB2 Zornitza Stark Phenotypes for gene: COPB2 were changed from Osteoporosis and developmental delay to Osteoporosis, childhood- or juvenile-onset, with developmental delay, MIM# 619884
Intellectual disability syndromic and non-syndromic v0.4796 COPB2 Zornitza Stark edited their review of gene: COPB2: Changed phenotypes: Osteoporosis, childhood- or juvenile-onset, with developmental delay, MIM# 619884
Intellectual disability syndromic and non-syndromic v0.4795 PROSER1 Zornitza Stark Phenotypes for gene: PROSER1 were changed from Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM # to Syndromic disease MONDO:0002254, PROSER1-related; Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM #
Intellectual disability syndromic and non-syndromic v0.4794 PCDHGC4 Zornitza Stark Phenotypes for gene: PCDHGC4 were changed from Intellectual disability; Seizures to Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880
Intellectual disability syndromic and non-syndromic v0.4793 PCDHGC4 Zornitza Stark edited their review of gene: PCDHGC4: Changed phenotypes: Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880
Intellectual disability syndromic and non-syndromic v0.4792 ZNF526 Zornitza Stark edited their review of gene: ZNF526: Changed phenotypes: Dentici-Novelli neurodevelopmental syndrome, MIM# 619877
Intellectual disability syndromic and non-syndromic v0.4792 LRP2 Chirag Patel reviewed gene: LRP2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 17632512; Phenotypes: Donnai-Barrow syndrome, MIM#222448; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4791 GEMIN4 Chirag Patel reviewed gene: GEMIN4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25558065, 30237576, 27878435; Phenotypes: Neurodevelopmental disorder with microcephaly, cataracts, and renal abnormalities, MIM# 617913; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4790 GFM2 Chirag Patel gene: GFM2 was added
gene: GFM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GFM2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GFM2 were set to PMID: 22700954, 26016410, 29075935
Phenotypes for gene: GFM2 were set to Combined oxidative phosphorylation deficiency 39, OMIM #618397
Review for gene: GFM2 was set to GREEN
Added comment: Combined oxidative phosphorylation deficiency-39 (COXPD39) is an autosomal recessive multisystem disorder resulting from a defect in mitochondrial energy metabolism. Affected individuals show global developmental delay, sometimes with regression after normal early development, axial hypotonia with limb spasticity or abnormal involuntary movements, and impaired intellectual development with poor speech. More variable features may include hypotonia, seizures, and features of Leigh syndrome on brain imaging. There are variable deficiencies of the mitochondrial respiratory chain enzyme complexes in patient tissues.

4 families reported with biallelic variants with functional evidence in 1 family.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4787 CPSF3 Zornitza Stark Phenotypes for gene: CPSF3 were changed from Neurodevelopmental disorder, CPSF3-related, MONDO:0700092 to Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876
Intellectual disability syndromic and non-syndromic v0.4786 CPSF3 Zornitza Stark reviewed gene: CPSF3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4786 MFF Zornitza Stark Phenotypes for gene: MFF were changed from to Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086
Intellectual disability syndromic and non-syndromic v0.4783 MFF Zornitza Stark reviewed gene: MFF: Rating: GREEN; Mode of pathogenicity: None; Publications: 22499341, 26783368, 32181496; Phenotypes: Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4783 OPHN1 Zornitza Stark Phenotypes for gene: OPHN1 were changed from to Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, MIM#300486
Intellectual disability syndromic and non-syndromic v0.4780 OPHN1 Zornitza Stark reviewed gene: OPHN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20528889, 9582072, 12807966, 16221952; Phenotypes: Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, MIM#300486; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4780 GRIA4 Ain Roesley Phenotypes for gene: GRIA4 were changed from Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864 to Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864
Intellectual disability syndromic and non-syndromic v0.4779 GRIA4 Ain Roesley Phenotypes for gene: GRIA4 were changed from to Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864
Intellectual disability syndromic and non-syndromic v0.4778 GRIA4 Ain Roesley reviewed gene: GRIA4: Rating: GREEN; Mode of pathogenicity: None; Publications: 35518358, 29220673; Phenotypes: Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4777 GRID2 Ain Roesley reviewed gene: GRID2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32622959, 32170608; Phenotypes: Spinocerebellar ataxia, autosomal recessive 18 MIM#616204; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4776 ADD1 Chirag Patel gene: ADD1 was added
gene: ADD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADD1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: ADD1 were set to PMID: 34906466
Phenotypes for gene: ADD1 were set to Intellectual disability, corpus callosum dysgenesis, and ventriculomegaly; no OMIM #
Review for gene: ADD1 was set to GREEN
Added comment: 4 unrelated individuals affected by ID and/or complete or partial agenesis of corpus callosum, and enlarged lateral ventricles. WES found loss-of-function variants - 1 recessive missense variant and 3 de novo variants. The recessive variant is associated with ACC and enlarged lateral ventricles, and the de novo variants were associated with complete or partial agenesis of corpus callosum, mild ID and attention deficit. Human variants impair ADD1 protein expression and/or dimerization with ADD2. Add1 knockout mice recapitulate corpus callosum dysgenesis and ventriculomegaly phenotypes. Three adducin genes (ADD1, ADD2, and ADD3) encode cytoskeleton proteins that are critical for osmotic rigidity and cell shape. ADD1, ADD2, and ADD3 form heterodimers (ADD1/ADD2, ADD1/ADD3), which further form heterotetramers. Adducins interconnect spectrin and actin filaments to form polygonal scaffolds beneath the cell membranes and form ring-like structures in neuronal axons. Adducins regulate mouse neural development, but their function in the human brain is unknown.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4775 PROSER1 Chirag Patel gene: PROSER1 was added
gene: PROSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PROSER1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PROSER1 were set to PMID: 35229282
Phenotypes for gene: PROSER1 were set to Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM #
Review for gene: PROSER1 was set to RED
Added comment: 4 children from 3 related families with developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, genitourinary malformations, and common facial features (arched eyebrows, prominent eyes, broad nasal bridge, low-hanging columella, open mouth, thick lower lip, protruding tongue, large low-set ears, and parietal bossing). WES revealed a homozygous frame-shift variant (p.Thr612Glnfs*22) in PROSER1. This encodes the proline and serine rich protein 1, part of the histone methyltransferases KMT2C/KMT2D complexes. PROSER1 stabilizes TET2, a member of the TET family of DNA demethylases which is involved in recruiting the enhancer-associated KMT2C/KMT2D complexes and mediating DNA demethylation, activating gene expression. Therefore, PROSER1 may play vital and potentially general roles in gene regulation. No functional assays and 3 related families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4774 MTOR Zornitza Stark Phenotypes for gene: MTOR were changed from to Smith-Kingsmore syndrome, MIM# 616638; Focal cortical dysplasia, type II, somatic, MIM# 607341; Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283
Intellectual disability syndromic and non-syndromic v0.4772 MTOR Zornitza Stark Mode of pathogenicity for gene: MTOR was changed from to Other
Intellectual disability syndromic and non-syndromic v0.4770 MTOR Zornitza Stark reviewed gene: MTOR: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28892148, 25878179, 26018084; Phenotypes: Smith-Kingsmore syndrome, MIM# 616638, Focal cortical dysplasia, type II, somatic, MIM# 607341, Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4770 WASF1 Zornitza Stark Phenotypes for gene: WASF1 were changed from to Neurodevelopmental disorder with absent language and variable seizures , MIM#618707
Intellectual disability syndromic and non-syndromic v0.4768 WASF1 Zornitza Stark reviewed gene: WASF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29961568, 34845217, 34478686, 34356165; Phenotypes: Neurodevelopmental disorder with absent language and variable seizures , MIM#618707; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4766 FTO Bryony Thompson reviewed gene: FTO: Rating: GREEN; Mode of pathogenicity: None; Publications: 19559399, 26378117, 26697951, 26378117, 26740239; Phenotypes: Growth retardation, developmental delay, facial dysmorphism MIM#612938; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4765 RHEB Zornitza Stark edited their review of gene: RHEB: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, RHEB-related, Intellectual disability, Macrocephaly, Focal cortical dysplasia
Intellectual disability syndromic and non-syndromic v0.4763 RBM28 Zornitza Stark edited their review of gene: RBM28: Added comment: PMID 33941690: second family reported, yeast functional studies.; Changed rating: AMBER; Changed publications: 18439547, 33941690
Intellectual disability syndromic and non-syndromic v0.4763 SLC1A1 Zornitza Stark changed review comment from: ID is part of the phenotype of this metabolic disorder.; to: ID is part of the phenotype of this metabolic disorder. However, only two families reported and rated as LIMITED by ClinGen.
Intellectual disability syndromic and non-syndromic v0.4763 SLC1A1 Zornitza Stark edited their review of gene: SLC1A1: Changed rating: AMBER; Changed publications: 21123949
Intellectual disability syndromic and non-syndromic v0.4762 GTF3C3 Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF3C3-related
Intellectual disability syndromic and non-syndromic v0.4762 DEPDC5 Zornitza Stark Phenotypes for gene: DEPDC5 were changed from to Epilepsy, familial focal, with variable foci 1, MIM#604364
Intellectual disability syndromic and non-syndromic v0.4759 DEPDC5 Zornitza Stark reviewed gene: DEPDC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 31444548, 23542697, 23542701; Phenotypes: Epilepsy, familial focal, with variable foci 1, MIM#604364; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4756 DCHS1 Zornitza Stark reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27262615, 22473091, 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4756 ACTL6B Zornitza Stark Mode of inheritance for gene: ACTL6B was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4755 ACTL6B Zornitza Stark edited their review of gene: ACTL6B: Changed phenotypes: Epileptic encephalopathy, early infantile, 76, MIM# 618468, Intellectual developmental disorder with severe speech and ambulation defects, MIM# 618470; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4754 MAPKAPK5 Zornitza Stark reviewed gene: MAPKAPK5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurocardiofaciodigital syndrome, MIM# 619869; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4751 DCAF17 Zornitza Stark reviewed gene: DCAF17: Rating: GREEN; Mode of pathogenicity: None; Publications: 19026396, 20507343, 35002959, 34877714, 34732557, 34590781; Phenotypes: Woodhouse-Sakati syndrome, MIM# 241080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4748 CYC1 Ain Roesley reviewed gene: CYC1: Rating: RED; Mode of pathogenicity: None; Publications: 23910460, 34252606; Phenotypes: Mitochondrial complex III deficiency, nuclear type 6 MIM#615453; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4744 DNAH14 Zornitza Stark Gene: dnah14 has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.4744 PRDM13 Zornitza Stark Phenotypes for gene: PRDM13 were changed from intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia, MONDO:0016054, PRDM13-associated; congenital hypogonadotropic hypogonadism, MONDO:0015770 to intellectual disability, MONDO:0001071, PRDM13-associated; Pontocerebellar hypoplasia (MONDO:0020135), PRDM13 related; congenital hypogonadotropic hypogonadism, MONDO:0015770
Intellectual disability syndromic and non-syndromic v0.4741 CTR9 Dean Phelan gene: CTR9 was added
gene: CTR9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CTR9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CTR9 were set to PMID: 35499524
Phenotypes for gene: CTR9 were set to Neurodevelopmental disorder (MONDO:0700092), CTR9-related; Intellectual disability (MONDO:0001071); hypotonia (HP:0001252); joint hyperlaxity (HP:0001388); speech delay; coordination problems; tremor (HP:0001337); autism spectrum disorder (MONDO:0005258)
Review for gene: CTR9 was set to GREEN
Added comment: PMID: 35499524 - Thirteen individuals with variables degrees of intellectual disability, hypotonia, joint hyperlaxity, speech delay, coordination problems, tremor, autism spectrum disorder. Mild dysmorphism and cardiac anomalies were less frequent. Eleven of the variants were shown to be de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4741 PRDM13 Dean Phelan reviewed gene: PRDM13: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35390279; Phenotypes: Pontocerebellar hypoplasia (MONDO:0020135), PRDM13 related, Intellectual disability (MONDO:0001071); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4741 DNAH14 Chern Lim gene: DNAH14 was added
gene: DNAH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DNAH14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAH14 were set to PMID: 35438214
Phenotypes for gene: DNAH14 were set to Neurodevelopmental disorder, DNAH14-related (MONDO#0700092)
Review for gene: DNAH14 was set to GREEN
gene: DNAH14 was marked as current diagnostic
Added comment: PMID: 35438214:
- Three previously unreported patients with compound heterozygous DNAH14 variants, including one nonsense, one frameshift, and four missense variants. A spectrum of neurological and developmental phenotypes was observed, including seizures, global developmental delay, microcephaly, and hypotonia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4740 DROSHA Lucy Spencer gene: DROSHA was added
gene: DROSHA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DROSHA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DROSHA were set to 35405010
Phenotypes for gene: DROSHA were set to Neurodevelopmental disorder (MONDO#0700092), DROSHA-related
Review for gene: DROSHA was set to AMBER
Added comment: 2 individuals with profound intellectual disability, epilepsy, white matter atrophy, microcephaly, and dysmorphic features, who carry damaging de novo heterozygous variants in DROSHA. Both variants are missense, absent from gnomad. Both individuals noted to have Rett-like features.

Functional studies in patient fibroblasts showed one of the missense altered the expression of mature miRNA. Fruit fly models with homozygous LOF variants die during larval stages. introduction of the missense seen in the patients was able to partially rescue this phenotype suggesting LOF is not the mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4739 DTYMK Zornitza Stark Phenotypes for gene: DTYMK were changed from Intellectual disability; microcephaly to Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847)
Intellectual disability syndromic and non-syndromic v0.4736 KCNH5 Elena Savva gene: KCNH5 was added
gene: KCNH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNH5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KCNH5 were set to https://www.medrxiv.org/content/10.1101/2022.04.26.22274147v1
Phenotypes for gene: KCNH5 were set to Neurodevelopmental disorder MONDO#0700092, KCNH5-related
Mode of pathogenicity for gene: KCNH5 was set to Other
Review for gene: KCNH5 was set to GREEN
Added comment: Happ (2022), preprint: Screen of 893 patients with DEE found 17 patients with missense variants (16/17 de novo, 1/17 inherited). GOF mechanism suggested.
Patient phenotypes included focal/generalized seizures, Cognitive outcome for the ten individuals >5 years ranged from normal (3/10) to mild (3/10), moderate (2/10), severe (1/10) and profound (1/10) intellectual disability (ID)

p.Arg327His (7 probands), p.Arg333His (4 probands) were recurring
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4733 STX1A Ain Roesley gene: STX1A was added
gene: STX1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: STX1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: STX1A were set to neurodevelopmental disorder MONDO#0700092, STX1A-related
Review for gene: STX1A was set to GREEN
gene: STX1A was marked as current diagnostic
Added comment: Preprint: https://www.medrxiv.org/content/10.1101/2022.04.20.22274073v1
8 individuals - 2x hom (related) and 6x hets (all de novo except 1x unknown)

7 unrelated since the 2 siblings share similar features:
7/7 ID, 7/7 motor delay, 4/7 epilepsy, 5/7 neonatal hypotonia 2/7 regression, 2/7 ASD excluding 1 with features but did not meet criteria
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4732 PPFIBP1 Zornitza Stark gene: PPFIBP1 was added
gene: PPFIBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: PPFIBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPFIBP1 were set to https://www.medrxiv.org/content/10.1101/2022.04.04.22273309v1
Phenotypes for gene: PPFIBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related
Review for gene: PPFIBP1 was set to GREEN
Added comment: 16 individuals from 10 unrelated families reported with moderate to profound developmental delay, often refractory early-onset epilepsy and progressive microcephaly. Drosophila model.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4731 DTYMK Daniel Flanagan reviewed gene: DTYMK: Rating: GREEN; Mode of pathogenicity: None; Publications: 34918187; Phenotypes: Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4731 CPS1 Ain Roesley Phenotypes for gene: CPS1 were changed from Carbamoylphosphate synthetase I deficiency MIM#237300 to Carbamoylphosphate synthetase I deficiency MIM#237300
Intellectual disability syndromic and non-syndromic v0.4730 CPS1 Ain Roesley Phenotypes for gene: CPS1 were changed from to Carbamoylphosphate synthetase I deficiency MIM#237300
Intellectual disability syndromic and non-syndromic v0.4729 CPS1 Ain Roesley reviewed gene: CPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8486760, 17310273, 21120950, 31268178; Phenotypes: Carbamoylphosphate synthetase I deficiency MIM#237300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4729 GNAI1 Zornitza Stark Phenotypes for gene: GNAI1 were changed from Intellectual disability; seizures; hypotonia to Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854
Intellectual disability syndromic and non-syndromic v0.4728 GNAI1 Zornitza Stark edited their review of gene: GNAI1: Changed phenotypes: Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854
Intellectual disability syndromic and non-syndromic v0.4728 MCCC2 Zornitza Stark Phenotypes for gene: MCCC2 were changed from to 3-Methylcrotonyl-CoA carboxylase 2 deficiency (MIM#210210)
Intellectual disability syndromic and non-syndromic v0.4724 MCCC2 Zornitza Stark reviewed gene: MCCC2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-Methylcrotonyl-CoA carboxylase 2 deficiency (MIM#210210); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4724 SIK1 Zornitza Stark Phenotypes for gene: SIK1 were changed from to Developmental and epileptic encephalopathy 30, MIM#616341; developmental and epileptic encephalopathy, MONDO#0100062
Intellectual disability syndromic and non-syndromic v0.4721 SIK1 Zornitza Stark reviewed gene: SIK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25839329, 27966542, 35267137; Phenotypes: Developmental and epileptic encephalopathy 30, MIM#616341, developmental and epileptic encephalopathy, MONDO#0100062; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4720 CHD8 Zornitza Stark edited their review of gene: CHD8: Changed phenotypes: {Autism, susceptibility to, 18} 615032, Neurodevelopmental disorder, MONDO:0700092, CHD8-associated
Intellectual disability syndromic and non-syndromic v0.4717 HERC1 Zornitza Stark reviewed gene: HERC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28323226, 27108999, 26153217, 26138117, 20041218; Phenotypes: Macrocephaly, dysmorphic facies, and psychomotor retardation, MIM# 617011; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4713 LINS1 Alison Yeung reviewed gene: LINS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32802957, 34450347, 32499722, 31922598; Phenotypes: ntellectual developmental disorder, autosomal recessive 27, MIM# 614340; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4713 HCN1 Zornitza Stark Phenotypes for gene: HCN1 were changed from to Developmental and epileptic encephalopathy 24, MIM# 615871; Generalized epilepsy with febrile seizures plus, type 10, MIM# 618482
Intellectual disability syndromic and non-syndromic v0.4710 HCN1 Zornitza Stark reviewed gene: HCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24747641, 30351409, 30351409; Phenotypes: Developmental and epileptic encephalopathy 24, MIM# 615871, Generalized epilepsy with febrile seizures plus, type 10, MIM# 618482; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4710 MCCC2 Teresa Zhao reviewed gene: MCCC2: Rating: AMBER; Mode of pathogenicity: None; Publications: 34899149; Phenotypes: 3-Methylcrotonyl-CoA carboxylase 2 deficiency (MIM#210210); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4707 AP1S2 Zornitza Stark reviewed gene: AP1S2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17186471, 17617514, 19377476, 30714330, 23756445; Phenotypes: Pettigrew syndrome, MIM# 304340; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4706 ENTPD1 Zornitza Stark gene: ENTPD1 was added
gene: ENTPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ENTPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ENTPD1 were set to 35471564
Phenotypes for gene: ENTPD1 were set to Spastic paraplegia 64, autosomal recessive, MIM# 615683
Review for gene: ENTPD1 was set to GREEN
Added comment: 27 individuals from 17 families published, expanding the phenotype to a complex neurodevelopmental disorder characterised by ID, white matter abnormalities and spastic paraplegia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4705 NRCAM Zornitza Stark Phenotypes for gene: NRCAM were changed from Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833 to Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833
Intellectual disability syndromic and non-syndromic v0.4705 NRCAM Zornitza Stark Phenotypes for gene: NRCAM were changed from neurodevelopmental disorder, MONDO:0700092 to Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833
Intellectual disability syndromic and non-syndromic v0.4704 NRCAM Zornitza Stark reviewed gene: NRCAM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4703 CDC42BPB Zornitza Stark reviewed gene: CDC42BPB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Chilton-Okur-Chung neurodevelopmental syndrome, MIM# 619841; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4703 CNNM2 Ain Roesley Mode of inheritance for gene: CNNM2 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4702 CNNM2 Ain Roesley reviewed gene: CNNM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34604137, 35170241; Phenotypes: Hypomagnesemia 6, renal MIM#613882, Hypomagnesemia, seizures, and mental retardation MIM#616418; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4701 PIGC Zornitza Stark edited their review of gene: PIGC: Added comment: Third family reported, pair of siblings, DD/seizures.; Changed publications: 27694521, 32707268
Intellectual disability syndromic and non-syndromic v0.4701 PIGW Zornitza Stark Phenotypes for gene: PIGW were changed from to Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025
Intellectual disability syndromic and non-syndromic v0.4698 PIGW Zornitza Stark reviewed gene: PIGW: Rating: GREEN; Mode of pathogenicity: None; Publications: 24367057, 27626616, 30813920, 32198969; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4695 CIT Zornitza Stark reviewed gene: CIT: Rating: GREEN; Mode of pathogenicity: None; Publications: 27453578, 27503289, 27453579; Phenotypes: Microcephaly 17, primary, autosomal recessive (MIM#617090); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4694 CIC Ain Roesley reviewed gene: CIC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28288114, 21076407; Phenotypes: Intellectual developmental disorder, autosomal dominant 45 MIM#617600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4694 PDE4D Zornitza Stark Phenotypes for gene: PDE4D were changed from to Acrodysostosis 2, with or without hormone resistance, MIM# 614613
Intellectual disability syndromic and non-syndromic v0.4691 PDE4D Zornitza Stark reviewed gene: PDE4D: Rating: GREEN; Mode of pathogenicity: None; Publications: 22464250, 22464252, 23033274, 24203977; Phenotypes: Acrodysostosis 2, with or without hormone resistance, MIM# 614613; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4690 ATP11A Zornitza Stark reviewed gene: ATP11A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 24 , MIM# 619851; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4690 PIDD1 Zornitza Stark Phenotypes for gene: PIDD1 were changed from Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum to Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827
Intellectual disability syndromic and non-syndromic v0.4689 PIDD1 Zornitza Stark reviewed gene: PIDD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4689 CLPB Zornitza Stark Phenotypes for gene: CLPB were changed from 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271 to 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271; 3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835
Intellectual disability syndromic and non-syndromic v0.4688 CLPB Zornitza Stark edited their review of gene: CLPB: Changed phenotypes: 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271, 3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835
Intellectual disability syndromic and non-syndromic v0.4687 GLRA2 Zornitza Stark gene: GLRA2 was added
gene: GLRA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GLRA2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: GLRA2 were set to 26370147; 20479760; 35294868
Phenotypes for gene: GLRA2 were set to Intellectual developmental disorder, X-linked, syndromic, Pilorge type, MIM# 301076
Review for gene: GLRA2 was set to GREEN
Added comment: More than 10 unrelated families reported. Both males and females affected, though some mothers are asymptomatic or mild. Zebrafish model.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4684 FASTKD2 Bryony Thompson reviewed gene: FASTKD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 18771761, 28499982, 31944455, 34234304; Phenotypes: FASTKD2-related infantile mitochondrial encephalomyopathy MONDO:0015632; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4684 PDE4D Krithika Murali reviewed gene: PDE4D: Rating: GREEN; Mode of pathogenicity: None; Publications: 24203977, 22464250; Phenotypes: Acrodysostosis 2, with or without hormone resistance - MIM#614613; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4680 PPP1R15B Zornitza Stark reviewed gene: PPP1R15B: Rating: AMBER; Mode of pathogenicity: None; Publications: 26159176, 26307080, 27640355; Phenotypes: Microcephaly, short stature, and impaired glucose metabolism 2, MIM# 616817; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4677 PRMT7 Zornitza Stark reviewed gene: PRMT7: Rating: GREEN; Mode of pathogenicity: None; Publications: 26437029, 27718516, 30513135; Phenotypes: Short stature, brachydactyly, intellectual developmental disability, and seizures, MIM# 617157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4673 PRSS12 Zornitza Stark reviewed gene: PRSS12: Rating: AMBER; Mode of pathogenicity: None; Publications: 12459588; Phenotypes: Intellectual disability, PRSS12 related MIM#249500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4670 PSMD12 Zornitza Stark reviewed gene: PSMD12: Rating: GREEN; Mode of pathogenicity: None; Publications: 28132691, 34906456; Phenotypes: Stankiewicz-Isidor syndrome, MIM# 617516; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4667 PYCR2 Zornitza Stark reviewed gene: PYCR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25865492, 27130255; Phenotypes: Leukodystrophy, hypomyelinating, 10, MIM# 616420; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4664 SET Zornitza Stark reviewed gene: SET: Rating: GREEN; Mode of pathogenicity: None; Publications: 29688601, 29907757, 25356899; Phenotypes: Intellectual developmental disorder, autosomal dominant 58, MIM#618106, intellectual disability, autosomal dominant 58, MONDO:0020847; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4664 PIGA Zornitza Stark Phenotypes for gene: PIGA were changed from Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM#300868 to Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466; Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072
Intellectual disability syndromic and non-syndromic v0.4662 PIGA Zornitza Stark edited their review of gene: PIGA: Added comment: PMID 34875027: variants in PIGA causing a neurodevelopment disorder and a juvenile form of hereditary hemochromatosis reported in > three unrelated patients. All patients had increased serum iron, ferritin and transferrin saturation levels, high ALP and low hepcidin. All patients had generalised seizures and intellectual disability. A subpopulation of patient blood cells showed a slight reduction of GPI-anchored proteins, suggesting that the mutations were hypomorphic and retained some residual activity. CRISPR/Cas12a-mediated knockdown of PIGA in Hep3B liver cells eliminated the cell surface expression of GPI-anchored proteins CD59 and hemojuvelin (HJV; 608374), as well as caused decreased expression of hepcidin (606464) compared to controls. These hypomorphic alleles could explain the milder neurologic phenotype, which allowed for sufficiently long survival for the iron overload phenotype to manifest.; Changed publications: 22305531, 24357517, 24706016, 26545172, 33333793, 32694024, 34875027; Changed phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466, Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072
Intellectual disability syndromic and non-syndromic v0.4661 CACNA2D1 Alison Yeung Phenotypes for gene: CACNA2D1 were changed from developmental and epileptic encephalopathy disorder MONDO:0100062 CACNA2D1-related to Developmental and epileptic encephalopathy disorder MONDO:0100062 CACNA2D1-related
Intellectual disability syndromic and non-syndromic v0.4658 CACNA2D1 Michelle Torres gene: CACNA2D1 was added
gene: CACNA2D1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNA2D1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CACNA2D1 were set to 35293990
Phenotypes for gene: CACNA2D1 were set to developmental and epileptic encephalopathy disorder MONDO:0100062 CACNA2D1-related
Review for gene: CACNA2D1 was set to GREEN
Added comment: PMID 35293990: WES of 2x unrelated individuals with early-onset developmental epileptic encephalopathy, microcephaly, severe hypotonia, absent speech, spasticity, choreiform movements, orofacial dyskinesia, and 2 cortical visual impairment, corpus callosum hypoplasia and progressive volume loss. Patient 2 also had a tiny patent foramen ovale.

Patient 1 is homozygous for p.(Ser275Asnfs*13). mRNA and protein expression were reduced to ~10% of WT in fibroblasts

Patient 2 is cHet for p.(Leu9Alafs*5) and p.(Gly209Asp). mRNA expression in patients fibroblasts was similar to controls, and protein expression reduced to 31-38%. Functional of the p.(Gly209Asp) showed impaired localization and mutagenesis showed complete loss of channel function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4658 ATP2B1 Daniel Flanagan changed review comment from: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense.
Sources: Expert list; to: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), dissimilar forms of seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4658 TRAPPC10 Naomi Baker gene: TRAPPC10 was added
gene: TRAPPC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRAPPC10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC10 were set to PMID: 35298461; 30167849
Phenotypes for gene: TRAPPC10 were set to neurodevelopmental disorder (MONDO:0700092), TRAPPC10-related
Review for gene: TRAPPC10 was set to GREEN
Added comment: PMID: 35298461 – two Pakistani families reported with homozygous variants. Family 1 has frameshift variant in 8 affected individual and family 2 has missense variant in 2 affected individuals. Patients present with microcephaly, short stature, hypotonia, severe ID and behavioural abnormalities. Seizures also reported in 4/10 individuals. Paper also reported brain abnormalities in null mouse model and other functional in transfected cell lines.

PMID: 30167849 – initial report of family 2 above.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4658 ATP2B1 Daniel Flanagan gene: ATP2B1 was added
gene: ATP2B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ATP2B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP2B1 were set to PMID: 35358416
Phenotypes for gene: ATP2B1 were set to Neurodevelopmental disorder, MONDO:0700092, ATP2B1-related
Review for gene: ATP2B1 was set to GREEN
Added comment: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4658 ADAM22 Alison Yeung Phenotypes for gene: ADAM22 were changed from Epileptic encephalopathy, early infantile, 61, MIM# 617933 to Developmental and epileptic encephalopathy 61 (MIM#617933)
Intellectual disability syndromic and non-syndromic v0.4656 ADAM22 Lucy Spencer reviewed gene: ADAM22: Rating: GREEN; Mode of pathogenicity: None; Publications: 35373813; Phenotypes: Developmental and epileptic encephalopathy 61 (MIM#617933); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4656 AHSG Elena Savva gene: AHSG was added
gene: AHSG was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AHSG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AHSG were set to PMID: 28054173; 9395485; 31288248; 17389622
Phenotypes for gene: AHSG were set to ?Alopecia-intellectual disability syndrome 1 MIM#203650; infantile cortical hyperostosis
Review for gene: AHSG was set to RED
Added comment: PMID: 28054173 - 7 relatives within a large consanguinous fam w/ alopecia and ID, and a hom missense (p.Arg317His). Modelling predicts this variant to be a phosphorylation site, functional studies show a difference in protein size. Unclear biological significance.
Alt change with stronger GS (p.(Arg317Cys)) is a common poly with 19 homozygotes in gnomAD.

No hom PTCs in gnomAD

PMID: 9395485 - K/O mouse model shows no gross anatomical abnormalities, were fertile and "healthy". No mentioned of ID, alopecia
PMID: 17389622 - K/O mouse model on the calcification resistant genetic background C57BL/6, shows uraemia and phosphate challenge. No mentioned of ID, alopecia

PMID: 31288248 - 1 hom infant (p.K2*, within 5' NMD escape region) with infantile cortical hyperostosis, loss of enzyme in patient serum shown by ELISA. No mentioned of ID, alopecia
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4654 VPS16 Ain Roesley gene: VPS16 was added
gene: VPS16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS16 were set to 33938619; 34013567; 34901436
Phenotypes for gene: VPS16 were set to mucopolysaccharidosis-like disorder, VPS16-related MONDO#0100365
Review for gene: VPS16 was set to GREEN
gene: VPS16 was marked as current diagnostic
Added comment: for AR MPS - developmental delay reported
3 unrelated families - 2x hom c.2272‐18C>A and 1x hom p.Trp180Cys

RNA and functional studies done on the splice variant

also associated with AD dystonia
PMID:34901436 suggests dystonia is transcript specific
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4653 SPATA5 Zornitza Stark Phenotypes for gene: SPATA5 were changed from Epilepsy, hearing loss, and mental retardation syndrome MIM#616577 to Neurodevelopmental disorder with hearing loss, seizures, and brain abnormalities MIM#616577
Intellectual disability syndromic and non-syndromic v0.4652 SPATA5 Zornitza Stark edited their review of gene: SPATA5: Changed phenotypes: Neurodevelopmental disorder with hearing loss, seizures, and brain abnormalities 616577
Intellectual disability syndromic and non-syndromic v0.4647 TSPAN7 Zornitza Stark reviewed gene: TSPAN7: Rating: AMBER; Mode of pathogenicity: None; Publications: 10449641, 12070254, 10655063, 25081361; Phenotypes: Intellectual developmental disorder, X-linked 58, MIM #300210, MONDO:0010266; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4643 SLC6A17 Zornitza Stark reviewed gene: SLC6A17: Rating: AMBER; Mode of pathogenicity: None; Publications: 25704603, 23672601; Phenotypes: Mental retardation, autosomal recessive 48, MIM# 616269; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4639 WDR11 Elena Savva Mode of inheritance for gene: WDR11 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4638 WDR11 Elena Savva reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, WDR11-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4635 RAB3GAP2 Teresa Zhao reviewed gene: RAB3GAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23420520, 32376645; Phenotypes: Martsolf syndrome (MIM212720), Warburg micro syndrome 2 (MIM#614225); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4631 NTRK1 Zornitza Stark Phenotypes for gene: NTRK1 were changed from to Insensitivity to pain, congenital, with anhidrosis - MIM#256800
Intellectual disability syndromic and non-syndromic v0.4624 NSUN2 Zornitza Stark reviewed gene: NSUN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 35126837; Phenotypes: Mental retardation, autosomal recessive 5 - MIM#611091; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4621 NUBPL Krithika Murali reviewed gene: NUBPL: Rating: GREEN; Mode of pathogenicity: None; Publications: 20818383, 32518176, 23553477, 31917109, 32518176, 31787496, 30897263, 22826544; Phenotypes: Mitochondrial complex I deficiency, nuclear type 21 - MIM#618242; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4621 NTRK1 Krithika Murali reviewed gene: NTRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10233776, 19250380, 10861667, 10982191, 20301726, 20089052; Phenotypes: Insensitivity to pain, congenital, with anhidrosis - MIM#256800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4621 NSUN2 Krithika Murali reviewed gene: NSUN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22541559, 22541562, 21063731, 22577224; Phenotypes: Mental retardation, autosomal recessive 5 - MIM#611091; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4621 NRXN1 Krithika Murali reviewed gene: NRXN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25486015, 19896112, 21964664, 30873608, 35101781, 22337556, 22670139; Phenotypes: Pitt-Hopkins-like syndrome 2 - MIM#614325; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4618 SMARCE1 Zornitza Stark reviewed gene: SMARCE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23906836, 23929686, 32732226, 32436246, 32410215, 34205270; Phenotypes: Coffin-Siris syndrome 5, MIM# 616938; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4615 SNX14 Zornitza Stark reviewed gene: SNX14: Rating: GREEN; Mode of pathogenicity: None; Publications: 25439728, 25848753, 27913285; Phenotypes: Spinocerebellar ataxia, autosomal recessive 20 (MIM#616354); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4612 SMS Zornitza Stark reviewed gene: SMS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30237987, 34177437, 32838743, 23805436; Phenotypes: Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583, Syndromic X-linked intellectual disability Snyder type, MONDO:0010664; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4612 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 to Developmental and epileptic encephalopathy 101 , MIM#619814; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Intellectual disability syndromic and non-syndromic v0.4610 GRIN1 Zornitza Stark edited their review of gene: GRIN1: Changed publications: 29365063, 27164704, 27164704, 28051072, 34611970; Changed phenotypes: Developmental and epileptic encephalopathy 101 , MIM#619814, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Intellectual disability syndromic and non-syndromic v0.4607 TBL1XR1 Zornitza Stark reviewed gene: TBL1XR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26769062, 30365874, 25425123, 9450851, 23160955, 28687524, 23176139, 16007632; Phenotypes: Mental retardation, autosomal dominant 41, MIM# 616944, Pierpont syndrome, MIM# 602342; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4607 TBCK Zornitza Stark Phenotypes for gene: TBCK were changed from to Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900
Intellectual disability syndromic and non-syndromic v0.4604 TBCK Zornitza Stark reviewed gene: TBCK: Rating: GREEN; Mode of pathogenicity: None; Publications: 27040692, 30103036, 27040691; Phenotypes: Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4601 TBC1D23 Zornitza Stark reviewed gene: TBC1D23: Rating: GREEN; Mode of pathogenicity: None; Publications: 28823707, 28823706; Phenotypes: Pontocerebellar hypoplasia, type 11, MIM# 617695; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4595 NONO Krithika Murali reviewed gene: NONO: Rating: GREEN; Mode of pathogenicity: None; Publications: 26571461, 27329731, 27550220; Phenotypes: Intellectual developmental disorder, X-linked syndromic 34 - MIM#300967; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4592 STAG1 Zornitza Stark reviewed gene: STAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28119487, 34440290; Phenotypes: Mental retardation, autosomal dominant 47, MIM# 617635; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4587 NHS Zornitza Stark Mode of inheritance for gene: NHS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4586 NFIA Zornitza Stark Phenotypes for gene: NFIA were changed from to Brain malformations with or without urinary tract defects - MIM#613735
Intellectual disability syndromic and non-syndromic v0.4583 STX1B Zornitza Stark Phenotypes for gene: STX1B were changed from to Generalized epilepsy with febrile seizures plus, type 9, MIM# 616172
Intellectual disability syndromic and non-syndromic v0.4580 STX1B Zornitza Stark reviewed gene: STX1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 25362483, 33677401; Phenotypes: Generalized epilepsy with febrile seizures plus, type 9, MIM# 616172; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4580 NLGN3 Krithika Murali reviewed gene: NLGN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28584888, 12669065, 25167861; Phenotypes: {Asperger syndrome susceptibility, X-linked 1} - MIM#300494, {Autism susceptibility, X-linked 1} - MIM#300425; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4580 KCND3 Elena Savva reviewed gene: KCND3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35021282, 32823520, 34067185, 34361012; Phenotypes: Spinocerebellar ataxia 19 MIM#607346; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4580 NHS Krithika Murali reviewed gene: NHS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31755796, 25266737; Phenotypes: Nance-Horan syndrome - MIM#302350, Cataract 40, X-linked - MIM#302200; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4580 NFIA Krithika Murali reviewed gene: NFIA: Rating: GREEN; Mode of pathogenicity: None; Publications: 35018717, 33973697, 32926563; Phenotypes: Brain malformations with or without urinary tract defects - MIM#613735; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4580 NDUFV2 Zornitza Stark changed review comment from: Multiple unrelated families. Common presenting features include HOCM and encephalopathy, unclear in what proportion ID is likely to be the presenting or main feature.; to: Multiple unrelated families. Common presenting features include HOCM and encephalopathy, or episodic regression with cavitating leukoencephalopathy, unclear in what proportion ID is likely to be the presenting or main feature.
Intellectual disability syndromic and non-syndromic v0.4580 NDUFV2 Zornitza Stark edited their review of gene: NDUFV2: Changed publications: 12754703, 26008862, 29554876, 33811136
Intellectual disability syndromic and non-syndromic v0.4580 SYNJ1 Zornitza Stark Phenotypes for gene: SYNJ1 were changed from to Developmental and epileptic encephalopathy 53, MIM# 617389
Intellectual disability syndromic and non-syndromic v0.4577 SYNJ1 Zornitza Stark reviewed gene: SYNJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32435303, 27435091; Phenotypes: Developmental and epileptic encephalopathy 53, MIM# 617389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4575 SZT2 Zornitza Stark reviewed gene: SZT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23932106, 30560016, 30359774, 28556953, 32402703; Phenotypes: Developmental and epileptic encephalopathy 18, OMIM #615476; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4572 NDST1 Krithika Murali reviewed gene: NDST1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25125150, 21937992, 32878022, 28211985; Phenotypes: Mental retardation, autosomal recessive 46 - MIM#616116; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4571 ITCH Zornitza Stark edited their review of gene: ITCH: Added comment: Unrelated individual reported in PMID 31091003 had normal intellect.; Changed publications: 20170897, 31091003
Intellectual disability syndromic and non-syndromic v0.4571 ITPA Zornitza Stark Phenotypes for gene: ITPA were changed from to Developmental and epileptic encephalopathy 35, MIM# 616647
Intellectual disability syndromic and non-syndromic v0.4568 ITPA Zornitza Stark reviewed gene: ITPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 26224535, 19498443, 35234647, 35098521; Phenotypes: Developmental and epileptic encephalopathy 35, MIM# 616647; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4567 C12orf57 Ain Roesley reviewed gene: C12orf57: Rating: GREEN; Mode of pathogenicity: None; Publications: 29383837, 31853307; Phenotypes: Temtamy syndrome MIM#218340; Mode of inheritance: None; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4565 C12orf4 Ain Roesley Mode of pathogenicity for gene: C12orf4 was changed from to None
Intellectual disability syndromic and non-syndromic v0.4563 C12orf4 Ain Roesley reviewed gene: C12orf4: Rating: GREEN; Mode of pathogenicity: None; Publications: 34967075, 31334606, 27311568, 25558065, 28097321; Phenotypes: Intellectual developmental disorder, autosomal recessive 66 MIM#618221; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4561 KCND3 Zornitza Stark changed review comment from: Progressive neurological condition; ID only reported in some, most however reported as having normal cognition.; to: Progressive neurological condition; ID only reported in some. Recent review of all published patients, PMID 32823520 defined a group with early onset of disease, where DD/ID are the predominant presenting symptoms, with ataxia developing later.
Intellectual disability syndromic and non-syndromic v0.4561 KCND3 Zornitza Stark edited their review of gene: KCND3: Changed rating: GREEN; Changed publications: 32823520
Intellectual disability syndromic and non-syndromic v0.4558 KCNJ10 Zornitza Stark reviewed gene: KCNJ10: Rating: GREEN; Mode of pathogenicity: None; Publications: 19289823, 19420365, 21849804, 11466414; Phenotypes: SESAME syndrome, MIM# 612780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4557 KCNK3 Zornitza Stark gene: KCNK3 was added
gene: KCNK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: KCNK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNK3 were set to 33057194
Phenotypes for gene: KCNK3 were set to Neurodevelopmental disorder, MONDO:0700092, KCNK3-related
Review for gene: KCNK3 was set to AMBER
Added comment: Established pulmonary hypertension gene.

PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 8 de novo variants (7 missense, 1 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided).
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4554 NAT8L Zornitza Stark reviewed gene: NAT8L: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: N-acetylaspartate deficiency - MIM#614063; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4550 ARHGAP35 Ain Roesley reviewed gene: ARHGAP35: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder, ARHGAP35-related MONDO#0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4547 KIAA1109 Zornitza Stark reviewed gene: KIAA1109: Rating: GREEN; Mode of pathogenicity: None; Publications: 29290337, 30906834; Phenotypes: Alkuraya-Kucinskas syndrome, MIM# 617822; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4547 FBXO28 Zornitza Stark Phenotypes for gene: FBXO28 were changed from Developmental and epileptic encephalopathy to Developmental and epileptic encephalopathy 100, MIM# 619777
Intellectual disability syndromic and non-syndromic v0.4546 FBXO28 Zornitza Stark edited their review of gene: FBXO28: Changed phenotypes: Developmental and epileptic encephalopathy 100, MIM# 619777
Intellectual disability syndromic and non-syndromic v0.4546 NAT8L Krithika Murali gene: NAT8L was added
gene: NAT8L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAT8L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAT8L were set to 11310630; 19807691; 32275776
Phenotypes for gene: NAT8L were set to ?N-acetylaspartate deficiency - MIM#614063
Review for gene: NAT8L was set to AMBER
Added comment: Absence of brain N-acetylaspartate, has been described in only one patient, with truncal ataxia, marked developmental delay, seizures and secondary microcephaly (first described by - PMID: 11310630 Martin et al 2001). PMID: 19807691 - Wiame et al 2009 identified in this patient a homozygous 19 bp NAT8L gene deletion, resulting in a change in reading frame and the absence of production of a functional protein. The affected individual is adopted and testing of the biological parents was not possible. The authors provide supportive functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4543 NACC1 Zornitza Stark Phenotypes for gene: NACC1 were changed from to Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination - MIM#617393
Intellectual disability syndromic and non-syndromic v0.4540 NACC1 Zornitza Stark reviewed gene: NACC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28132692; Phenotypes: Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination - MIM#617393; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4540 NAA15 Zornitza Stark Phenotypes for gene: NAA15 were changed from to Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787
Intellectual disability syndromic and non-syndromic v0.4537 NAA15 Zornitza Stark reviewed gene: NAA15: Rating: GREEN; Mode of pathogenicity: None; Publications: 33103328, 29656860, 31127942, 28191889, 33557580, 28990276; Phenotypes: Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4537 NANS Krithika Murali reviewed gene: NANS: Rating: GREEN; Mode of pathogenicity: None; Publications: 8152878, 15726110, 8723082, 27213289, 7551156; Phenotypes: Spondyloepimetaphyseal dysplasia, Camera-Genevieve type - MIM#610442; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4535 IRX5 Zornitza Stark edited their review of gene: IRX5: Added comment: Third family with Hamamy syndrome and homozygous missense variant reported, p.Arg168His. Two cousins, >4 meioses, good segregation data. Intellectual disability.; Changed rating: GREEN; Changed publications: 22581230, 27453922, 34899143
Intellectual disability syndromic and non-syndromic v0.4533 MAN2C1 Zornitza Stark reviewed gene: MAN2C1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of deglycosylation 2, MIM# 619775; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4533 NFE2L1 Zornitza Stark gene: NFE2L1 was added
gene: NFE2L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NFE2L1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NFE2L1 were set to 35112409
Phenotypes for gene: NFE2L1 were set to Syndromic disease, MONDO:0002254
Review for gene: NFE2L1 was set to RED
Added comment: A single patient with developmental delay, hypotonia, hypospadias, bifid scrotum, and failure to thrive, with a heterozygous nonsense variant in the last exon. In vitro functional assays suggest a dominant-negative effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4529 QDPR Zornitza Stark reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 11153907; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4528 CRLS1 Zornitza Stark reviewed gene: CRLS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4526 HIST1H4E Alison Yeung Gene: hist1h4e has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.4524 HIST1H4D Paul De Fazio changed review comment from: Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD).
A zebrafish model has developmental defects.
Sources: Literature; to: HGNC recognised gene name: H4C4
Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD).
A zebrafish model has developmental defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4521 HIST1H4C Zornitza Stark Phenotypes for gene: HIST1H4C were changed from Growth delay, microcephaly and intellectual disability to Tessadori-van Haaften neurodevelopmental syndrome 1 MIM#619758
Intellectual disability syndromic and non-syndromic v0.4520 CPSF3 Belinda Chong gene: CPSF3 was added
gene: CPSF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CPSF3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CPSF3 were set to 35121750
Phenotypes for gene: CPSF3 were set to Intellectual disability syndrome
Review for gene: CPSF3 was set to GREEN
gene: CPSF3 was marked as current diagnostic
Added comment: Study of a deficit of observed homozygous carriers of missense variants, versus an expected number in a set of 153,054 chip-genotyped Icelanders, to identify potentially pathogenic genotypes

Six homozygous carriers of missense variants in CPSF3 show severe intellectual disability, seizures, microcephaly, and abnormal muscle tone.

- Four identified through Icelandic geneology (p.Gly468Glu), three carrier couples total of four children who had died prematurely. Tested archival samples for two of these children, and confirm a homozygous genotype.
- Two of Mexican descent (p.Ile354Thr), first-degree cousins
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 HIST1H4E Paul De Fazio changed review comment from: 17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD).
A zebrafish model has developmental defects.
Sources: Literature; to: HGNC recognised gene: H4C5
17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD).
A zebrafish model has developmental defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 HIST1H4C Paul De Fazio changed review comment from: 6 additional individuals with ID and dev delay. All variants were de novo. Lys92 (Lys91 in H4 nomenclature) and Pro33 (Pro32) were the only variants identified. Additional phenotypes in some but not all patients included hypotonia, facial dysmorphisms, conductive hearing loss. Most had reduced birth length, OFC, weight (-1 to -2.5SD).
A zebrafish model has developmental defects.; to: HGNC recognised gene name: H4C3
6 additional individuals with ID and dev delay. All variants were de novo. Lys92 (Lys91 in H4 nomenclature) and Pro33 (Pro32) were the only variants identified. Additional phenotypes in some but not all patients included hypotonia, facial dysmorphisms, conductive hearing loss. Most had reduced birth length, OFC, weight (-1 to -2.5SD).
A zebrafish model has developmental defects.
Intellectual disability syndromic and non-syndromic v0.4519 HIST1H4E Paul De Fazio gene: HIST1H4E was added
gene: HIST1H4E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4E was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4E were set to 35202563
Phenotypes for gene: HIST1H4E were set to Neurodevelopmental disorder, HIST1H4E-related MONDO:0700092
Review for gene: HIST1H4E was set to GREEN
gene: HIST1H4E was marked as current diagnostic
Added comment: 17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD).
A zebrafish model has developmental defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 NRCAM Ee Ming Wong gene: NRCAM was added
gene: NRCAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NRCAM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NRCAM were set to PMID: 35108495
Phenotypes for gene: NRCAM were set to neurodevelopmental disorder, MONDO:0700092
Penetrance for gene: NRCAM were set to unknown
Review for gene: NRCAM was set to GREEN
gene: NRCAM was marked as current diagnostic
Added comment: -Ten individuals from 8 families with developmental delay/intellectual disability, hypotonia, peripheral neuropathy, and/or spasticity
- Affected individuals are biallelic for missense and/or LoF variants which are mainly in the fibronectin type III (Fn-III) domain
- Zebrafish mutants lacking the third Fn-III domain displayed significantly altered swimming behavior compared to wild-type larvae (p < 0.03) and a trend toward increased amounts of alpha-tubulin fibers in the dorsal telencephalon, demonstrating an alteration in white matter tracts and projections
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 HIST1H4D Paul De Fazio gene: HIST1H4D was added
gene: HIST1H4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4D were set to 35202563
Phenotypes for gene: HIST1H4D were set to Neurodevelopmental disorder, HIST1H4D-related MONDO:0700092
Review for gene: HIST1H4D was set to AMBER
gene: HIST1H4D was marked as current diagnostic
Added comment: Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD).
A zebrafish model has developmental defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 CRLS1 Michelle Torres gene: CRLS1 was added
gene: CRLS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CRLS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRLS1 were set to 35147173
Phenotypes for gene: CRLS1 were set to Mitochondrial disease MONDO:0044970 CRLS1-related
Added comment: - Three families (4 individuals) with cardiolipin deficiency.
- Two families (one consanguineous with 2 affected siblings) with homozygous the p.(Ile109Asn) had infantile progressive encephalopathy, bull’s eye maculopathy, auditory neuropathy, diabetes insipidus, autonomic instability, cardiac defects and early death.
- The fourth individual cHet p.(Ala172Asp) and p.(Leu217Phe) presented with chronic encephalopathy with neurodevelopmental regression, congenital nystagmus with decreased vision, sensorineural hearing loss, failure to thrive and acquired microcephaly.
- Functional studies on patient cells showed increased levels of the substrate of CRLS1 and impaired mitochondrial morphology and biogenesis
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 ZBTB7A Daniel Flanagan gene: ZBTB7A was added
gene: ZBTB7A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ZBTB7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZBTB7A were set to 34515416; 31645653
Phenotypes for gene: ZBTB7A were set to Macrocephaly, neurodevelopmental delay, lymphoid hyperplasia, and persistent fetal hemoglobin (MIM#619769)
Review for gene: ZBTB7A was set to GREEN
Added comment: PMID: 34515416. Monoallelic ZBTB7A variants identified in 12 individuals from 11 families, with macrocephaly (11/12), some degree of ID (12/12), autistic features (7/12) and hypertrophy of pharyngeal lymphoid tissue (12/12). Variants included LoF variants and missense, 8 variants were de novo.

PMID: 31645653. De novo ZBTB7A missense identified in a boy with macrocephaly, intellectual disability, and sleep apnea.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4519 HIST1H4C Paul De Fazio reviewed gene: HIST1H4C: Rating: GREEN; Mode of pathogenicity: None; Publications: 35202563; Phenotypes: Tessadori-van Haaften neurodevelopmental syndrome 1 MIM#619758, Neurodevelopmental disorder, HIST1H4C-related MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4517 HIST1H4F Elena Savva edited their review of gene: HIST1H4F: Added comment: PMID: 35202563 - single de novo missense in a patient with neurodevelopmental features of intellectual disability and motor and/or gross developmental delay.
- zebrafish studies show a significant increase in all of mild dev delay, necrosis, defective organogenesis and pre-gastrulation failure
Sources: Literature; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.4517 ZBTB11 Chern Lim reviewed gene: ZBTB11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:35104841; Phenotypes: Intellectual developmental disorder, autosomal recessive 69 (MIM#618383), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4517 HIST1H4F Elena Savva gene: HIST1H4F was added
gene: HIST1H4F was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4F was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4F were set to PMID: 35202563
Phenotypes for gene: HIST1H4F were set to Neurodevelopmental disorders
Review for gene: HIST1H4F was set to GREEN
Added comment: PMID: 35202563 - single de novo missense in a patient with neurodevelopmental features of intellectual disability and motor and/or gross developmental delay.
- zebrafish studies show a significant increase in all of mild dev delay, necrosis, defective organogenesis and pre-gastrulation failure
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4515 HIST1H4I Elena Savva gene: HIST1H4I was added
gene: HIST1H4I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4I was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4I were set to PMID: 35202563
Phenotypes for gene: HIST1H4I were set to Neurodevelopmental syndrome
Review for gene: HIST1H4I was set to GREEN
Added comment: PMID: 35202563
- 3 unrelated de novo patients, p.His75Arg was recurring and observed in 2/3 probands.
- Zebrafish study shows both variants resulted in a significant increases in developmental issues such as in mild dev delay, necrosis and defective organogenesis.
- All patients had intellectual disability and motor and/or gross developmental delay and dysmorphisms.
- 2/3 patients showed bilateral conductive hearing loss
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4512 ATP6V0A1 Zornitza Stark Mode of inheritance for gene: ATP6V0A1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4511 TIAM1 Alison Yeung gene: TIAM1 was added
gene: TIAM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TIAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TIAM1 were set to Neurodevelopmental disorder, TIAM1-related, MONDO:0700092
Review for gene: TIAM1 was set to GREEN
Added comment: Reported in 4 unrelated individuals. Phenotype of developmental delay/intellectual disability and seizures. Loss of ortholog in Drosophila reduces the survival rate, and the surviving adults exhibit climbing defects, are prone to severe seizures, and have a short lifespan. Functional studies in 3 variants from two probands showed loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4510 ATP6V0A1 Chern Lim reviewed gene: ATP6V0A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:34909687; Phenotypes: Early-onset progressive myoclonus epilepsy with ataxia, AR, severe developmental and epileptic encephalopathy, AD.; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4510 HIST1H4J Elena Savva reviewed gene: HIST1H4J: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 35202563, 31804630; Phenotypes: Neurodevelopmental syndrome, microcephaly, intellectual disability, dysmorphic features; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4507 CHKA Konstantinos Varvagiannis gene: CHKA was added
gene: CHKA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHKA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHKA were set to 35202461
Phenotypes for gene: CHKA were set to Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature
Penetrance for gene: CHKA were set to Complete
Review for gene: CHKA was set to GREEN
Added comment: Klöckner (2022 - PMID: 35202461) describe the phenotype of 6 individuals (from 5 unrelated families) harboring biallelic CHKA variants.

Shared features incl. abnormal muscle tone(6/6 - hypertonia or hypotonia, 3/6 each), DD/ID (6/6,severe in 4, severe/profound in 2), epilepsy (6/6 - onset: infancy - 3y2m | epileptic spasms or GS at onset), microcephaly (6/6), movement disorders (3/6 - incl. dyskinesia, rigidity, choreoatetotic movements). 2/5 individuals exhibited MRI abnormalities, notably hypomyelination. Short stature was observed in 4/6.

Eventual previous genetic testing was not discussed.

Exome sequencing (quattro ES for 2 sibs, trio ES for 1 individual, singleton for 3 probands) revealed biallelic CHKA variants in all affected individuals. Sanger sequencing was performed for confirmation and segregation studies.

Other variants (in suppl.) were not deemed to be causative for the neurodevelopmental phenotype.

3 different missense, 1 start-loss and 1 truncating variant were identified, namely (NM_0012772.2):
- c.421C>T/p.(Arg141Trp) [3 hmz subjects from 2 consanguineous families],
- c.580C>T/p.Pro194Ser [1 hmz individual born to consanguineous parents],
- c.2T>C/p.(Met1?) [1 hmz individual born to related parents],
- c.14dup/p.(Cys6Leufs*19) in trans with c.1021T>C/p.(Phe341Leu) in 1 individual.

CHKA encodes choline kinase alpha, an enzyme catalyzing the first step of phospholipid synthesis in the Kennedy pathway. The pathway is involved in de novo synthesis of glycerophospholipids, phosphatidylcholine and phosphatidylethanolamine being the most abundant in eukaryotic membranes.

CHKA with its paralog (CHKB) phosphorylates either choline or ethanolamine to phosphocholine or phosphoethanolamine respectively with conversion of ATP to ADP.

As the authors comment, biallelic pathogenic variants in CHKB cause a NDD with muscular dystrophy, hypotonia, ID, microcephaly and structural mitochondrial anomalies (MIM 602541). [Prominent mitochondrial patterning was observed in a single muscle biopsy available from an individual with biallelic CHKA variants].

Other disorders of the Kennedy pathway (due to biallelic PCYT2, SELENOI, PCYT1A variants) present with overlapping features incl. variable DD/ID (no-severe), microcephaly, seizures, visual impairment etc.

CHKA variants were either absent or observed once in gnomAD, affected highly conserved AAs with multiple in silico predictions in favor of a deleterious effect.

In silico modeling suggests structural effects for several of the missense variants (Arg141Trp, Pro194Ser presumably affect ADP binding, Phe341 lying close to the binding site of phosphocholine).

Each of the missense variants was expressed in yeast cells and W. Blot suggested expression at the expected molecular weight at comparative levels. The 3 aforementioned variants exhibited reduced catalytic activity (20%, 15%, 50% respectively).

NMD is thought to underly the deleterious effect of the frameshift one (not studied).

The start-loss variant is expected to result in significantly impaired expression and protein function as eventual utilization of the next possible start codon - occurring at position 123 - would remove 26% of the protein.

Chka(-/-) is embryonically lethal in mice, suggesting that complete loss is not compatible with life. Reduction of choline kinase activity by 30% in heterozygous mice did not appear to result in behavioral abnormalities although this was not studied in detail (PMID cited: 18029352). Finally, screening of 1566 mouse lines identified 198 genes whose disruption yields neuroanatomical phenotypes, Chka(+/-) mice being among these (PMID cited: 31371714).

There is no associated phenotype in OMIM, Gene2Phenotype or SysID.

Overall this gene can be considered for inclusion in the ID and epilepsy panes with green or amber rating (>3 individuals, >3 variants, variant studies, overlapping phenotype of disorders belonging to the same pathway, etc). Consider also inclusion in the microcephaly panel (where available this seemed to be of postnatal onset).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4506 KIAA0391 Zornitza Stark edited their review of gene: KIAA0391: Changed phenotypes: Combined oxidative phosphorylation deficiency 54, MIM# 619737
Intellectual disability syndromic and non-syndromic v0.4506 THOC6 Zornitza Stark Marked gene: THOC6 as ready
Intellectual disability syndromic and non-syndromic v0.4506 THOC6 Zornitza Stark Gene: thoc6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4506 THOC6 Zornitza Stark Phenotypes for gene: THOC6 were changed from to Beaulieu-Boycott-Innes syndrome, MIM# 613680
Intellectual disability syndromic and non-syndromic v0.4505 THOC6 Zornitza Stark Publications for gene: THOC6 were set to
Intellectual disability syndromic and non-syndromic v0.4504 THOC6 Zornitza Stark Mode of inheritance for gene: THOC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4503 THOC6 Zornitza Stark reviewed gene: THOC6: Rating: GREEN; Mode of pathogenicity: None; Publications: 23621916, 26739162, 27102954, 30238602, 30476144; Phenotypes: Beaulieu-Boycott-Innes syndrome, MIM# 613680; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4500 SYP Zornitza Stark reviewed gene: SYP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23966691, 19377476; Phenotypes: Mental retardation, X-linked 96 MIM#300802; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4500 SPRED2 Zornitza Stark Phenotypes for gene: SPRED2 were changed from Rasopathy; developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt to Noonan syndrome 14, MIM# 619745
Intellectual disability syndromic and non-syndromic v0.4499 SPRED2 Zornitza Stark reviewed gene: SPRED2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Noonan syndrome 14, MIM# 619745; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4498 POLRMT Zornitza Stark edited their review of gene: POLRMT: Changed phenotypes: Combined oxidative phosphorylation deficiency 55, MIM# 619743, intellectual disability, hypotonia
Intellectual disability syndromic and non-syndromic v0.4497 ABHD16A Zornitza Stark edited their review of gene: ABHD16A: Changed phenotypes: Spastic paraplegia 86, autosomal recessive, MIM# 619735, Intellectual Disability, Corpus callosum abnormalities; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4497 THUMPD1 Zornitza Stark reviewed gene: THUMPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4497 THUMPD1 Zornitza Stark Marked gene: THUMPD1 as ready
Intellectual disability syndromic and non-syndromic v0.4497 THUMPD1 Zornitza Stark Gene: thumpd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4497 THUMPD1 Zornitza Stark Phenotypes for gene: THUMPD1 were changed from Syndromic form of intellectual disability associated with developmental delay, behavioral abnormalities, hearing loss and facial dysmorphism, AR to Syndromic disease, MONDO:0002254, THUMPD1-related
Intellectual disability syndromic and non-syndromic v0.4496 THUMPD1 Zornitza Stark Classified gene: THUMPD1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4496 THUMPD1 Zornitza Stark Gene: thumpd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4495 THUMPD1 Chern Lim changed review comment from: Broly, M. et al. (2022), AJHG:
- 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del).
- Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities.
Sources: Other; to: Broly, M. et al. (2022), AJHG:
- 13 individuals from 8 families, biallelic loss of function variants (PTVs, one missense, one single AA del).
- Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.4495 THUMPD1 Chern Lim changed review comment from: Broly, M. et al. (2022) manuscript accepted in AJHG:
- 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del).
- Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities.
Sources: Other; to: Broly, M. et al. (2022), AJHG:
- 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del).
- Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.4495 THUMPD1 Chern Lim gene: THUMPD1 was added
gene: THUMPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: THUMPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: THUMPD1 were set to Syndromic form of intellectual disability associated with developmental delay, behavioral abnormalities, hearing loss and facial dysmorphism, AR
gene: THUMPD1 was marked as current diagnostic
Added comment: Broly, M. et al. (2022) manuscript accepted in AJHG:
- 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del).
- Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.4495 PRSS12 Ain Roesley reviewed gene: PRSS12: Rating: RED; Mode of pathogenicity: None; Publications: 12459588, 22090715, 23344636; Phenotypes: Intellectual disability, PRSS12 related MIM#249500; Mode of inheritance: None; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4494 PAX5 Bryony Thompson gene: PAX5 was added
gene: PAX5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PAX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PAX5 were set to 35094443; 31452935; 28263302; 25418537; 8001127; 27626380
Phenotypes for gene: PAX5 were set to neurodevelopmental disorder MONDO:0700092
Review for gene: PAX5 was set to GREEN
Added comment: 5 individuals from 4 families with large deletions involving PAX5 and 11 individuals from 9 families with frameshift/stopgain/missense variants and neurodevelopmental phenotypes that included delayed developmental milestones (DD), intellectual disability (ID), and/or ASD. 6 of the variants are de novo. Null mouse have retarded growth and altered patterning of the posterior midbrain. Pax5+/− mice of both sexes are hyperactive and have abnormal auditory brainstem responses.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4490 EEF1B2 Bryony Thompson reviewed gene: EEF1B2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31845318, 21937992, 35015920; Phenotypes: neurodevelopmental disorder MONDO:0700092, non-syndromic ID and seizures; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4488 CENPJ Zornitza Stark commented on gene: CENPJ: PMID 34068194: two further families reported with Seckel syndrome, same homozygous missense, founder?
Intellectual disability syndromic and non-syndromic v0.4486 ATP5E Ain Roesley gene: ATP5E was added
gene: ATP5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP5E was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP5E were set to 34954817; 20566710; 27626380; 20026007
Phenotypes for gene: ATP5E were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053
Penetrance for gene: ATP5E were set to Complete
Review for gene: ATP5E was set to AMBER
gene: ATP5E was marked as current diagnostic
Added comment: 3 unrelated with the same Tyr12Cys avriant

3/3 with dev delay. 2/3 with ID (the other NA)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4485 BAP1 Anna Ritchie gene: BAP1 was added
gene: BAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BAP1 were set to PMID: 35051358
Phenotypes for gene: BAP1 were set to syndromic intellectual disability MONDO:0000508
Penetrance for gene: BAP1 were set to unknown
Review for gene: BAP1 was set to GREEN
Added comment: 11 de novo germline heterozygous missense BAP1 variants associated with a rare syndromic neurodevelopmental disorder. Functional analysis showed that most of the variants cannot rescue the consequences of BAP1 inactivation, suggesting a loss-of-function mechanism. All affected individuals harboring a de novo BAP1 variant had DD or ID (11/11) characterized notably by speech (11/ 11) and motor delay (6/11). Most of them had hypotonia (7/11), seizures (6/11), and abnormal behavior (8/10), including autism spectrum disorder, attention deficit hyperactivity disorder, and hypersensitivity. Almost all individuals showed dysmorphic facial features (10/11), and more than half (6/11) had skeletal malformations (involving the hands [4/11], feet [3/11], or spine [2/11]). Most of the individuals had growth failure (9/11), including four individuals with a very short stature.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4484 SOD1 Naomi Baker gene: SOD1 was added
gene: SOD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SOD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SOD1 were set to PMID: 31314961; 31332433; 34788402
Phenotypes for gene: SOD1 were set to Spastic tetraplegia and axial hypotonia, progressive, MIM#618598
Review for gene: SOD1 was set to GREEN
Added comment: Phenotypes include one individual with axial hypotonia and loss of gross and fine motor function beginning at 6 months of age, after which severe, progressive spastic tetraparesis developed and Babinski’s sign was present in both feet. MRI of brain detected mild frontoparietal atrophy.

The second individual had severe and marked by progressive loss of motor abilities from 9 months of age, tetraspasticity with predominance in the lower extremities, mild cerebellar atrophy, and hyperekplexia-like symptoms. Dysmorphic features such as low set, posteriorly rotated ears, and overlapping toes

The third individual is an infant with severe global developmental delay, axial hypotonia and limb spasticity. No dysmorphic facial features were noted, but she had a high arched palate, bilateral 5th finger clinodactyly, partial toe syndactyly of the second and third toes, and a single hyperpigmented macule tongue fasciculations, axial hypotonia with limb spasticity (more pronounced in the lower limbs), ankle clonus, and brisk patellar deep tendon reflexes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4484 ITSN1 Ee Ming Wong changed review comment from: -10 individuals from eight unrelated with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment.
-variants included heterozygous premature truncating and missense variants
-Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father
Sources: Literature; to: -10 individuals from eight unrelated families with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment.
-variants included heterozygous premature truncating and missense variants
-Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4484 ITSN1 Ee Ming Wong gene: ITSN1 was added
gene: ITSN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ITSN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ITSN1 were set to PMID: 34707297
Phenotypes for gene: ITSN1 were set to neurodevelopmental disorder MONDO:0700092 ITSN1-related
Penetrance for gene: ITSN1 were set to unknown
gene: ITSN1 was marked as current diagnostic
Added comment: -10 individuals from eight unrelated with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment.
-variants included heterozygous premature truncating and missense variants
-Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4482 MAN2C1 Michelle Torres gene: MAN2C1 was added
gene: MAN2C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAN2C1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAN2C1 were set to 35045343
Phenotypes for gene: MAN2C1 were set to neurodevelopmental disorder MONDO:0700092 MAN2C1-related
Review for gene: MAN2C1 was set to GREEN
Added comment: Six individuals from four different families, including two fetuses, exhibiting dysmorphic facial features, congenital anomalies such as tongue hamartoma, variable degrees of intellectual disability, and brain anomalies including polymicrogyria, interhemispheric cysts, hypothalamic hamartoma, callosal anomalies, and hypoplasia of brainstem and cerebellar vermis. Variants include PTC and missense.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4482 RBL2 Elena Savva reviewed gene: RBL2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33980986, 32105419, 9806916; Phenotypes: Severe motor and cognitive impairment, Intellectual disability, Brunet-Wagner neurodevelopmental syndrome MIM#619690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4482 SLC38A3 Ain Roesley gene: SLC38A3 was added
gene: SLC38A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC38A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC38A3 were set to 34605855
Phenotypes for gene: SLC38A3 were set to developmental epileptic encephalopathy, SLC38A3-related MONDO:0100062
Penetrance for gene: SLC38A3 were set to Complete
Review for gene: SLC38A3 was set to GREEN
gene: SLC38A3 was marked as current diagnostic
Added comment: 7 families 6 of whom are consanguineous but unique variants in all of them

10/10 with GDD/ID
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4481 FRA10AC1 Zornitza Stark gene: FRA10AC1 was added
gene: FRA10AC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FRA10AC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRA10AC1 were set to 34694367
Phenotypes for gene: FRA10AC1 were set to Neurodevelopmental disorder, MONDO:0700092, FRA10AC1-related
Review for gene: FRA10AC1 was set to GREEN
Added comment: PMID 34694367: 5 individuals from 3 unrelated families reported.

Variable ID, possibly related to variant type with LoF variants associated with more severe ID. All individuals had microcephaly, hypoplasia or agenesis of the corpus callosum, growth retardation, and craniofacial dysmorphism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4480 PLAA Zornitza Stark Phenotypes for gene: PLAA were changed from to Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527
Intellectual disability syndromic and non-syndromic v0.4477 PLAA Zornitza Stark reviewed gene: PLAA: Rating: GREEN; Mode of pathogenicity: None; Publications: 28007986, 28413018, 31322726; Phenotypes: Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4477 PGAP1 Zornitza Stark Phenotypes for gene: PGAP1 were changed from to Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802
Intellectual disability syndromic and non-syndromic v0.4474 PGAP1 Zornitza Stark reviewed gene: PGAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24784135, 25823418, 25804403, 26050939; Phenotypes: Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4474 KCNN2 Zornitza Stark Phenotypes for gene: KCNN2 were changed from Neurodevelopmental movement disorders; Developmental Delay; Seizures to Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725
Intellectual disability syndromic and non-syndromic v0.4472 KCNN2 Zornitza Stark reviewed gene: KCNN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4471 NAA20 Zornitza Stark edited their review of gene: NAA20: Changed phenotypes: Intellectual developmental disorder, autosomal recessive 73, MIM# 619717
Intellectual disability syndromic and non-syndromic v0.4470 SHANK1 Zornitza Stark reviewed gene: SHANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SHANK1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4470 ABCC9 Zornitza Stark Phenotypes for gene: ABCC9 were changed from to Intellectual disability and myopathy syndrome, MIM# 619719; Hypertrichotic osteochondrodysplasia, MIM# 239850 Cantu syndrome
Intellectual disability syndromic and non-syndromic v0.4469 ABCC9 Zornitza Stark Mode of inheritance for gene: ABCC9 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4468 ABCC9 Zornitza Stark reviewed gene: ABCC9: Rating: GREEN; Mode of pathogenicity: None; Publications: 31575858, 22610116, 22608503; Phenotypes: Intellectual disability and myopathy syndrome, MIM# 619719, Hypertrichotic osteochondrodysplasia, MIM# 239850 Cantu syndrome; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4465 CAMK2G Zornitza Stark edited their review of gene: CAMK2G: Changed publications: 30184290, 29100089
Intellectual disability syndromic and non-syndromic v0.4465 CAMK2G Zornitza Stark gene: CAMK2G was added
gene: CAMK2G was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CAMK2G was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CAMK2G were set to 30184290
Phenotypes for gene: CAMK2G were set to Intellectual disability
Mode of pathogenicity for gene: CAMK2G was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: CAMK2G was set to AMBER
Added comment: Two unrelated individuals reported with de novo (p.Arg292Pro) variant. Functional data suggests GoF.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4461 CSNK2B Zornitza Stark reviewed gene: CSNK2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28585349, 28762608; Phenotypes: Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4459 GDI1 Zornitza Stark Mode of inheritance for gene: GDI1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4458 GDI1 Zornitza Stark reviewed gene: GDI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28863211, 22002931, 9620768, 9668174; Phenotypes: Intellectual developmental disorder, X-linked 41 MIM#300849; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4454 FMN2 Zornitza Stark reviewed gene: FMN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480035, 32162566, 24161494; Phenotypes: Intellectual developmental disorder, autosomal recessive 47, MIM#616193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4454 MDH2 Zornitza Stark Phenotypes for gene: MDH2 were changed from to Developmental and epileptic encephalopathy 51 MIM#617339
Intellectual disability syndromic and non-syndromic v0.4451 MDH2 Zornitza Stark reviewed gene: MDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27989324, 34766628; Phenotypes: Developmental and epileptic encephalopathy 51 MIM#617339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4444 OTUD6B Zornitza Stark Phenotypes for gene: OTUD6B were changed from to Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452
Intellectual disability syndromic and non-syndromic v0.4441 LMBRD2 Zornitza Stark Phenotypes for gene: LMBRD2 were changed from Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye to Developmental delay with variable neurologic and brain abnormalities, MIM# 619694; Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye
Intellectual disability syndromic and non-syndromic v0.4440 LMBRD2 Zornitza Stark edited their review of gene: LMBRD2: Changed phenotypes: Developmental delay with variable neurologic and brain abnormalities, MIM# 619694, Intellectual disability
Intellectual disability syndromic and non-syndromic v0.4439 OGDHL Zornitza Stark reviewed gene: OGDHL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Yoon-Bellen neurodevelopmental syndrome, MIM# 619701; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4438 ANAPC7 Zornitza Stark gene: ANAPC7 was added
gene: ANAPC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ANAPC7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ANAPC7 were set to 34942119
Phenotypes for gene: ANAPC7 were set to Ferguson-Bonni neurodevelopmental syndrome, MIM# 619699
Review for gene: ANAPC7 was set to AMBER
Added comment: 11 individuals of Amish heritage reported homozygous for an intragenic deletion. Clinical features included ID, hypotonia, deafness in 5, relatively small head size (but microcephaly only in 1), and occasional congenital anomalies.

Supportive mouse model.

Amber rating in light of this being a founder variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4436 DISP1 Zornitza Stark Mode of inheritance for gene: DISP1 was changed from Unknown to Other
Intellectual disability syndromic and non-syndromic v0.4435 SIN3A Chirag Patel changed review comment from: 9 patients from 5 unrelated families reported with heterozygous truncating mutations in the SIN3A gene. Features include intellectual disability, ASD, seizures, dysmorphism, short stature, microcephaly, joint hypermotility, and small hands and feet. Brain imaging showed dilated ventricles, thin corpus callosum and, in some cases, dysgyria or polymicrogyria. Suitable for fetal anomalies panel.; to: 9 patients from 5 unrelated families reported with heterozygous truncating mutations in the SIN3A gene. Features include intellectual disability, ASD, seizures, dysmorphism, short stature, microcephaly, joint hypermotility, and small hands and feet. Brain imaging showed dilated ventricles, thin corpus callosum and, in some cases, dysgyria or polymicrogyria.
Intellectual disability syndromic and non-syndromic v0.4435 SIN3A Chirag Patel reviewed gene: SIN3A: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 27399968; Phenotypes: Witteveen-Kolk syndrome, OMIM # 613406; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4435 SOX11 Chirag Patel reviewed gene: SOX11: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 24886874, 33785884, 33430815, 33086258, 31530938; Phenotypes: Coffin-Siris syndrome 9, OMIM # 615866; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4435 OTUD6B Chirag Patel reviewed gene: OTUD6B: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 28343629, 32924626, 31147255; Phenotypes: Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4435 RNF220 Zornitza Stark Phenotypes for gene: RNF220 were changed from Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum to Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688; Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Intellectual disability syndromic and non-syndromic v0.4434 RNF220 Zornitza Stark reviewed gene: RNF220: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688, Leukodystrophy, CNS hypomyelination, Ataxia, Intellectual disability, Sensorineural hearing impairment, Elevated hepatic transaminases, Hepatic fibrosis, Dilated cardiomyopathy, Spastic paraplegia, Dysarthria, Abnormality of the corpus callosum; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4432 NSD2 Zornitza Stark edited their review of gene: NSD2: Changed phenotypes: Rauch-Steindl syndrome, MIM# 619695, Microcephaly, intellectual disability
Intellectual disability syndromic and non-syndromic v0.4430 HNRNPH2 Zornitza Stark Mode of inheritance for gene: HNRNPH2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4429 HNRNPH2 Zornitza Stark reviewed gene: HNRNPH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34907471, 33728377, 31670473, 31236915, 30887513; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Bain type MIM#300986; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4429 TCTN1 Ain Roesley gene: TCTN1 was added
gene: TCTN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TCTN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TCTN1 were set to 31302911; 28631893; 21725307; 26477546; 34980503
Phenotypes for gene: TCTN1 were set to Joubert syndrome 13, MIM# 614173; MONDO:0013608
Penetrance for gene: TCTN1 were set to Complete
Review for gene: TCTN1 was set to GREEN
gene: TCTN1 was marked as current diagnostic
Added comment: Rare cause of JBS, at least 6 families reported, mouse model.

ID/developmental delay described in at least 3 of them
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4426 NAA10 Zornitza Stark Phenotypes for gene: NAA10 were changed from to Microphthalmia, syndromic 1, MIM# 309800; Ogden syndrome MIM#300855
Intellectual disability syndromic and non-syndromic v0.4424 NAA10 Zornitza Stark Mode of inheritance for gene: NAA10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4423 NAA10 Zornitza Stark reviewed gene: NAA10: Rating: GREEN; Mode of pathogenicity: None; Publications: 30842225, 34075687, 21700266; Phenotypes: Microphthalmia, syndromic 1, MIM# 309800, Ogden syndrome MIM#300855; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4423 SLC35F1 Zornitza Stark gene: SLC35F1 was added
gene: SLC35F1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC35F1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC35F1 were set to 33821533
Phenotypes for gene: SLC35F1 were set to Neruodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome
Review for gene: SLC35F1 was set to RED
Added comment: WES found a de novo heterozygous c.1037T>C; p.(I346T) (absent in gnomad v2 and v3) in a female described to have Rett-like syndrome.

Global developmental delay, generalized tonic andtonic–clonic seizure, never acquired independent walking and developed spastictetraplegia in adulthood and limited speech

No functional data
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4422 VPS50 Zornitza Stark Phenotypes for gene: VPS50 were changed from Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum to Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685; Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Intellectual disability syndromic and non-syndromic v0.4421 VPS50 Zornitza Stark reviewed gene: VPS50: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4421 PRDM13 Zornitza Stark Phenotypes for gene: PRDM13 were changed from intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia, MONDO:MONDO:0016054. PRDM13-associated; congenital hypogonadotropic hypogonadism, MONDO:0015770 to intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia, MONDO:0016054, PRDM13-associated; congenital hypogonadotropic hypogonadism, MONDO:0015770
Intellectual disability syndromic and non-syndromic v0.4420 CCND2 Alison Yeung Added comment: Comment on phenotypes: Distal variants associated with Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3

Proximal variants associated with reciprocal phenotype of mild neurodevelopment disorder with microcephaly and short stature
Intellectual disability syndromic and non-syndromic v0.4418 PRKAR1B Paul De Fazio reviewed gene: PRKAR1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33833410; Phenotypes: Marbach-Schaaf neurodevelopmental syndrome MIM#619680; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4418 NAA10 Ain Roesley reviewed gene: NAA10: Rating: GREEN; Mode of pathogenicity: None; Publications: 34075687; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4418 PRKAR1B Paul De Fazio Deleted their review
Intellectual disability syndromic and non-syndromic v0.4418 PRKAR1B Paul De Fazio reviewed gene: PRKAR1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33833410; Phenotypes: Marbach-Schaaf neurodevelopmental syndrome MIM#619680; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4418 PRDM13 Seb Lunke Phenotypes for gene: PRDM13 were changed from intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia to intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia, MONDO:MONDO:0016054. PRDM13-associated; congenital hypogonadotropic hypogonadism, MONDO:0015770
Intellectual disability syndromic and non-syndromic v0.4416 PRDM13 Seb Lunke gene: PRDM13 was added
gene: PRDM13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
founder tags were added to gene: PRDM13.
Mode of inheritance for gene: PRDM13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PRDM13 were set to 34730112
Phenotypes for gene: PRDM13 were set to intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia
Review for gene: PRDM13 was set to AMBER
Added comment: Recessive disease causing ID and DSD described in three supposedly unrelated families (2 consanguine), but all are from Malta, and all share the same 13bp deletion spanning an exon-intron boundary. Mouse KO is embryonically lethal, and tissue specific KO failed to replicate many of the patients phenotypes, other than hypoplasia of the cerebellar vermis and hemispheres at P21.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4415 NAA20 Zornitza Stark reviewed gene: NAA20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Autosomal recessive developmental delay, intellectual disability, and microcephaly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4412 RAB23 Zornitza Stark reviewed gene: RAB23: Rating: GREEN; Mode of pathogenicity: None; Publications: 17503333, 21412941, 23599695, 25168863; Phenotypes: Carpenter syndrome (MIM#201000); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4408 NAA20 Chirag Patel gene: NAA20 was added
gene: NAA20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAA20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAA20 were set to PMID: 34230638
Phenotypes for gene: NAA20 were set to Autosomal recessive developmental delay, intellectual disability, and microcephaly
Added comment: 2 consanguineous families with 5 affected individuals with developmental delay, intellectual disability, and microcephaly (-2-4SD). Exome and genome sequencing identified 2 different homozygous variants in NAA20 gene (p.Met54Val and p.Ala80Val), and segregated with affected individuals. N-terminal acetyltransferases modify proteins by adding an acetyl moiety to the first amino acid and are vital for protein and cell function. The NatB complex acetylates 20% of the human proteome and is composed of the catalytic subunit NAA20 and the auxiliary subunit NAA25. Both NAA20-M54V and NAA20-A80V were impaired in their capacity to form a NatB complex with NAA25, and in vitro acetylation assays revealed reduced catalytic activities toward different NatB substrates.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4404 KCNC1 Zornitza Stark reviewed gene: KCNC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28145425, 31353862, 25401298; Phenotypes: Intellectual disability, Movement disorders, Epilepsy, progressive myoclonic 7 (MIM#616187); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4404 DPF2 Belinda Chong reviewed gene: DPF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29429572, 31706665; Phenotypes: Coffin-Siris syndrome 7 MIM#618027; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4401 SGPL1 Seb Lunke reviewed gene: SGPL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33074640; Phenotypes: Sphingosine Phosphate Lyase Insufficiency Syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4399 COX15 Zornitza Stark reviewed gene: COX15: Rating: GREEN; Mode of pathogenicity: None; Publications: 33746038, 32232962, 26959537, 21412973, 12474143, 15235026; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4397 BRWD3 Zornitza Stark Mode of inheritance for gene: BRWD3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4396 BRWD3 Zornitza Stark reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: 17668385, 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, MIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4395 AUTS2 Zornitza Stark edited their review of gene: AUTS2: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 26, MIM# 615834
Intellectual disability syndromic and non-syndromic v0.4395 ALDH4A1 Zornitza Stark Phenotypes for gene: ALDH4A1 were changed from to Hyperprolinemia, type II MIM#239510; disorders of ornithine or proline metabolism
Intellectual disability syndromic and non-syndromic v0.4392 ALDH4A1 Zornitza Stark reviewed gene: ALDH4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9700195, 34037900, 31884946; Phenotypes: Hyperprolinemia, type II MIM#239510, disorders of ornithine or proline metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4390 FLVCR2 Zornitza Stark Phenotypes for gene: FLVCR2 were changed from to Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790
Intellectual disability syndromic and non-syndromic v0.4387 FLVCR2 Zornitza Stark reviewed gene: FLVCR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30712878, 20206334, 20518025, 20690116, 25677735; Phenotypes: Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4384 VPS53 Zornitza Stark changed review comment from: Multiple Moroccan Jewish families reported, segregating two founder variants.; to: Multiple Moroccan Jewish families reported, segregating two founder variants. ID is part of the phenotype.
Intellectual disability syndromic and non-syndromic v0.4384 VPS53 Zornitza Stark reviewed gene: VPS53: Rating: GREEN; Mode of pathogenicity: None; Publications: 24577744, 12920088; Phenotypes: Pontocerebellar hypoplasia, type 2E, OMIM #615851; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4384 YY1 Zornitza Stark edited their review of gene: YY1: Changed publications: 28575647
Intellectual disability syndromic and non-syndromic v0.4381 YY1 Zornitza Stark reviewed gene: YY1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Gabriele-de Vries syndrome, OMIM #617557; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4381 TNR Zornitza Stark Phenotypes for gene: TNR were changed from Spastic para- or tetraparesis; Axial muscular hypotonia; Intellectual disability; Transient opisthotonus to Neurodevelopmental disorder, nonprogressive, with spasticity and transient opisthotonus, MIM# 619653; Spastic para- or tetraparesis; Axial muscular hypotonia; Intellectual disability; Transient opisthotonus
Intellectual disability syndromic and non-syndromic v0.4380 TNR Zornitza Stark edited their review of gene: TNR: Changed phenotypes: Neurodevelopmental disorder, nonprogressive, with spasticity and transient opisthotonus, MIM# 619653, Spastic para- or tetraparesis, Axial muscular hypotonia, Intellectual disability, Transient opisthotonus
Intellectual disability syndromic and non-syndromic v0.4377 COL4A3BP Zornitza Stark reviewed gene: COL4A3BP: Rating: GREEN; Mode of pathogenicity: None; Publications: 25533962; Phenotypes: Mental retardation, autosomal dominant 34, MIM# 616351; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4374 ZBTB18 Zornitza Stark reviewed gene: ZBTB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 29573576; Phenotypes: Mental retardation, autosomal dominant 22, MIM# 612337, Intellectual disability, microcephaly, corpus callosum abnormalities; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4371 ZBTB20 Zornitza Stark reviewed gene: ZBTB20: Rating: GREEN; Mode of pathogenicity: None; Publications: 25017102, 27061120, 30256248; Phenotypes: Primrose syndrome, MIM# 259050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4370 KCND2 Zornitza Stark gene: KCND2 was added
gene: KCND2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCND2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCND2 were set to 24501278; 16934482; 29581270; 34245260
Phenotypes for gene: KCND2 were set to Neurodevelopmental disorder MONDO:0700092; global developmental delay, HP:0001263; seizure, HP:0001250
Review for gene: KCND2 was set to GREEN
Added comment: 6 new unrelated cases with developmental delay reported in PMID: 34245260 (Zhang et al 2021), 3 of whom had seizures. All had heterozygous missense variants of KCND2 in sites known to be critical for channel gating (E323K, P403A, two individuals, V404L, two individuals and V404M). Functional studies suggest that these missense changes cause both a partial loss-of-function (LOF) and gain-of-function (GOF). The V404 change appears to increase epileptic seizure susceptibility with the 3 patients with a V404 change showing this phenotype.

PMID:24501278 - Lee et al, 2014 - reports pair of monozygotic twin boys with infantile onset severe refractory epilepsy and autism. A de novo heterozygous missense variant was identified by WES - V404M.

PMID: 29581270 - Lin et al, 2018 - performed functional work that shows V404M enhances inactivation of channels that have not yet opened and dramatically impairs the inactivation of channels that have opened.

PMID:16934482 - Singh et al, 2006 - reports a patient with cognative impairment who also went on to have seizures starting from age 13 with a 5 bp deletion in KCND2 leading to premature stop codon. The proband's asymptomatic father also shared this variant.
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4369 UBE4A Zornitza Stark Phenotypes for gene: UBE4A were changed from Intellectual disability and global developmental delay to Neurodevelopmental disorder with hypotonia and gross motor and seech delay, MIM# 619639
Intellectual disability syndromic and non-syndromic v0.4368 UBE4A Zornitza Stark reviewed gene: UBE4A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and gross motor and seech delay, MIM# 619639; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4365 CHD8 Zornitza Stark reviewed gene: CHD8: Rating: GREEN; Mode of pathogenicity: None; Publications: 31980904; Phenotypes: {Autism, susceptibility to, 18} 615032, CHD8-related neurodevelopmental syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4362 CCDC22 Zornitza Stark reviewed gene: CCDC22: Rating: GREEN; Mode of pathogenicity: None; Publications: 21826058, 24916641, 34020006, 33059814, 31971710; Phenotypes: Ritscher-Schinzel syndrome 2, MIM# 300963; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4362 ADCY5 Zornitza Stark Phenotypes for gene: ADCY5 were changed from Dyskinesia, familial, with facial myokymia, MIM#606703 to Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651
Intellectual disability syndromic and non-syndromic v0.4360 ADCY5 Zornitza Stark Mode of inheritance for gene: ADCY5 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4358 ADCY5 Zornitza Stark changed review comment from: Mono-allelic variants in this gene also cause a movement disorder, intellectual disability is not typically a feature.

Note also reports of a milder AR condition causing a movement disorder, where ID is not a feature.; to: Mono-allelic variants in this gene also cause a movement disorder, intellectual disability is not typically a feature.

Note also reports of a milder AR condition causing a movement disorder, where ID is not a feature, Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647.
Intellectual disability syndromic and non-syndromic v0.4358 ADCY5 Zornitza Stark changed review comment from: Variants in this gene cause a movement disorder, intellectual disability is not typically a feature.

Note one report of two siblings with bi-allelic variants and much more severe phenotype including ID (PMID 33704598); however parents were asymptomatic so evidence for causality is limited.; to: Mono-allelic variants in this gene also cause a movement disorder, intellectual disability is not typically a feature.

Note also reports of a milder AR condition causing a movement disorder, where ID is not a feature.
Intellectual disability syndromic and non-syndromic v0.4358 ADCY5 Zornitza Stark edited their review of gene: ADCY5: Added comment: Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD) is an autosomal recessive complex neurologic disorder characterized by severe global developmental delay with axial hypotonia, impaired intellectual development, poor overall growth, and abnormal involuntary hyperkinetic movements, including dystonia, myoclonus, spasticity, and orofacial dyskinesia. It is the most severe manifestation of ADCY5-related dyskinetic disorders. Five individuals from 2 families reported.; Changed rating: AMBER; Changed publications: 22782511, 24700542, 33051786, 32647899, 33704598, 34631954, 28971144, 30975617; Changed phenotypes: Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4356 CAMK2A Zornitza Stark Mode of inheritance for gene: CAMK2A was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4355 CAMK2A Zornitza Stark reviewed gene: CAMK2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 32600977, 29784083, 29560374; Phenotypes: Mental retardation, autosomal recessive 63 MIM#618095, Mental retardation, autosomal dominant 53 MIM#617798; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4354 BCAS3 Zornitza Stark reviewed gene: BCAS3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hengel-Maroofian-Schols syndrome, MIM# 619641; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4351 ASXL2 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v0.4351 ASXL2 Zornitza Stark reviewed gene: ASXL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27693232, 33751773; Phenotypes: Shashi-Pena syndrome, MIM# 617190; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4351 ARFGEF2 Zornitza Stark Phenotypes for gene: ARFGEF2 were changed from to Periventricular heterotopia with microcephaly (MIM#608097)
Intellectual disability syndromic and non-syndromic v0.4348 ARFGEF2 Zornitza Stark reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4345 CLCN7 Zornitza Stark gene: CLCN7 was added
gene: CLCN7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLCN7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CLCN7 were set to 31155284
Phenotypes for gene: CLCN7 were set to Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541
Mode of pathogenicity for gene: CLCN7 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: CLCN7 was set to AMBER
Added comment: Two individuals reported with same missense variant and hypopigmentation, organomegaly, and delayed myelination and development. Variant is GoF. No osteopetrosis, biopsy findings from skin and other organs are consistent with a lysosomal storage disorder. IUGR, prematurity and polyhydramnios are features. Bi-allelic variants in this gene are associated with osteopetrosis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4343 SNIP1 Zornitza Stark edited their review of gene: SNIP1: Added comment: A single (founder) variant NM_024700.4:c.1097A>G, p.(Glu366Gly) has been reported in over 30 cases of Psychomotor retardation, epilepsy, and craniofacial dysmorphism OMIM:614501 in the Amish community (PMIDs: 22279524; 34570759). Cases are homozygous for this variant and unaffected members of the families are heterozygous or wt. Overexpression of the equivalent mouse variant in mouse inner medullary collecting duct cells, resulted in a more aggregated appearance in the nucleus compared to wildtype. The variant protein maybe unstable as Western blots showed reduced levels of the variant protein (PMID: 22279524). Whole transcriptomic analysis of patient blood was performed in PMID: 34570759. This revealed 11 upregulated and 32 downregulated genes, of which 24 had previously been associated with neurological disease.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.4342 TAF4 Zornitza Stark gene: TAF4 was added
gene: TAF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAF4 were set to 33875846; 28191890
Phenotypes for gene: TAF4 were set to Neurodevelopmental disorder
Review for gene: TAF4 was set to AMBER
Added comment: Three individuals reported with de novo LoF variants as part of large cohorts, limited phenotypic information available.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4340 RAB11A Zornitza Stark edited their review of gene: RAB11A: Added comment: Two additional cases reported in PMID 33875846.; Changed rating: GREEN; Changed publications: 29100083, 33875846
Intellectual disability syndromic and non-syndromic v0.4338 PLK1 Zornitza Stark gene: PLK1 was added
gene: PLK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLK1 were set to 33875846
Phenotypes for gene: PLK1 were set to Epilepsy; microcephaly; intellectual disability
Review for gene: PLK1 was set to GREEN
Added comment: More than 5 individuals reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4335 RAP1GDS1 Zornitza Stark edited their review of gene: RAP1GDS1: Added comment: Two additional families reported.; Changed rating: GREEN; Changed publications: 32431071, 33875846
Intellectual disability syndromic and non-syndromic v0.4334 TMEM218 Zornitza Stark gene: TMEM218 was added
gene: TMEM218 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: TMEM218 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM218 were set to 33791682; 25161209
Phenotypes for gene: TMEM218 were set to Joubert syndrome 39, MIM#619562
Review for gene: TMEM218 was set to GREEN
Added comment: 11 cases in 6 families with homozygous or compound heterozygous missense and nonsense (1) variants, with a Joubert/Meckel syndrome phenotype. Clinical features included the molar tooth sign (N=2), occipital encephalocele (N=5, all fetuses), retinal dystrophy (N=4, all living individuals), polycystic kidneys (N=2), and polydactyly (N=2), without liver involvement. A null mouse model had nephronophthisis and retinal degeneration. No OMIM entry.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4331 ATP9A Zornitza Stark edited their review of gene: ATP9A: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.4331 ATP9A Zornitza Stark edited their review of gene: ATP9A: Added comment: Four unrelated families and mouse model.; Changed publications: 34379057, 34764295
Intellectual disability syndromic and non-syndromic v0.4329 CNKSR2 Zornitza Stark Mode of inheritance for gene: CNKSR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4328 CNKSR2 Zornitza Stark edited their review of gene: CNKSR2: Changed mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4328 CNKSR2 Zornitza Stark reviewed gene: CNKSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34266427; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Houge type, MIM# 301008; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4326 ANK3 Zornitza Stark edited their review of gene: ANK3: Added comment: PMID 34218362: four unrelated novel, and two previously published patients with heterozygos ANK3 LoF variants are reported/summarized.; Changed rating: GREEN; Changed publications: 23390136, 28687526, 34218362
Intellectual disability syndromic and non-syndromic v0.4325 FOXR1 Zornitza Stark Mode of pathogenicity for gene: FOXR1 was changed from Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments to None
Intellectual disability syndromic and non-syndromic v0.4323 Zornitza Stark removed gene:FOXR2 from the panel
Intellectual disability syndromic and non-syndromic v0.4322 OGDHL Melanie Marty Deleted their comment
Intellectual disability syndromic and non-syndromic v0.4322 OGDHL Melanie Marty edited their review of gene: OGDHL: Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing
loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum.

Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing.

Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.; Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.4322 OGDHL Melanie Marty commented on gene: OGDHL: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing
loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum.

Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing.

Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.
Intellectual disability syndromic and non-syndromic v0.4322 OGDHL Melanie Marty Deleted their comment
Intellectual disability syndromic and non-syndromic v0.4322 OGDHL Melanie Marty changed review comment from: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing
loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum.

Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing.

Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.
Sources: Literature; to: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing
loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum.

Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing.

Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4322 OGDHL Melanie Marty gene: OGDHL was added
gene: OGDHL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: OGDHL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OGDHL were set to PMID: 34800363
Phenotypes for gene: OGDHL were set to Neurodevelopmental disorder featuring epilepsy, hearing loss and visual impairment
Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing
loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum.

Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing.

Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4322 FOXR2 Paul De Fazio reviewed gene: FOXR2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Other; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4322 FOXR2 Paul De Fazio Deleted their review
Intellectual disability syndromic and non-syndromic v0.4322 FOXR2 Paul De Fazio edited their review of gene: FOXR2: Changed publications: -; Changed phenotypes: -
Intellectual disability syndromic and non-syndromic v0.4322 FOXR2 Paul De Fazio edited their review of gene: FOXR2: Changed rating: RED; Changed mode of inheritance: Other
Intellectual disability syndromic and non-syndromic v0.4322 FOXR2 Paul De Fazio changed review comment from: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype.

In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation).

A mouse knockout has comparable phenotypes, and a severe survival deficit.

Rated amber (1 patient, functional evidence, mouse model).
Sources: Literature; to: Geme added incorrectly.
Intellectual disability syndromic and non-syndromic v0.4322 FOXR1 Paul De Fazio gene: FOXR1 was added
gene: FOXR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FOXR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXR1 were set to 34723967
Phenotypes for gene: FOXR1 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay
Mode of pathogenicity for gene: FOXR1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: FOXR1 was set to AMBER
gene: FOXR1 was marked as current diagnostic
Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype.

In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation).

A mouse knockout has comparable phenotypes, and a severe survival deficit.

Rated amber (1 patient, functional evidence, mouse model).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4322 FOXR2 Paul De Fazio gene: FOXR2 was added
gene: FOXR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FOXR2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXR2 were set to 34723967
Phenotypes for gene: FOXR2 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay
Review for gene: FOXR2 was set to AMBER
gene: FOXR2 was marked as current diagnostic
Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype.

In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation).

A mouse knockout has comparable phenotypes, and a severe survival deficit.

Rated amber (1 patient, functional evidence, mouse model).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4319 RNF125 Zornitza Stark reviewed gene: RNF125: Rating: GREEN; Mode of pathogenicity: None; Publications: 25196541; Phenotypes: Tenorio syndrome - MIM# 616260; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4316 GTPBP3 Zornitza Stark reviewed gene: GTPBP3: Rating: GREEN; Mode of pathogenicity: None; Publications: 34276756, 25434004; Phenotypes: Combined oxidative phosphorylation deficiency 23 MIM#616198; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4316 CWC27 Zornitza Stark Phenotypes for gene: CWC27 were changed from to Retinitis pigmentosa with or without skeletal anomalies, MIM# 250410
Intellectual disability syndromic and non-syndromic v0.4313 CWC27 Zornitza Stark reviewed gene: CWC27: Rating: GREEN; Mode of pathogenicity: None; Publications: 28285769, 31481716; Phenotypes: Retinitis pigmentosa with or without skeletal anomalies, MIM# 250410; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4310 ELAC2 Zornitza Stark reviewed gene: ELAC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23849775, 31045291; Phenotypes: Combined oxidative phosphorylation deficiency 17, MIM#615440; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4307 CUL4B Zornitza Stark reviewed gene: CUL4B: Rating: GREEN; Mode of pathogenicity: None; Publications: 17236139, 19377476; Phenotypes: Mental retardation, X-linked, syndromic 15 (Cabezas type), MIM# 300354; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4307 CTNNB1 Zornitza Stark Phenotypes for gene: CTNNB1 were changed from to Neurodevelopmental disorder with spastic diplegia and visual defects , MIM#615075
Intellectual disability syndromic and non-syndromic v0.4304 CTNNB1 Zornitza Stark reviewed gene: CTNNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23033978, 24614104, 25326669, 27915094; Phenotypes: Neurodevelopmental disorder with spastic diplegia and visual defects , MIM#615075; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4301 CSNK2A1 Zornitza Stark reviewed gene: CSNK2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27048600, 29240241, 29383814; Phenotypes: Okur-Chung neurodevelopmental syndrome, MIM# 617062; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4298 MAF Zornitza Stark reviewed gene: MAF: Rating: GREEN; Mode of pathogenicity: None; Publications: 30160832, 34643041; Phenotypes: Ayme-Gripp syndrome (MIM#601088); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4298 CRB2 Zornitza Stark Phenotypes for gene: CRB2 were changed from to Ventriculomegaly with cystic kidney disease, MIM# 219730
Intellectual disability syndromic and non-syndromic v0.4295 CRB2 Zornitza Stark reviewed gene: CRB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25557780, 33687977, 32051522, 30212996, 33575434, 31438467, 30593785; Phenotypes: Ventriculomegaly with cystic kidney disease, MIM# 219730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4292 COLEC11 Zornitza Stark reviewed gene: COLEC11: Rating: GREEN; Mode of pathogenicity: None; Publications: 21258343, 26789649, 28301481; Phenotypes: 3MC syndrome 2, MIM# 265050; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4292 SPATA5L1 Zornitza Stark Phenotypes for gene: SPATA5L1 were changed from Intellectual disability; spastic-dystonic cerebral palsy; epilepsy; hearing loss to Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616
Intellectual disability syndromic and non-syndromic v0.4291 SPATA5L1 Zornitza Stark reviewed gene: SPATA5L1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4288 MEIS2 Zornitza Stark reviewed gene: MEIS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33427397, 25712757; Phenotypes: Cleft palate, cardiac defects, and mental retardation (MIM#600987); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4288 ATP1A2 Zornitza Stark Phenotypes for gene: ATP1A2 were changed from Alternating hemiplegia of childhood 1, MIM# 104290; Developmental and epileptic encephalopathy, polymicrogyria to Alternating hemiplegia of childhood 1, MIM# 104290; Developmental and epileptic encephalopathy 98, MIM# 619605
Intellectual disability syndromic and non-syndromic v0.4287 ATP1A2 Zornitza Stark edited their review of gene: ATP1A2: Changed phenotypes: Alternating hemiplegia of childhood 1, MIM# 104290, Developmental and epileptic encephalopathy 98, MIM# 619605
Intellectual disability syndromic and non-syndromic v0.4284 CNTNAP2 Zornitza Stark reviewed gene: CNTNAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16571880, 19896112, 27439707; Phenotypes: Cortical dysplasia-focal epilepsy syndrome, MIM# 610042; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4281 CKAP2L Zornitza Stark reviewed gene: CKAP2L: Rating: GREEN; Mode of pathogenicity: None; Publications: 25439729, 33913579, 29473684; Phenotypes: Filippi syndrome, MIM# 272440; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4278 IL1RAPL1 Ain Roesley reviewed gene: IL1RAPL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34452636, 27470653, 21484992, 18801879, 18801879; Phenotypes: Intellectual developmental disorder, X-linked 21 MIM#300143; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4275 CHKB Zornitza Stark reviewed gene: CHKB: Rating: GREEN; Mode of pathogenicity: None; Publications: 21665002, 23692895, 24997086; Phenotypes: Muscular dystrophy, congenital, megaconial type, MIM# 602541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4272 CHAMP1 Zornitza Stark reviewed gene: CHAMP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27148580, 26340335; Phenotypes: Mental retardation, autosomal dominant 40 (MIM#616579); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4269 CEP290 Zornitza Stark reviewed gene: CEP290: Rating: GREEN; Mode of pathogenicity: None; Publications: 16682973, 16682970, 17705300, 33370260, 32600475; Phenotypes: Joubert syndrome 5, MIM# 610188, Meckel syndrome 4, MIM# 611134, Bardet-Biedl syndrome 14, MIM# 615991; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4266 CENPJ Zornitza Stark reviewed gene: CENPJ: Rating: GREEN; Mode of pathogenicity: None; Publications: 20522431, 23166506, 15793586, 20978018, 22775483, 32677750, 32549991; Phenotypes: Microcephaly 6, primary, autosomal recessive, MIM# 608393, MONDO:0012029, Seckel syndrome 4, MIM# 613676, MONDO:0013358; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4266 CDKL5 Zornitza Stark Phenotypes for gene: CDKL5 were changed from to Developmental and epileptic encephalopathy 2, MIM# 300672
Intellectual disability syndromic and non-syndromic v0.4264 CDKL5 Zornitza Stark Mode of inheritance for gene: CDKL5 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4263 CDKL5 Zornitza Stark reviewed gene: CDKL5: Rating: GREEN; Mode of pathogenicity: None; Publications: 19793311; Phenotypes: Developmental and epileptic encephalopathy 2, MIM# 300672; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4262 SRCAP Zornitza Stark edited their review of gene: SRCAP: Changed phenotypes: Developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities, MIM# 619595
Intellectual disability syndromic and non-syndromic v0.4260 DDX3X Zornitza Stark Mode of inheritance for gene: DDX3X was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4260 DDX3X Zornitza Stark Mode of inheritance for gene: DDX3X was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4259 DDX3X Zornitza Stark reviewed gene: DDX3X: Rating: GREEN; Mode of pathogenicity: None; Publications: 30266093, 26235985, 25533962, 33528536, 30936465, 31274575, 30817323; Phenotypes: Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4255 ASXL1 Zornitza Stark reviewed gene: ASXL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29446906, 21706002; Phenotypes: Bohring-Opitz syndrome , MIM#605039; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4255 MYH10 Krithika Murali gene: MYH10 was added
gene: MYH10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list,Literature
Mode of inheritance for gene: MYH10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYH10 were set to 24825879; 24901346; 25356899; 22495309; 25003005
Phenotypes for gene: MYH10 were set to Microcephaly; Intellectual Disability
Review for gene: MYH10 was set to GREEN
Added comment: De novo variants were identified in 5 unrelated individuals with moderate-severe ID and developmental delay.

Other reported phenotypic features include microcephaly (4/5), IUGR/failure to thrive (4/5), cerebral atrophy (3/5), hydrocephalus (2/5), congenital bilateral hip dysplasia (2/5), cerebellar atrophy (1/5), congenital diaphragmatic hernia (1/5), cranial nerve palsy (1/5), nystagmus (1/5), dysplastic kidney (1/5).

Defects in heart development, body wall closure and other birth defects noted in mouse models.
Sources: Expert list, Literature
Intellectual disability syndromic and non-syndromic v0.4254 CSF1R Zornitza Stark gene: CSF1R was added
gene: CSF1R was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSF1R was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSF1R were set to 30982609; 33749994; 34135456
Phenotypes for gene: CSF1R were set to Brain abnormalities, neurodegeneration, and dysosteosclerosis, MIM# 618476; BANDDOS
Review for gene: CSF1R was set to AMBER
Added comment: Brain abnormalities, neurodegeneration, and dysosteosclerosis (BANDDOS) is an autosomal recessive disorder characterized by brain abnormalities, progressive neurologic deterioration, and sclerotic bone dysplasia similar to dysosteosclerosis (DOS). The age at onset is highly variable: some patients may present in infancy with hydrocephalus, global developmental delay, and hypotonia, whereas others may have onset of symptoms in the late teens or early twenties after normal development. Neurologic features include loss of previous motor and language skills, cognitive impairment, spasticity, and focal seizures. Brain imaging shows periventricular white matter abnormalities and calcifications, large cisterna magna or Dandy-Walker malformation, and sometimes agenesis of the corpus callosum.

Four unrelated families reported.

Note mono-allelic variants cause an adult-onset disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4252 RNPC3 Zornitza Stark gene: RNPC3 was added
gene: RNPC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNPC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNPC3 were set to 29866761; 32462814; 33650182
Phenotypes for gene: RNPC3 were set to Growth hormone deficiency; Intellectual disability
Review for gene: RNPC3 was set to AMBER
Added comment: Three families reported, ID in two.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4251 KCNQ2 Zornitza Stark Phenotypes for gene: KCNQ2 were changed from to Developmental and epileptic encephalopathy 7, MIM# 613720; Intellectual disability
Intellectual disability syndromic and non-syndromic v0.4248 KCNQ2 Zornitza Stark reviewed gene: KCNQ2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33659638, 33754465; Phenotypes: Developmental and epileptic encephalopathy 7, MIM# 613720, Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4248 OTUD7A Zornitza Stark Phenotypes for gene: OTUD7A were changed from Epileptic encephalopathy, intellectual disability, no OMIM# yet to Intellectual disability; Epilepsy
Intellectual disability syndromic and non-syndromic v0.4245 OTUD7A Zornitza Stark edited their review of gene: OTUD7A: Added comment: Additional patient reported in PMID 33381903, with hypotonia, ID and seizures. Bi-allelic LoF variants. Some supportive functional data.; Changed rating: AMBER; Changed publications: 31997314, 29395075, 29395074, 33381903; Changed phenotypes: Intellectual disability, Epilepsy
Intellectual disability syndromic and non-syndromic v0.4244 NUP85 Zornitza Stark gene: NUP85 was added
gene: NUP85 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NUP85 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NUP85 were set to 34170319; 30179222
Phenotypes for gene: NUP85 were set to Intellectual disability
Review for gene: NUP85 was set to AMBER
Added comment: Bi-allelic variants in this gene are associated with nephrotic syndrome in 3 families.

Phenotype expansion:

PMID: 34170319 - Ravindran et al 2021 report two pedigrees with an MCPH-SCKS phenotype spectrum without SRNS. In the first family, a 9 yo female, with consanguineous parents, is reported to have a missense variant in NUP85 (c.932G > A; p.R311Q). Intrauterine growth restriction was noticed. At birth microcephaly was observed (OFC < 3rd centile, < −3.6 SD) as well as hypotrophy [weight −2.8 SD), length 45 cm (−2.7 SD), both <3rd centile], facial dysmorphism, syndactyly, long and thin fingers, and bilateral pes adductus. She has severe developmental delay with strongly delayed motor milestones and absent speech. Drug-resistant, genetic epilepsy with focal-onset seizures started in the first year of life. She had no clinical, laboratory or radiological findings indicative of kidney dysfunction. In the second family, compound heterozygous missense variants in NUP85 were detected (c.1109A > G, c.1589 T > C;p.N370S, p.M530T ) in a fetus. MRI of the fetal brain at 24 + 2 GW indicated complete agenesis of the corpus callosum, abnormal sulcation in the left frontal lobe, nodularity of the frontal horn and trigone with focal puckering of the left lateral ventricle.

PMID: 30179222 - Braun et al 2018 - 2 individuals from 1 of the families reported with steroid-resistant nephrotic syndrome were also reported to have intellectual disability but showed no structural brain defects. The degree of intellectual disability is not stated. They were found to have 2 compound heterozygous alleles (c.405+1G>A and c.1741G>C, p.Ala581Pro) in NUP85.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4240 ALG1 Zornitza Stark reviewed gene: ALG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26931382; Phenotypes: Congenital disorder of glycosylation, type Ik, MIM# 608540; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4239 STT3A Zornitza Stark Mode of inheritance for gene: STT3A was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4238 KIAA0391 Zornitza Stark reviewed gene: KIAA0391: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4236 SPRED2 Zornitza Stark Phenotypes for gene: SPRED2 were changed from developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt to Rasopathy; developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt
Intellectual disability syndromic and non-syndromic v0.4233 STT3A Elena Savva reviewed gene: STT3A: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 34653363, 23842455, 30701557, 28424003; Phenotypes: Congenital disorder of glycosylation, type Iw MIM#615596; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4233 SPRED2 Dean Phelan gene: SPRED2 was added
gene: SPRED2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPRED2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPRED2 were set to PMID: 34626534
Phenotypes for gene: SPRED2 were set to developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt
Review for gene: SPRED2 was set to GREEN
Added comment: PMID: 34626534
Homozygosity for three different variants c.187C>T (p.Arg63∗), c.299T>C (p.Leu100Pro), and c.1142_1143delTT (p.Leu381Hisfs∗95) were identified in four subjects from three families. All variants severely affected protein stability, causing accelerated degradation, and variably perturbed SPRED2 functional behaviour. The clinical phenotype of the four affected individuals included developmental delay, intellectual disability, cardiac defects, short stature, skeletal anomalies, and a typical facial gestalt as major features, without the occurrence of the distinctive skin signs characterizing Legius syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4233 SPATA5L1 Paul De Fazio changed review comment from: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly.

In 25 patients for whom full phenotype datasets were available, all 25 had ID.
Sources: Literature; to: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly.

~53% of patients had ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4233 SPATA5L1 Paul De Fazio gene: SPATA5L1 was added
gene: SPATA5L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPATA5L1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPATA5L1 were set to 34626583
Phenotypes for gene: SPATA5L1 were set to Intellectual disability; spastic-dystonic cerebral palsy; epilepsy; hearing loss
Review for gene: SPATA5L1 was set to GREEN
gene: SPATA5L1 was marked as current diagnostic
Added comment: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly.

In 25 patients for whom full phenotype datasets were available, all 25 had ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4230 PHF6 Zornitza Stark reviewed gene: PHF6: Rating: GREEN; Mode of pathogenicity: None; Publications: 16912705; Phenotypes: Borjeson-Forssman-Lehmann syndrome, MIM# 301900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4230 GRIK2 Zornitza Stark Phenotypes for gene: GRIK2 were changed from Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant to Mental retardation, autosomal recessive, 6 MIM# 611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures, MIM# 619580
Intellectual disability syndromic and non-syndromic v0.4226 AHDC1 Zornitza Stark reviewed gene: AHDC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24791903, 27148574, 30152016; Phenotypes: Xia-Gibbs syndrome, MIM# 615829, AHDC1-related intellectual disability, obstructive sleep apnoea, mild dysmorphism syndrome MONDO:0014358; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4223 ACY1 Zornitza Stark reviewed gene: ACY1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16274666, 16465618, 17562838, 24117009; Phenotypes: Aminoacylase 1 deficiency, MIM# 609924; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4223 TFE3 Zornitza Stark Phenotypes for gene: TFE3 were changed from TFE3-associated neurodevelopmental disorder; Intellectual disability; Epilepsy; Coarse facial features to Intellectual developmental disorder, X-linked, syndromic, with pigmentary mosaicism and coarse facies, MIM# 301066; Intellectual disability; Epilepsy; Coarse facial features
Intellectual disability syndromic and non-syndromic v0.4222 TFE3 Zornitza Stark edited their review of gene: TFE3: Changed phenotypes: Intellectual developmental disorder, X-linked, syndromic, with pigmentary mosaicism and coarse facies, MIM# 301066, Intellectual disability, Epilepsy, Coarse facial features
Intellectual disability syndromic and non-syndromic v0.4222 ETHE1 Zornitza Stark Marked gene: ETHE1 as ready
Intellectual disability syndromic and non-syndromic v0.4222 ETHE1 Zornitza Stark Gene: ethe1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4222 ETHE1 Zornitza Stark Phenotypes for gene: ETHE1 were changed from to Ethylmalonic encephalopathy , MIM#602473
Intellectual disability syndromic and non-syndromic v0.4221 ETHE1 Zornitza Stark Publications for gene: ETHE1 were set to
Intellectual disability syndromic and non-syndromic v0.4220 ETHE1 Zornitza Stark Mode of inheritance for gene: ETHE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4219 ETHE1 Zornitza Stark reviewed gene: ETHE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14732903, 28933811; Phenotypes: Ethylmalonic encephalopathy , MIM#602473; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4218 IFT74 Zornitza Stark edited their review of gene: IFT74: Changed phenotypes: Bardet-Biedl syndrome 20, MIM# 617119, Joubert syndrome 40, MIM# 619582, Spermatogenic failure 58, MIM# 619585
Intellectual disability syndromic and non-syndromic v0.4218 TAOK1 Zornitza Stark Phenotypes for gene: TAOK1 were changed from Intellectual disability; hypotonia; macrocephaly to Developmental delay with or without intellectual impairment or behavioural abnormalities, MIM#619575; Intellectual disability; hypotonia; macrocephaly
Intellectual disability syndromic and non-syndromic v0.4217 TAOK1 Zornitza Stark reviewed gene: TAOK1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay with or without intellectual impairment or behavioural abnormalities, MIM#619575; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4214 ZNHIT3 Zornitza Stark gene: ZNHIT3 was added
gene: ZNHIT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNHIT3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNHIT3 were set to 28335020; 28335020; 31048081
Phenotypes for gene: ZNHIT3 were set to PEHO syndrome, MIM# 260565
Review for gene: ZNHIT3 was set to GREEN
Added comment: PEHO is a severe autosomal recessive neurodevelopmental disorder characterized by extreme cerebellar atrophy due to almost total loss of granule neurons. Affected individuals present in early infancy with hypotonia, profoundly delayed psychomotor development, optic atrophy, progressive atrophy of the cerebellum and brainstem, and dysmyelination. Most patients also develop infantile seizures that are often associated with hypsarrhythmia on EEG, and many have peripheral oedema. More than 20 affected individuals reported of Finnish origin, p.Ser31Leu is a founder variant. One compound het reported and supportive animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4213 FGF12 Zornitza Stark Phenotypes for gene: FGF12 were changed from to Developmental and epileptic encephalopathy 47, MIM# 617166
Intellectual disability syndromic and non-syndromic v0.4210 FGF12 Zornitza Stark reviewed gene: FGF12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32645220, 27164707, 27830185, 27872899; Phenotypes: Developmental and epileptic encephalopathy 47, MIM# 617166; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4208 KCTD13 Zornitza Stark edited their review of gene: KCTD13: Changed mode of inheritance: Unknown
Intellectual disability syndromic and non-syndromic v0.4207 NDUFA8 Krithika Murali gene: NDUFA8 was added
gene: NDUFA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDUFA8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA8 were set to 32385911; 33153867
Phenotypes for gene: NDUFA8 were set to Mitochondrial complex I deficiency, nuclear type 37- 619272; Epilepsy; Microcephaly; Developmental Delay
Review for gene: NDUFA8 was set to AMBER
Added comment: 3 individuals from 2 unrelated families reported with phenotypic features including microcephaly (1/3), seizures (2/3), developmental delay (3/3) and MRI-B changes (3/3).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4204 MAGEL2 Zornitza Stark reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, MIM# 615547; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.4203 NSRP1 Zornitza Stark reviewed gene: NSRP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4203 NSRP1 Krithika Murali gene: NSRP1 was added
gene: NSRP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSRP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSRP1 were set to 34385670
Phenotypes for gene: NSRP1 were set to Epilepsy; Cerebral palsy; microcephaly; Intellectual disability
Review for gene: NSRP1 was set to AMBER
Added comment: Novel gene regulating splicing. Biallelic LoF pathogenic variants reported in 6 individuals from 3 unrelated families associated with a phenotype characterized by developmental delay, epilepsy, microcephaly, and spastic cerebral palsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4202 GABRD Zornitza Stark gene: GABRD was added
gene: GABRD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABRD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRD were set to 15115768; 34633442
Phenotypes for gene: GABRD were set to Intellectual disability; Epilepsy; Susceptibility to epilepsy, MIM#613060
Review for gene: GABRD was set to GREEN
Added comment: Susceptibility to epilepsy, MIM#613060: Limited reports. The variant originally reported in PMID 15115768 in association with epilepsy is present in >4,000 hets in gnomad and 55 homs which is not consistent with a Mendelian disorder.

PMID 34633442: 10 individuals with 7 unique variants reported in individuals with neurodevelopmental disorders and epilepsy. Six of the variants were demonstrated to be GoF, and those individuals with neurodevelopmental disorders with behavioural issues, various degrees of intellectual disability, generalized epilepsy with atypical absences and generalized myoclonic and/or bilateral tonic-clonic seizures. In contrast, the one individual carrying a loss-of-function variant had normal intelligence, no seizure history but has a diagnosis of autism spectrum disorder and suffering from elevated internalizing psychiatric symptoms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4201 TNPO2 Zornitza Stark Phenotypes for gene: TNPO2 were changed from Intellectual disability, neurologic deficits and dysmorphic features to Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556
Intellectual disability syndromic and non-syndromic v0.4200 TNPO2 Zornitza Stark reviewed gene: TNPO2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4197 KCTD3 Zornitza Stark reviewed gene: KCTD3: Rating: GREEN; Mode of pathogenicity: None; Publications: 29406573; Phenotypes: Epilepsy, Intellectual disability, Posterior fossa abnormalities; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4195 ABHD16A Zornitza Stark reviewed gene: ABHD16A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4195 TARS2 Krithika Murali gene: TARS2 was added
gene: TARS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TARS2 were set to 33153448; 24827421; 34508595
Phenotypes for gene: TARS2 were set to Combined oxidative phosphorylation deficiency 21 - 615918; Epilepsy; Developmental Delay
Review for gene: TARS2 was set to GREEN
Added comment: 8 cases from 7 unrelated families are reported in the literature with a heterogenous phenotype characterised by either early-onset illness within the first months, of severe hypotonia, failure to thrive, epilepsy and early death, or onset after six months with a milder course and longer survival. Other phenotypic features include developmental delay (at least 3 out of 8 cases), MRI-B abnormalities and more rarely dystonia, regression, hyperhidrosis and hearing impairment.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4195 THG1L Zornitza Stark Marked gene: THG1L as ready
Intellectual disability syndromic and non-syndromic v0.4195 THG1L Zornitza Stark Gene: thg1l has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4195 THG1L Zornitza Stark Classified gene: THG1L as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4195 THG1L Zornitza Stark Gene: thg1l has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4194 THG1L Krithika Murali gene: THG1L was added
gene: THG1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: THG1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: THG1L were set to 33682303
Phenotypes for gene: THG1L were set to Spinocerebellar ataxia, autosomal recessive 28 - 618800; Epilepsy; Intellectual Disability
Review for gene: THG1L was set to AMBER
Added comment: 3 individuals from 2 unrelated families of Ashkenazi Jewish descent with compound heterozygous variants ( p.Cys51Trp and p.Val55Ala) presented with profound developmental delays, microcephaly, intractable epilepsy, and cerebellar hypoplasia.

Homozygous variants associated with ataxia phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4194 CELF2 Zornitza Stark Phenotypes for gene: CELF2 were changed from Developmental and epileptic encephalopathy to Developmental and epileptic encephalopathy 97, MIM#619561
Intellectual disability syndromic and non-syndromic v0.4193 CELF2 Zornitza Stark edited their review of gene: CELF2: Changed phenotypes: Developmental and epileptic encephalopathy 97, MIM#619561
Intellectual disability syndromic and non-syndromic v0.4192 AP1G1 Zornitza Stark edited their review of gene: AP1G1: Changed phenotypes: Usmani-Riazuddin syndrome, autosomal dominant, MIM# 619467, Usmani-Riazuddin syndrome, autosomal recessive, MIM# 619548, Neurodevelopmental disorder (NDD), Intellectual Disability, Epilepsy
Intellectual disability syndromic and non-syndromic v0.4187 CACNA1C Chirag Patel reviewed gene: CACNA1C: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34163037; Phenotypes: Neurodevelopmental abnormalities and epilepsy, no OMIM#; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4185 SHANK1 Chirag Patel reviewed gene: SHANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34113010; Phenotypes: Neurodevelopmental disorder, no OMIM#; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4184 PLXNA1 Chirag Patel gene: PLXNA1 was added
gene: PLXNA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLXNA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: PLXNA1 were set to PMID: 34054129
Phenotypes for gene: PLXNA1 were set to Neurodevelopmental disorder with cerebral and eye anomalies
Review for gene: PLXNA1 was set to GREEN
Added comment: Dworschak et al. (2021) via WES reported 10 patients from 7 families with biallelic (n=7) or de novo (n=3) PLXNA1 variants. Shared phenotypic features include global developmental delay (9/10), brain anomalies (6/10), and eye anomalies (7/10). Seizures were predominantly reported in patients with monoallelic variants. Zebrafish studies showed an embryonic role of plxna1a in the development of the central nervous system and the eye. Biallelic variants in the extracellular Plexin-A1 domains lead to impaired dimerization or lack of receptor molecules, whereas monoallelic variants in the intracellular Plexin-A1 domains might impair downstream signaling through a dominant-negative effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4180 HNRNPD Ee Ming Wong reviewed gene: HNRNPD: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33874999; Phenotypes: Neurodevelopmental disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4179 BPTF Zornitza Stark commented on gene: BPTF: Over 30 unrelated individuals reported, mostly de novo, some inherited variants. Clinical features include intellectual disability, seizures, poor growth with small head size, dysmorphic facial features, and mild abnormalities of the hands and feet.
Intellectual disability syndromic and non-syndromic v0.4179 BPTF Zornitza Stark edited their review of gene: BPTF: Changed publications: 28942966, 33522091
Intellectual disability syndromic and non-syndromic v0.4176 BCL11A Zornitza Stark reviewed gene: BCL11A: Rating: GREEN; Mode of pathogenicity: None; Publications: 27453576, 32903878; Phenotypes: Dias-Logan syndrome, MIM# 617101; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4175 SNIP1 Zornitza Stark changed review comment from: Three Amish individuals with same homozygous variant, founder effect.; to: Four Amish individuals with same homozygous variant, founder effect.
Intellectual disability syndromic and non-syndromic v0.4175 SNIP1 Zornitza Stark edited their review of gene: SNIP1: Changed publications: 22279524, 34570759
Intellectual disability syndromic and non-syndromic v0.4174 LONP1 Zornitza Stark Phenotypes for gene: LONP1 were changed from CODAS syndrome, MIM#600373; Mitochondrial cytopathy to CODAS syndrome, MIM#600373; Mitochondrial cytopathy
Intellectual disability syndromic and non-syndromic v0.4174 LONP1 Zornitza Stark Phenotypes for gene: LONP1 were changed from to CODAS syndrome, MIM#600373; Mitochondrial cytopathy
Intellectual disability syndromic and non-syndromic v0.4171 LONP1 Zornitza Stark reviewed gene: LONP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31636596; Phenotypes: CODAS syndrome, MIM#600373, Mitochondrial cytopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4171 WIPI2 Zornitza Stark Phenotypes for gene: WIPI2 were changed from Intellectual developmental disorder with short stature and variable skeletal anomalies 618453 to Intellectual developmental disorder with short stature and variable skeletal anomalies 618453; global developmental delay; intellectual disability; refractory infantile/childhood-onset epilepsy; progressive tetraplegia with joint contractures; dyskinesia; speech and visual impairment; autistic features; ataxic gait
Intellectual disability syndromic and non-syndromic v0.4166 ZDHHC15 Zornitza Stark reviewed gene: ZDHHC15: Rating: RED; Mode of pathogenicity: None; Publications: 34345675, 32989326; Phenotypes: Mental retardation, X-linked 91, 300577; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4166 ERBB4 Seb Lunke Added comment: Comment on list classification: CNVs only, not clear on the differentiation between ID and ALS.
Intellectual disability syndromic and non-syndromic v0.4164 WIPI2 Dean Phelan reviewed gene: WIPI2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30968111, 34557665; Phenotypes: global developmental delay, intellectual disability, refractory infantile/childhood-onset epilepsy, progressive tetraplegia with joint contractures, dyskinesia, speech and visual impairment, autistic features, ataxic gait; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4163 ABHD16A Lucy Spencer gene: ABHD16A was added
gene: ABHD16A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ABHD16A were set to PMID: 34587489
Phenotypes for gene: ABHD16A were set to Spastic paraplegia
Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls.
In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian.
4 missense variants, 1 frameshift, 1 nonsense.
From PMID: 34587489
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4162 ATP11A Elena Savva gene: ATP11A was added
gene: ATP11A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ATP11A were set to PMID: 34403372
Phenotypes for gene: ATP11A were set to Neurological disorder
Mode of pathogenicity for gene: ATP11A was set to Other
Review for gene: ATP11A was set to AMBER
Added comment: PMID: 34403372:
- Single de novo missense variant reported in a patient with developmental delay and neurological deterioration.
- Patient MRI showed severe cerebral atrophy, ventriculomegaly, hypomyelination leukodystrophy, thinned corpus callosum. Axonal neuropathy suggested.
- K/I heterozygous mice died perinatally.
- Functional studies on missense variant show plasma membrane lipid content impairment, reduced ATPase activity etc.

gnomAD: some NMD PTCs present, good quality variants found with 4-5 hets.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4162 ERBB4 Ain Roesley edited their review of gene: ERBB4: Changed phenotypes: intellectual disability
Intellectual disability syndromic and non-syndromic v0.4162 ERBB4 Ain Roesley gene: ERBB4 was added
gene: ERBB4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ERBB4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ERBB4 were set to 33603162
Penetrance for gene: ERBB4 were set to unknown
Review for gene: ERBB4 was set to GREEN
Added comment: CNVs reported only
exonic deletions:
3x families with ID, speech delays, aggressive outbursts (including 1x de novo)
1x family with global dev delay inherited from unaffected parent

exonic del with limited clinical info:
1x severe expressive language delay
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4161 SARS Bryony Thompson gene: SARS was added
gene: SARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SARS were set to 28236339; 34570399
Phenotypes for gene: SARS were set to Intellectual disability
Review for gene: SARS was set to AMBER
Added comment: Summary - 2 unrelated families with overlapping ID phenotype, and supporting in vitro and patient cell assays.
PMID: 28236339 - an Iranian family (distantly related) segregating a homozygous missense (c.514G>A, p.Asp172Asn) with moderate ID, microcephaly, ataxia, speech impairment, and aggressive behaviour. Also, supporting in vitro functional assays demonstrating altered protein function.
PMID: 34570399 - a consanguineous Turkish family segregating a homozygous missense (c.638G>T, p.(Arg213Leu)) with developmental delay, central deafness, cardiomyopathy, and metabolic decompensation during fever leading to death. Also, reduced protein level and enzymatic activity in patient cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4158 ZNF407 Zornitza Stark edited their review of gene: ZNF407: Changed rating: AMBER; Changed phenotypes: SIMHA syndrome, MIM# 619557; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4156 RNF113A Zornitza Stark reviewed gene: RNF113A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31880405; Phenotypes: Trichothiodystrophy 5, nonphotosensitive, OMIM #300953; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4156 RNF113A Zornitza Stark Mode of inheritance for gene: RNF113A was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4154 EIF3F Chirag Patel reviewed gene: EIF3F: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33736665; Phenotypes: EIF3F-related neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4154 CDH15 Zornitza Stark reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4150 CDH15 Elena Savva reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: Other; Publications: PMID: 19012874, 12052883, 28422132, 26506440; Phenotypes: Mental retardation, autosomal dominant 3 MIM#612580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4148 CPE Zornitza Stark edited their review of gene: CPE: Added comment: Bosch et al. 2021 (PMID: 34383079) reported on 4 individuals from 3 additional families harbouring 2 different homozygous truncating variants in this gene. Clinical presentation was prominent for obesity and intellectual disability. Hypogonadotropic hypogonadism was confirmed in one individual and was suspected but not tested for in another two subjects.; Changed rating: GREEN; Changed publications: 26120850, 32936766, 34383079; Changed phenotypes: Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326
Intellectual disability syndromic and non-syndromic v0.4148 HCFC1 Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541
Intellectual disability syndromic and non-syndromic v0.4145 HCFC1 Zornitza Stark reviewed gene: HCFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34164576, 24011988; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4141 CSTB Zornitza Stark reviewed gene: CSTB: Rating: RED; Mode of pathogenicity: None; Publications: 9012407, 9054946; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4140 ATP6V0C Zornitza Stark gene: ATP6V0C was added
gene: ATP6V0C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: ATP6V0C.
Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V0C were set to 33190975; 33090716
Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly
Review for gene: ATP6V0C was set to AMBER
Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4138 ARFGEF1 Zornitza Stark gene: ARFGEF1 was added
gene: ARFGEF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARFGEF1 were set to 34113008
Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy
Review for gene: ARFGEF1 was set to GREEN
Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4137 PRR12 Zornitza Stark Phenotypes for gene: PRR12 were changed from intellectual disability; iris abnormalities to Neuroocular syndrome, MIM#619539; Intellectual disability; Iris abnormalities; Complex microphthalmia
Intellectual disability syndromic and non-syndromic v0.4136 PRR12 Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Intellectual disability, Iris abnormalities, Complex microphthalmia
Intellectual disability syndromic and non-syndromic v0.4134 ZC4H2 Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4133 ZC4H2 Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4131 KIF4A Zornitza Stark edited their review of gene: KIF4A: Added comment: Further 11 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several.; Changed rating: GREEN; Changed publications: 24812067, 34346154
Intellectual disability syndromic and non-syndromic v0.4130 FAM149B1 Michelle Torres gene: FAM149B1 was added
gene: FAM149B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FAM149B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM149B1 were set to 30905400
Phenotypes for gene: FAM149B1 were set to Joubert; Ciliopathy
Review for gene: FAM149B1 was set to GREEN
gene: FAM149B1 was marked as current diagnostic
Added comment: Four unrelated, but consanguineous, families reported with 2 truncating variants. Developmental delay with hypotonia and intellectual disability are typical features, and many children have characteristic facies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4130 ZMYM2 Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Intellectual disability syndromic and non-syndromic v0.4129 ZMYM2 Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Intellectual disability syndromic and non-syndromic v0.4126 BCAP31 Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4123 AMPD2 Zornitza Stark reviewed gene: AMPD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23911318, 27066553; Phenotypes: Pontocerebellar hypoplasia, type 9, MIM#615809; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4119 HMGB1 Chirag Patel gene: HMGB1 was added
gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HMGB1 were set to PMID: 34164801
Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM #
Review for gene: HMGB1 was set to GREEN
Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4117 TAF2 Chirag Patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4116 DDX23 Chirag Patel reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34050707; Phenotypes: Neurodevelopmental disorder, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4115 COPB2 Zornitza Stark reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4112 MTRR Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4109 MTR Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4106 UMPS Zornitza Stark reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre Deleted their review
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: ; Mode of pathogenicity: None; Publications: 24076603, 30302899, 31397880; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.4104 PRICKLE2 Hazel Phillimore gene: PRICKLE2 was added
gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to PMID: 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.

Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4104 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4102 COPB2 Belinda Chong gene: COPB2 was added
gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COPB2 were set to PMID: 34450031
Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay
Review for gene: COPB2 was set to AMBER
Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis

3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4102 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4100 GRIK2 Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4099 GRIK2 Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4097 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4096 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Intellectual disability syndromic and non-syndromic v0.4095 GNB2 Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503
Intellectual disability syndromic and non-syndromic v0.4094 GNB2 Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503
Intellectual disability syndromic and non-syndromic v0.4093 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4091 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4090 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4088 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4087 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.4086 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4086 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Intellectual disability syndromic and non-syndromic v0.4085 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4081 WDR11 Konstantinos Varvagiannis reviewed gene: WDR11: Rating: AMBER; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Microcephaly, Short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4078 FGD1 Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4075 RAD21 Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4071 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4070 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4066 NIPBL Zornitza Stark reviewed gene: NIPBL: Rating: GREEN; Mode of pathogenicity: None; Publications: 16604071, 20358602, 16236812, 17661813; Phenotypes: Cornelia de Lange syndrome 1, MIM # 122470; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4066 IGF1 Zornitza Stark Phenotypes for gene: IGF1 were changed from to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747
Intellectual disability syndromic and non-syndromic v0.4064 IGF1 Zornitza Stark Mode of inheritance for gene: IGF1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4063 IGF1 Zornitza Stark reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4060 TCN2 Zornitza Stark reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 19373259, 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency, 275350; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis changed review comment from: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other; to: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.

Consider inclusion in panels for leukodystrophies, childhood onset ataxia, sensorineural hearing loss, corpus callosum anomalies, cardiomyopathies, hepatopathies, etc in all cases with green rating.

Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis gene: RNF220 was added
gene: RNF220 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Penetrance for gene: RNF220 were set to Complete
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4058 ARF3 Zornitza Stark reviewed gene: ARF3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4058 ARF3 Konstantinos Varvagiannis gene: ARF3 was added
gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Penetrance for gene: ARF3 were set to unknown
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4055 CEP57 Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266, 32861809, 30147898; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4054 SUPT16H Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum
Intellectual disability syndromic and non-syndromic v0.4053 SUPT16H Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum
Intellectual disability syndromic and non-syndromic v0.4053 PLXNA2 Konstantinos Varvagiannis gene: PLXNA2 was added
gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNA2 were set to 34327814
Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology
Penetrance for gene: PLXNA2 were set to Incomplete
Review for gene: PLXNA2 was set to AMBER
Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants.

The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members.

Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)).

Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed).

The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed).

Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved.

Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele.

As the authors discuss:
*PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration.
*Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch.
*Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD.
*Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus.

Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg:
- Cyanotic heart disease explaining discordance in cognitive outcome among sibs
- Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or
- Additional pathogenic variants possibly explaining the CHD in the first subject.

There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes.
Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4052 HNMT Zornitza Stark edited their review of gene: HNMT: Added comment: Verhoeven et al. 2020 (PMID: 33310825) report an adult male patient with severe intellectual disability and autism, born to second cousins, with a homozygous nonsense variant (c.88C>T; p.Gln30*). Treatment with antihistaminergic medication and a histamine-restricted diet resulted in significant general improvement, supporting an etiological role for HNMT deficiency. Taskiran et al. 2021 (PMID: 33739554) report an adult male patient with severe intellectual disability, pervasive developmental disorder and ADHD, born to consanguineous parents, with a homozygous nonsense variant (c.100G>T; p.Glu34*).; Changed publications: 26206890, 30744146, 33310825, 33739554
Intellectual disability syndromic and non-syndromic v0.4051 VPS50 Konstantinos Varvagiannis gene: VPS50 was added
gene: VPS50 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Penetrance for gene: VPS50 were set to Complete
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.

Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4048 ROGDI Zornitza Stark reviewed gene: ROGDI: Rating: GREEN; Mode of pathogenicity: None; Publications: 22424600, 23086778, 33866847; Phenotypes: Kohlschutter-Tonz syndrome, MIM# 226750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4047 TMEM222 Zornitza Stark Phenotypes for gene: TMEM222 were changed from Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality to Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality
Intellectual disability syndromic and non-syndromic v0.4046 TMEM222 Zornitza Stark reviewed gene: TMEM222: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4043 TCF7L2 Konstantinos Varvagiannis reviewed gene: TCF7L2: Rating: AMBER; Mode of pathogenicity: None; Publications: 34003604; Phenotypes: Global developmental delay, Intellectual disability, Autism, Attention deficit hyperactivity disorder, Myopia, Abnormality of skeletal system; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.4041 JAKMIP1 Seb Lunke gene: JAKMIP1 was added
gene: JAKMIP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JAKMIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: JAKMIP1 were set to 29158550; 26627310; 27799067
Phenotypes for gene: JAKMIP1 were set to Intellectual disability; Seizures
Review for gene: JAKMIP1 was set to AMBER
Added comment: Identified in two independent patients in the literature with a mouse model. Patient 1 (27799067) with developmental delay, speech delay, and cognitive impairment; self-injurious and aggressive behaviour, seizures, dysmorphic features. De-novo missense JAKMIP1 (p.D586H). Patient 2 (29158550) with feeding difficulties, hypotonia, epilepsy, severe ID, no active speech, kyphoscoliosis, constipation, autism, short stature. Splice variant c.1432-2A>G, no segregation or RNA data available. KO mouse model (27799067) displays social deficits, stereotyped activity, abnormal postnatal vocalizations, and other autistic-like behaviors.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4040 PIDD1 Konstantinos Varvagiannis gene: PIDD1 was added
gene: PIDD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010
Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum
Penetrance for gene: PIDD1 were set to Complete
Review for gene: PIDD1 was set to GREEN
Added comment: There is enough evidence to include this gene in the current panel with green rating.

Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested.

The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families].

Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants.

Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder.

PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage.

There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation.

Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants.

Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26

Evidence so far provided includes:
- Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern.
- Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability.
- Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp]
- Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain.
- Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD.

Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects.

There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes.

Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4040 SHOC2 Zornitza Stark Phenotypes for gene: SHOC2 were changed from to Noonan syndrome-like with loose anagen hair 1, MIM# 607721
Intellectual disability syndromic and non-syndromic v0.4038 SHOC2 Zornitza Stark Mode of pathogenicity for gene: SHOC2 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.4036 SHOC2 Zornitza Stark reviewed gene: SHOC2: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 19684605, 23918763, 20882035; Phenotypes: Noonan syndrome-like with loose anagen hair 1, MIM# 607721; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4033 UBR1 Zornitza Stark changed review comment from: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, mental retardation, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.; to: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, intellectual disability, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.
Intellectual disability syndromic and non-syndromic v0.4033 UBR1 Zornitza Stark reviewed gene: UBR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24599544; Phenotypes: Johanson-Blizzard syndrome (MIM#243800); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4033 ACTL6A Zornitza Stark changed review comment from: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.; to: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.
PMID 31994175: fourth individual reported, recurrent de novo p.Arg377Trp
Intellectual disability syndromic and non-syndromic v0.4033 ACTL6A Zornitza Stark edited their review of gene: ACTL6A: Changed publications: 28649782, 31994175
Intellectual disability syndromic and non-syndromic v0.4033 ACTL6A Zornitza Stark changed review comment from: Two individuals from unrelated families reported with missense variants in this gene. Part of the BAF complex. Only one confirmed de novo.; to: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.
Intellectual disability syndromic and non-syndromic v0.4030 SNRPB Zornitza Stark reviewed gene: SNRPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25047197, 25504470, 26971886; Phenotypes: Cerebrocostomandibular syndrome, MIM# 117650; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4029 TP73 Zornitza Stark edited their review of gene: TP73: Added comment: Additional 5 families reported in PMID 34077761; Changed rating: GREEN; Changed publications: 31130284, 34077761; Changed phenotypes: Ciliary dyskinesia, primary, 47, and lissencephaly, MIM#619466, Intellectual disability, lissencephaly
Intellectual disability syndromic and non-syndromic v0.4028 MAST3 Zornitza Stark gene: MAST3 was added
gene: MAST3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAST3 were set to 34185323
Phenotypes for gene: MAST3 were set to Developmental and epileptic encephalopathy
Review for gene: MAST3 was set to GREEN
Added comment: Eleven individuals reported with de novo missense variants in the STK domain, including two recurrent variants p.G510S (n = 5) and p.G515S (n = 3). All 11 individuals had developmental and epileptic encephalopathy, with 8 having normal development prior to seizure onset at <2 years of age. All patients developed multiple seizure types, 9 of 11 patients had seizures triggered by fever and 9 of 11 patients had drug-resistant seizures. Limited functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4026 TRIM8 Zornitza Stark edited their review of gene: TRIM8: Changed phenotypes: Focal segmental glomerulosclerosis and neurodevelopmental syndrome, MIM# 619428, Intellectual disability, Seizures, FSGS
Intellectual disability syndromic and non-syndromic v0.4026 RNF2 Zornitza Stark Phenotypes for gene: RNF2 were changed from epilepsy; intellectual disability; intrauterine growth retardation to Lou-Schoch-Yamamoto syndrome , MIM#619460; epilepsy; intellectual disability; intrauterine growth retardation
Intellectual disability syndromic and non-syndromic v0.4025 RNF2 Zornitza Stark edited their review of gene: RNF2: Changed phenotypes: Lou-Schoch-Yamamoto syndrome , MIM#619460, epilepsy, intellectual disability, intrauterine growth retardation
Intellectual disability syndromic and non-syndromic v0.4024 USP7 Zornitza Stark edited their review of gene: USP7: Changed phenotypes: Hao-Fountain syndrome, MIM# 616863, MONDO:0014805, Intellectual disability, Autism
Intellectual disability syndromic and non-syndromic v0.4023 AP1G1 Zornitza Stark changed review comment from: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants.

Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site.

Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality.

All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe.
Sources: Literature; to: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants.

Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site.

Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality.

All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe.

GREEN for mono-allelic, AMBER for bi-allelic.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4023 AP1G1 Zornitza Stark gene: AP1G1 was added
gene: AP1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AP1G1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: AP1G1 were set to 34102099
Phenotypes for gene: AP1G1 were set to Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy
Review for gene: AP1G1 was set to GREEN
Added comment: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants.

Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site.

Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality.

All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4020 CLCN3 Zornitza Stark gene: CLCN3 was added
gene: CLCN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLCN3 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: CLCN3 were set to 34186028
Phenotypes for gene: CLCN3 were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CLCN3 was set to Other
Review for gene: CLCN3 was set to GREEN
Added comment: 11 individuals reported, 9 that carried 8 different rare heterozygous missense variants in CLCN3, and 2 siblings that were homozygous for an NMD-predicted frameshift variant likely abolishing ClC-3 function. All missense variants were confirmed to be de novo in eight individuals for whom parental data was available.

The 11 individuals in the cohort share clinical features of variable severity. All 11 have GDD or ID and dysmorphic features, and a majority has mood or behavioural disorders and structural brain abnormalities:
- Structural brain abnormalities on MRI (9/11) included partial or full agenesis of the corpus callosum (6/9), disorganized cerebellar folia (4/9), delayed myelination (3/9), decreased white matter volume (3/9), pons hypoplasia (3/9), and dysmorphic dentate nuclei (3/9). Six of those with brain abnormalities also presented with seizures.
- Nine have abnormal vision, including strabismus in four and inability to fix or follow in the two with homozygous loss-of-function variants.
- Hypotonia ranging from mild to severe was reported in 7 of the 11 individuals.
- Six have mood or behavioural disorders, particularly anxiety (3/6).
- Consistent dysmorphic facial features included microcephaly, prominent forehead, hypertelorism, down-slanting palpebral fissures, full cheeks, and micrognathia.

The severity of disease in the two siblings with homozygous disruption of ClC-3 is consistent with the drastic phenotype seen in Clcn3 KO mice. The disease was more severe in two siblings carrying homozygous loss-of-function variants with the presence of GDD, absent speech, seizures, and salt and pepper fundal pigmentation in both individuals, with one deceased at 14 months of age. The siblings also had significant neuroanatomical findings including diffusely decreased white matter volume, thin corpora callosa, small hippocampi, and disorganized cerebellar folia. Supporting biallelic inheritance for LoF variants, disruption of mouse Clcn3 results in drastic neurodegeneration with loss of the hippocampus a few months after birth and early retinal degeneration. Clcn3−/− mice display severe neurodegeneration, whereas heterozygous Clcn3+/− mice appear normal.

Patch-clamp studies were used to investigate four of the missense variants. These suggested a gain of function in two variants with increased current in HEK cells, however they also showed reduced rectification of voltage and a loss of transient current, plus decreased current amplitude, glycosylation and surface expression when expressed in oocytes, and were suspected to interfere with channel gating and a negative feedback mechanism. These effects were also shown to vary depending on pH levels. The current of the remaining two variants did not differ from WT. For heterozygous missense variants, the disruption induced may be at least partially conferred to mutant/WT homodimers and mutant/ClC-4 heterodimers.

Both loss and gain of function in this gene resulted in the same phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4017 TNPO2 Elena Savva gene: TNPO2 was added
gene: TNPO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TNPO2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TNPO2 were set to PMID: 34314705
Phenotypes for gene: TNPO2 were set to Developmental delays, neurologic deficits and dysmorphic features
Mode of pathogenicity for gene: TNPO2 was set to Other
Review for gene: TNPO2 was set to GREEN
Added comment: PMID: 34314705 - all de novo missense variants with intellectual disability (9/9), speech impairment (15/15), motor impairment (15/15), ophthalmologic abnormalities (10/15), muscle tone abnormalities (11/15, primarily hypotonia), seizures (6/15, febrile to non-febrile), microcephaly (5/15) and MRI anomalies (7/13, 3/13 had cerebellar hypoplasia/dysplasia).

Null fly model was homozygous lethal, no obvious phenotypes in heterozygotes. Upregulated gene expression also resulted in lethality. Overexpression of some human variants in fly models resulted in "toxicity" and phenotypic defects, authors speculate two variants are GOF, 1 variant is LOF.

gnomAD: minimal PTCs present
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4016 SPTBN1 Belinda Chong changed review comment from: PMID: 34211179
- Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features.
- Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics.

PMID: 33847457
- Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset.
- identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities).
- Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis.
Sources: Literature
Sources: Literature; to: PMID: 34211179
- Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures (9/29); behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features.
- Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics.

PMID: 33847457
- Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset.
- identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities).
- Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis.
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4015 SPTBN1 Belinda Chong gene: SPTBN1 was added
gene: SPTBN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPTBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPTBN1 were set to PMID: 34211179 PMID: 33847457
Phenotypes for gene: SPTBN1 were set to Neurodevelopmental Syndrome
Review for gene: SPTBN1 was set to GREEN
Added comment: PMID: 34211179
- Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features.
- Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics.

PMID: 33847457
- Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset.
- identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities).
- Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis.
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4013 EDEM3 Michelle Torres gene: EDEM3 was added
gene: EDEM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EDEM3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EDEM3 were set to 34143952
Phenotypes for gene: EDEM3 were set to EDEM3-congenital disorder of glycosylation
Review for gene: EDEM3 was set to GREEN
Added comment: PMID: 34143952: 7 families (11 individuals) with 6x PTV and 2x missense variants with neurodevelopmental delay and variable facial dysmorphisms. The unaffected parents were all heterozygous carriers. Functional show LoF of EDEM3 enzymatic activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4009 ANK2 Zornitza Stark reviewed gene: ANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22542183, 25363768, 27479843, 28554332, 30564305, 30755392, 31981491, 33004838, 33057194; Phenotypes: Complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4009 ANK2 Anna Le Fevre edited their review of gene: ANK2: Changed phenotypes: intellectual disability, autism
Intellectual disability syndromic and non-syndromic v0.4009 ANK2 Anna Le Fevre gene: ANK2 was added
gene: ANK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: ANK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANK2 were set to 22542183, 25363768, 27479843, 28554332, 30564305, 30755392, 31981491
Phenotypes for gene: ANK2 were set to intellectual disability
Penetrance for gene: ANK2 were set to unknown
Added comment: Curated by ClinGen 2020 as definitively associated
? consider taking gene off incidentalome gene list
Sources: Other
Intellectual disability syndromic and non-syndromic v0.4009 EIF4A3 Zornitza Stark Phenotypes for gene: EIF4A3 were changed from to Robin sequence with cleft mandible and limb anomalies, MIM# 268305; Richieri-Costa-Pereira syndrome
Intellectual disability syndromic and non-syndromic v0.4006 EIF4A3 Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4003 HSD17B4 Zornitza Stark reviewed gene: HSD17B4: Rating: GREEN; Mode of pathogenicity: None; Publications: 27790638; Phenotypes: D-bifunctional protein deficiency, AR (MIM#261515), Perrault syndrome 1, AR (MIM#233400); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4002 SYNCRIP Konstantinos Varvagiannis gene: SYNCRIP was added
gene: SYNCRIP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SYNCRIP were set to 34157790; 30504930; 27479843; 23020937
Phenotypes for gene: SYNCRIP were set to Global developmental delay; Intellectual disability; Autism; Myoclonic atonic seizures; Abnormality of nervous system morphology
Review for gene: SYNCRIP was set to AMBER
Added comment: Semino et al (2021 - PMID: 34157790) provide clinical details on 3 unrelated individuals with de novo SYNCRIP variants and provide a review of 5 additional subjects previously identified within large cohorts in the literature and databases.

Features included DD, ID (7/7 for whom this information was available), ASD or autistic features (4/7). MRI abnormalities were observed in 3 (widening of CSF spaces, periventricular nodular heterotopia, prominent lat. ventricles). Epilepsy (myoclonic-astatic epilepsy / Doose syndrome) was reported for 2(/8) individuals.

The 3 patients here reported were identified following trio/singleton exome with Sanger confirmation of the variants and their de novo occurrence.

Variants are in almost all cases de novo (7/7 for whom this was known) and in 5/8 cases were pLoF, in 2/8 missense SNVs while a case from DECIPHER had a 77.92 kb whole gene deletion not involving other genes with unknown inheritance.

Overall the variants reported to date include [NM_006372.5]:
1 - c.858_859del p.(Gly287Leufs*5)
2 - c.854dupA p.(Asn285Lysfs*8)
3 - c.734T>C p.(Leu245Pro)
4 - chr6:85605276-85683190 deletion (GRCh38)
5 - c.629T>C p.(Phe210Ser)
6 - c.1573_1574delinsTT p.(Gln525Leu)
7 - c.1247_1250del p.(Arg416Lysfs*145)
8 - c.1518_1519insC p.(Ala507Argfs*14)

[P1-3: this report, P4: DECIPHER 254774, P5-6: Guo et al 2019 - PMID: 30504930, P7: Lelieveld et al 2016 - PMID: 27479843, P8: Rauch et al 2012 - PMID: 23020937 / all other Refs not here reviewed, clinical details summarized by Semino et al in table 1]

SYNCRIP (also known as HNRNPQ) encodes synaptotagmin‐binding cytoplasmic RNA‐interacting protein. As the authors note, this RNA-binding protein is involved in multiple pathways associated with neuronal/muscular developmental disorders. Several references are provided for its involvement in regulation of RNA metabolism, among others sequence recognition, pre-mRNA splicing, translation, transport and degradation.

Mutations in other RNA-interacting proteins and hnRNP members (e.g. HNRNPU, HNRNPD) are associated with NDD.

The missense variant (p.Leu245Pro) is within RRM2 one of the 3 RNA recognition motif (RRM) domains of the protein. These 3 domains, corresponding to the central part of the protein (aa 150-400), are relatively intolerant to variation (based on in silico predictions and/or variation in gnomAD). Leu245 localizes within an RNA binding pocket and in silico modeling suggests alteration of the tertiary structure and RNA-binding capacity of RRM2.

There are no additional studies performed.

Overall haploinsufficiency appears to be the underlying disease mechanism based on the truncating variants and the gene deletion. [pLI in gnomAD : 1, %HI : 2.48%]

Animal models are not discussed.

There is no associated phenotype in OMIM. This gene is included in the DD panel of G2P (monoallelic LoF variants / SYNCRIP-related developmental disorder). SysID also lists SYNCRIP within the current primary ID genes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4001 CAMK4 Konstantinos Varvagiannis gene: CAMK4 was added
gene: CAMK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: CAMK4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CAMK4 were set to 30262571; 33098801; 33211350
Phenotypes for gene: CAMK4 were set to Global developmental delay; Intellectual disability; Autism; Behavioral abnormality; Abnormality of movement; Dystonia; Ataxia; Chorea; Myoclonus
Penetrance for gene: CAMK4 were set to Complete
Review for gene: CAMK4 was set to GREEN
Added comment: 3 publications by Zech et al (2018, 2020 - PMIDs : 30262571, 33098801, 33211350) provide clinical details on 3 individuals, each harboring a private de novo CAMK4 variant.

Overlapping features included DD, ID, behavoral issues, autism and abnormal hyperkinetic movements. Dystonia and chorea in all 3 appeared 3-20 years after initial symptoms.

CAMK4 encodes Calcium/Calmodulin-dependent protein kinase IV, an important mediator of calcium-mediated activity and dynamics, particularly in the brain. It is involved in neuronal transmission, synaptic plasticity, and neuronal gene expression required for brain development and neuronal homeostasis (summary by OMIM based on Zech et al, 2018).

The 473 aa enzyme has a protein kinase domain (aa 46-300) and a C-terminal autoregulatory domain (aa 305-341) the latter comprising an autoinhibitory domain (AID / aa 305-321) and a calmodulin-binding domain (CBD / aa 322-341) [NP_001735.1 / NM_001744.4 - also used below].

Variants in all 3 subjects were identified following trio-WES and were in all cases protein-truncating, mapping to exon 10 or exon 10-intron 10 junction, expected to escape NMD and cause selective abrogation of the autoinhibitory domain (aa 305-321) leading overall to gain-of-function.

Variation databases include pLoF CAMK4 variants albeit in all cases usptream or downstream of this region (pLI of this gene in gnomAD: 0.51). Variants leading to selective abrogation of the autoregulatory domain have not been reported.

Extensive evidence for the GoF effect of the variant has been provided in the first publication. Several previous studies have demonstrated that abrogation of the AID domain leads to consitutive activation (details below).

Mouse models - though corresponding to homozygous loss of function - support a role for CAMKIV in cognitive and motor symptoms. Null mice display tremulous and ataxic movements, deficiencies in balance and sensorimotor performance associated with reduced number of Purkinje neurons (Ribar et al 2000, PMID: 11069976 - not reviewed). Wei et al (2002, PMID: 12006982 - not reviewed) provided evidence for alteration in hippocampal physiology and memory function.

Heterozygous mutations in other genes for calcium/calmodulin-dependent protein kinases (CAMKs) e.g. CAMK2A/CAMK2B (encoding subunits of CAMKII) have been reported in individuals with ID.

---

The proband in the first publication (PMID: 30262571) was a male with DD, ID, behavioral difficulties (ASD, autoaggression, stereotypies) and hyperkinetic movement disorder (myoclonus, chorea, ataxia) with severe generalized dystonia (onset at the age of 13y). Brain MRI demonstrated cerebellar atrophy.

Extensive work-up incl. karyotyping, CMA, DYT-TOR1A, THAP1, GCH1, SCA1/2/3/6/7/8/12/17, Friedreich's ataxia and FMR1 analysis was negative.F

Trio WES identified a dn splice site variant (c.981+1G>A) in the last exon-intron junction. RT-PCR followed by gel electrophoresis and Sanger in fibroblasts from an affected and control subject revealed that the proband had - as predicted by the type/location of the variant - in equal amount 2 cDNA products, a normal as well as a truncated one.

Sequencing of the shortest revealed utilization of a cryptic donor splice site upstream of the mutated donor leading to a 77bp out-of-frame deletion and introduction of a premature stop codon in the last codon (p.Lys303Serfs*28). Western blot in fibroblast cell lines revealed 2 bands corresponding to the normal protein product as well as to the p.Lys303Serfs*28 although expression of the latter was lower than that of the full length protein.

Several previous studies have shown that mutant CAMKIV species that lack the autoinhibitory domain are consitutively active (several Refs provided). Among others Chatila et al (1996, PMID: 8702940) studied an in vitro-engineered truncation mutant (Δ1-317 - truncation at position 317 of the protein) with functionally validated gain-of-function effect.

To prove enhanced activity of the splicing variant, Zech et al assessed phosphorylation of CREB (cyclic AMP-responsive element binding protein), a downstream substrate of CAMKIV. Immunobloting revealed significant increase of CREB phosphorylation in patient fibroblasts compared to controls. Overactivation of CAMKIV signaling was reversed when cells were treated with STO-609 an inhibitor of CAMKK, the ustream activator of CAMKIV.

Overall the authors demonstrated that loss of CAMKIV autoregulatory domain due to this splice variant had a gain-of-function effect.

----

Following trio-WES, Zech et al (2020 - PMID: 33098801) identified another relevant subject within cohort of 764 individuals with dystonia. This 12-y.o. male, harboring a different variant affecting the same donor site (c.981+1G>T), presented DD, ID, dystonia (onset at 3y) and additional movement disorders (myoclonus, ataxia) as well as similar behavior (ASD, autoaggression, stereotypies). [Details in suppl. p20].

----

Finally Zech et al (2020 - PMID: 33211350) reported on a 24-y.o. woman with adolescence onset choreodystonia. Other features included DD, moderate ID, absence seizures in infancy, OCD with anxiety and later diagnosis of ASD. Trio WES revealed a dn stopgain variant (c.940C>T; p.Gln314*).

----

There is no associated phenotype in OMIM, G2P.

In SysID CAMK4 is listed among the current primary ID genes.

----

Please consider inclusion in other relevant panels.
Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4001 DPYSL5 Zornitza Stark Phenotypes for gene: DPYSL5 were changed from Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities to Ritscher-Schinzel syndrome 4, MIM# 619435; Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities
Intellectual disability syndromic and non-syndromic v0.4000 DPYSL5 Zornitza Stark edited their review of gene: DPYSL5: Changed phenotypes: Ritscher-Schinzel syndrome 4, MIM# 619435, Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities
Intellectual disability syndromic and non-syndromic v0.3995 DDB1 Zornitza Stark edited their review of gene: DDB1: Changed phenotypes: White-Kernohan syndrome, MIM# 619426, Syndromic intellectual disability
Intellectual disability syndromic and non-syndromic v0.3995 WDR26 Paul De Fazio reviewed gene: WDR26: Rating: GREEN; Mode of pathogenicity: None; Publications: 28686853, 33506510, 33675273; Phenotypes: Skraban-Deardorff syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3995 ABCD4 Zornitza Stark Phenotypes for gene: ABCD4 were changed from to Methylmalonic aciduria and homocystinuria, cblJ type, MIM# 614857
Intellectual disability syndromic and non-syndromic v0.3992 ABCD4 Zornitza Stark reviewed gene: ABCD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22922874, 31113616, 30651581, 28572511, 33729671; Phenotypes: Methylmalonic aciduria and homocystinuria, cblJ type, MIM# 614857; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3989 CCBE1 Zornitza Stark reviewed gene: CCBE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19935664, 19911200, 19287381, 25925991, 27345729, 21778431; Phenotypes: Hennekam lymphangiectasia- lymphoedema syndrome MIM# 235510, lymphangiectasia and lymphoedema, facial abnormalities, dysmorphic features, hypoalbuminaemia, intellectual disability, hypoglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3987 SUFU Zornitza Stark Mode of inheritance for gene: SUFU was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3985 SUFU Zornitza Stark edited their review of gene: SUFU: Added comment: Heterozygous truncating variants in SUFU in 15 subjects from 6 unrelated families of various ethnic backgrounds (familial and de novo cases). Clinical features of early-onset (congenital) ocular ataxia and developmental delay, with some phenotypic variability. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign of Joubert syndrome. Paper reports that condition reported here and SUFU-associated Basal cell nevus syndrome (Gorlin) are likely allelic disorders, as there is currently no convincing evidence for a clinical overlap.

Functional studies showed no differences in cilia occurrence, morphology, or localization of ciliary proteins, such as smoothened. However, analysis of expression of HH signaling target genes detected a significant increase in the general signaling activity in COMA patient–derived fibroblasts compared with control cells. We observed higher basal HH signaling activity resulting in increased basal expression levels of GLI1, GLI2, GLI3, and Patched1. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign. Knockout mice with SuFu deficiency demonstrated that SuFu is required for proper midhindbrain patterning and controls cerebellar patterning.; Changed rating: GREEN; Changed publications: 28965847, 33024317; Changed phenotypes: Joubert syndrome 32, MIM#617757, SUFU-related neurodevelopmental syndrome; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3984 PCDHGC4 Zornitza Stark gene: PCDHGC4 was added
gene: PCDHGC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PCDHGC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCDHGC4 were set to 34244665
Phenotypes for gene: PCDHGC4 were set to Intellectual disability; Seizures
Review for gene: PCDHGC4 was set to GREEN
Added comment: Eight variants reported in 19 members of nine unreleted families with a neurodevelopmental syndrome. Severe or moderate intellectual disabilty in eight families and seizures in four families. Four of the variants were LoF, in silico analysis of the remaining missense (n=3) and splice variants were predicted to be pathogenic.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3982 CEP85L Zornitza Stark gene: CEP85L was added
gene: CEP85L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CEP85L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CEP85L were set to 32097630
Phenotypes for gene: CEP85L were set to Lissencephaly, posterior predominant
Review for gene: CEP85L was set to GREEN
Added comment: Thirteen individuals reported with mono allelic variants in this gene, inherited in two of the families. Mouse model had neuronal migration defects.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.3980 LINGO1 Zornitza Stark edited their review of gene: LINGO1: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v0.3980 IMPDH2 Zornitza Stark reviewed gene: IMPDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with dystonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3980 IMPDH2 Zornitza Stark Phenotypes for gene: IMPDH2 were changed from to Neurodevelopmental disorder with dystonia
Intellectual disability syndromic and non-syndromic v0.3978 IMPDH2 Laura Raiti gene: IMPDH2 was added
gene: IMPDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IMPDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: IMPDH2 were set to PMID: 33098801
Added comment: 6 unrelated individuals
1x individual in a dystonia cohort index case with infancy-onset dystonia and other neurological manifestations with a de-novo missense variant, c.338G>A (p.Gly113Glu) in IMPDH2, predicted to disrupt an invariant residue within the cystathionine-β-synthase (CBS) domain pair of the encoded protein.
IMPDH2 encodes IMPDH2, a key enzyme in the purine biosynthetic pathway, expressed throughout the brain and not linked previously to any human Mendelian condition.
1x individual with a de-novo substitution, c.337G>A (p.Gly113Arg), was found in in-house whole-exome sequencing data from 500 individuals with neurodevelopmental disorders. Through GeneMatcher, de novo variants identified:
3 x missense: c.729G>C (p.Gln243His), c.619G>C (p.Gly207Arg), and c.619G>A (p.Gly207Arg)
1 x deletion: c.478_480delTCC (p.Ser160del)
The six variants were predicted to be deleterious and none of them seen in control databases. All affected conserved amino acids and resided in and around the cystathionine-β-synthase domain pair.
The described variants are situated in and around the CBS domain pair, a regulatory element in which clustering of pathogenic missense variants has already been shown for the homologue of IMPDH2, IMPDH1.

The variant carriers shared similar neurodevelopmental phenotypes. Apart from the dystonia cohort index case, one participant had evidence of dystonic posturing. Modelling of the variants on 3D protein structures revealed spatial clustering near specific functional sites, predicted to result in deregulation of IMPDH2 activity. Additionally, thermal-shift assays showed that the c.619G>A (p.Gly207Arg) variant, identified as within the CBS domain pair, and c.729G>C (p.Gln243His), which is in close vicinity, affected the stability or folding behaviour of IMPDH2.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3978 ATG7 Zornitza Stark changed review comment from: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature; to: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3978 ATG7 Zornitza Stark changed review comment from: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The ore severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature; to: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3977 ATG7 Zornitza Stark gene: ATG7 was added
gene: ATG7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATG7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATG7 were set to 34161705
Phenotypes for gene: ATG7 were set to Spinocerebellar ataxia, SCAR31, MIM#619422
Review for gene: ATG7 was set to GREEN
Added comment: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The ore severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3975 C2orf69 Zornitza Stark gene: C2orf69 was added
gene: C2orf69 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C2orf69 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C2orf69 were set to 34038740; 33945503
Phenotypes for gene: C2orf69 were set to Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423
Review for gene: C2orf69 was set to GREEN
Added comment: PMID 34038740: 20 affected children from 8 unrelated families reported, presenting with fatal syndrome consisting of severe autoinflammation and progredient leukoencephalopathy with recurrent seizures; 12 of these subjects, whose DNA was available, segregated homozygous loss-of-function C2orf69 variants. Endogenous C2ORF69 was found to be (1) loosely bound to mitochondria, (2) affects mitochondrial membrane potential and oxidative respiration in cultured neurons, and (3) controls the levels of the glycogen branching enzyme 1 (GBE1) consistent with a glycogen-storage-associated mitochondriopathy. Zebrafish model.

PMID 33945503: 8 individuals from 5 families reported with muscle hypotonia, developmental delay, progressive microcephaly, and brain MRI abnormalities. Age at onset ranged from birth to 6 months of age. Six patients had vision impairment, liver abnormalities, inflammation/inflammatory arthritis, and 5 patients had seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3973 KDM3B Zornitza Stark reviewed gene: KDM3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Diets-Jongmans syndrome, MIM# 618846, Intellectual disability, dysmorphic features, short stature, Intellectual disability, short stature, deafness; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3972 YARS Zornitza Stark edited their review of gene: YARS: Changed phenotypes: Infantile-onset multisystem neurologic, endocrine, and pancreatic disease 2, MIM# 619418
Intellectual disability syndromic and non-syndromic v0.3970 ERGIC3 Zornitza Stark reviewed gene: ERGIC3: Rating: AMBER; Mode of pathogenicity: None; Publications: 33710394, 31585110; Phenotypes: Intellectual disability; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.3969 ZC3H14 Zornitza Stark reviewed gene: ZC3H14: Rating: AMBER; Mode of pathogenicity: None; Publications: 28666327; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3968 RNF2 Zornitza Stark gene: RNF2 was added
gene: RNF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNF2 were set to 33864376
Phenotypes for gene: RNF2 were set to epilepsy; intellectual disability; intrauterine growth retardation
Review for gene: RNF2 was set to AMBER
Added comment: Not associated with any phenotype in OMIM. PMID:33864376 (Luo et al 2021) report 2 cases of children with de novo missense variants (p.R70H and p.S82R) in RNF2 and a phenotype of intrauterine growth retardation, severe intellectual disabilities, behavioral problems, seizures, feeding difficulties and dysmorphic features. Seizures started in infancy. Both variants are absent from gnomad. Functional studies in Drosophila showed that the disease-linked variants (p.R70H and p.S82R) behave as LoF alleles.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3967 RING1 Zornitza Stark gene: RING1 was added
gene: RING1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RING1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RING1 were set to 29386386
Phenotypes for gene: RING1 were set to microcephaly; intellectual disability
Review for gene: RING1 was set to RED
Added comment: Not associated with any phenotype in OMIM. PMID: 29386386 - Pierce et al 2018 - report a 13 yo female with a de novo RING1 p.R95Q variant and syndromic neurodevelopmental disabilities. Early motor and language development were normal but were delayed after the first year of life. Cognitive testing showed a verbal IQ of 55 and a visual performance IQ of 63. Head circumference at birth was -4.9 SD, and -4.2 SD at age 13 which falls into the severe microcephaly category. C. elegans with either the missense mutation or complete knockout of spat-3 (the suggested RING1 ortholog) were defective in monoubiquitylation of histone H2A and had defects in neuronal migration and axon guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3962 IRX5 Zornitza Stark reviewed gene: IRX5: Rating: RED; Mode of pathogenicity: None; Publications: 22581230, 27453922; Phenotypes: Hamamy syndrome, MIM# 611174; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3959 RAB3GAP1 Zornitza Stark reviewed gene: RAB3GAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15696165, 20512159, 23420520, 23420520, 30730599; Phenotypes: Warburg micro syndrome 1, MIM# 600118, Martsolf syndrome 2, MIM# 619420; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3957 GNB2 Zornitza Stark reviewed gene: GNB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31698099, 33971351, 34183358, 33057194; Phenotypes: Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3955 HID1 Zornitza Stark gene: HID1 was added
gene: HID1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HID1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HID1 were set to 33999436
Phenotypes for gene: HID1 were set to Syndromic infantile encephalopathy; Hypopituitarism
Review for gene: HID1 was set to GREEN
Added comment: 7 individuals from 6 unrelated families reported. Clinical features included: hypopituitarism in combination with brain atrophy, thin corpus callosum, severe developmental delay, visual impairment, and epilepsy
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3952 ERGIC3 Seb Lunke gene: ERGIC3 was added
gene: ERGIC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ERGIC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERGIC3 were set to ERGIC3
Phenotypes for gene: ERGIC3 were set to 33710394; 31585110
Review for gene: ERGIC3 was set to AMBER
Added comment: PMID: 33710394 - two homozygous sibs with mild ID, a novel canonical splice (c.717+1G>A). Absent in gnomAD, no splice studies. Classed as a VUS.

PMID: 31585110 - 1 hom (p.Gln233Argfs*10) in a male 8yo with Growth retardation, Microcephaly, Learning disability, Facial dysmorphism, Abnormal pigmentation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3951 JPH3 Seb Lunke gene: JPH3 was added
gene: JPH3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JPH3 was set to Unknown
Publications for gene: JPH3 were set to 33824468
Phenotypes for gene: JPH3 were set to Intellectual disability; dystonia
Review for gene: JPH3 was set to RED
Added comment: One homozygous truncating variant (NM_020655.4: c.1740dup; p.(Val581Argfs*137)) found in a female individual affected with genetically undetermined neurodevelopmental anomalies (including delayed motor milestones, abnormal social communication, language difficulties and borderline cognitive impairment) and paroxysmal attacks of dystonia since her early infancy. No functional work were performed.

Only STRs disease causing, see separate STR list. No evidence for SNVs etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3948 ATP1A2 Zornitza Stark Phenotypes for gene: ATP1A2 were changed from Alternating hemiplegia of childhood 1, MIM# 104290; Developmental and epileptic encephalopathy, polymicrogyria to Alternating hemiplegia of childhood 1, MIM# 104290; Developmental and epileptic encephalopathy, polymicrogyria
Intellectual disability syndromic and non-syndromic v0.3947 ATP1A2 Zornitza Stark Phenotypes for gene: ATP1A2 were changed from Alternating hemiplegia of childhood 1, MIM# 104290; Developmental and epileptic encephalopathy, polymicrogyria to Alternating hemiplegia of childhood 1, MIM# 104290; Developmental and epileptic encephalopathy, polymicrogyria
Intellectual disability syndromic and non-syndromic v0.3947 HEATR5B Seb Lunke gene: HEATR5B was added
gene: HEATR5B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HEATR5B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HEATR5B were set to 33824466
Phenotypes for gene: HEATR5B were set to pontocerebellar hypoplasia; intellectual disability; seizures
Review for gene: HEATR5B was set to AMBER
Added comment: Four affected children from two families presenting with pontocerebellar hypoplasiawith neonatal seizures, severe ID and motor delay. Two homozygous splice variants were reported (c.5051–1G>A and c.5050+4A>G) in intron 31 of HEATR5B gene. Aberrant splicing was found in patient fibroblasts, which correlated with reduced levels of HEATR5B protein. Homozygous knockout mice were not viable. *NOTE: gene (and alias) not found in OMIM
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3947 ATP1A2 Zornitza Stark Phenotypes for gene: ATP1A2 were changed from Alternating hemiplegia of childhood 1, MIM# 104290 to Alternating hemiplegia of childhood 1, MIM# 104290; Developmental and epileptic encephalopathy, polymicrogyria
Intellectual disability syndromic and non-syndromic v0.3945 ATP1A2 Zornitza Stark changed review comment from: Although some of the symptoms of this condition are episodic, intellectual disability is a recognised feature.; to: Alternating hemiplegia: Although some of the symptoms of this condition are episodic, intellectual disability is a recognised feature.
Intellectual disability syndromic and non-syndromic v0.3945 ATP1A2 Zornitza Stark edited their review of gene: ATP1A2: Added comment: PMID 33880529: six individuals with de novo missense variants reported and DD/EE/PMG.; Changed publications: 33880529; Changed phenotypes: Alternating hemiplegia of childhood 1, MIM# 104290, Developmental and epileptic encephalopathy, polymicrogyria
Intellectual disability syndromic and non-syndromic v0.3945 ATP1A3 Zornitza Stark Phenotypes for gene: ATP1A3 were changed from Alternating hemiplegia of childhood 2, MIM#614820 to Alternating hemiplegia of childhood 2, MIM#614820; Developmental and epileptic encephalopathy, polymicrogyria
Intellectual disability syndromic and non-syndromic v0.3943 ATP1A3 Zornitza Stark edited their review of gene: ATP1A3: Added comment: PMID 33880529: 16 individuals reported with DD/EE and PMG.; Changed rating: GREEN; Changed publications: 33880529; Changed phenotypes: Alternating hemiplegia of childhood 2, MIM#614820, Developmental and epileptic encephalopathy, polymicrogyria
Intellectual disability syndromic and non-syndromic v0.3943 ZC3H14 Seb Lunke reviewed gene: ZC3H14: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.3939 PITRM1 Zornitza Stark edited their review of gene: PITRM1: Changed phenotypes: Spinocerebellar ataxia-30 (SCAR30), MIM#619405, intellectual disability, cognitive decline, psychosis
Intellectual disability syndromic and non-syndromic v0.3939 VPS41 Zornitza Stark Phenotypes for gene: VPS41 were changed from Dystonia; intellectual disability to Spinocerebellar ataxia-29 (SCAR29), MIM#619389; Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay
Intellectual disability syndromic and non-syndromic v0.3938 VPS41 Zornitza Stark edited their review of gene: VPS41: Changed phenotypes: Spinocerebellar ataxia-29 (SCAR29), MIM#619389, Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay
Intellectual disability syndromic and non-syndromic v0.3938 GNB2 Arina Puzriakova reviewed gene: GNB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31698099, 33971351, 34183358; Phenotypes: Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.3937 EPHA7 Zornitza Stark gene: EPHA7 was added
gene: EPHA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: EPHA7.
Mode of inheritance for gene: EPHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHA7 were set to 34176129
Phenotypes for gene: EPHA7 were set to Intellectual disability
Review for gene: EPHA7 was set to AMBER
Added comment: Lévy et al (2021 - PMID: 34176129) provide evidence that haploinssuficiency of EPHA7 results in a neurodevelopmental disorder.

The authors report on 12 individuals belonging to 9 unrelated families, all harboring with 6q microdeletions spanning EPHA7.

Overlapping features included DD (13/13), ID (10/10 - mild in most cases, individuals with larger CNVs/additional variants had more severe phenotype), speech delay and behavioral disorders. Variable other features incl. hypotonia (70%), non specific facial features, eye abnormalities (40%) and cardiac defects (25%).

The CNVs ranged from 152 kb to few Mb in size but in 4 subjects (P5-8) were only minimal, involving only EPHA7.



9 out of 12 individuals had inherited the deletion (5 subjects paternal, 4 maternal), in 1 subject (P12) this occured de novo, while for 2 others inheritance was not specified. Most deletions were inherited from an unaffected parent (in 6/7 families), with unclear contribution in a further one.

The authors discuss on previous studies suggesting an important role for EphA7 in brain development (modulation of cell-cell adhesion and repulsion, regulation of dendrite morphogenesis in early corticogenesis, role in dendritic spine formation later in development. EphA7 has also been proposed to drive neuronal maturation and synaptic function).

Haploinsufficiency for other ephrins or ephrin receptors has been implicated in other NDDs.

Overall Lévy et al promote incomplete penetrance and variable expressivity with haploinsufficiency of this gene being a risk factor for NDD. [The gene has also an %HI of 2.76% and a pLI of 1].
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3936 DNM1 Zornitza Stark Phenotypes for gene: DNM1 were changed from to Developmental and epileptic encephalopathy 31, OMIM:616346
Intellectual disability syndromic and non-syndromic v0.3934 DNM1 Zornitza Stark Mode of inheritance for gene: DNM1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3933 DNM1 Zornitza Stark reviewed gene: DNM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25262651, 27066543, 33372033, 34172529; Phenotypes: Developmental and epileptic encephalopathy 31, OMIM:616346; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3930 TTC8 Zornitza Stark reviewed gene: TTC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 14520415, 19797195; Phenotypes: Bardet-Biedl syndrome 8, MIM# 615985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3930 FTCD Elena Savva reviewed gene: FTCD: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 29178637, 30740726; Phenotypes: Glutamate formiminotransferase deficiency MIM#229100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3929 ATP9A Zornitza Stark gene: ATP9A was added
gene: ATP9A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP9A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP9A were set to http://dx.doi.org/10.1136/jmedgenet-2021-107843
Phenotypes for gene: ATP9A were set to Neurodevelopmental delay; Postnatal microcephaly; Failure to thrive; Gastrointestinal symptoms
Review for gene: ATP9A was set to AMBER
Added comment: Vogt et al. 2021 report on 3 individuals from 2 unrelated consanguineous families with different homozygous truncating variants in ATP9A, presenting with DD/ID of variable degree (2 mild, 1 severe), postnatal microcephaly (OFC range: −2.33 SD to −3.58 SD), failure to thrive, and gastrointestinal symptoms. Patient-derived fibroblasts showed reduced expression of ATP9A, and consistent with previous findings also overexpression of interacting partners, ARPC3 and SNX3.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3928 ATP2C2 Zornitza Stark gene: ATP2C2 was added
gene: ATP2C2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP2C2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP2C2 were set to 33864365; 28440294
Phenotypes for gene: ATP2C2 were set to language impairment, HP:0002463
Review for gene: ATP2C2 was set to RED
Added comment: PMID: 33864365 - Martinelli et al 2021 - report a family with a missense variant NM_001286527.2:c.304G>A, p.(Val102Met) in ATP2C2 in a father and two siblings with specific language impairment. However two other affected siblings did not have this variant. This variant was also reported by Chen et al. They found that the variant had a higher frequency in language cases (1.8%, N = 360) compared with cohorts selected for dyslexia (0.8%, N = 520) and ADHD (0.7%, N = 150), which presented frequencies comparable to reference databases (0.9%, N = 24 046 gnomAD controls). They postulate that variant is not sufficient on its own to cause a disorder but is a susceptibility factor which increases the risk for language impairment. PMID: 28440294 - Chen et al 2017 - report 2 probands with severe learning impairment, and missense variants in ATP2C2 (NM_001286527: c.G304A:p.V102M and NM_001291454:exon21: c.C1936T:p.R646W).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3924 TMEM67 Zornitza Stark reviewed gene: TMEM67: Rating: GREEN; Mode of pathogenicity: None; Publications: 16415887, 17377820, 17160906, 19508969; Phenotypes: Joubert syndrome 6, MIM# 610688, Meckel syndrome 3, MIM# 607361, COACH syndrome 1, MIM# 216360; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3924 SDCCAG8 Zornitza Stark Phenotypes for gene: SDCCAG8 were changed from to Bardet-Biedl syndrome 16, MIM# 615993; MONDO:0014444; Senior-Loken syndrome 7, MIM# 613615; MONDO:0013326; Nephronophthisis
Intellectual disability syndromic and non-syndromic v0.3921 SDCCAG8 Zornitza Stark reviewed gene: SDCCAG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 20835237, 22626039, 22626039, 32432520, 31534065, 26968886; Phenotypes: Bardet-Biedl syndrome 16, MIM# 615993, MONDO:0014444, Senior-Loken syndrome 7, MIM# 613615, MONDO:0013326, Nephronophthisis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3921 KIF1B Paul De Fazio gene: KIF1B was added
gene: KIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KIF1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF1B were set to 33710394
Phenotypes for gene: KIF1B were set to Hypotonia; coloboma; hypoplasia of the corpus callosum; severe neurodevelopmental delay
Review for gene: KIF1B was set to RED
gene: KIF1B was marked as current diagnostic
Added comment: Compound heterozygous missense variants reported in a woman with severe hypotonia, hypsarrhythmia, coloboma, hypoplasia of corpus callosum, severe neurodevelopmental delay.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3921 MYT1 Paul De Fazio changed review comment from: Missense variant reported de novo in a patient with mild ID. Patient also had a COL9A2 variant and skeletal features.
Sources: Literature; to: Missense variant reported de novo in a patient with mild ID reported in a cohort study, Patient also had a COL9A2 variant and skeletal features. Authors referred to it as an extended phenotype and dual diagnosis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3921 MYT1 Paul De Fazio gene: MYT1 was added
gene: MYT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MYT1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MYT1 were set to 33710394
Phenotypes for gene: MYT1 were set to Intellectual disability
Review for gene: MYT1 was set to RED
gene: MYT1 was marked as current diagnostic
Added comment: Missense variant reported de novo in a patient with mild ID. Patient also had a COL9A2 variant and skeletal features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3921 ZC3H14 Elena Savva reviewed gene: ZC3H14: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 21734151, 33710394; Phenotypes: Mental retardation, autosomal recessive 56 MIM#617125; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3921 SAMD9L Paul De Fazio edited their review of gene: SAMD9L: Changed publications: 33710394
Intellectual disability syndromic and non-syndromic v0.3921 SAMD9L Paul De Fazio gene: SAMD9L was added
gene: SAMD9L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SAMD9L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SAMD9L were set to Intellectual disability
Review for gene: SAMD9L was set to RED
gene: SAMD9L was marked as current diagnostic
Added comment: Missense variant reported de novo in a patient with moderate ID, in a large cohort study. Author described it as a phenotype expansion as ataxia-pancytopenia not found in that patient.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3921 ARHGEF9 Zornitza Stark Phenotypes for gene: ARHGEF9 were changed from to Developmental and epileptic encephalopathy 8, MIM# 300607
Intellectual disability syndromic and non-syndromic v0.3919 ARHGEF9 Zornitza Stark Mode of inheritance for gene: ARHGEF9 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3918 ARHGEF9 Zornitza Stark reviewed gene: ARHGEF9: Rating: GREEN; Mode of pathogenicity: None; Publications: 31942680, 30048823, 29130122, 28620718, 33600053, 32939676; Phenotypes: Developmental and epileptic encephalopathy 8, MIM# 300607; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3917 CEP83 Zornitza Stark Phenotypes for gene: CEP83 were changed from to Nephronophthisis 18, MIM# 615862; MONDO:0014374; Retinal dystrophy; ID
Intellectual disability syndromic and non-syndromic v0.3914 CEP83 Zornitza Stark reviewed gene: CEP83: Rating: GREEN; Mode of pathogenicity: None; Publications: 24882706, 33938610; Phenotypes: Nephronophthisis 18, MIM# 615862, MONDO:0014374, Retinal dystrophy, ID; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3913 CEP164 Zornitza Stark gene: CEP164 was added
gene: CEP164 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CEP164 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP164 were set to 34132027; 34013113; 32055034; 27708425; 22863007
Phenotypes for gene: CEP164 were set to Bardet-Biedl syndrome; Nephronophthisis 15, MIM# 614845; Oro-facio-digital syndrome
Review for gene: CEP164 was set to GREEN
Added comment: More than 10 unrelated families reported. Although this is labelled as a nephronophthisis gene in OMIM, some of the reported individuals have had features such as retinal involvement, ID and polydactyly to suggest a more BBS-like phenotype. Also note one individual reported with OFD-like phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.3911 CEP104 Zornitza Stark edited their review of gene: CEP104: Changed phenotypes: Joubert syndrome 25, MIM# 616781, MONDO:0014770
Intellectual disability syndromic and non-syndromic v0.3908 C5orf42 Zornitza Stark reviewed gene: C5orf42: Rating: GREEN; Mode of pathogenicity: None; Publications: 22425360, 24178751; Phenotypes: Joubert syndrome 17, MIM# 614615, MONDO:0013824, Orofaciodigital syndrome VI, MIM# 277170; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3904 BBS9 Zornitza Stark reviewed gene: BBS9: Rating: GREEN; Mode of pathogenicity: None; Publications: 16380913, 22353939, 32686083, 32037757; Phenotypes: Bardet-Biedl syndrome 9, MIM#615986, MONDO:0014437; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3901 BBS7 Zornitza Stark reviewed gene: BBS7: Rating: GREEN; Mode of pathogenicity: None; Publications: 12567324, 21937992, 19797195; Phenotypes: Bardet-Biedl syndrome 7, MIM# 615984, MONDO:0014435; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3898 BBS5 Zornitza Stark reviewed gene: BBS5: Rating: GREEN; Mode of pathogenicity: None; Publications: 19252258, 15137946, 10053027, 15637713; Phenotypes: Bardet-Biedl syndrome 5, MIM#615983, MONDO:0014434; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3895 BBS4 Zornitza Stark reviewed gene: BBS4: Rating: GREEN; Mode of pathogenicity: None; Publications: 12016587, 11381270; Phenotypes: Bardet-Biedl syndrome 4, MIM#615982, MONDO:0014433; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3892 ARL6 Zornitza Stark reviewed gene: ARL6: Rating: GREEN; Mode of pathogenicity: None; Publications: 15258860, 32361989, 31888296, 25402481; Phenotypes: Bardet-Biedl syndrome 3, MIM# 600151; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3889 PPP2R1A Zornitza Stark reviewed gene: PPP2R1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 36, MIM#616362, Microcephaly-corpus callosum hypoplasia-intellectual disability-facial dysmorphism syndrome, MONDO:0014605; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3889 CLPB Zornitza Stark Phenotypes for gene: CLPB were changed from to 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271
Intellectual disability syndromic and non-syndromic v0.3887 CLPB Zornitza Stark Mode of inheritance for gene: CLPB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3886 CLPB Zornitza Stark reviewed gene: CLPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25597510, 34140661; Phenotypes: 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3886 NCDN Zornitza Stark Phenotypes for gene: NCDN were changed from neurodevelopmental delay, intellectual disability, and epilepsy to Neurodevelopmental disorder with infantile epileptic spasms (NEDIES), MIM#619373
Intellectual disability syndromic and non-syndromic v0.3885 NCDN Zornitza Stark reviewed gene: NCDN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with infantile epileptic spasms (NEDIES), MIM#619373; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.3885 ARCN1 Zornitza Stark Phenotypes for gene: ARCN1 were changed from to Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164)
Intellectual disability syndromic and non-syndromic v0.3882 ARCN1 Zornitza Stark reviewed gene: ARCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27476655, 33154040; Phenotypes: Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3882 SLC13A5 Zornitza Stark Phenotypes for gene: SLC13A5 were changed from to Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905; MONDO:0014392
Intellectual disability syndromic and non-syndromic v0.3879 SLC13A5 Zornitza Stark reviewed gene: SLC13A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 24995870, 26384929; Phenotypes: Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905, MONDO:0014392; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3879 CTC1 Zornitza Stark Phenotypes for gene: CTC1 were changed from to Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199
Intellectual disability syndromic and non-syndromic v0.3876 CTC1 Zornitza Stark reviewed gene: CTC1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3875 IFT74 Zornitza Stark gene: IFT74 was added
gene: IFT74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IFT74 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT74 were set to 27486776; 32144365; 33531668
Phenotypes for gene: IFT74 were set to Bardet-Biedl syndrome 20, MIM# 617119; Joubert syndrome
Review for gene: IFT74 was set to GREEN
Added comment: Two individuals reported with BBS phenotype.

PMID 33531668: Identified IFT74 as a JBTS-associated gene in 3 unrelated families through WES. All the affected individuals carried truncated variants and shared one missense variant (p.Q179E) found only in East Asians. The expression of the human p.Q179E-IFT74 variant displayed compromised rescue effects in zebrafish ift74 morphants. Attenuated ciliogenesis; altered distribution of IFT proteins and ciliary membrane proteins, including ARL13B, INPP5E, and GPR161; and disrupted hedgehog signaling were observed in patient fibroblasts with IFT74 variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3864 RFX4 Chirag Patel gene: RFX4 was added
gene: RFX4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RFX4 were set to PMID: 33658631
Phenotypes for gene: RFX4 were set to ID, ASD, ADHD
Review for gene: RFX4 was set to GREEN
Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3864 RFX3 Chirag Patel gene: RFX3 was added
gene: RFX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RFX3 were set to PMID: 33658631
Phenotypes for gene: RFX3 were set to ID, ASD, ADHD
Review for gene: RFX3 was set to GREEN
Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3864 RFX7 Chirag Patel gene: RFX7 was added
gene: RFX7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFX7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RFX7 were set to PMID: 33658631
Phenotypes for gene: RFX7 were set to ID, ASD, ADHD
Review for gene: RFX7 was set to GREEN
Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3863 DLG4 Chirag Patel reviewed gene: DLG4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33597769; Phenotypes: Intellectual developmental disorder 62; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3863 GNAI1 Chirag Patel reviewed gene: GNAI1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33473207; Phenotypes: Developmental delay, seizures, and hypotonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3862 FARSA Chirag Patel gene: FARSA was added
gene: FARSA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FARSA were set to PMID: 33598926
Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2
Review for gene: FARSA was set to GREEN
gene: FARSA was marked as current diagnostic
Added comment: FARSA is a subunit with FARSB to form FARS1 enzyme. Bi-allelic mutations in FARSB are well described.
Schuch et al. (2021) report 3 unrelated individuals with bi-allelic variants in FARSA. Identified through WES and variants segregated with disease. Functional evidence was obtained with reduced FARS1 enzyme activity levels in fibroblasts or EBV-transformed lymphoblastoid cell lines (EBV-LCLs) of patients. Common to all was a chronic interstitial lung disease starting early in life and characterized by bilateral ground-glass opacification on HR-CT, and cholesterol pneumonitis in lung histology. Additional abnormalities in other organ systems include liver disease, neurological manifestations, and growth restriction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3857 ZNF81 Zornitza Stark reviewed gene: ZNF81: Rating: RED; Mode of pathogenicity: None; Publications: 15121780; Phenotypes: Intellectual disability; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3856 FOXP1 Zornitza Stark reviewed gene: FOXP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34109629; Phenotypes: Mental retardation with language impairment and with or without autistic features 613670; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3855 PARP6 Zornitza Stark edited their review of gene: PARP6: Changed publications: 34067418
Intellectual disability syndromic and non-syndromic v0.3852 SRCAP Zornitza Stark reviewed gene: SRCAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, non-Floating Harbor; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3851 EIF5A Zornitza Stark edited their review of gene: EIF5A: Changed phenotypes: Faundes-Banka syndrome, MIM# 619376, Intellectual disability, microcephaly, dysmorphism
Intellectual disability syndromic and non-syndromic v0.3850 PIGF Zornitza Stark reviewed gene: PIGF: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Onychodystrophy, osteodystrophy, impaired intellectual development, and seizures syndrome, MIM# 619356; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3847 LTBP1 Chern Lim changed review comment from: PMID:33991472
- Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families.
- Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly).
- Most of the affected individuals have developmental delay and other neurological features.
- Functional studies done on patient fibroblasts and zebrafish models.
Sources: Literature; to: PMID:33991472
- Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families.
- Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly).
- Most of the affected individuals have developmental delay and other neurological features.
- Functional studies done on patient fibroblasts and zebrafish models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3847 LTBP1 Chern Lim gene: LTBP1 was added
gene: LTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LTBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LTBP1 were set to 33991472
Phenotypes for gene: LTBP1 were set to cutis laxa syndrome
Review for gene: LTBP1 was set to GREEN
gene: LTBP1 was marked as current diagnostic
Added comment: PMID:33991472
- Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families.
- Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly).
- Most of the affected individuals have developmental delay and other neurological features.
- Functional studies done on patient fibroblasts and zebrafish models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3847 PGM2L1 Chern Lim gene: PGM2L1 was added
gene: PGM2L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PGM2L1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PGM2L1 were set to 33979636
Phenotypes for gene: PGM2L1 were set to Neurodevelopmental disorder
Review for gene: PGM2L1 was set to GREEN
gene: PGM2L1 was marked as current diagnostic
Added comment: PMID: 33979636:
- Hom/chet PTVs in 4 unrelated individuals. All four affected individuals had severe developmental and speech delay, dysmorphic facial features, ear anomalies, high arched palate, strabismus, hypotonia, and keratosis pilaris. Early obesity and seizures were present in three individuals.
- Studies on patient fibroblasts and cell lines indicated that PGM2L1 deficiency causes a decrease, but not a disappearance, of the sugar bisphosphates needed for the formation of NDP-sugars and that there is no evidence that this leads to a glycosylation defect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3846 ATXN2L Sue White gene: ATXN2L was added
gene: ATXN2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATXN2L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATXN2L were set to 33283965; 33057194
Phenotypes for gene: ATXN2L were set to macrocephaly; intellectual disability
Penetrance for gene: ATXN2L were set to Complete
Review for gene: ATXN2L was set to AMBER
Added comment: Combined data from three large exome groups identified several de novo variants, including frameshift and missense, in ATXN2L in patients with developmental delay (Kaplanis et al., 2020). pLI=1.0
Single case report of a novel de novo missense variant in a child with macrocephaly and developmental delay. No functional work.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3845 BCAS3 Paul De Fazio gene: BCAS3 was added
gene: BCAS3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BCAS3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BCAS3 were set to 34022130
Phenotypes for gene: BCAS3 were set to Syndromic neurodevelopmental disorder
Review for gene: BCAS3 was set to GREEN
gene: BCAS3 was marked as current diagnostic
Added comment: 15 individuals from eight unrelated families with germline bi-allelic loss-of-function variants in BCAS3. All probands share a global developmental delay accompanied by pyramidal tract involvement, microcephaly, short stature, strabismus, dysmorphic facial features, and seizures. Patient fibroblasts confirmed absence of BCAS3 protein.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3845 SRCAP Paul De Fazio changed review comment from: Truncating variants in exons 33 and 34 of the SNF2-related CREBBP activator protein (SRCAP) gene cause the neurodevelopmental disorder Floating-Harbor syndrome (FLHS).

A cohort of 33 individuals with mostly de novo truncating variants both proximal and distal to the FLHS locus were found to have a distinct phenotype and DNA methylation pattern to FLHS.; to: Truncating variants in exons 33 and 34 of the SNF2-related CREBBP activator protein (SRCAP) gene cause the neurodevelopmental disorder (NDD) Floating-Harbor syndrome (FLHS).

A cohort of 33 individuals with mostly de novo truncating variants both proximal and distal to the FLHS locus were found to have a distinct phenotype and DNA methylation pattern to FLHS, referred to by the authors as "non-FLHS SRCAP-related NDD".
Intellectual disability syndromic and non-syndromic v0.3845 SRCAP Paul De Fazio reviewed gene: SRCAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 33909990; Phenotypes: Floating-Harbor syndrome MIM#136140; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3845 SYT1 Zornitza Stark reviewed gene: SYT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30107533; Phenotypes: Baker-Gordon syndrome, MIM# 618218, MONDO:0033864; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3844 UBTF Zornitza Stark Phenotypes for gene: UBTF were changed from to Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701
Intellectual disability syndromic and non-syndromic v0.3841 UBTF Zornitza Stark reviewed gene: UBTF: Rating: GREEN; Mode of pathogenicity: None; Publications: 28777933, 29300972; Phenotypes: Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672, MONDO:0044701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3840 ZEB2 Zornitza Stark edited their review of gene: ZEB2: Changed phenotypes: Mowat-Wilson syndrome, MIM# 235730, MONDO:0009341
Intellectual disability syndromic and non-syndromic v0.3837 SLC9A6 Zornitza Stark reviewed gene: SLC9A6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18342287, 19377476, 25044251, 33278113, 32569089, 31879735; Phenotypes: Mental retardation, X-linked syndromic, Christianson type, MIM# 300243, MONDO:0010278; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3834 SHANK3 Zornitza Stark reviewed gene: SHANK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 16284256, 17173049, 20186804, 22892527; Phenotypes: Phelan-McDermid syndrome, MIM# 606232, MONDO:0011652; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3831 SATB2 Zornitza Stark reviewed gene: SATB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29023086, 28151491, 32446642; Phenotypes: Glass syndrome, MIM# 612313, MONDO:0100147; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3828 MEF2C Zornitza Stark reviewed gene: MEF2C: Rating: GREEN; Mode of pathogenicity: None; Publications: 19876902, 19471318, 19592390, 19592390, 20513142, 34055696, 34022131; Phenotypes: Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM# 613443, MONDO:0013266 Edit; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3828 MBD5 Zornitza Stark edited their review of gene: MBD5: Changed phenotypes: Mental retardation, autosomal dominant 1, MIM# 156200, MONDO:0007974
Intellectual disability syndromic and non-syndromic v0.3825 MBD5 Zornitza Stark reviewed gene: MBD5: Rating: GREEN; Mode of pathogenicity: None; Publications: 18812405, 21981781, 23708187, 22726846, 33912662; Phenotypes: 18812405, 21981781, 23708187, 22726846, 33912662; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3823 IQSEC2 Zornitza Stark Mode of inheritance for gene: IQSEC2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3822 IQSEC2 Zornitza Stark edited their review of gene: IQSEC2: Added comment: More than 20 unrelated families reported.; Changed publications: 31415821, 20473311, 30842726, 33368194, 23674175; Changed phenotypes: Mental retardation, X-linked 1/78, MIM# 309530, MONDO:0010656, Severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome MONDO:0018347
Intellectual disability syndromic and non-syndromic v0.3820 EHMT1 Zornitza Stark edited their review of gene: EHMT1: Changed publications: 16826528, 19264732, 19293338, 22670143, 30448833
Intellectual disability syndromic and non-syndromic v0.3820 EHMT1 Zornitza Stark commented on gene: EHMT1: Well established gene-disease association. Deletions are common. Key features includeID/seizures/microcephaly/dysmorphism/congenital anomalies. More than 100 individuals reported.
Intellectual disability syndromic and non-syndromic v0.3820 EHMT1 Zornitza Stark edited their review of gene: EHMT1: Changed phenotypes: Kleefstra syndrome 1, MIM# 610253, MONDO:0027407
Intellectual disability syndromic and non-syndromic v0.3820 EEF1A2 Zornitza Stark Phenotypes for gene: EEF1A2 were changed from Epileptic encephalopathy, early infantile, 33, MIM# 616409; Mental retardation, autosomal dominant 38, MIM# 616393 to Mental retardation, autosomal dominant 38, MIM# 616393; MONDO:0014617; Developmental and epileptic encephalopathy 33, MIM# 616409; MONDO:0014625
Intellectual disability syndromic and non-syndromic v0.3818 EEF1A2 Zornitza Stark edited their review of gene: EEF1A2: Changed phenotypes: Mental retardation, autosomal dominant 38, MIM# 616393, MONDO:0014617, Developmental and epileptic encephalopathy 33, MIM# 616409, MONDO:0014625
Intellectual disability syndromic and non-syndromic v0.3818 EEF1A2 Zornitza Stark edited their review of gene: EEF1A2: Changed publications: 24697219, 32196822, 32160274, 32062104, 31893083
Intellectual disability syndromic and non-syndromic v0.3815 MASP1 Zornitza Stark reviewed gene: MASP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26789649, 21258343, 21035106; Phenotypes: 3MC syndrome 1, MIM# 257920, MONDO:0009770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3815 BRPF1 Zornitza Stark Phenotypes for gene: BRPF1 were changed from to Intellectual developmental disorder with dysmorphic facies and ptosis, MIM# 617333; MONDO:0015022
Intellectual disability syndromic and non-syndromic v0.3812 BRPF1 Zornitza Stark reviewed gene: BRPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27939640, 27939639, 32652122; Phenotypes: Intellectual developmental disorder with dysmorphic facies and ptosis, MIM# 617333, MONDO:0015022; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3809 POGZ Zornitza Stark reviewed gene: POGZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 33098347, 31782611, 26942287; Phenotypes: White-Sutton syndrome, MIM# 616364, MONDO:0014606; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3806 UBE3B Zornitza Stark reviewed gene: UBE3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 23200864, 23200864, 34012380, 32949109; Phenotypes: Kaufman oculocerebrofacial syndrome, MIM# 244450, MONDO:0009485; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3803 TAF6 Zornitza Stark reviewed gene: TAF6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25558065, 25574841, 32030742; Phenotypes: Alazami-Yuan syndrome, MIM# 617126; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3802 PSMC3 Zornitza Stark gene: PSMC3 was added
gene: PSMC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMC3 were set to 32500975
Phenotypes for gene: PSMC3 were set to Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354
Review for gene: PSMC3 was set to AMBER
Added comment: Three affected individuals from a single consanguineous family reported with homozygous intronic variant. Animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3800 GEMIN5 Zornitza Stark gene: GEMIN5 was added
gene: GEMIN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GEMIN5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GEMIN5 were set to 33963192
Phenotypes for gene: GEMIN5 were set to Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, MIM# 619333
Review for gene: GEMIN5 was set to GREEN
Added comment: Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction (NEDCAM) is an autosomal recessive disorder characterized by global developmental delay with prominent motor abnormalities, mainly axial hypotonia, gait ataxia, and appendicular spasticity. Affected individuals have cognitive impairment and speech delay; brain imaging shows cerebellar atrophy.

30 individuals from 22 unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3799 NSF Zornitza Stark Phenotypes for gene: NSF were changed from Seizures; EEG with burst suppression; Global developmental delay; Intellectual disability to Developmental and epileptic encephalopathy 96, MIM# 619340; Seizures; EEG with burst suppression; Global developmental delay; Intellectual disability
Intellectual disability syndromic and non-syndromic v0.3798 NSF Zornitza Stark edited their review of gene: NSF: Changed phenotypes: Developmental and epileptic encephalopathy 96, MIM# 619340, Seizures, EEG with burst suppression, Global developmental delay, Intellectual disability
Intellectual disability syndromic and non-syndromic v0.3795 NFU1 Zornitza Stark reviewed gene: NFU1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21944046, 22077971, 32747156, 29441221; Phenotypes: Multiple mitochondrial dysfunctions syndrome 1, MIM# 605711; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3795 RAB11B Zornitza Stark Phenotypes for gene: RAB11B were changed from to Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807
Intellectual disability syndromic and non-syndromic v0.3792 RAB11B Zornitza Stark reviewed gene: RAB11B: Rating: GREEN; Mode of pathogenicity: None; Publications: 29106825; Phenotypes: Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3791 UFSP2 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v0.3791 UFSP2 Zornitza Stark edited their review of gene: UFSP2: Added comment: Additional cases identified in 100,000 Genomes project.; Changed rating: GREEN; Changed phenotypes: Abnormal muscle tone, Seizures, Global developmental delay, Delayed speech and language development, Intellectual disability, Strabismus; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3788 ADNP Zornitza Stark reviewed gene: ADNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 24531329, 25057125, 25533962, 29724491, 29911927; Phenotypes: Helsmoortel-van der Aa syndrome MIM#615873, MONDO:0014379; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3787 PARP6 Zornitza Stark gene: PARP6 was added
gene: PARP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PARP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PARP6 were set to Cells 2021, 10(6), 1289; https://doi.org/10.3390/cells10061289
Phenotypes for gene: PARP6 were set to Intellectual disability; Epilepsy; Microcephaly
Review for gene: PARP6 was set to GREEN
Added comment: Four unrelated individuals reported with de novo variants in this gene and a neurodevelopmental phenotype. Supportive functional data. One pair of siblings with a homozygous missense: limited evidence for bi-allelic variants causing disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3786 UFSP2 Konstantinos Varvagiannis changed review comment from: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)].

Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3).

Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2.

The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity.

Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8).

UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided]

UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1).

Additional studies were carried to provide evidence for pathogenicity of this variant.

Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability.

The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization.

Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers.

Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain.

Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants.

Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance.

In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes.

You may consider inclusion in the current panel with amber/green rating.
Sources: Literature; to: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)].

Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3).

Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2.

The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity.

Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8).

UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided]

UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1).

Additional studies were carried to provide evidence for pathogenicity of this variant.

Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability.

The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization.

Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers.

Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain.

Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants.

**Monoallelic** (correction to previous review) UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance.

In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes.

You may consider inclusion in the current panel with amber/green rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3785 UFSP2 Konstantinos Varvagiannis gene: UFSP2 was added
gene: UFSP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UFSP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFSP2 were set to 33473208
Phenotypes for gene: UFSP2 were set to Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus
Penetrance for gene: UFSP2 were set to Complete
Review for gene: UFSP2 was set to AMBER
Added comment: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)].

Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3).

Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2.

The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity.

Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8).

UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided]

UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1).

Additional studies were carried to provide evidence for pathogenicity of this variant.

Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability.

The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization.

Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers.

Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain.

Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants.

Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance.

In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes.

You may consider inclusion in the current panel with amber/green rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3784 FAR1 Zornitza Stark edited their review of gene: FAR1: Changed phenotypes: Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154, Cataracts, spastic paraparesis, and speech delay, MIM#619338
Intellectual disability syndromic and non-syndromic v0.3783 BICRA Zornitza Stark reviewed gene: BICRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Siris syndrome-12, MIM#619325; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3783 SBF1 Zornitza Stark Phenotypes for gene: SBF1 were changed from Charcot-Marie-Tooth disease, type 4B3, MIM# 615284 to Charcot-Marie-Tooth disease, type 4B3, MIM# 615284; MONDO:0014117
Intellectual disability syndromic and non-syndromic v0.3782 SBF1 Zornitza Stark edited their review of gene: SBF1: Changed phenotypes: Charcot-Marie-Tooth disease, type 4B3, MIM# 615284, MONDO:0014117
Intellectual disability syndromic and non-syndromic v0.3782 TBC1D2B Zornitza Stark Phenotypes for gene: TBC1D2B were changed from Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality to Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323; Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality
Intellectual disability syndromic and non-syndromic v0.3781 TBC1D2B Zornitza Stark reviewed gene: TBC1D2B: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3781 SCN1A Zornitza Stark Phenotypes for gene: SCN1A were changed from to Epileptic encephalopathy, early infantile, 6 (Dravet syndrome) 607208 Developmental and epileptic encephalopathy 6B, non-Dravet, MIM# 619317
Intellectual disability syndromic and non-syndromic v0.3780 SCN1A Zornitza Stark reviewed gene: SCN1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Epileptic encephalopathy, early infantile, 6 (Dravet syndrome) 607208 Developmental and epileptic encephalopathy 6B, non-Dravet, MIM# 619317; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3779 KDM4B Zornitza Stark reviewed gene: KDM4B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 65, MIM# 619320; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3779 THOC2 Zornitza Stark Marked gene: THOC2 as ready
Intellectual disability syndromic and non-syndromic v0.3779 THOC2 Zornitza Stark Gene: thoc2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.3779 THOC2 Zornitza Stark Phenotypes for gene: THOC2 were changed from to Mental retardation, X-linked 12/35 MIM#300957
Intellectual disability syndromic and non-syndromic v0.3778 THOC2 Zornitza Stark Publications for gene: THOC2 were set to
Intellectual disability syndromic and non-syndromic v0.3777 THOC2 Zornitza Stark Mode of inheritance for gene: THOC2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3776 THOC2 Paul De Fazio reviewed gene: THOC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26166480, 32116545, 29851191, 32960281; Phenotypes: Mental retardation, X-linked 12/35 MIM#300957; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3773 SIAH1 Zornitza Stark edited their review of gene: SIAH1: Changed phenotypes: Buratti-Harel syndrome, MIM# 619314, Developmental delay, Infantile hypotonia, Dysmorphic features, Laryngomalacia
Intellectual disability syndromic and non-syndromic v0.3771 SMARCA5 Zornitza Stark gene: SMARCA5 was added
gene: SMARCA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCA5 were set to 33980485
Phenotypes for gene: SMARCA5 were set to Neurodevelopmental disorder; microcephaly; dysmorphic features
Review for gene: SMARCA5 was set to GREEN
Added comment: 12 individuals reported with either de novo or appropriately segregating variants in this gene and mild developmental delay, frequent postnatal short stature and microcephaly, and recurrent dysmorphic features. Functional data supports gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3770 FBXW7 Zornitza Stark gene: FBXW7 was added
gene: FBXW7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXW7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FBXW7 were set to 33057194
Phenotypes for gene: FBXW7 were set to FBXW7-related neurodevelopmental syndrome
Review for gene: FBXW7 was set to GREEN
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 12 de novo missense and 1 de novo synonymous variant identified in ~10,000 cases with developmental disorders (no other phenotype info provided).

We are aware of additional cases pending publication.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3766 SPG11 Zornitza Stark reviewed gene: SPG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 33581793; Phenotypes: Spastic paraplegia 11, autosomal recessive 604360; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3766 SPTAN1 Zornitza Stark Phenotypes for gene: SPTAN1 were changed from to Developmental and epileptic encephalopathy 5, MIM# 613477
Intellectual disability syndromic and non-syndromic v0.3763 SPTAN1 Zornitza Stark reviewed gene: SPTAN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20493457, 22258530, 32811770; Phenotypes: Developmental and epileptic encephalopathy 5, MIM# 613477; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3758 AFF3 Zornitza Stark reviewed gene: AFF3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31388108, 33961779; Phenotypes: KINSSHIP syndrome, MIM# 619297; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3757 RALA Zornitza Stark edited their review of gene: RALA: Changed phenotypes: Hiatt-Neu-Cooper neurodevelopmental syndrome, MIM# 619311, Intellectual disability, short stature, dysmorphism
Intellectual disability syndromic and non-syndromic v0.3756 CAPN15 Zornitza Stark gene: CAPN15 was added
gene: CAPN15 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAPN15 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CAPN15 were set to 33410501; 32885237
Phenotypes for gene: CAPN15 were set to Oculogastrointestinal neurodevelopmental syndrome, MIM# 619318
Review for gene: CAPN15 was set to GREEN
Added comment: 5 families reported, including DD/ID in 3. Profound in one family with bi-allelic LoF variant, PMID 33410501.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3755 EXOC2 Zornitza Stark Phenotypes for gene: EXOC2 were changed from Global developmental delay; Intellectual disability; Abnormality of the face; Abnormality of brain morphology to Neurodevelopmental disorder with dysmorphic facies and cerebellar hypoplasia, MIM# 619306; Global developmental delay; Intellectual disability; Abnormality of the face; Abnormality of brain morphology
Intellectual disability syndromic and non-syndromic v0.3754 EXOC2 Zornitza Stark reviewed gene: EXOC2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with dysmorphic facies and cerebellar hypoplasia, MIM# 619306; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3753 TMEM222 Konstantinos Varvagiannis gene: TMEM222 was added
gene: TMEM222 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM222 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM222 were set to 33824500
Phenotypes for gene: TMEM222 were set to Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality
Penetrance for gene: TMEM222 were set to Complete
Review for gene: TMEM222 was set to GREEN
Added comment: Polla et al (2021 - PMID: 33824500) report 17 individuals from 9 unrelated families, with biallelic TMEM222 pathogenic variants.

The phenotype included motor, speech delay and moderate to severe ID (as universal features). Other manifestations included hypotonia (10/15), broad gait (5/12), seizures (7/17 - belonging to 6/9 families), MRI abnormalities (5/8). Variable behavioral abnormalities were observed (aggressive behavior, shy character, stereotypic movements etc). Abnormal OFC was a feature in several with microcephaly in 7 subjects from 4 families (measurements not available for all 17). Nonspecific facial features were reported in 10/17. Rare features incl. body tremors, decreased lower extremity muscle mass or disorder of motor neurons.

TMEM222 variants were identified following exome sequencing. Previous investigations incl. metabolic studies, FMR1, chromosomes by standard karyotype or CMA, SMA, CMT1A were reported to be normal (available for some individuals).

TMEM222 variants missense and pLoF ones mostly found in homozygosity (7/9 families were consanguineous, compound heterozygosity reported in a single case from the 9 families). Sanger sequencing was used for confirmation of variants, parental carrier state as well as testing of sibs (unaffected sibs tested in 4 families).

Few individuals had additional genetic findings in other genes, though classified as VUS (3 families).

The gene encodes transmembrane protein 222 (208 residues) which however has unknown function. The protein comprises 3 transmembrane domains and a domain of unknown function. TMEMs are a group of transmembrane proteins spanning membranes with - most commonly - unclear function.

The authors measured expression by qPCR mRNA analysis, demonstrating highest fetal and adult brain expression (incl. parietal and occipital cortex). Expression levels from GTEx data also support a role in neurodevelopment.

Immunocytochemistry revealed highest levels in mature human iPSC-derived glutaminergic cortical neurons and moderate in immature ones. Additional studies supported that the gene is highly expressed in dendrites and might play a role in postsynaptic vesicles (colocalization with postsynaptic and early endosomal markers).

A previous study by Riazuddin et al (2017 - PMID: 27457812) had identified TMEM222 as a candidate gene for ID. This family (PKMR213) however appears to be included as family 2 in the aforementioned publication (same pedigree, variant and phenotype in both articles).

In OMIM there is currently no associated phenotype.

The gene is listed among the primary ID genes in SysID.

Please consider inclusion in the ID panel with green (or amber) rating. This gene may also be included in other panels e.g. for epilepsy, microcephaly, etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3752 CHD5 Zornitza Stark gene: CHD5 was added
gene: CHD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHD5 were set to 33944996
Phenotypes for gene: CHD5 were set to Intellectual disability; Epilepsy
Review for gene: CHD5 was set to GREEN
Added comment: 16 unrelated individuals reported with language deficits (81%), behavioral symptoms (69%), intellectual disability (64%), epilepsy (62%), and motor delay (56%).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3749 FBXO31 Zornitza Stark Mode of inheritance for gene: FBXO31 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3747 FBXO31 Zornitza Stark changed review comment from: Single consanguineous family reported with homozygous truncating variant, limited functional evidence.; to: AR ID: Single consanguineous family reported with homozygous truncating variant, limited functional evidence.
Intellectual disability syndromic and non-syndromic v0.3747 FBXO31 Zornitza Stark edited their review of gene: FBXO31: Added comment: PMIDs 33675180; 32989326: three unrelated individuals with de novo missense variant, (p.Asp334Asn) and spastic-dystonic CP, including ID.; Changed rating: GREEN; Changed publications: 24623383, 33675180, 32989326; Changed phenotypes: Mental retardation, autosomal recessive 45, MIM#615979, Spastic-dystonic cerebral palsy, de novo dominant; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3746 DPYSL5 Zornitza Stark gene: DPYSL5 was added
gene: DPYSL5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPYSL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DPYSL5 were set to 33894126
Phenotypes for gene: DPYSL5 were set to Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities
Review for gene: DPYSL5 was set to GREEN
Added comment: Nine individuals with brain malformations, including corpus callosum agenesis and/or posterior fossa abnormalities, associated with variable degrees of intellectual disability. The recurrent de novo p.Glu41Lys was found in eight unrelated patients, and a p.Gly47Arg variant was identified in one individual from the first family reported with Ritscher-Schinzel syndrome. Both impaired DPYSL5 function on dendritic outgrowth regulation by preventing the formation of the ternary complex with MAP2 and βIII-tubulin, ultimately leading to abnormal brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3741 VPS41 Zornitza Stark edited their review of gene: VPS41: Added comment: Another 9 individuals from 5 unrelated families reported.

Affected individuals were born after uneventful pregnancies and presented in most cases early in life with developmental delay. Various degrees of ataxia, hypotonia, and dystonia were present in all affected individuals, preventing independent ambulation. Likewise, nystagmus was commonly described. In addition, all affected individuals displayed intellectual disability and speech delay, and one sib pair had treatment-resistant epilepsy.; Changed rating: GREEN; Changed publications: 32808683, 33764426
Intellectual disability syndromic and non-syndromic v0.3738 PTPN4 Bryony Thompson gene: PTPN4 was added
gene: PTPN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTPN4 were set to 17953619; 25424712; 30238967; DOI: https://doi.org/10.1016/j.xhgg.2021.100033
Phenotypes for gene: PTPN4 were set to Intellectual disability; developmental delay
Review for gene: PTPN4 was set to GREEN
Added comment: >3 unrelated probands and supporting mouse model
PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity
PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder
PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines
DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3737 YWHAG Zornitza Stark Phenotypes for gene: YWHAG were changed from to Developmental and epileptic encephalopathy 56, (MIMI#617665)
Intellectual disability syndromic and non-syndromic v0.3734 YWHAG Zornitza Stark reviewed gene: YWHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 33393734, 33590706, 31926053, 33767733; Phenotypes: Developmental and epileptic encephalopathy 56, (MIMI#617665); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3733 HTT Zornitza Stark edited their review of gene: HTT: Added comment: PMID 33432339: Jung et al 2021 - further characterisation of the family previously reported in PMID: 27329733 (Rodan et al 2016) - using WGS they confirm they are the most likely cause of the LOMARS phenotype and clarify their locations as NM_002111.8(HTT): c.8157T>A (p.Phe2719Leu) and NM_002111.8(HTT)c.4469+1G>A (Note there are incorrect Clinvar entries). Functional studies show them each to be a hypomorphic mutation, resulting in severe deficiency of huntingtin in compound heterozygotes.

Still only 2 cases reported to date ((PMID: 27329733/33432339 and 26740508) with biallelic LOF variants in HTT associated with the LOMARS phenotype although this study add further weight with some functional data.; Changed publications: 26740508, 27329733, 33432339
Intellectual disability syndromic and non-syndromic v0.3730 MED25 Zornitza Stark changed review comment from: Basel-Vanagaite-Smirin-Yosef syndrome is an autosomal recessive multiple congenital anomaly disorder characterized by severely delayed psychomotor development resulting in mental retardation, as well as variable eye, brain, cardiac, and palatal abnormalities. 7 individuals from 4 families reported initially, founder variant p.Tyr39Cys. Over 20 individuals reported since, including other variants.; to: Basel-Vanagaite-Smirin-Yosef syndrome is an autosomal recessive multiple congenital anomaly disorder characterized by severely delayed psychomotor development resulting in intellectual disability, as well as variable eye, brain, cardiac, and palatal abnormalities. 7 individuals from 4 families reported initially, founder variant p.Tyr39Cys. Over 20 individuals reported since, including other variants.
Intellectual disability syndromic and non-syndromic v0.3730 MED25 Zornitza Stark reviewed gene: MED25: Rating: GREEN; Mode of pathogenicity: None; Publications: 25792360, 32816121; Phenotypes: Basel-Vanagait-Smirin-Yosef syndrome, MIM# 616449, Congenital cataract-microcephaly-naevus flammeus syndrome MONDO:0014643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3730 ANKRD17 Paul De Fazio reviewed gene: ANKRD17: Rating: GREEN; Mode of pathogenicity: None; Publications: 33909992; Phenotypes: Intellectual disability, speech delay, and dysmorphism; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3730 SIN3B Elena Savva gene: SIN3B was added
gene: SIN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SIN3B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SIN3B were set to PMID: 33811806
Phenotypes for gene: SIN3B were set to Syndromic intellectual disability/autism spectrum disorder
Review for gene: SIN3B was set to GREEN
Added comment: PMID: 33811806
- 9 affected patients, all de novo (2 PTCs, 2 missense, multigenic CNVs)
- syndrome hallmarked by intellectual disability, developmental delay, and dysmorphic facial features with variably penetrant ASD, congenital malformations, corpus callosum defects, and impaired growth.
- All SNV carriers had mild/mod ID
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3729 PPIL1 Zornitza Stark edited their review of gene: PPIL1: Changed phenotypes: Pontocerebellar hypoplasia, type 14, MIM# 619301, microcephaly, seizures
Intellectual disability syndromic and non-syndromic v0.3725 KCNQ5 Zornitza Stark reviewed gene: KCNQ5: Rating: GREEN; Mode of pathogenicity: None; Publications: 28669405, 30359776; Phenotypes: Mental retardation, autosomal dominant 46, MIM# 617601; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3722 KCNK9 Zornitza Stark edited their review of gene: KCNK9: Changed phenotypes: Birk-Barel syndrome, MIM# 612292, MONDO:0012856
Intellectual disability syndromic and non-syndromic v0.3722 KCNK9 Zornitza Stark reviewed gene: KCNK9: Rating: GREEN; Mode of pathogenicity: None; Publications: 28333430, 27151206, 24980697, 18678320; Phenotypes: Birk-Barel syndrome, MIM# 612292; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.3719 ADCY5 Zornitza Stark Mode of inheritance for gene: ADCY5 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3718 ADCY5 Zornitza Stark changed review comment from: Variants in this gene cause a movement disorder, intellectual disability is not typically a feature.; to: Variants in this gene cause a movement disorder, intellectual disability is not typically a feature.

Note one report of two siblings with bi-allelic variants and much more severe phenotype including ID (PMID 33704598); however parents were asymptomatic so evidence for causality is limited.
Intellectual disability syndromic and non-syndromic v0.3718 ADCY5 Zornitza Stark edited their review of gene: ADCY5: Changed publications: 22782511, 24700542, 33051786, 32647899, 33704598; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3718 XPNPEP3 Zornitza Stark changed review comment from: 1 family with 3 sibs with a renal disease reminiscent of nephronophthisis.; to: Three families reported but phenotype is predominantly a renal ciliopathy.
Intellectual disability syndromic and non-syndromic v0.3717 KCNJ6 Zornitza Stark changed review comment from: Keppen-Lubinsky syndrome characterised by severely delayed psychomotor development, hypertonia, hyperreflexia, generalized lipodystrophy giving an aged appearance, and distinctive dysmorphic features, including microcephaly, prominent eyes, narrow nasal bridge, and open mouth.

Three unrelated individuals reported with de novo variants in this gene (one recurred in 2), mouse model.; to: Keppen-Lubinsky syndrome characterised by severely delayed psychomotor development, hypertonia, hyperreflexia, generalized lipodystrophy giving an aged appearance, and distinctive dysmorphic features, including microcephaly, prominent eyes, narrow nasal bridge, and open mouth.

Four unrelated individuals reported with de novo variants in this gene (one recurred in 2), mouse model. One of the individuals did not have lipodystrophy but had a prominent hyperkinetic movement disorder.
Intellectual disability syndromic and non-syndromic v0.3717 KCNJ6 Zornitza Stark edited their review of gene: KCNJ6: Changed publications: 25620207, 29852244
Intellectual disability syndromic and non-syndromic v0.3714 KCNJ6 Zornitza Stark reviewed gene: KCNJ6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25620207; Phenotypes: Keppen-Lubinsky syndrome, MIM# 614098, MONDO:0013572; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3713 JMJD1C Zornitza Stark reviewed gene: JMJD1C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3713 JMJD1C Chris Richmond gene: JMJD1C was added
gene: JMJD1C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: JMJD1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: JMJD1C were set to 26181491; 32996679
Phenotypes for gene: JMJD1C were set to Intellectual disability
Penetrance for gene: JMJD1C were set to unknown
Review for gene: JMJD1C was set to GREEN
Added comment: Reported in ID cohort (with Rett-like phenotypic overlap) with supporting functional studies (PMID: 26181491) "Functional study of the JMJD1C mutant Rett syndrome patient demonstrated that the altered protein had abnormal subcellular localization, diminished activity to demethylate the DNA damage-response protein MDC1, and reduced binding to MECP2. We confirmed that JMJD1C protein is widely expressed in brain regions and that its depletion compromises dendritic activity."

Splice-disrupting JMJD1C variant reported in association with learning disability and myoclonic epilepsy (PMID 32996679)

Disruption of gene due to balanced translocation (PMID 33591602) implicated in autism spectrum disease phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.3713 AFF4 Zornitza Stark edited their review of gene: AFF4: Changed mode of pathogenicity: Other; Changed publications: 25730767, 33248856, 31630891, 31058441; Changed phenotypes: CHOPS syndrome, MIM#616368, MONDO:0014609; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3713 AFF4 Zornitza Stark edited their review of gene: AFF4: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.3709 AFF4 Zornitza Stark Mode of pathogenicity for gene: AFF4 was changed from to Other
Intellectual disability syndromic and non-syndromic v0.3707 AFF4 Teresa Zhao reviewed gene: AFF4: Rating: GREEN; Mode of pathogenicity: Other; Publications: 25730767; Phenotypes: CHOPS syndrome, MIM#616368; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.3706 VPS4A Zornitza Stark reviewed gene: VPS4A: Rating: GREEN; Mode of pathogenicity: Other; Publications: ; Phenotypes: CIMDAG syndrome MIM# 619273; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3706 MED27 Zornitza Stark Phenotypes for gene: MED27 were changed from Intellectual disability; cerebellar hypoplasia; dystonia to Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286
Intellectual disability syndromic and non-syndromic v0.3705 MED27 Zornitza Stark reviewed gene: MED27: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3702 TGIF1 Zornitza Stark reviewed gene: TGIF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10835638, 16323008; Phenotypes: Holoprosencephaly 4, MIM# 142946, MONDO:0007734; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3702 NEUROD2 Zornitza Stark Phenotypes for gene: NEUROD2 were changed from Epileptic encephalopathy, early infantile, 72, MIM# 618374 to Epileptic encephalopathy, early infantile, 72, MIM# 618374; Intellectual disability
Intellectual disability syndromic and non-syndromic v0.3700 NEUROD2 Zornitza Stark gene: NEUROD2 was added
gene: NEUROD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NEUROD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NEUROD2 were set to 33438828; 30323019
Phenotypes for gene: NEUROD2 were set to Epileptic encephalopathy, early infantile, 72, MIM# 618374
Review for gene: NEUROD2 was set to GREEN
Added comment: Four unrelated individuals altogether with de novo variants in this gene, two presenting predominantly with seizures, and two with ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3699 MPLKIP Zornitza Stark Phenotypes for gene: MPLKIP were changed from to Trichothiodystrophy 4, nonphotosensitive, MIM# 234050; MONDO:0021013
Intellectual disability syndromic and non-syndromic v0.3696 MPLKIP Zornitza Stark reviewed gene: MPLKIP: Rating: GREEN; Mode of pathogenicity: None; Publications: 15645389, 16977596; Phenotypes: Trichothiodystrophy 4, nonphotosensitive, MIM# 234050, MONDO:0021013; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3696 GTF2E2 Zornitza Stark Phenotypes for gene: GTF2E2 were changed from Trichothiodystrophy 6, nonphotosensitive; OMIM #616943 to Trichothiodystrophy 6, nonphotosensitive, MIM# 616943; MONDO:0014841
Intellectual disability syndromic and non-syndromic v0.3694 GTF2E2 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v0.3690 ERCC5 Zornitza Stark reviewed gene: ERCC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 7951246, 9096355, 9096355, 24700531, 33766032, 33219753; Phenotypes: Cerebrooculofacioskeletal syndrome 3, MIM# 616570, MONDO:0014696, Xeroderma pigmentosum, group G, MIM# 278780, MONDO:0010216; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3687 ERCC1 Zornitza Stark reviewed gene: ERCC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273966, 23623389, 32557569, 26085086, 33315086; Phenotypes: Cerebrooculofacioskeletal syndrome 4, MIM# 610758, MONDO:0012554; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3687 KCNH1 Zornitza Stark Phenotypes for gene: KCNH1 were changed from to Temple-Baraitser syndrome, OMIM:611816; Zimmermann-Laband syndrome 1, OMIM:135500; Intellectual disability; Encephalopathy without features of TBS/ZLS
Intellectual disability syndromic and non-syndromic v0.3684 KCNH1 Arina Puzriakova reviewed gene: KCNH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33811134; Phenotypes: Temple-Baraitser syndrome, OMIM:611816, Zimmermann-Laband syndrome 1, OMIM:135500, Intellectual disability, Encephalopathy without features of TBS/ZLS; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3684 EMC10 Zornitza Stark Phenotypes for gene: EMC10 were changed from Developmental delay and intellectual disability, no OMIM# to Neurodevelopmental disorder with dysmorphic facies and variable seizures, MIM# 619264
Intellectual disability syndromic and non-syndromic v0.3681 EMC10 Zornitza Stark changed review comment from: Additional 12 individuals from 7 Middle Eastern families reported. Same variant in all, suggestive of founder effect.; to: Additional 12 individuals from 7 Middle Eastern families reported. Same variant in all, suggestive of founder effect (but different to the previously reported family).
Intellectual disability syndromic and non-syndromic v0.3681 EMC10 Zornitza Stark reviewed gene: EMC10: Rating: GREEN; Mode of pathogenicity: None; Publications: 33531666; Phenotypes: Neurodevelopmental disorder with dysmorphic facies and variable seizures, MIM# 619264; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3680 HDAC4 Bryony Thompson edited their review of gene: HDAC4: Changed publications: 33537682
Intellectual disability syndromic and non-syndromic v0.3679 PLCH1 Zornitza Stark gene: PLCH1 was added
gene: PLCH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLCH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLCH1 were set to 33820834
Phenotypes for gene: PLCH1 were set to Holoprosencephaly spectrum; Severe developmental delay; Brain malformations
Review for gene: PLCH1 was set to AMBER
Added comment: PMID: 33820834 (2021) - Two sibling pairs from two unrelated families with a holoprosencephaly spectrum phenotype and different homozygous PLCH1 variants (c.2065C>T, p.Arg689* and c.4235delA, p.Cys1079ValfsTer16, respectively). One family presented with congenital hydrocephalus, epilepsy, significant developmental delay and a monoventricle or fused thalami; while sibs from the second family had alobar holoprosencephaly and cyclopia. 3/4 individuals also displayed a cleft palate and congenital heart disease. Human embryo immunohistochemistry showed PLCH1 to be expressed in the notorcord, developing spinal cord (in a ventral to dorsal gradient), dorsal root ganglia, cerebellum and dermatomyosome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3678 PIGC Zornitza Stark Phenotypes for gene: PIGC were changed from to Glycosylphosphatidylinositol biosynthesis defect 16, MIM# 617816
Intellectual disability syndromic and non-syndromic v0.3672 DDX11 Zornitza Stark reviewed gene: DDX11: Rating: GREEN; Mode of pathogenicity: None; Publications: 20137776, 23033317, 30216658; Phenotypes: Warsaw breakage syndrome, MIM# 613398, MONDO:0013252; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3670 FAR1 Zornitza Stark Mode of inheritance for gene: FAR1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3668 FAR1 Zornitza Stark edited their review of gene: FAR1: Added comment: PMID 33239752: 12 patients with paediatric onset spastic paraparesis and bilateral congenital/juvenile cataracts. Most also had speech and gross motor developmental delay and truncal hypotonia. Exome sequencing identified de novo variants affecting the Arg480 residue in FAR1 (p.Arg480Cys/His/Leu). Further functional studies in fibroblasts showed that these variants cause a disruption of the plasmalogen-dependent feedback regulation of FAR1 protein levels leading to uncontrolled ether lipid production.; Changed rating: GREEN; Changed publications: 25439727, 33239752; Changed phenotypes: Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154, spastic paraparesis and bilateral cataracts; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3665 GRIA3 Michelle Torres reviewed gene: GRIA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32977175, 17989220; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3664 MAPKAPK5 Chirag Patel gene: MAPKAPK5 was added
gene: MAPKAPK5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAPKAPK5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAPKAPK5 were set to PMID: 3344202
Phenotypes for gene: MAPKAPK5 were set to Developmental delay, variable brain anomalies, congenital heart defects, dysmorphic
Review for gene: MAPKAPK5 was set to GREEN
Added comment: 3 individuals from 2 families with severe developmental delay, variable brain anomalies, congenital heart defects, dysmorphic facial features, and a distinctive type of synpolydactyly with an additional hypoplastic digit between the fourth and fifth digits of hands and/or feet. Exome sequencing identified different homozygous truncating variants in MAPKAPK5 in both families, segregating with disease and unaffected parents as carriers.

Patient-derived cells showed no expression of MAPKAPK5 protein isoforms and reduced levels of the MAPKAPK5-interacting protein ERK3. F-actin recovery after latrunculin B treatment was found to be less efficient in patient-derived fibroblasts than in control cells, supporting a role of MAPKAPK5 in F-actin polymerization.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3662 UBE4A Chirag Patel gene: UBE4A was added
gene: UBE4A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE4A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBE4A were set to PMID: 33420346
Phenotypes for gene: UBE4A were set to Intellectual disability and global developmental delay
Review for gene: UBE4A was set to GREEN
Added comment: 8 individuals, from 4 unrelated families, with syndromic intellectual disability and global developmental delay (other clinical features included hypotonia, short stature, seizures, and behaviour disorder. Exome sequencing identified biallelic loss-of-function variants in UBE4A in the 4 families, with variants segregating with disease and parents carriers. They demonstrated that UBE4A loss-of-function variants reduced RNA expression and protein levels in clinical samples. Mice generated to mimic patient-specific Ube4a loss-of-function variant exhibited muscular and neurological/behavioural abnormalities, some of which are suggestive of the clinical abnormalities seen in the affected individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3658 SGSH Zornitza Stark reviewed gene: SGSH: Rating: GREEN; Mode of pathogenicity: None; Publications: 7493035, 9158154, 9401012, 9554748; Phenotypes: Mucopolysaccharidosis type IIIA (Sanfilippo A), MIM# 252900, MONDO:0009655; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3655 SMPD1 Zornitza Stark reviewed gene: SMPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32292456, 32280632, 28164782; Phenotypes: Niemann-Pick disease, type A, MIM# 257200, MONDO:0009756; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3652 MFSD8 Zornitza Stark reviewed gene: MFSD8: Rating: GREEN; Mode of pathogenicity: None; Publications: 17564970, 19201763; Phenotypes: Ceroid lipofuscinosis, neuronal, 7, MIM# 610951, MONDO:0012588; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3650 MCOLN1 Zornitza Stark reviewed gene: MCOLN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mucolipidosis IV, MIM# 252650, MONDO:0009653; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3648 MANBA Zornitza Stark reviewed gene: MANBA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mannosidosis, beta, MIM# 248510, MONDO:0009562; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3646 MAN2B1 Zornitza Stark reviewed gene: MAN2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mannosidosis, alpha-, types I and II, MIM# 248500, MONDO:0009561; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3642 TSPOAP1 Ain Roesley gene: TSPOAP1 was added
gene: TSPOAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TSPOAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TSPOAP1 were set to 33539324
Phenotypes for gene: TSPOAP1 were set to Dystonia, intellectual disability and cerebellar atrophy
Penetrance for gene: TSPOAP1 were set to unknown
Review for gene: TSPOAP1 was set to GREEN
Added comment: 7 affecteds from 3 families (1 consanguineous)
2x null, 1x missense

Affecteds with the null variants presented with juvenile-onset progressive generalized dystonia, associated with intellectual disability and cerebellar atrophy while those with the missense p.(Gly1808Ser) presented with isolated adult-onset focal dystonia (mild cognitive impairment noted)

mice KO models were investigated
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3641 NCDN Ain Roesley gene: NCDN was added
gene: NCDN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NCDN was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: NCDN were set to 33711248
Phenotypes for gene: NCDN were set to neurodevelopmental delay, intellectual disability, and epilepsy
Penetrance for gene: NCDN were set to unknown
Added comment: 4x families all missense and de novo except for 1 consag family where 3 affecteds were homozygous and carrier parents unaffected

ID ranged from mild to severe
3/4 probands had seizures
only 3 affecteds had MRI done, with 1 delayed myelination

in vitro studies were done
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3639 TBX1 Zornitza Stark reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: DiGeorge syndrome, MIM# 188400; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3639 SLC5A5 Zornitza Stark Phenotypes for gene: SLC5A5 were changed from to Thyroid dyshormonogenesis 1, MIM# 274400
Intellectual disability syndromic and non-syndromic v0.3636 SLC5A5 Zornitza Stark reviewed gene: SLC5A5: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Thyroid dyshormonogenesis 1, MIM# 274400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3636 SLC45A1 Zornitza Stark Phenotypes for gene: SLC45A1 were changed from to Intellectual developmental disorder with neuropsychiatric features, MIM# 617532
Intellectual disability syndromic and non-syndromic v0.3632 SLC45A1 Zornitza Stark reviewed gene: SLC45A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 28434495; Phenotypes: Intellectual developmental disorder with neuropsychiatric features, MIM# 617532; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3629 SLC2A2 Zornitza Stark reviewed gene: SLC2A2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Fanconi-Bickel syndrome, MIM# 227810; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3626 PIK3R2 Zornitza Stark reviewed gene: PIK3R2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22729224, 23745724, 33604570; Phenotypes: Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 1, MIM# 603387; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3623 FGFR2 Zornitza Stark Phenotypes for gene: FGFR2 were changed from to Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, MIM# 207410; Apert syndrome, MIM# 101200
Intellectual disability syndromic and non-syndromic v0.3620 FGFR2 Zornitza Stark reviewed gene: FGFR2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, MIM# 207410, Apert syndrome, MIM# 101200; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3620 CYP27A1 Zornitza Stark Phenotypes for gene: CYP27A1 were changed from to Cerebrotendinous xanthomatosis, MIM# 213700
Intellectual disability syndromic and non-syndromic v0.3617 CYP27A1 Zornitza Stark reviewed gene: CYP27A1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebrotendinous xanthomatosis, MIM# 213700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3614 HGSNAT Zornitza Stark reviewed gene: HGSNAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 19479962, 31228227, 20825431, 20583299; Phenotypes: Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM# 252930, MONDO:0009657; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3612 GUSB Zornitza Stark reviewed gene: GUSB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mucopolysaccharidosis VII, MIM# 253220, MONDO:0009662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3609 GNPTG Zornitza Stark reviewed gene: GNPTG: Rating: GREEN; Mode of pathogenicity: None; Publications: 10712439, 19370764, 19659762, 33507475, 33023972, 32651481; Phenotypes: Mucolipidosis III gamma, MIM# 252605, MONDO:0009652; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3607 CDH11 Zornitza Stark Mode of inheritance for gene: CDH11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3606 CDH11 Zornitza Stark reviewed gene: CDH11: Rating: GREEN; Mode of pathogenicity: None; Publications: 33811546, 27431290, 28988429, 29271567; Phenotypes: Elsahy-Waters syndrome, MIM# 211380, Teebi hypertelorism syndrome; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3606 CDH11 Chirag Patel reviewed gene: CDH11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33811546; Phenotypes: Teebi hypertelorism syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3606 NMNAT1 Zornitza Stark edited their review of gene: NMNAT1: Changed phenotypes: Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual disability, and Leber congenital amaurosis (SHILCA), MIM#619260
Intellectual disability syndromic and non-syndromic v0.3604 NMNAT1 Zornitza Stark gene: NMNAT1 was added
gene: NMNAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV, founder tags were added to gene: NMNAT1.
Mode of inheritance for gene: NMNAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NMNAT1 were set to 32533184; 33668384
Phenotypes for gene: NMNAT1 were set to Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual disability, and Leber congenital amaurosis (SHILCA), MIM#619260; Leber congenital amaurosis 9, MIM# 608553
Review for gene: NMNAT1 was set to AMBER
Added comment: Three families reported, but two are distantly related (shared haplotype). The affected children in those two families were homozygous for 7.4-kb duplication involving the last 2 exons of the NMNAT1 gene, spanning the beginning of intron 3 to the middle of the 3-prime UTR (chr1:10,036,359-10,043,727, GRCh37). The third affected individual was compound het for the duplication and a splicing variant.

Note bi-allelic variants in this gene are associated with non-syndromic LCA, multiple families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3600 CLN5 Zornitza Stark reviewed gene: CLN5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20157158; Phenotypes: Ceroid lipofuscinosis, neuronal, 5, MIM# 256731, MONDO:0009745; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3597 ARSB Zornitza Stark reviewed gene: ARSB: Rating: GREEN; Mode of pathogenicity: None; Publications: 11668612; Phenotypes: Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200, MONDO:0009661; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3596 COPB1 Zornitza Stark edited their review of gene: COPB1: Changed phenotypes: Baralle-Macken syndrome, MIM# 619255, Severe intellectual disability, variable microcephaly, cataracts
Intellectual disability syndromic and non-syndromic v0.3596 TTC5 Zornitza Stark Phenotypes for gene: TTC5 were changed from Central hypotonia; Global developmental delay; Intellectual disability; Abnormality of nervous system morphology; Microcephaly; Abnormality of the face; Behavioral abnormality; Abnormality of the genitourinary system to Neurodevelopmental disorder with cerebral atrophy and variable facial dysmorphism , MIM#619244; Central hypotonia; Global developmental delay; Intellectual disability; Abnormality of nervous system morphology; Microcephaly; Abnormality of the face; Behavioral abnormality; Abnormality of the genitourinary system
Intellectual disability syndromic and non-syndromic v0.3595 TTC5 Zornitza Stark reviewed gene: TTC5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with cerebral atrophy and variable facial dysmorphism , MIM#619244; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3595 WDR62 Zornitza Stark Phenotypes for gene: WDR62 were changed from to Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM# 604317; MONDO:0011435
Intellectual disability syndromic and non-syndromic v0.3592 WDR62 Zornitza Stark reviewed gene: WDR62: Rating: GREEN; Mode of pathogenicity: None; Publications: 20890279, 20729831, 20890278, 21496009, 21834044, 22775483, 32677750, 31788460; Phenotypes: Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM# 604317, MONDO:0011435; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3589 TRMT10A Zornitza Stark reviewed gene: TRMT10A: Rating: GREEN; Mode of pathogenicity: None; Publications: 24204302, 25053765, 33448213, 33067246, 26535115, 26526202, 26297882; Phenotypes: Microcephaly, short stature, and impaired glucose metabolism 1, MIM# 616033, MONDO:0000208; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3588 TRAIP Zornitza Stark edited their review of gene: TRAIP: Added comment: Three families reported, though two distantly related (founder); functional data.; Changed publications: 26595769
Intellectual disability syndromic and non-syndromic v0.3585 STIL Zornitza Stark reviewed gene: STIL: Rating: GREEN; Mode of pathogenicity: None; Publications: 19215732, 22989186, 25218063, 33132204, 32677750, 29230157; Phenotypes: Microcephaly 7, primary, autosomal recessive, MIM# 612703, MONDO:0012989; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3582 STAMBP Zornitza Stark reviewed gene: STAMBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23542699, 31638258, 29907875, 27531570, 25692795, 25266620; Phenotypes: Microcephaly-capillary malformation syndrome, MIM# 614261, MONDO:0013659; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3582 RTTN Zornitza Stark Phenotypes for gene: RTTN were changed from to Microcephaly, short stature, and polymicrogyria with seizures, MIM# 614833; Microcephalic primordial dwarfism due to RTTN deficiency MONDO:0018764
Intellectual disability syndromic and non-syndromic v0.3579 RTTN Zornitza Stark reviewed gene: RTTN: Rating: GREEN; Mode of pathogenicity: None; Publications: 22939636, 26608784, 26940245, 30121372, 29967526, 30927481, 30121372; Phenotypes: Microcephaly, short stature, and polymicrogyria with seizures, MIM# 614833, Microcephalic primordial dwarfism due to RTTN deficiency MONDO:0018764; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3578 BRD4 Chirag Patel reviewed gene: BRD4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.3578 NDE1 Zornitza Stark Phenotypes for gene: NDE1 were changed from to Lissencephaly 4 (with microcephaly), MIM# 614019; MONDO:0013527; Microhydranencephaly, MIM# 605013; MONDO:0011504
Intellectual disability syndromic and non-syndromic v0.3575 NDE1 Zornitza Stark reviewed gene: NDE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21529752, 21529751, 30637988, 15473967; Phenotypes: Lissencephaly 4 (with microcephaly), MIM# 614019, MONDO:0013527, Microhydranencephaly, MIM# 605013, MONDO:0011504; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3572 MSMO1 Zornitza Stark reviewed gene: MSMO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 21285510, 24144731, 33161406, 28673550, 33161406; Phenotypes: Microcephaly, congenital cataract, and psoriasiform dermatitis, MIM# 616834, MONDO:0014793; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3569 MCPH1 Zornitza Stark reviewed gene: MCPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12046007, 15199523, 16311745, 20978018, 32294449, 30351297, 29026105; Phenotypes: Microcephaly 1, primary, autosomal recessive, MIM# 251200, MONDO:0009617; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3566 LARP7 Zornitza Stark reviewed gene: LARP7: Rating: GREEN; Mode of pathogenicity: None; Publications: 22865833, 21937992, 30006060, 33569879; Phenotypes: Alazami syndrome, MIM# 615071, Microcephalic primordial dwarfism, Alazami type MONDO:0014031; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3563 KNL1 Zornitza Stark reviewed gene: KNL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22983954, 26626498, 27149178, 30304678, 27784895; Phenotypes: Microcephaly 4, primary, autosomal recessive, MIM# 604321, MONDO:0011437; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3563 TNRC6B Zornitza Stark Phenotypes for gene: TNRC6B were changed from Global developmental delay; Intellectual disability; Autistic behavior to Global developmental delay with speech and behavioural abnormalities, MIM# 619243
Intellectual disability syndromic and non-syndromic v0.3562 TNRC6B Zornitza Stark edited their review of gene: TNRC6B: Changed rating: GREEN; Changed phenotypes: Global developmental delay with speech and behavioural abnormalities, MIM# 619243; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3562 KIF11 Zornitza Stark Phenotypes for gene: KIF11 were changed from Microcephaly with or without chorioretinopathy, lymphoedema, or mental retardation, MIM# 152950; MONDO:0007918 to Microcephaly with or without chorioretinopathy, lymphoedema, or mental retardation, MIM# 152950; MONDO:0007918
Intellectual disability syndromic and non-syndromic v0.3561 KIF11 Zornitza Stark Phenotypes for gene: KIF11 were changed from Microcephaly with or without chorioretinopathy, lymphedema, or mental retardation MIM#152950 to Microcephaly with or without chorioretinopathy, lymphoedema, or mental retardation, MIM# 152950; MONDO:0007918
Intellectual disability syndromic and non-syndromic v0.3559 KIF11 Zornitza Stark reviewed gene: KIF11: Rating: GREEN; Mode of pathogenicity: None; Publications: 22284827, 25115524, 25124931, 27212378, 32730767, 31993640, 25996076; Phenotypes: Microcephaly with or without chorioretinopathy, lymphoedema, or mental retardation, MIM# 152950, MONDO:0007918; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3556 IER3IP1 Zornitza Stark reviewed gene: IER3IP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21835305, 22991235, 24138066, 28711742; Phenotypes: Microcephaly, epilepsy, and diabetes syndrome, MIM# 614231, Primary microcephaly-epilepsy-permanent neonatal diabetes syndrome, MONDO:0013647; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3553 EFTUD2 Zornitza Stark reviewed gene: EFTUD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22305528, 23188108, 33601405, 33262786, 26507355; Phenotypes: Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536, Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3550 CEP152 Zornitza Stark reviewed gene: CEP152: Rating: GREEN; Mode of pathogenicity: None; Publications: 20598275, 22775483, 21131973, 23199753; Phenotypes: Microcephaly 9, primary, autosomal recessive, MIM# 614852, MONDO:0013923, Seckel syndrome 5, MIM# 613823, MONDO:0013443; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3550 CUL3 Zornitza Stark Phenotypes for gene: CUL3 were changed from Global developmental delay; Intellectual disability; Seizures; Abnormality of cardiovascular system morphology; Abnormality of the palate to Neurodevelopmental disorder with or without autism or seizures, MIM# 619239; Global developmental delay; Intellectual disability; Seizures; Abnormality of cardiovascular system morphology; Abnormality of the palate
Intellectual disability syndromic and non-syndromic v0.3549 CUL3 Zornitza Stark reviewed gene: CUL3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with or without autism or seizures, MIM# 619239; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3548 DDB1 Sue White reviewed gene: DDB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33743206; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3548 ZNF711 Zornitza Stark Mode of inheritance for gene: ZNF711 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3545 ZNF711 Zornitza Stark Mode of inheritance for gene: ZNF711 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3544 ZNF711 Chirag Patel reviewed gene: ZNF711: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 27993705, 19377476; Phenotypes: Mental retardation, X-linked 97, OMIM #300803; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3543 DM1 Bryony Thompson STR: DM1 was added
STR: DM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: DM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM1 were set to 20301344; 29325606
Phenotypes for STR: DM1 were set to Myotonic dystrophy 1 MIM#160900
Review for STR: DM1 was set to GREEN
STR: DM1 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_001081560.2:c.*224_*226CTG[X]
RNA toxic gain of function is mechanism of disease
Premutation: 35-49 repeats, no clinical signs
Mild: 50-~150 repeats, age of onset 20-70 yrs, clinical signs - cataracts, mild myotonia
Classic: ~100-~1,000 repeats, age of onset 10-30 yrs, clinical signs - weakness, myotonia, cataracts, balding, cardiac arrhythmia
Congenital: >1,000 repeats, age of onset birth-10 yrs , clinical signs - infantile hypotonia, respiratory deficits, intellectual disability, classic signs in adults
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3542 DMPK Bryony Thompson Added comment: Comment on list classification: STR is the only cause of condition for this gene and is present in STRs for this panel.
Intellectual disability syndromic and non-syndromic v0.3542 DMPK Bryony Thompson Gene: dmpk has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.3540 INPP4A Zornitza Stark gene: INPP4A was added
gene: INPP4A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INPP4A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: INPP4A were set to 31978615; 31938306; 25338135; 20011524
Phenotypes for gene: INPP4A were set to Intellectual disability
Review for gene: INPP4A was set to AMBER
Added comment: Two families reported with bi-allelic variants and a neurological phenotype. Supportive mouse model and expression data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3539 SATB1 Zornitza Stark Phenotypes for gene: SATB1 were changed from Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228; Neurodevelopmental disorder; intellectual disability; epilepsy; microcephaly to Kohlschutter-Tonz syndrome-like, MIM# 619229; Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228; Neurodevelopmental disorder; intellectual disability; epilepsy; microcephaly
Intellectual disability syndromic and non-syndromic v0.3538 SATB1 Zornitza Stark edited their review of gene: SATB1: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.3538 SATB1 Zornitza Stark edited their review of gene: SATB1: Added comment: Kohlschutter-Tonz syndrome-like (KTZSL) is characterized by global developmental delay with moderately to severely impaired intellectual development, poor or absent speech, and delayed motor skills. Although the severity of the disorder varies, many patients are nonverbal and have hypotonia with inability to sit or walk. Early-onset epilepsy is common and may be refractory to treatment, leading to epileptic encephalopathy and further interruption of developmental progress. Most patients have feeding difficulties with poor overall growth and dysmorphic facial features, as well as significant dental anomalies resembling amelogenesis imperfecta. This phenotype was reported in 28 patients (patients 13 to 40, PMID 33513338), including 9 patients from 3 families. Most variants were de novo, though some were inherited, suggestive of incomplete penetrance and variable expressivity.

Developmental delay with dysmorphic facies and dental anomalies (DEFDA) is characterized by generally mild global developmental delay with variably impaired intellectual development, walking by 2 to 3 years, and slow language acquisition. The severity of the disorder ranges from moderate cognitive deficits to mild learning difficulties or behavioral abnormalities. Most patients have dysmorphic facial features, often with abnormal dentition and nonspecific visual defects, such as myopia, astigmatism, and strabismus. Although rare, involvement of other systems, such as skeletal, cardiac, and gastrointestinal, may be present. 12 individuals from 11 families reported (one inherited variant, affected parent).; Changed phenotypes: Kohlschutter-Tonz syndrome-like, MIM# 619229, Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228, Developmental disorders
Intellectual disability syndromic and non-syndromic v0.3538 SATB1 Zornitza Stark Phenotypes for gene: SATB1 were changed from Neurodevelopmental disorder; intellectual disability; epilepsy; microcephaly to Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228; Neurodevelopmental disorder; intellectual disability; epilepsy; microcephaly
Intellectual disability syndromic and non-syndromic v0.3537 SATB1 Zornitza Stark edited their review of gene: SATB1: Changed phenotypes: Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228, Developmental disorders
Intellectual disability syndromic and non-syndromic v0.3536 INPP5E Zornitza Stark edited their review of gene: INPP5E: Changed publications: 19668216, 32139166, 29230161, 29052317, 27998989, 27401686, 19668215
Intellectual disability syndromic and non-syndromic v0.3533 INPP5E Zornitza Stark reviewed gene: INPP5E: Rating: GREEN; Mode of pathogenicity: None; Publications: 19668216, 32139166, 29230161, 29052317, 27998989, 27401686; Phenotypes: Joubert syndrome 1, MIM# 213300, MONDO:0008944, Mental retardation, truncal obesity, retinal dystrophy, and micropenis, MIM# 610156, MONDO:0012423; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3530 CSPP1 Zornitza Stark reviewed gene: CSPP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360808, 24360803, 24360807, 25997910; Phenotypes: Joubert syndrome 21, MIM# 615636, MONDO:0014288; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3530 KDM5B Zornitza Stark edited their review of gene: KDM5B: Changed phenotypes: Mental retardation, autosomal recessive 65 MIM#618109, Intellectual disability and/or autism, autosomal dominant
Intellectual disability syndromic and non-syndromic v0.3528 KDM5B Zornitza Stark Mode of inheritance for gene: KDM5B was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3527 KDM5B Zornitza Stark reviewed gene: KDM5B: Rating: GREEN; Mode of pathogenicity: None; Publications: 29276005, 30217758, 30409806; Phenotypes: Mental retardation, autosomal recessive 65 MIM#618109, autosomal dominant autism spectrum disorder or intellectual disability; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3526 TPP2 Zornitza Stark gene: TPP2 was added
gene: TPP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TPP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TPP2 were set to 25525876; 25414442; 33586135; 18362329
Phenotypes for gene: TPP2 were set to Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220
Review for gene: TPP2 was set to GREEN
Added comment: Immunodeficiency-78 with autoimmunity and developmental delay (IMD78) is an autosomal recessive systemic disorder characterized by onset of symptoms in early childhood. Affected individuals present with features of immune deficiency, such as recurrent sinopulmonary or skin infections, as well as autoimmunity, including autoimmune cytopenias, hemolytic anemia, and thrombocytopenia. Autoimmune hepatitis or thyroid disease and central nervous system vasculitis with stroke may also occur. There is increased susceptibility to bacterial, viral, and fungal infections. Laboratory studies show lymphopenia with advanced differentiation and premature senescence of CD8+ T cells and B cells; some patients may have hypergammaglobulinemia. The findings indicate immune dysregulation. Patients also have global developmental delay with speech delay and variable intellectual disability. Five unrelated families and a mouse model.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3525 DOCK7 Zornitza Stark Phenotypes for gene: DOCK7 were changed from Developmental and epileptic encephalopathy 23 MIM#615859 to Developmental and epileptic encephalopathy 23 MIM#615859; MONDO:0014371
Intellectual disability syndromic and non-syndromic v0.3524 DOCK7 Zornitza Stark Phenotypes for gene: DOCK7 were changed from to Developmental and epileptic encephalopathy 23 MIM#615859
Intellectual disability syndromic and non-syndromic v0.3521 DOCK7 Paul De Fazio reviewed gene: DOCK7: Rating: GREEN; Mode of pathogenicity: None; Publications: 24814191, 30771731, 30807358; Phenotypes: Developmental and epileptic encephalopathy 23 MIM#615859; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3519 SLC1A4 Zornitza Stark Phenotypes for gene: SLC1A4 were changed from Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657 to Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657; MONDO:0014725
Intellectual disability syndromic and non-syndromic v0.3518 WDR45B Zornitza Stark Phenotypes for gene: WDR45B were changed from to Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM# 617977
Intellectual disability syndromic and non-syndromic v0.3515 WDR45B Zornitza Stark reviewed gene: WDR45B: Rating: GREEN; Mode of pathogenicity: None; Publications: 21937992, 28503735, 27431290; Phenotypes: Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM# 617977; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3512 NT5C2 Zornitza Stark reviewed gene: NT5C2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 32153630, 29123918, 28884889, 28327087; Phenotypes: Spastic paraplegia 45, autosomal recessive, MIM# 613162, MONDO:0013165; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3512 HACE1 Zornitza Stark Phenotypes for gene: HACE1 were changed from to Spastic paraplegia and psychomotor retardation with or without seizures, 616756; MONDO:0014764
Intellectual disability syndromic and non-syndromic v0.3509 HACE1 Zornitza Stark reviewed gene: HACE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26424145, 26437029, 31321300; Phenotypes: Spastic paraplegia and psychomotor retardation with or without seizures, 616756, MONDO:0014764; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3506 KIDINS220 Zornitza Stark reviewed gene: KIDINS220: Rating: GREEN; Mode of pathogenicity: None; Publications: 27005418, 29667355; Phenotypes: Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296, MONDO:0015007; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3504 KDM5C Zornitza Stark Mode of inheritance for gene: KDM5C was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3503 KDM5C Zornitza Stark reviewed gene: KDM5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 15586325, 32279304; Phenotypes: Mental retardation, X-linked, syndromic, Claes-Jensen type, MIM# 300534, MONDO:0010355; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3500 AP4M1 Zornitza Stark reviewed gene: AP4M1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19559397, 21937992, 21937992, 32979048, 31915823, 29096665, 28464862, 25496299; Phenotypes: Spastic paraplegia 50, autosomal recessive, MIM# 612936; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3497 AP4B1 Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758, 32979048, 32171285, 32166732, 31525725, 31525725; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3494 AP4S1 Zornitza Stark reviewed gene: AP4S1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 25552650, 32979048, 32216065, 31915823, 30283821, 27444738; Phenotypes: Spastic paraplegia 52, autosomal recessive, MIM# 614067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3491 AIMP1 Zornitza Stark reviewed gene: AIMP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26173967, 21092922, 24958424, 33402283, 32531460, 30486714, 30477741; Phenotypes: Intellectual disability, Leukodystrophy, hypomyelinating, 3, MIM# 260600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3488 CC2D1A Michelle Torres edited their review of gene: CC2D1A: Added comment: 7 NMD predicted reported, no missense (ClinVar, Decipher, LOVD, PMID: 25066123). Severity of ID and presence of cognitive and social features, as well as seizures is variable inter and intra-familial (PMID: 25066123).; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3488 CC2D1A Michelle Torres reviewed gene: CC2D1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25066123; Phenotypes: Autosomal recessive mental retardation, (MIM#608443), AR; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.3485 CDK5RAP2 Zornitza Stark reviewed gene: CDK5RAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15793586, 22887808, 23995685, 23726037, 27761245, 20460369, 32677750, 32015000; Phenotypes: Microcephaly 3, primary, autosomal recessive, MIM# 604804, MONDO:0011488; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3483 PGK1 Zornitza Stark reviewed gene: PGK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 6933565, 1547346, 7577653, 9512313; Phenotypes: Phosphoglycerate kinase 1 deficiency, MIM# 300653; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3482 SIAH1 Zornitza Stark gene: SIAH1 was added
gene: SIAH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SIAH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SIAH1 were set to 32430360
Phenotypes for gene: SIAH1 were set to Developmental delay; Infantile hypotonia; Dysmorphic features; Laryngomalacia
Review for gene: SIAH1 was set to GREEN
Added comment: - PMID: 32430360 (2021) - Five unrelated individuals with shared features of developmental delay, infantile hypotonia, dysmorphic features and laryngomalacia. All had speech delay and where cognitive assessment was age appropriate individuals exhibited learning difficulties. Trio WES revealed distinct de novo variants in SIAH1. In vitro assays demonstrated that SIAH1 mutants induce loss of Wnt stimulatory activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3480 EEF2 Zornitza Stark gene: EEF2 was added
gene: EEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EEF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EEF2 were set to 33355653
Phenotypes for gene: EEF2 were set to Neurodevelopmental disorder; macrocephaly; hydrocephalus
Review for gene: EEF2 was set to GREEN
Added comment: De novo EEF2 missense variants reported in 3 unrelated children (3, 6 and 9 years of age) with a mild neurodevelopmental phenotype comprising motor delay and relative macrocephaly associated with ventriculomegaly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3479 DLK1 Zornitza Stark Added comment: Comment when marking as ready: Association with central precocious puberty but not ID.
Intellectual disability syndromic and non-syndromic v0.3476 DLK1 Natasha Brown reviewed gene: DLK1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 28324015, PMID: 30462238; Phenotypes: central precocious puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.3476 DLK1 Natasha Brown Source Genetic Health Queensland was removed from DLK1.
Source Literature was added to DLK1.
Mode of inheritance for gene DLK1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Phenotypes for gene: DLK1 were changed from to central precocious puberty
Penetrance for gene DLK1 was set from to None
Publications for gene DLK1 were changed from PMID: 28324015 to PMID: 28324015
Intellectual disability syndromic and non-syndromic v0.3474 EIF5A Zornitza Stark gene: EIF5A was added
gene: EIF5A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF5A were set to 33547280
Phenotypes for gene: EIF5A were set to Intellectual disability; microcephaly; dysmorphism
Review for gene: EIF5A was set to GREEN
Added comment: 7 unrelated individuals reported with de novo variants in this gene and variable combinations of developmental delay, microcephaly, micrognathia and dysmorphism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3472 POLRMT Zornitza Stark gene: POLRMT was added
gene: POLRMT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLRMT was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: POLRMT were set to 33602924
Phenotypes for gene: POLRMT were set to Mitochondrial disorder; intellectual disability; hypotonia
Review for gene: POLRMT was set to GREEN
Added comment: 8 individuals from 7 families reported. 5 families with bi-allelic variants and 2 with heterozygous variants. Affected individuals presented with global developmental delay, hypotonia, short stature, and speech/intellectual disability in childhood; one subject displayed an indolent progressive external ophthalmoplegia phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3471 KARS Zornitza Stark Phenotypes for gene: KARS were changed from Leukoencephalopathy with or without deafness (LEPID), MIM#619147; Combined mitochondrial oxidative phosphorylation deficiency; epilepsy; intellectual disability; microcephaly to Leukoencephalopathy with or without deafness (LEPID), MIM#619147; Combined mitochondrial oxidative phosphorylation deficiency; epilepsy; intellectual disability; microcephaly
Intellectual disability syndromic and non-syndromic v0.3471 KARS Zornitza Stark Phenotypes for gene: KARS were changed from Combined mitochondrial oxidative phosphorylation deficiency; epilepsy; intellectual disability; microcephaly to Leukoencephalopathy with or without deafness (LEPID), MIM#619147; Combined mitochondrial oxidative phosphorylation deficiency; epilepsy; intellectual disability; microcephaly
Intellectual disability syndromic and non-syndromic v0.3470 KARS Zornitza Stark edited their review of gene: KARS: Changed phenotypes: Leukoencephalopathy with or without deafness (LEPID), MIM#619147, Combined mitochondrial oxidative phosphorylation deficiency, epilepsy, intellectual disability, microcephaly
Intellectual disability syndromic and non-syndromic v0.3466 SPEN Chern Lim reviewed gene: SPEN: Rating: GREEN; Mode of pathogenicity: None; Publications: 33596411; Phenotypes: Developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3463 FOXP2 Zornitza Stark reviewed gene: FOXP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15877281, 15983371, 27336128; Phenotypes: Speech-language disorder-1, MIM# 602081; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3462 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439; 32453716
Phenotypes for gene: TOGARAM1 were set to Joubert syndrome 37, MIM# 619185
Review for gene: TOGARAM1 was set to GREEN
Added comment: Six families reported with features of ciliopathy, including molar tooth sign consistent with Joubert syndrome. In some of the families the disorder presented prenatally; however, severe ID in survivors including absent speech.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3461 HS2ST1 Zornitza Stark Phenotypes for gene: HS2ST1 were changed from Intellectual disability; dysmorphic features; congenital anomalies to Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194; Intellectual disability; dysmorphic features; congenital anomalies
Intellectual disability syndromic and non-syndromic v0.3460 HS2ST1 Zornitza Stark reviewed gene: HS2ST1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3460 UBR7 Zornitza Stark Phenotypes for gene: UBR7 were changed from Intellectual disability; epilepsy; hypothyroidism; congenital anomalies; dysmorphic features to Li-Campeau syndrome, MIM# 619189; Intellectual disability; epilepsy; hypothyroidism; congenital anomalies; dysmorphic features
Intellectual disability syndromic and non-syndromic v0.3459 UBR7 Zornitza Stark edited their review of gene: UBR7: Changed phenotypes: Li-Campeau syndrome, MIM# 619189, Intellectual disability, epilepsy, hypothyroidism, congenital anomalies, dysmorphic features
Intellectual disability syndromic and non-syndromic v0.3458 ZNF292 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v0.3458 ZNF292 Zornitza Stark edited their review of gene: ZNF292: Changed rating: GREEN; Changed phenotypes: Intellectual developmental disorder, autosomal dominant 63, MIM# 619188; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3457 LMNB2 Zornitza Stark reviewed gene: LMNB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Microcephaly 27, primary, autosomal dominant, MIM# 619180; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3457 LMNB1 Zornitza Stark Phenotypes for gene: LMNB1 were changed from Global developmental delay, Intellectual disability, Microcephaly, Short stature, Seizures, Abnormality of the corpus callosum, Cortical gyral simplification, Feeding difficulties, Scoliosis; Leukodystrophy, adult-onset, autosomal dominant, MIM#169500 to Microcephaly 26, primary, autosomal dominant, MIM# 619179; Global developmental delay, Intellectual disability, Microcephaly, Short stature, Seizures, Abnormality of the corpus callosum, Cortical gyral simplification, Feeding difficulties, Scoliosis; Leukodystrophy, adult-onset, autosomal dominant, MIM#169500
Intellectual disability syndromic and non-syndromic v0.3456 FGF13 Zornitza Stark Phenotypes for gene: FGF13 were changed from Intellectual disability; epilepsy to Developmental and epileptic encephalopathy 90, MIM# 301058; Intellectual disability; epilepsy
Intellectual disability syndromic and non-syndromic v0.3455 FGF13 Zornitza Stark edited their review of gene: FGF13: Changed phenotypes: Developmental and epileptic encephalopathy 90, MIM# 301058, Intellectual disability, epilepsy
Intellectual disability syndromic and non-syndromic v0.3453 MSL3 Zornitza Stark Mode of inheritance for gene: MSL3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3452 MSL3 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v0.3452 MSL3 Zornitza Stark commented on gene: MSL3: Well established ID gene. 2021 paper documents findings in 25 individuals. Variants found to be clustering in the terminal eight exons suggesting that truncating variants in the first five exons might be compensated by an alternative MSL3 transcript. Three-dimensional modeling of missense and splice variants indicated that these have a deleterious effect. The main clinical findings comprised developmental delay and intellectual disability ranging from mild to severe. Autism spectrum disorder, muscle tone abnormalities, and macrocephaly were common as well as hearing impairment and gastrointestinal problems. Hypoplasia of the cerebellar vermis emerged as a consistent magnetic resonance image (MRI) finding.
Intellectual disability syndromic and non-syndromic v0.3452 MSL3 Zornitza Stark reviewed gene: MSL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 33173220; Phenotypes: Basilicata-Akhtar syndrome, OMIM # 301032; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3449 TOE1 Zornitza Stark reviewed gene: TOE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28092684; Phenotypes: Pontocerebellar hypoplasia, type 7, MIM# 614969; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3446 CLP1 Zornitza Stark reviewed gene: CLP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24766809, 29307788; Phenotypes: Pontocerebellar hypoplasia type 10, MIM# 615803; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3443 CHMP1A Zornitza Stark reviewed gene: CHMP1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23023333; Phenotypes: Pontocerebellar hypoplasia, type 8, MIM# 614961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3440 BRF1 Zornitza Stark reviewed gene: BRF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25561519, 25561519, 27748960; Phenotypes: Cerebellofaciodental syndrome, MIM# 616202; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3439 CLCN6 Zornitza Stark edited their review of gene: CLCN6: Changed phenotypes: Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173, Developmental delay, neurodegeneration
Intellectual disability syndromic and non-syndromic v0.3439 OTUD5 Zornitza Stark Phenotypes for gene: OTUD5 were changed from X-linked severe neurodevelopmental delay, hydrocephalus, and early lethality to Multiple congenital anomalies-neurodevelopmental syndrome, X-linked, MIM# 301056
Intellectual disability syndromic and non-syndromic v0.3436 OTUD5 Zornitza Stark reviewed gene: OTUD5: Rating: GREEN; Mode of pathogenicity: None; Publications: 33523931; Phenotypes: Multiple congenital anomalies-neurodevelopmental syndrome, X-linked, MIM# 301056; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3433 SLC46A1 Zornitza Stark reviewed gene: SLC46A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17446347, 17129779, 21333572; Phenotypes: Folate malabsorption, hereditary, MIM# 229050; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3433 PRUNE1 Zornitza Stark Phenotypes for gene: PRUNE1 were changed from to Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481
Intellectual disability syndromic and non-syndromic v0.3430 PRUNE1 Zornitza Stark reviewed gene: PRUNE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26539891, 28334956, 33105479; Phenotypes: Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3428 TRIM8 Zornitza Stark edited their review of gene: TRIM8: Added comment: Further 10 families reported.; Changed publications: 30244534, 27346735, 23934111, 33508234; Changed phenotypes: Intellectual disability, Seizures, FSGS
Intellectual disability syndromic and non-syndromic v0.3427 PIGF Paul De Fazio gene: PIGF was added
gene: PIGF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIGF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGF were set to 33386993
Phenotypes for gene: PIGF were set to Glycosylphosphatidylinositol deficiency, onychodystrophy, osteodystrophy, intellectual disability, and seizures
Review for gene: PIGF was set to RED
gene: PIGF was marked as current diagnostic
Added comment: The same homozygous missense variant identified in 2 individuals from different families from the same region of India. Individuals had a phenotype similar to DOORS syndrome without deafness. Impaired glycosylphosphatidylinositol (GPI) biosynthesis was demonstrated.

Rated Red as the two families are likely to be related (founder mutation?).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3426 HIRA Paul De Fazio gene: HIRA was added
gene: HIRA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIRA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIRA were set to 33417013; 28135719; 25363760
Phenotypes for gene: HIRA were set to Neurodevelopmental disorder
Review for gene: HIRA was set to GREEN
gene: HIRA was marked as current diagnostic
Added comment: Two unrelated patients with different de novo loss of function variants identified in PMID 33417013:

Individual 1: intragenic deletion, phenotype included psychomotor retardation, ID, growth retardation, microcephaly, and facial features reminiscent of 22q deletion syndrome.
Individual 2: canonical splice variant, phenotype mostly confined to ASD

Another two de novo variants were identified in the literature by the authors of that paper, one stop-gain (DDD study, PMID 28135719) and one missense (large autism cohort, PMID 25363760).

PMID 33417013 also showed that HIRA knockdown in mice results in neurodevelopmental abnormalities.

Rated Green due to 4 unrelated individuals (albeit 2 in large cohort studies) and a mouse model. NB: HIRA is within the common 22q deletion region.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3420 METAP1 Paul De Fazio gene: METAP1 was added
gene: METAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: METAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: METAP1 were set to 32764695
Phenotypes for gene: METAP1 were set to Intellectual disability, aggression, neurodevelopmental delay
Review for gene: METAP1 was set to RED
gene: METAP1 was marked as current diagnostic
Added comment: Biallelic nonsense (NMD-predicted) variant identified in 4 sibs in a consanguineous family with dev delay. One sib had bilateral clinodactyly of her toes and her left 3rd finger, other sibs were not dysmorphic. Rated red due to single consanguineous family.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3420 SATB1 Elena Savva reviewed gene: SATB1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 33513338, 33057194; Phenotypes: Neurodevelopmental disorders; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.3420 KCNN2 Ain Roesley gene: KCNN2 was added
gene: KCNN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNN2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KCNN2 were set to 33242881
Phenotypes for gene: KCNN2 were set to neurodevelopmental movement disorders
Penetrance for gene: KCNN2 were set to unknown
Review for gene: KCNN2 was set to GREEN
Added comment: - 11 probands all de novo except for 1 mother-daughter pair.
- a mix of null and missense variants
- 2/11 with microcephaly, 10/11 motor delay, 7/11 language delay (excluding 2 with regression), all with varying degrees of ID, 3/11 seizures, 7/11 movement disorder, 4/11 cerebellar ataxia, 6/11 MRI anomalies

additional variants were noted in 2 patients: 1x cHet for variants in MED12L and 1x de novo TNK2 variant

patch clamp functional studies were also done
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3420 OTUD5 Chirag Patel gene: OTUD5 was added
gene: OTUD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: OTUD5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: OTUD5 were set to PMID: 33131077
Phenotypes for gene: OTUD5 were set to X-linked severe neurodevelopmental delay, hydrocephalus, and early lethality
Review for gene: OTUD5 was set to RED
Added comment: 13 male patients from a single family with three generations affected. Patients presented prenatally or during the neonatal period with IUGR, ventriculomegaly, hydrocephalus, hypotonia, congenital heart defects, hypospadias, and severe neurodevelopmental delay. The disease is typically fatal during infancy, mainly due to sepsis (pneumonias). Female carriers are asymptomatic. WGS in four individuals identified a unique candidate variant in the OTUD5 gene (NM_017602.3:c.598G > A, p.Glu200Lys). The variant cosegregated with the disease in 10 tested individuals. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3419 PDE2A Zornitza Stark Phenotypes for gene: PDE2A were changed from Paroxysmal dyskinesia to Paroxysmal dyskinesia; Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150
Intellectual disability syndromic and non-syndromic v0.3418 PDE2A Zornitza Stark edited their review of gene: PDE2A: Changed phenotypes: Paroxysmal dyskinesia, Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150
Intellectual disability syndromic and non-syndromic v0.3418 NBEA Zornitza Stark Phenotypes for gene: NBEA were changed from Intellectual disability; Seizures to Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157; Intellectual disability; Seizures
Intellectual disability syndromic and non-syndromic v0.3417 NBEA Zornitza Stark edited their review of gene: NBEA: Changed phenotypes: Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157, Intellectual disability, Seizures
Intellectual disability syndromic and non-syndromic v0.3414 SDHAF1 Zornitza Stark reviewed gene: SDHAF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19465911, 26749241, 22995659; Phenotypes: Mitochondrial complex II deficiency, nuclear type 2, MIM# 619166; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3410 UPB1 Zornitza Stark reviewed gene: UPB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 24526388, 25638458, 22525402, 15385443, 17964839; Phenotypes: Beta-ureidopropionase deficiency, MIM# 613161; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3406 UROC1 Zornitza Stark reviewed gene: UROC1: Rating: RED; Mode of pathogenicity: None; Publications: 19304569, 30619714; Phenotypes: Urocanase deficiency, MIM#276880; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3406 HNRNPU Zornitza Stark Phenotypes for gene: HNRNPU were changed from Epileptic encephalopathy, early infantile, 54, MIM#617391 to Developmental and epileptic encephalopathy 54 MIM# 617391
Intellectual disability syndromic and non-syndromic v0.3403 LAS1L Zornitza Stark changed review comment from: Three unrelated families.; to: Three unrelated families, however note the pathogenicity of the variant reported in PMID 26358559 is questionable.
Intellectual disability syndromic and non-syndromic v0.3403 LAS1L Zornitza Stark edited their review of gene: LAS1L: Changed rating: AMBER; Changed publications: 25644381, 26358559
Intellectual disability syndromic and non-syndromic v0.3402 AGO2 Zornitza Stark edited their review of gene: AGO2: Changed phenotypes: Lessel-Kreienkamp syndrome (LESKRES), MIM#619149, Intellectual disability
Intellectual disability syndromic and non-syndromic v0.3401 CBY1 Bryony Thompson gene: CBY1 was added
gene: CBY1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CBY1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CBY1 were set to 33131181; 25103236; 25220153
Phenotypes for gene: CBY1 were set to intellectual disability; cerebellar ataxia; molar tooth sign; polydactyly; Joubert syndrome
Review for gene: CBY1 was set to GREEN
Added comment: Three cases in two unrelated consanguineous families with homozygous loss of function variants, with ID as a feature of the phenotype. Multiple null model organisms recapitulate the human phenotype: Null mouse model had cystic kidneys, a phenotype common to ciliopathies. Reducing Cby levels in Xenopus laevis model reduced the density of multiciliated cells, the number of basal bodies per multiciliated cell, and the numbers of neural tube primary cilia; it also led to abnormal development of the neural crest, central nervous system, and pronephros. Depletion of cby1 in zebrafish results in ciliopathy‐related phenotypes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3400 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191; Cystic leukoencephalopathy
Intellectual disability syndromic and non-syndromic v0.3397 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467, 25925986; Phenotypes: Lissencephaly 5, MIM# 615191, Cystic leukoencephalopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3394 HIST1H1E Zornitza Stark reviewed gene: HIST1H1E: Rating: GREEN; Mode of pathogenicity: None; Publications: 28475857, 33270410, 31910894, 31400068; Phenotypes: Rahman syndrome, MIM# 617537; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3391 EED Zornitza Stark reviewed gene: EED: Rating: GREEN; Mode of pathogenicity: None; Publications: 25787343, 27193220, 27868325, 28229514; Phenotypes: Cohen-Gibson syndrome, MIM# 617561; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3389 PPP2R5D Zornitza Stark Mode of pathogenicity for gene: PPP2R5D was changed from to Other
Intellectual disability syndromic and non-syndromic v0.3387 PPP2R5D Zornitza Stark reviewed gene: PPP2R5D: Rating: GREEN; Mode of pathogenicity: Other; Publications: 32074998, 26168268; Phenotypes: Mental retardation, autosomal dominant 35, MIM#616355; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3387 SCAMP5 Zornitza Stark Mode of pathogenicity for gene: SCAMP5 was changed from None to Other
Intellectual disability syndromic and non-syndromic v0.3386 SCAMP5 Zornitza Stark edited their review of gene: SCAMP5: Changed mode of pathogenicity: Other
Intellectual disability syndromic and non-syndromic v0.3384 SCAMP5 Zornitza Stark edited their review of gene: SCAMP5: Added comment: PMID 33390987: Four unrelated individuals reported with same de novo missense variant, p. Gly180Trp. The onset age of seizures was ranged from 6 to 15 months. Patients had different types of seizures, including focal seizures, generalized tonic-clonic seizures and tonic seizure. One patient showed typical autism spectrum disorder (ASD) symptoms. Electroencephalogram (EEG) findings presented as focal or multifocal discharges, sometimes spreading to generalization. Brain magnetic resonance imaging (MRI) abnormalities were present in each patient. Severe intellectual disability and language and motor developmental disorders were found in our patients, with all patients having poor language development and were nonverbal at last follow-up. All but one of the patients could walk independently in childhood, but the ability to walk independently in one patient had deteriorated with age. All patients had abnormal neurological exam findings, mostly signs of extrapyramidal system involvement. Dysmorphic features were found in 2/4 patients, mainly in the face and trunk.; Changed rating: GREEN; Changed publications: 33390987; Changed phenotypes: Intellectual disability, seizures, autism; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3383 ZNF526 Zornitza Stark gene: ZNF526 was added
gene: ZNF526 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF526 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF526 were set to 21937992; 25558065; 33397746
Phenotypes for gene: ZNF526 were set to Intellectual disability; Microcephaly; Cataracts; Epilepsy; Hypertonia; Dystonia
Review for gene: ZNF526 was set to GREEN
Added comment: Currently not associated with any phenotype in OMIM (last updated on 09/12/2011), but has a 'possible' disease confidence rating for 'Autosomal Recessive Mental Retardation' in Gene2Phenotype.

- PMID: 21937992 (2011) - Two unrelated families (with 4 affected individuals in each) with non-syndromic ID (mild or moderate, respectively) identified harbouring different biallelic missense variants in the ZNF526 gene.

- PMID: 25558065 (2015) - One family with ID, Noonan-like facies, pulmonary stenosis and a homozygous missense variant in this gene. No further details provided.

- PMID: 33397746 (2021) - Five individuals from four unrelated families with homozygous ZNF526 variants. Four harboured truncating variants, and were all affected by profound DD and severe ID, microcephaly (ranging from -4 SD to -8 SD), bilateral progressive cataracts, hypertonic-dystonic movements, epilepsy and brain MRI anomalies. The fifth patient had a homozygous missense variant and a slightly less severe disorder, with postnatal microcephaly (-2 SD), progressive bilateral cataracts, severe ID, and normal brain MRI. Zebrafish model demonstrated brain and eye malformations resembling findings seen in the human holoprosencephaly spectrum
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3382 MORC2 Zornitza Stark Phenotypes for gene: MORC2 were changed from Charcot-Marie-Tooth disease, axonal, type 2Z, MIM #616688; Intellectual disability to Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090; Intellectual disability
Intellectual disability syndromic and non-syndromic v0.3381 MORC2 Zornitza Stark edited their review of gene: MORC2: Changed phenotypes: Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090, Intellectual disability
Intellectual disability syndromic and non-syndromic v0.3380 CELF2 Zornitza Stark gene: CELF2 was added
gene: CELF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF2 were set to 33131106
Phenotypes for gene: CELF2 were set to Developmental and epileptic encephalopathy
Review for gene: CELF2 was set to GREEN
Added comment: Five unrelated individuals reported. Four with de novo variants, and one inherited from a mosaic mother. Notably, all identified variants, except for c.272‐1G>C, were clustered within 20 amino acid residues of the C‐terminus, which might be a nuclear localization signal.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3378 FGF13 Zornitza Stark gene: FGF13 was added
gene: FGF13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FGF13 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: FGF13 were set to 33245860
Phenotypes for gene: FGF13 were set to Intellectual disability; epilepsy
Mode of pathogenicity for gene: FGF13 was set to Other
Review for gene: FGF13 was set to GREEN
Added comment: Two sibling pairs and three unrelated males reported who presented in infancy with intractable focal seizures and severe developmental delay. The variants were located in the N-terminal domain of the A isoform of FGF13/FHF2 (FHF2A). The X-linked FHF2 gene (also known as FGF13) has alternative first exons which produce multiple protein isoforms that differ in their N-terminal sequence. The variants were located at highly conserved residues in the FHF2A inactivation particle that competes with the intrinsic fast inactivation mechanism of Nav channels. Functional characterization of mutant FHF2A co-expressed with wild-type Nav1.6 (SCN8A) revealed that mutant FHF2A proteins lost the ability to induce rapid-onset, long-term blockade of the channel while retaining pro-excitatory properties. These gain-of-function effects are likely to increase neuronal excitability consistent with the epileptic potential of FHF2 variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3376 UBR7 Zornitza Stark gene: UBR7 was added
gene: UBR7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBR7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBR7 were set to 33340455
Phenotypes for gene: UBR7 were set to Intellectual disability; epilepsy; hypothyroidism; congenital anomalies; dysmorphic features
Review for gene: UBR7 was set to GREEN
Added comment: Seven individuals from 6 unrelated families. All had developmental delay, and all males had urogenital anomalies, namely cryptorchidism in 5/6 and small penis in 1/6. Six individuals had seizures and hypotonia. Hypothyroidism was present in 4/7 individuals, and ptosis was noted in 6/7 individuals. Five individuals exhibited cardiac abnormalities: two had ventricular septal defect, one had atrial septal defect, one had a patent ductus arteriosus requiring surgery, and the other had a patent ductus arteriosus and a patent foramen ovale that both closed spontaneously. Five individuals had short stature (height < 3rd percentile). Physical examination revealed various dysmorphic features, including prominent forehead (3/7), hypertelorism (4/7), telecanthus (1/7), epicanthus(1/7), downslanting palpebral fissures (3/7), thick eyebrow (1/7), low-set ears (3/7), long philtrum (2/7), unilateral single transverse palmar crease (1/7), and hypertrichosis (1/7).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3368 CAMK2B Zornitza Stark reviewed gene: CAMK2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 29100089, 29560374, 32875707; Phenotypes: Mental retardation, autosomal dominant 54, MIM# 617799; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3368 RALGAPB Elena Savva gene: RALGAPB was added
gene: RALGAPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RALGAPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RALGAPB were set to PMID: 32853829
Phenotypes for gene: RALGAPB were set to Neurodevelopmental disorders, autism
Review for gene: RALGAPB was set to RED
Added comment: PMID: 32853829 - Reviews previous publications and identifies 10 de novo variants (5 PTCs, 5 missense) in patients with ASD (7/10), epilepsy (2/10) and developmental delay (1/10).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3368 LSM11 Ee Ming Wong gene: LSM11 was added
gene: LSM11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LSM11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LSM11 were set to PMID: 33230297
Phenotypes for gene: LSM11 were set to type I interferonopathy Aicardi–Goutières syndrome
Review for gene: LSM11 was set to RED
gene: LSM11 was marked as current diagnostic
Added comment: - Two affected siblings from a consanguineous family carrying a homozygous variant in LSM11
- Compared to control fibroblasts, patient fibroblasts were enriched for misprocessed forms of
replication-dependent histone (RDH) mRNAs
- Knockdown of LSM11 in THP-1 cells results in an increase in misprocessed RDH mRNA and
interferon signaling

(added as Red as per discussion with Seb)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3367 DPH2 Paul De Fazio gene: DPH2 was added
gene: DPH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPH2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DPH2 were set to 32576952; 27421267
Phenotypes for gene: DPH2 were set to Diphthamide-deficiency syndrome
Review for gene: DPH2 was set to AMBER
gene: DPH2 was marked as current diagnostic
Added comment: One 19 month old reported (PMID:32576952) with biallelic (one missense, one nonsense) variants in DPH2, with phenotype similar to DPH1 deficiency (gross motor delay, not walking, fine motor and expressive language delays, macrocephaly)

Another family (sibs) was previously reported with biallelic nonsense variants (PMID:27421267) with a comparable phenotype, this family also has biallelic variants in KALRN and the authors thought those variants more likely causative. Patients had ID and microcephaly (in contrast to the 19 month old above).

In vitro functional assays support reduced diphthamide synthesis activity for the variants identified in PMID:32576952.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3367 EIF2AK2 Seb Lunke reviewed gene: EIF2AK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.3367 FBRSL1 Elena Savva gene: FBRSL1 was added
gene: FBRSL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBRSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FBRSL1 were set to PMID: 32424618
Phenotypes for gene: FBRSL1 were set to Malformation and intellectual disability syndrome
Review for gene: FBRSL1 was set to GREEN
Added comment: Three children with de novo PTCs that escape NMD, and an overlapping syndromic phenotype with respiratory insufficiency, postnatal growth restriction, microcephaly, global developmental delay and other malformations. 2/3 had heart defects, cleft palate and hearing impairement.
Supported by Xenopus oocyte functional studies
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3364 MLYCD Zornitza Stark reviewed gene: MLYCD: Rating: GREEN; Mode of pathogenicity: None; Publications: 12955715; Phenotypes: Malonyl-CoA decarboxylase deficiency, MIM# 248360; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3361 KCNQ3 Zornitza Stark reviewed gene: KCNQ3: Rating: GREEN; Mode of pathogenicity: None; Publications: 33337327, 25524373, 24851285; Phenotypes: Seizures, benign neonatal, 2, MIM# 121201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3361 PRKACB Zornitza Stark Phenotypes for gene: PRKACB were changed from Postaxial hand polydactyly; Postaxial foot polydactyly; Common atrium; Atrioventricular canal defect; Narrow chest; Abnormality of the teeth; Intellectual disability to Cardioacrofacial dysplasia 2, MIM# 619143; Postaxial hand polydactyly; Postaxial foot polydactyly; Common atrium; Atrioventricular canal defect; Narrow chest; Abnormality of the teeth; Intellectual disability
Intellectual disability syndromic and non-syndromic v0.3360 PRKACB Zornitza Stark reviewed gene: PRKACB: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Cardioacrofacial dysplasia 2, MIM# 619143; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3360 YIF1B Zornitza Stark Phenotypes for gene: YIF1B were changed from Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement to Kaya-Barakat-Masson syndrome, MIM# 619125; Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement
Intellectual disability syndromic and non-syndromic v0.3359 YIF1B Zornitza Stark reviewed gene: YIF1B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kaya-Barakat-Masson syndrome, MIM# 619125, Central hypotonia, Failure to thrive, Microcephaly, Global developmental delay, Intellectual disability, Seizures, Spasticity, Abnormality of movement; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3356 ATIC Zornitza Stark reviewed gene: ATIC: Rating: GREEN; Mode of pathogenicity: None; Publications: 15114530, 32557644; Phenotypes: AICA-ribosiduria due to ATIC deficiency, MIM# 608688; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3356 SOX2 Zornitza Stark Phenotypes for gene: SOX2 were changed from Microphthalmia, syndromic 3, MIM# 206900; Optic nerve hypoplasia and abnormalities of the central nervous system, MIM# 206900 to Microphthalmia, syndromic 3, MIM# 206900; Optic nerve hypoplasia and abnormalities of the central nervous system, MIM# 206900
Intellectual disability syndromic and non-syndromic v0.3356 SOX2 Zornitza Stark Phenotypes for gene: SOX2 were changed from to Microphthalmia, syndromic 3, MIM# 206900; Optic nerve hypoplasia and abnormalities of the central nervous system, MIM# 206900
Intellectual disability syndromic and non-syndromic v0.3353 SOX2 Zornitza Stark reviewed gene: SOX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30450772, 28121235, 25542770, 24498598, 24211324, 24033328, 21326281; Phenotypes: Microphthalmia, syndromic 3, MIM# 206900, Optic nerve hypoplasia and abnormalities of the central nervous system, MIM# 206900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3353 RERE Zornitza Stark Phenotypes for gene: RERE were changed from to Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart, MIM# 616975
Intellectual disability syndromic and non-syndromic v0.3350 RERE Zornitza Stark reviewed gene: RERE: Rating: GREEN; Mode of pathogenicity: None; Publications: 27087320, 23451234, 30896913, 30061196; Phenotypes: Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart, MIM# 616975; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3350 RARB Zornitza Stark Phenotypes for gene: RARB were changed from to Microphthalmia, syndromic 12, MIM# 615524
Intellectual disability syndromic and non-syndromic v0.3348 RARB Zornitza Stark Mode of inheritance for gene: RARB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3347 RARB Zornitza Stark reviewed gene: RARB: Rating: GREEN; Mode of pathogenicity: None; Publications: 30880327, 30281527, 24075189, 27120018, 25457163, 17506106; Phenotypes: Microphthalmia, syndromic 12, MIM# 615524; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3347 SMOC1 Zornitza Stark Phenotypes for gene: SMOC1 were changed from to Microphthalmia with limb anomalies, MIM# 206920
Intellectual disability syndromic and non-syndromic v0.3344 SMOC1 Zornitza Stark reviewed gene: SMOC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21194678, 21194680, 30445150; Phenotypes: Microphthalmia with limb anomalies, MIM# 206920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3344 MAB21L2 Zornitza Stark Phenotypes for gene: MAB21L2 were changed from to Microphthalmia/coloboma and skeletal dysplasia syndrome, MIM# 615877
Intellectual disability syndromic and non-syndromic v0.3341 MAB21L2 Zornitza Stark reviewed gene: MAB21L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24906020, 25719200, 31037784, 30375740, 30073347, 26116559; Phenotypes: Microphthalmia/coloboma and skeletal dysplasia syndrome, MIM# 615877; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3338 PDSS1 Paul De Fazio reviewed gene: PDSS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17332895, 22494076, 33285023; Phenotypes: Coenzyme Q10 deficiency, primary, 2 MIM#614651; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3337 C16orf62 Zornitza Stark edited their review of gene: C16orf62: Changed phenotypes: Ritscher-Schinzel syndrome-3 (RTSC3), MIM#619135
Intellectual disability syndromic and non-syndromic v0.3337 GAD1 Zornitza Stark Phenotypes for gene: GAD1 were changed from Cerebral palsy, spastic quadriplegic, 1, MIM#603513; Developmental and epileptic encephalopathy to Cerebral palsy, spastic quadriplegic, 1, MIM#603513; Developmental and epileptic encephalopathy 89, MIM# 619124
Intellectual disability syndromic and non-syndromic v0.3336 GAD1 Zornitza Stark edited their review of gene: GAD1: Changed phenotypes: Cerebral palsy, spastic quadriplegic, 1, MIM#603513, Developmental and epileptic encephalopathy 89, MIM# 619124
Intellectual disability syndromic and non-syndromic v0.3335 XYLT1 Zornitza Stark reviewed gene: XYLT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30554721, 24581741, 23982343; Phenotypes: Desbuquois dysplasia 2, MIM# 615777, Baratela-Scott syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3332 TUSC3 Zornitza Stark reviewed gene: TUSC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 18452889, 18455129, 21739581, 27148795, 31606977; Phenotypes: Mental retardation, autosomal recessive 7, MIM# 611093, MONDO:0012615, TUSC3-CDG (Disorders of protein N-glycosylation); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3329 TMEM165 Zornitza Stark reviewed gene: TMEM165: Rating: GREEN; Mode of pathogenicity: None; Publications: 22683087, 28323990, 27401145, 27008884, 26238249, 25609749; Phenotypes: Congenital disorder of glycosylation, type IIk, MIM# 614727, TMEM165-CDG, MONDO:0013870; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3328 EXT2 Zornitza Stark edited their review of gene: EXT2: Changed publications: 30288735, 30075207, 26246518
Intellectual disability syndromic and non-syndromic v0.3328 ST3GAL5 Zornitza Stark Phenotypes for gene: ST3GAL5 were changed from Salt and pepper developmental regression syndrome; OMIM #609056 to Salt and pepper developmental regression syndrome 609056; GM3 synthase deficiency, MONDO:0018274; Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation)
Intellectual disability syndromic and non-syndromic v0.3326 ST3GAL5 Zornitza Stark reviewed gene: ST3GAL5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23436467, 22990144, 15502825, 27232954, 30691927, 30688114, 30576498; Phenotypes: Salt and pepper developmental regression syndrome 609056, GM3 synthase deficiency, MONDO:0018274, Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3326 DPYD Ain Roesley reviewed gene: DPYD: Rating: AMBER; Mode of pathogenicity: None; Publications: 10071185, 25565930, 30349988, 28275972, 17065071, 21114665, 22003227, 28123791; Phenotypes: Dihydropyrimidine dehydrogenase deficiency (MIM#274270); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3323 RFT1 Zornitza Stark reviewed gene: RFT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18313027, 19701946, 19856127, 23111317, 30071302, 29923091, 27927990, 26892341; Phenotypes: Congenital disorder of glycosylation, type In, MIM# 612015, RFT1-CDG, MONDO:0012783; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3320 MGAT2 Zornitza Stark reviewed gene: MGAT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 8808595, 11228641, 22105986, 33044030, 31420886; Phenotypes: Congenital disorder of glycosylation, type IIa, MIM# 212066, MGAT2-CDG, MONDO:0008908; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3316 MPI Zornitza Stark reviewed gene: MPI: Rating: RED; Mode of pathogenicity: None; Publications: 12414827, 9585601, 10980531, 33098580, 33204592, 32905087, 32266963, 30242110; Phenotypes: Congenital disorder of glycosylation, type Ib, MIM# 602579, MPI-CDG MONDO:0011257; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3313 PGM3 Zornitza Stark reviewed gene: PGM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 30578875, 31231132, 33098103, 30157810, 28704707; Phenotypes: Immunodeficiency 23, MIM# 615816, PGM3-CDG, MONDO:0014353; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3313 PGAP3 Zornitza Stark Phenotypes for gene: PGAP3 were changed from to Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318
Intellectual disability syndromic and non-syndromic v0.3309 PGAP3 Zornitza Stark reviewed gene: PGAP3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24439110, 29620724, 30345601, 30217754; Phenotypes: Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3309 PGAP2 Zornitza Stark Phenotypes for gene: PGAP2 were changed from to Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628
Intellectual disability syndromic and non-syndromic v0.3306 PGAP2 Zornitza Stark reviewed gene: PGAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23561846, 23561847, 31805394, 29119105, 27871432; Phenotypes: Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3306 PIGV Zornitza Stark Phenotypes for gene: PIGV were changed from to Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398
Intellectual disability syndromic and non-syndromic v0.3303 PIGV Zornitza Stark reviewed gene: PIGV: Rating: GREEN; Mode of pathogenicity: None; Publications: 20802478, 22315194, 28817240, 24129430; Phenotypes: Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3302 PIGT Zornitza Stark edited their review of gene: PIGT: Changed phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165
Intellectual disability syndromic and non-syndromic v0.3302 PIGO Zornitza Stark Phenotypes for gene: PIGO were changed from to Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882
Intellectual disability syndromic and non-syndromic v0.3299 PIGO Zornitza Stark reviewed gene: PIGO: Rating: GREEN; Mode of pathogenicity: None; Publications: 22683086, 31698102, 28900819, 28545593, 28337824; Phenotypes: Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3296 PIGN Zornitza Stark reviewed gene: PIGN: Rating: GREEN; Mode of pathogenicity: None; Publications: 21493957, 24253414, 26364997, 26394714, 33193741, 32585529, 29330547; Phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 1, MIM# 614080, MONDO:0013563; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3293 PIGL Zornitza Stark reviewed gene: PIGL: Rating: GREEN; Mode of pathogenicity: None; Publications: 22444671, 31535386, 30023290, 29473937, 28371479, 25706356; Phenotypes: CHIME syndrome, MIM# 280000, MONDO:0010221; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3293 B3GALNT2 Zornitza Stark Phenotypes for gene: B3GALNT2 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181; MONDO:0014071
Intellectual disability syndromic and non-syndromic v0.3290 B3GALNT2 Zornitza Stark reviewed gene: B3GALNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23453667, 33290285, 29791932, 29273094, 28688748, 28303321; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181, MONDO:0014071; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3287 MPDU1 Zornitza Stark reviewed gene: MPDU1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11733564, 11733556, 31741824, 29721919; Phenotypes: Congenital disorder of glycosylation, type If, MIM# 609180, MPDU1-CDG, MONDO:0012211; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3284 DPAGT1 Zornitza Stark reviewed gene: DPAGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12872255, 22492991, 22304930, 31153949, 30653653, 30117111; Phenotypes: Congenital disorder of glycosylation, type Ij, MIM# 608093, DPAGT1-CDG MONDO:0011964; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3281 DOLK Zornitza Stark reviewed gene: DOLK: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273964, 22242004, 23890587, 30653653, 28816422, 24144945; Phenotypes: DK1-CDG, MONDO:0012556, Congenital disorder of glycosylation, type Im, MIM# 610768; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3281 DPYD Elena Savva Deleted their review
Intellectual disability syndromic and non-syndromic v0.3278 EZH2 Zornitza Stark reviewed gene: EZH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29244146, 23865096; Phenotypes: Weaver syndrome MIM#277590; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3278 DPYD Elena Savva reviewed gene: DPYD: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29152729; Phenotypes: 5-fluorouracil toxicity MIM#274270, Dihydropyrimidine dehydrogenase deficiency MIM#274270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3275 COG5 Zornitza Stark reviewed gene: COG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23228021, 31572517, 32174980; Phenotypes: Congenital disorder of glycosylation, type IIi, MIM# 613612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3275 SHMT2 Zornitza Stark Phenotypes for gene: SHMT2 were changed from Congenital microcephaly; Infantile axial hypotonia; Spastic paraparesis; Global developmental delay; Intellectual disability; Abnormality of the corpus callosum; Abnormal cortical gyration; Hypertrophic cardiomyopathy; Abnormality of the face; Proximal placement of thumb; 2-3 toe syndactyly to Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121; Congenital microcephaly; Infantile axial hypotonia; Spastic paraparesis; Global developmental delay; Intellectual disability; Abnormality of the corpus callosum; Abnormal cortical gyration; Hypertrophic cardiomyopathy; Abnormality of the face; Proximal placement of thumb; 2-3 toe syndactyly
Intellectual disability syndromic and non-syndromic v0.3274 SHMT2 Zornitza Stark reviewed gene: SHMT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121, Congenital microcephaly, Infantile axial hypotonia, Spastic paraparesis, Global developmental delay, Intellectual disability, Abnormality of the corpus callosum, Abnormal cortical gyration, Hypertrophic cardiomyopathy, Abnormality of the face, Proximal placement of thumb, 2-3 toe syndactylyCongenital microcephaly, Infantile axial hypotonia, Spastic paraparesis, Global developmental delay, Intellectual disability, Abnormality of the corpus callosum, Abnormal cortical gyration, Hypertrophic cardiomyopathy, Abnormality of the face, Proximal placement of thumb, 2-3 toe syndactyly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3273 PPIL1 Zornitza Stark gene: PPIL1 was added
gene: PPIL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPIL1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPIL1 were set to 33220177
Phenotypes for gene: PPIL1 were set to Pontocerebellar hypoplasia; microcephaly; seizures
Review for gene: PPIL1 was set to GREEN
Added comment: 17 individuals from 9 unrelated families reported with bi-allelic variants in the gene and PCH, microcephaly, hypotonia, seizures, severe DD/ID. Mouse models support gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3272 DIP2B Bryony Thompson Gene: dip2b has been removed from the panel.
Intellectual disability syndromic and non-syndromic v0.3270 FRA12A Bryony Thompson STR: FRA12A was added
STR: FRA12A was added to Intellectual disability syndromic and non-syndromic. Sources: Other
5'UTR tags were added to STR: FRA12A.
Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA12A were set to 17236128
Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630
Review for STR: FRA12A was set to AMBER
Added comment: NM_173602.2:c.-137CGG[X]
All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp.
70 controls used to determine the "normal" repeat range.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.3268 FRAXE Bryony Thompson STR: FRAXE was added
STR: FRAXE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FRAXE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXE were set to 8334699; 8673085; 11388762
Phenotypes for STR: FRAXE were set to Fragile X syndrome, FRAXE type (OMIM 309548)
Review for STR: FRAXE was set to GREEN
STR: FRAXE was marked as clinically relevant
STR: FRAXE was marked as current diagnostic
Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)
Loss of function through methylation silencing is the mechanism of disease
Normal - 5-44 repeats
Inconclusive - 45-54 repeats
Premutation - 55-200 repeats
Abnormal - >200 or >230 repeats
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3265 RAP1B Zornitza Stark edited their review of gene: RAP1B: Added comment: Another individual with de novo missense variant from a Kabuki-like cohort but note facial gestalt was not typical, had DD.; Changed rating: GREEN; Changed publications: 32627184, 26280580