Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Intellectual disability syndromic and non-syndromic v1.174 | ANKS1B | Zornitza Stark Classified gene: ANKS1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.174 | ANKS1B | Zornitza Stark Gene: anks1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.173 | ANKS1B | Lilian Downie Marked gene: ANKS1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.173 | ANKS1B | Lilian Downie Gene: anks1b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.173 | ANKS1B |
Lilian Downie gene: ANKS1B was added gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ANKS1B. Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKS1B were set to PMID: 31388001; 38129387 Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related Review for gene: ANKS1B was set to GREEN Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model. Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.172 | KCNA6 | Zornitza Stark Marked gene: KCNA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.172 | KCNA6 | Zornitza Stark Gene: kcna6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.172 | KCNA6 | Zornitza Stark Classified gene: KCNA6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.172 | KCNA6 | Zornitza Stark Gene: kcna6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.171 | KCNA6 |
Zornitza Stark gene: KCNA6 was added gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNA6 were set to 36318112; 40472070 Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related Review for gene: KCNA6 was set to GREEN Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.170 | PIP5K1C | Zornitza Stark Phenotypes for gene: PIP5K1C were changed from Neurodevelopmental disorder and microcephaly, MONDO:0700092, PIP5K1C-related to Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.169 | PIP5K1C | Zornitza Stark reviewed gene: PIP5K1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 37451268; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.169 | ZBTB7B | Zornitza Stark Marked gene: ZBTB7B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.169 | ZBTB7B | Zornitza Stark Gene: zbtb7b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.169 | ZBTB7B | Zornitza Stark Classified gene: ZBTB7B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.169 | ZBTB7B | Zornitza Stark Gene: zbtb7b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.168 | ZBTB7B |
Zornitza Stark gene: ZBTB7B was added gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZBTB7B were set to 40392549 Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related Review for gene: ZBTB7B was set to AMBER Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure. K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.167 | TOP2B | Zornitza Stark Phenotypes for gene: TOP2B were changed from Intellectual disability to Intellectual disability (MONDO:0001071), TOP2B-related; B-cell immunodeficiency, distal limb anomalies, and urogenital malformations MIM#609296 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.166 | TOP2B | Zornitza Stark Classified gene: TOP2B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.166 | TOP2B | Zornitza Stark Gene: top2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.165 | PTPN1 | Zornitza Stark Marked gene: PTPN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.165 | PTPN1 | Zornitza Stark Gene: ptpn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.165 | PTPN1 | Zornitza Stark Classified gene: PTPN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.165 | PTPN1 | Zornitza Stark Gene: ptpn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.164 | PTPN1 |
Zornitza Stark gene: PTPN1 was added gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN1 were set to 39986310 Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related Review for gene: PTPN1 was set to GREEN Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.163 | WSB2 | Krithika Murali Classified gene: WSB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.163 | WSB2 | Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.164 | WSB2 | Krithika Murali Classified gene: WSB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.164 | WSB2 | Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.163 | WSB2 | Krithika Murali Classified gene: WSB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.163 | WSB2 | Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.163 | WSB2 | Krithika Murali Classified gene: WSB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.163 | WSB2 | Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.162 | WSB2 | Krithika Murali Marked gene: WSB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.162 | WSB2 | Krithika Murali Gene: wsb2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.162 | WSB2 |
Krithika Murali gene: WSB2 was added gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WSB2 were set to PMID:40374945 Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related Review for gene: WSB2 was set to GREEN Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include: - Dev delay (all) - Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia) - Dysmorphic feature - IUGR/oligohydramnios (3/5) - Hypotonia (all) - Microcephaly (3/5) - Seizures (3/5) Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense. Supportive mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.161 | NKAP | Zornitza Stark Mode of inheritance for gene: NKAP was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.160 | PRR12 | Zornitza Stark Publications for gene: PRR12 were set to 29556724 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.159 | RREB1 | Zornitza Stark Publications for gene: RREB1 were set to 32938917; 38332451 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.158 | TAF1C | Zornitza Stark Publications for gene: TAF1C were set to 32779182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.157 | TAF1C | Zornitza Stark Classified gene: TAF1C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.157 | TAF1C | Zornitza Stark Gene: taf1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.156 | TAF1C | Zornitza Stark edited their review of gene: TAF1C: Changed phenotypes: Neurodevelopmental disorder (MONDO#0700092), TAF1C-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.156 | TAF1C | Zornitza Stark reviewed gene: TAF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 40371665; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.156 | TM2D3 | Zornitza Stark Marked gene: TM2D3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.156 | TM2D3 | Zornitza Stark Gene: tm2d3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.156 | TM2D3 | Zornitza Stark Classified gene: TM2D3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.156 | TM2D3 | Zornitza Stark Gene: tm2d3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.155 | TM2D3 |
Zornitza Stark gene: TM2D3 was added gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TM2D3 were set to 40449487 Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related Review for gene: TM2D3 was set to GREEN Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.154 | SLK | Zornitza Stark Marked gene: SLK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.154 | SLK | Zornitza Stark Gene: slk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.154 | SLK | Zornitza Stark Classified gene: SLK as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.154 | SLK | Zornitza Stark Gene: slk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.153 | SLK |
Zornitza Stark gene: SLK was added gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLK were set to 40347834 Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related Review for gene: SLK was set to GREEN Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.152 | RREB1 | Chirag Patel Classified gene: RREB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.152 | RREB1 | Chirag Patel Gene: rreb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.152 | RREB1 | Chirag Patel Classified gene: RREB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.152 | RREB1 | Chirag Patel Gene: rreb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.151 | RREB1 | Chirag Patel reviewed gene: RREB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40418122; Phenotypes: Rasopathy, MONDO:0021060, RREB1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.151 | GON4L | Zornitza Stark Phenotypes for gene: GON4L were changed from complex neurodevelopmental disorder MONDO:0100038 to Li-Takada-Miyake syndrome, MIM# 621212 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.150 | GON4L | Zornitza Stark reviewed gene: GON4L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Li-Takada-Miyake syndrome, MIM# 621212; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.150 | PRR12 | Boris Keren reviewed gene: PRR12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33824499; Phenotypes: intellectual disability, ocular anomalies, heart defects, growth failure, kidney anomalies; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.150 | NKAP | Elena Savva Phenotypes for gene: NKAP were changed from Intellectual disability to intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.149 | MYCBP2 | Zornitza Stark Classified gene: MYCBP2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.149 | MYCBP2 | Zornitza Stark Gene: mycbp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.148 | MYCBP2 | Zornitza Stark edited their review of gene: MYCBP2: Added comment: Concerns about LoF variants in population datasets as well as in individuals undergoing diagnostic testing for a wide variety of unrelated phenotypes: downgrade to RED.; Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.148 | TOP2B | Chris Ciotta reviewed gene: TOP2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33459963, 31953910, 28343847; Phenotypes: Intellectual disability (MONDO:0001071), TOP2B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.148 | PIP5K1C | Sarah Pantaleo reviewed gene: PIP5K1C: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.148 | BBIP1 | Zornitza Stark Publications for gene: BBIP1 were set to 24026985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.147 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.147 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.146 | BBIP1 | Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported.; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.146 | FAM177A1 | Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177a1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.145 | FAM177A1 | Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.145 | GTF3C3 | Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.144 | GTF3C3 | Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.144 | PTPMT1 | Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.143 | PTPMT1 | Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.143 | PPP2R5C | Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.142 | PPP2R5C | Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.142 | MRPL49 | Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.141 | MRPL49 | Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.141 | SMAD6 |
Boris Keren changed review comment from: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606). Sources: Literature; to: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606) and 11/15 had neurodevelopmental delay in Timberlake et al. (PMID: 27606499) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.141 | SMAD6 |
Boris Keren gene: SMAD6 was added gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMAD6 were set to PMID: 32499606 Penetrance for gene: SMAD6 were set to Incomplete Review for gene: SMAD6 was set to GREEN Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.141 | LSM1 | Zornitza Stark Phenotypes for gene: LSM1 were changed from Neurodevelopmental disorder, MONDO:0700092, LSM1-related to FICUS syndrome, MIM# 621193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.140 | LSM1 | Zornitza Stark reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: FICUS syndrome, MIM# 621193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.140 | ZNF674 | Zornitza Stark Phenotypes for gene: ZNF674 were changed from to X-linked intellectual disability MONDO:0100284 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.139 | PLK1 | Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.138 | PLK1 | Zornitza Stark edited their review of gene: PLK1: Changed phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.138 | PLXNA2 | Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.137 | RFX3 | Zornitza Stark Phenotypes for gene: RFX3 were changed from ID, ASD, ADHD to RFX3-related neurodevelopmental disorder MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.136 | RFX4 | Zornitza Stark Phenotypes for gene: RFX4 were changed from ID, ASD, ADHD to RFX4-related neurodevelopmental disorder, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.135 | AMOTL1 | Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.134 | AMOTL1 | Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.134 | NAV3 | Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.133 | NAV3 | Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Marked gene: FBXO22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Classified gene: FBXO22 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.132 | FBXO22 |
Sarah Milton gene: FBXO22 was added gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO22 were set to PMID: 40215970 Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related Review for gene: FBXO22 was set to GREEN Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases. 14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4). Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies. Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.132 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.132 | GAP43 | Zornitza Stark Marked gene: GAP43 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.132 | GAP43 | Zornitza Stark Gene: gap43 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.132 | GAP43 |
Zornitza Stark gene: GAP43 was added gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GAP43 were set to 39738362 Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related Review for gene: GAP43 was set to RED Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities. The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.131 | LSM1 | Zornitza Stark Phenotypes for gene: LSM1 were changed from no OMIM number yet to Neurodevelopmental disorder, MONDO:0700092, LSM1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.130 | LSM1 | Zornitza Stark Publications for gene: LSM1 were set to PMID: 31010896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.129 | LSM1 | Zornitza Stark Classified gene: LSM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.129 | LSM1 | Zornitza Stark Gene: lsm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.128 | RNU2-2P | Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.127 | RNU2-2P | Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P | Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Previously referred to as RNU2-2P Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P | Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Marked gene: BRF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Classified gene: BRF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.125 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Marked gene: EIF3K as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Classified gene: EIF3K as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Marked gene: PCNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Marked gene: RAB3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Classified gene: RAB3A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.121 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | LSM1 |
Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | LSM1 | Sarah Milton edited their review of gene: LSM1: Changed publications: (PMID: 31010896, PMID: 36100156, PMID: 40204357) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | LSM1 | Sarah Milton reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: (PMID: 31010896, 36100156, 40204357); Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | PCNA |
Sangavi Sivagnanasundram gene: PCNA was added gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCNA were set to 24911150, 33426167, 36990216 Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309 Review for gene: PCNA was set to AMBER Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778 Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown. Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | EIF3K | Sangavi Sivagnanasundram edited their review of gene: EIF3K: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | EIF3K |
Sangavi Sivagnanasundram gene: EIF3K was added gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3K were set to 40219605 Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092 Review for gene: EIF3K was set to RED Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.118 | DLG3 | Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.117 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.115 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.113 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Marked STR: FMR1_FXS_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Classified STR: FMR1_FXS_CGG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.111 | FMR1_FXS_CGG |
Bryony Thompson STR: FMR1_FXS_CGG was added STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184 Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624 Review for STR: FMR1_FXS_CGG was set to GREEN STR: FMR1_FXS_CGG was marked as clinically relevant STR: FMR1_FXS_CGG was marked as current diagnostic Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.108 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.106 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.104 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.103 | AFF2_FRAXE_GCC | Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.102 | EEF1D | Bryony Thompson Classified gene: EEF1D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.102 | EEF1D | Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.101 | EEF1D | Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.100 | EEF1D | Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.100 | SPOUT1 | Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.99 | SPOUT1 | Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.99 | DISP1 | Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly (MONDO:0016296), DISP1-related to Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.98 | DISP1 | Zornitza Stark edited their review of gene: DISP1: Changed phenotypes: Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Marked gene: CDKL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Classified gene: CDKL2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.97 | CDKL2 | Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Marked gene: CDKL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Classified gene: CDKL1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 | Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 |
Sarah Milton gene: CDKL1 was added gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL1 were set to PMID: 40088891 Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related Mode of pathogenicity for gene: CDKL1 was set to Other Review for gene: CDKL1 was set to AMBER Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4). Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.96 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Penetrance for gene: CDKL2 were set to Complete Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.96 | MED16 | Zornitza Stark Phenotypes for gene: MED16 were changed from complex neurodevelopmental disorder MONDO:0100038 to Neurodevelopmental disorder, MONDO:0700092, MED16-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.95 | MED16 | Zornitza Stark Publications for gene: MED16 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.94 | MED16 | Zornitza Stark reviewed gene: MED16: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081376; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, MED16-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.94 | CELF4 | Zornitza Stark Marked gene: CELF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.94 | CELF4 | Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.94 | CELF4 | Zornitza Stark Classified gene: CELF4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.94 | CELF4 | Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.93 | CELF4 |
Zornitza Stark gene: CELF4 was added gene: CELF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CELF4 were set to 40108438 Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related Review for gene: CELF4 was set to GREEN Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.92 | SVBP | Zornitza Stark Phenotypes for gene: SVBP were changed from Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569 to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569; Spastic paraplegia 94, autosomal recessive, MIM# 621150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.91 | SVBP | Zornitza Stark Publications for gene: SVBP were set to PMID: 31363758; 30607023 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.90 | SVBP | Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.90 | CRMP1 | Zornitza Stark Marked gene: CRMP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.90 | CRMP1 | Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.90 | CRMP1 | Zornitza Stark Classified gene: CRMP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.90 | CRMP1 | Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.89 | CRMP1 |
Zornitza Stark gene: CRMP1 was added gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CRMP1 were set to 36511780; 39758889 Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related Review for gene: CRMP1 was set to GREEN Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants. PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID. Four individuals with neurodevelopmental disorders and de novo variants in this gene. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.88 | MACROD2 | Zornitza Stark Phenotypes for gene: MACROD2 were changed from Syndromic disease, MONDO:0002254, MACROD2-related to Syndromic disease, MONDO:0002254, MACROD2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.88 | MACROD2 | Zornitza Stark Phenotypes for gene: MACROD2 were changed from no OMIM number yet to Syndromic disease, MONDO:0002254, MACROD2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.87 | SLC35F1 | Zornitza Stark Phenotypes for gene: SLC35F1 were changed from Neruodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome to Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.86 | SLC35F1 | Zornitza Stark edited their review of gene: SLC35F1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated, Rett-like syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.86 | EXOSC2 | Zornitza Stark Publications for gene: EXOSC2 were set to 26843489; 31628467 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.85 | EXOSC2 | Zornitza Stark edited their review of gene: EXOSC2: Added comment: LIMITED by ClinGen. Two additional patients reported but again, predominantly missense variants.; Changed rating: AMBER; Changed publications: 26843489, 31628467, 36344539, 36069504 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.85 | KMT2C | Zornitza Stark Phenotypes for gene: KMT2C were changed from Kleefstra syndrome 2, MIM#617768 to Kleefstra syndrome 2, MIM#617768; Neurodevelopmental disorder, MONDO:0700092, KMT2C-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.84 | KMT2C | Zornitza Stark Publications for gene: KMT2C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | KMT2C | Zornitza Stark edited their review of gene: KMT2C: Added comment: Additional report of >80 individuals suggesting condition is distinct from Kleefstra syndrome and needs to be renamed.; Changed publications: 39013459; Changed phenotypes: Kleefstra syndrome 2, MIM#617768, Neurodevelopmental disorder, MONDO:0700092, KMT2C-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | LINC01578 | Zornitza Stark Tag non-coding gene tag was added to gene: LINC01578. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | MIR17HG | Zornitza Stark Tag non-coding gene tag was added to gene: MIR17HG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | RMRP | Zornitza Stark Tag non-coding gene tag was added to gene: RMRP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | RNU2-2P | Zornitza Stark Tag non-coding gene tag was added to gene: RNU2-2P. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | SNORD118 | Zornitza Stark Tag non-coding gene tag was added to gene: SNORD118. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | RNU7-1 | Zornitza Stark Tag non-coding gene tag was added to gene: RNU7-1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | RNU4ATAC | Zornitza Stark Tag non-coding gene tag was added to gene: RNU4ATAC. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | RNU4-2 | Zornitza Stark Tag non-coding gene tag was added to gene: RNU4-2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | DROSHA | Zornitza Stark Tag non-coding gene tag was added to gene: DROSHA. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | MEG3 | Zornitza Stark Marked gene: MEG3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | MEG3 | Zornitza Stark Gene: meg3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | MEG3 | Zornitza Stark Classified gene: MEG3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.83 | MEG3 | Zornitza Stark Gene: meg3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.82 | MEG3 |
Zornitza Stark gene: MEG3 was added gene: MEG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MEG3 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Publications for gene: MEG3 were set to 33010492; 33746039; 33067531; 38212313 Phenotypes for gene: MEG3 were set to Kagami-Ogata syndrome, MIM# 608149 Review for gene: MEG3 was set to GREEN Added comment: Small deletions of MAG3 reported in multiple patients as one of the mechanisms of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.81 | H19 | Zornitza Stark Tag non-coding gene tag was added to gene: H19. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.81 | PPFIA3 | Zornitza Stark Phenotypes for gene: PPFIA3 were changed from Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related to Paul-Chao neurodevelopmental syndrome, MIM# 621122 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.80 | PPFIA3 | Zornitza Stark edited their review of gene: PPFIA3: Changed phenotypes: Paul-Chao neurodevelopmental syndrome, MIM# 621122 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.80 | PIGW | Zornitza Stark Classified gene: PIGW as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.80 | PIGW | Zornitza Stark Gene: pigw has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.79 | PIGW | Zornitza Stark edited their review of gene: PIGW: Added comment: Downgraded to AMBER, assessed as LIMITED by ClinGen.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.79 | PPP2R5E |
Chirag Patel gene: PPP2R5E was added gene: PPP2R5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP2R5E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R5E were set to PMID: 39284558 Phenotypes for gene: PPP2R5E were set to Mendelian neurodevelopmental disorder MONDO:0100500 Review for gene: PPP2R5E was set to RED Added comment: One 20yrs old individual with learning issues, motor coordination disorders, hypotonia (myopathy on EMG), and behavioural issues (mood and emotional dysregulation). WES testing identified a de novo heterozygous missense variant (Glu191Lys) in PPP2R5E gene. The variant was not found in the 4 healthy brothers of the individual. The variant is located within a conserved LFDSEDPRER motif common to all PPP2R5 B-subunits. Biochemical assays demonstrated a decreased interaction with the PP2A A and C subunits, leading to disturbances in holoenzyme formation. Protein phosphatase 2A (PP2A) is a family of multifunctional enzymatic complexes crucial for cellular signalling, playing a pivotal role in brain function and development. Mutations in specific genes encoding PP2A complexes have been associated with neurodevelopmental disorders with hypotonia and high risk of seizures (e.g. PP2AR-1A, 2B, 3C, 5C, 5D). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.78 | DDX39B | Zornitza Stark Marked gene: DDX39B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.78 | DDX39B | Zornitza Stark Gene: ddx39b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.78 | DDX39B | Zornitza Stark Classified gene: DDX39B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.78 | DDX39B | Zornitza Stark Gene: ddx39b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.77 | CDO1 | Zornitza Stark Marked gene: CDO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.77 | CDO1 | Zornitza Stark Gene: cdo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.77 | CDO1 | Zornitza Stark Classified gene: CDO1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.77 | CDO1 | Zornitza Stark Gene: cdo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.76 | CDO1 |
Zornitza Stark gene: CDO1 was added gene: CDO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDO1 were set to 39949058 Phenotypes for gene: CDO1 were set to Syndromic disease, MONDO:0002254, CDO1-related Review for gene: CDO1 was set to AMBER Added comment: Three children with overlapping features including severe microcephaly and DD/ID. Three missense de novo variants were identified and were clustered around exon 3 and exon 4. The three missense variants identified p.(His147Arg, Ala131Val, Glu143Lys) are all absent from gnomAD v4.1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.75 | PHACTR4 | Zornitza Stark Marked gene: PHACTR4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.75 | PHACTR4 | Zornitza Stark Gene: phactr4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.75 | PHACTR4 | Zornitza Stark Classified gene: PHACTR4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.75 | PHACTR4 | Zornitza Stark Gene: phactr4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.74 | PHACTR4 |
Zornitza Stark gene: PHACTR4 was added gene: PHACTR4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PHACTR4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHACTR4 were set to 40012205 Phenotypes for gene: PHACTR4 were set to Syndromic disease, MONDO:0002254, PHACTR4-related Review for gene: PHACTR4 was set to AMBER Added comment: Two individuals with syndromic disease and de novo missense variants reported together with aggregate information on additional individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.73 | C14orf80 | Zornitza Stark Marked gene: C14orf80 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.73 | C14orf80 | Zornitza Stark Gene: c14orf80 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.73 | C14orf80 | Zornitza Stark Classified gene: C14orf80 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.73 | C14orf80 | Zornitza Stark Gene: c14orf80 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.72 | C14orf80 |
Zornitza Stark gene: C14orf80 was added gene: C14orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: C14orf80. Mode of inheritance for gene: C14orf80 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C14orf80 were set to 39979680; 38252227 Phenotypes for gene: C14orf80 were set to Primary microcephaly, MONDO:0016660 Review for gene: C14orf80 was set to AMBER Added comment: New HGNC approved Gene Name: TEDC1 Only two families reported with biallelic variants in this gene - Reports of a supportive functional assay however rated as Amber given that one of the reported families are consanguineous with hmz missense. PMID: 39979680 - Male sibs from non-consanguineous parents presenting with a range of phenotypes including growth development abnormalities, microcephaly, DD, ID and endocrine insufficiency. The brothers were found to carry chet variants identified in trans [NM_001134877.1 c.[104-5C>G];[787delG] p.[?];[(Ala263LeufsTer29)]. Homozygous zebrafish model recapitulated the human phenotype and is supportive of the loss of function mechanism of disease. PMID: 38252227 - Iranian consanguineous families identified with a rare biallelic missense variant (Gln269Arg). The affected brothers presented with a range of developmental phenotypes including cognitive impairment and microcephaly. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.71 | SPOUT1 | Bryony Thompson Marked gene: SPOUT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.71 | SPOUT1 | Bryony Thompson Gene: spout1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.71 | SPOUT1 | Bryony Thompson Classified gene: SPOUT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.71 | SPOUT1 | Bryony Thompson Gene: spout1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.70 | SPOUT1 |
Bryony Thompson gene: SPOUT1 was added gene: SPOUT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPOUT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPOUT1 were set to 39962046 Phenotypes for gene: SPOUT1 were set to complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related Review for gene: SPOUT1 was set to GREEN Added comment: Biallelic SPOUT1 variants were identified in 28 individuals with a complex neurodevelopmental disorder from 21 unrelated families. Common phenotypes include microcephaly (18/21), seizures (20/28), intellectual disability (14/14), and varying degrees of developmental delays (28/28). Also, supporting zebrafish model. The suggested name of the disorder is SpADMiSS (SPOUT1 Associated Development delay Microcephaly Seizures Short stature). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.69 | SIN3B | Zornitza Stark Phenotypes for gene: SIN3B were changed from Syndromic intellectual disability/autism spectrum disorder to Neurodevelopmental disorder, MONDO:0700092, SIN3B-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.68 | SIN3B | Zornitza Stark reviewed gene: SIN3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SIN3B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.68 | DDX39B |
Sangavi Sivagnanasundram gene: DDX39B was added gene: DDX39B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DDX39B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DDX39B were set to 39918047 Phenotypes for gene: DDX39B were set to neurodevelopmental disorder MONDO:0700092, DDX39B-related Review for gene: DDX39B was set to GREEN Added comment: Established gene-disease association - ID/DD is a prominent feature in affected individuals. 6 individuals from 5 families with variable neurological and developmental phenotypes including hypotonia, DD, ID and epilepsy. 4 de novo missense variants and 1 inherited splice variant were identified. All variants are absent from gnomAD v4.1. In vivo functional assay using Drosophila transgenic flies was supportive of a loss of function phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.68 | SMARCA1 | Zornitza Stark Marked gene: SMARCA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.68 | SMARCA1 | Zornitza Stark Gene: smarca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.68 | SMARCA1 | Zornitza Stark Classified gene: SMARCA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.68 | SMARCA1 | Zornitza Stark Gene: smarca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.67 | SMARCA1 |
Zornitza Stark gene: SMARCA1 was added gene: SMARCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMARCA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SMARCA1 were set to 37841849 Phenotypes for gene: SMARCA1 were set to Neurodevelopmental disorder, MONDO:0700092, SMARCA1-related Review for gene: SMARCA1 was set to GREEN Added comment: 40 individuals from 30 families with NDD and variants in this gene reported in this preprint, publication imminent Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.66 | C12orf66 | Zornitza Stark Phenotypes for gene: C12orf66 were changed from complex neurodevelopmental disorder MONDO:0100038 to Intellectual developmental disorder, autosomal recessive 83, MIM# 621100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.65 | C12orf66 | Zornitza Stark Publications for gene: C12orf66 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.64 | C12orf66 | Zornitza Stark edited their review of gene: C12orf66: Changed rating: GREEN; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 83, MIM# 621100; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.64 | EEFSEC | Zornitza Stark Phenotypes for gene: EEFSEC were changed from Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related to Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.63 | EEFSEC | Zornitza Stark edited their review of gene: EEFSEC: Changed phenotypes: Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.63 | HECTD1 | Zornitza Stark Marked gene: HECTD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.63 | HECTD1 | Zornitza Stark Gene: hectd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.63 | ARHGEF40 | Zornitza Stark Marked gene: ARHGEF40 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.63 | ARHGEF40 | Zornitza Stark Gene: arhgef40 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.63 | ARHGEF40 | Zornitza Stark Classified gene: ARHGEF40 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.63 | ARHGEF40 | Zornitza Stark Gene: arhgef40 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | ARHGEF40 | Zornitza Stark reviewed gene: ARHGEF40: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | C12orf66 | Zornitza Stark Marked gene: C12orf66 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | C12orf66 | Zornitza Stark Added comment: Comment when marking as ready: New HGNC approved gene name is KICS2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | C12orf66 | Zornitza Stark Gene: c12orf66 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | C12orf66 | Zornitza Stark Tag new gene name tag was added to gene: C12orf66. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | C12orf66 | Chirag Patel reviewed gene: C12orf66: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39824192; Phenotypes: Neurodevelopmental disorder MONDO:0700092; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | ARHGEF40 |
Chirag Patel gene: ARHGEF40 was added gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARHGEF40 were set to PMID: 39838643 Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: ARHGEF40 was set to RED Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of the importance of this residue. The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.61 | HECTD1 | Chirag Patel Classified gene: HECTD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.61 | HECTD1 | Chirag Patel Gene: hectd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.60 | HECTD1 | Chirag Patel Classified gene: HECTD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.60 | HECTD1 | Chirag Patel Gene: hectd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.60 | HECTD1 | Chirag Patel Classified gene: HECTD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.60 | HECTD1 | Chirag Patel Gene: hectd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.59 | HECTD1 |
Chirag Patel gene: HECTD1 was added gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HECTD1 were set to PMID: 39879987 Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: HECTD1 was set to GREEN Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy. The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype. Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease. HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.58 | PTPMT1 | Bryony Thompson Marked gene: PTPMT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.58 | PTPMT1 | Bryony Thompson Gene: ptpmt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.58 | PTPMT1 | Bryony Thompson Classified gene: PTPMT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.58 | PTPMT1 | Bryony Thompson Gene: ptpmt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.57 | PTPMT1 |
Bryony Thompson gene: PTPMT1 was added gene: PTPMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPMT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTPMT1 were set to 39279645; 37672386 Phenotypes for gene: PTPMT1 were set to inborn mitochondrial metabolism disorder MONDO:0004069 Review for gene: PTPMT1 was set to GREEN Added comment: 6 cases from 3 independent families with biallelic variants in PTPMT1 (a mitochondrial tyrosine phosphatase required for de novo cardiolipin biosynthesis). All cases presented with a complex, neonatal/infantile onset neurological and neurodevelopmental syndrome including developmental delay, microcephaly, facial dysmorphism, epilepsy, spasticity, cerebellar ataxia and nystagmus, sensorineural hearing loss, optic atrophy and bulbar dysfunction. Supporting knockout zebrafish and mouse models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Marked gene: ITGAV as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Classified gene: ITGAV as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Marked gene: ITGAV as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Classified gene: ITGAV as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.56 | ITGAV | Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.55 | ITGAV |
Zornitza Stark gene: ITGAV was added gene: ITGAV was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ITGAV was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ITGAV were set to 39526957 Phenotypes for gene: ITGAV were set to Syndromic disease, MONDO:0002254, ITGAV-related Review for gene: ITGAV was set to AMBER Added comment: Three unrelated families reported: two with affected children (one hmz missense; other compound het LoF with missense) and one family with four affected fetuses. Clinical features included brain and eye anomalies and IBD/immune dysregulation. TGF-beta signalling pathway affected. The deletion of itgav in zebrafish recapitulated patient phenotypes including retinal and brain defects and the loss of microglia in early development as well as colitis in juvenile zebrafish with reduced SMAD3 expression and transcriptional regulation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.54 | RYBP | Zornitza Stark Classified gene: RYBP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.54 | RYBP | Zornitza Stark Gene: rybp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.53 | RYBP | Zornitza Stark Marked gene: RYBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.53 | RYBP | Zornitza Stark Gene: rybp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.53 | RYBP | Zornitza Stark Classified gene: RYBP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.53 | RYBP | Zornitza Stark Gene: rybp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.52 | RYBP |
Zornitza Stark gene: RYBP was added gene: RYBP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RYBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RYBP were set to 39891528 Phenotypes for gene: RYBP were set to Neurodevelopmental disorder, MONDO:0700092, RYBP-related Review for gene: RYBP was set to GREEN Added comment: Seven individuals with heterozygous de novo variants in RYBP reported. Clinical findings include severe developmental delay, dysmorphisms and multiple congenital anomalies. All the single nucleotide variants in RYBP localized to the N-terminal domain of the gene, which encodes the zinc finger domain and ubiquitin binding moiety. Further supportive in vitro and Drosophila functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.51 | SEL1L | Zornitza Stark Phenotypes for gene: SEL1L were changed from Neurodevelopmental disorder, MONDO:0700092, SEL1L-related to Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068; Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.50 | SEL1L | Zornitza Stark reviewed gene: SEL1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068, Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.50 | MGA | Zornitza Stark Classified gene: MGA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.50 | MGA | Zornitza Stark Gene: mga has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.49 | MGA | Zornitza Stark edited their review of gene: MGA: Added comment: Note LoF variants now also associated with POF, supportive mouse model. Downgrade to Amber until further delineation of phenotypes and mechanisms.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.49 | TRPM7 | Zornitza Stark Marked gene: TRPM7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.49 | TRPM7 | Zornitza Stark Gene: trpm7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.49 | TRPM7 | Zornitza Stark Phenotypes for gene: TRPM7 were changed from Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related to Familial primary hypomagnesaemia, MONDO:0018100, TRPM7-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.48 | TRPM7 | Zornitza Stark Classified gene: TRPM7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.48 | TRPM7 | Zornitza Stark Gene: trpm7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.47 | TRPM7 |
Zornitza Stark gene: TRPM7 was added gene: TRPM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRPM7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRPM7 were set to 35561741; 35712613; 39099563 Phenotypes for gene: TRPM7 were set to Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related Review for gene: TRPM7 was set to GREEN Added comment: Protein expressed in the distal tubule, related to TRPM6. Postulated link with hypoMg with secondary hypoCa. PMID 35561741: two families reported with dominant inheritance. F1: three affected individuals with splicing variant; some supportive functional data. F2: single affected individual, de novo missense variant. PMID 35712613: de novo missense variant in an individual with hypoMg. PMID 39099563: three affected individuals with missense variants, all de novo. Probands had DD, two had seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.46 | TAOK2 | Zornitza Stark Marked gene: TAOK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.46 | TAOK2 | Zornitza Stark Gene: taok2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.46 | TAOK2 | Zornitza Stark Classified gene: TAOK2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.46 | TAOK2 | Zornitza Stark Gene: taok2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.45 | TAOK2 |
Zornitza Stark gene: TAOK2 was added gene: TAOK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TAOK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAOK2 were set to 39737487 Phenotypes for gene: TAOK2 were set to neurodevelopmental disorder, MONDO:0700092, TAOK2-related Review for gene: TAOK2 was set to GREEN Added comment: PMID:39737487 reported 10 individuals with monoallelic TAOK2 variants and with a neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.44 | GTF3C3 | Chirag Patel reviewed gene: GTF3C3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39636576; Phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF3C3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.44 | INPP4A | Chirag Patel Classified gene: INPP4A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.44 | INPP4A | Chirag Patel Gene: inpp4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.43 | INPP4A | Chirag Patel reviewed gene: INPP4A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39315527; Phenotypes: INPP4A-related neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.43 | LRRC45 | Zornitza Stark Marked gene: LRRC45 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.43 | LRRC45 | Zornitza Stark Gene: lrrc45 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.43 | LRRC45 | Zornitza Stark Classified gene: LRRC45 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.43 | LRRC45 | Zornitza Stark Gene: lrrc45 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.42 | LRRC45 |
Zornitza Stark gene: LRRC45 was added gene: LRRC45 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC45 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LRRC45 were set to 39638757 Phenotypes for gene: LRRC45 were set to Neurodevelopmental disorder MONDO:0700092, LRRC45-related Review for gene: LRRC45 was set to AMBER Added comment: Three individuals from two families reported with two homozygous variants, one splice site and the other missense. Features of a neurological ciliopathy with some supportive experimental evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.41 | WASHC3 | Zornitza Stark Marked gene: WASHC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.41 | WASHC3 | Zornitza Stark Gene: washc3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.41 | WASHC3 |
Zornitza Stark gene: WASHC3 was added gene: WASHC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WASHC3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915 Phenotypes for gene: WASHC3 were set to neurodevelopmental disorder MONDO:0700092, WASHC3 related Review for gene: WASHC3 was set to RED Added comment: One family with de novo missense. Two families with homozygous start loss variant. The functional evidence provided does not directly link to the human phenotype. Given two variants and two different MOIs, RED rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.40 | NAV3 | Zornitza Stark Marked gene: NAV3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.40 | NAV3 | Zornitza Stark Gene: nav3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.40 | NAV3 | Zornitza Stark Classified gene: NAV3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.40 | NAV3 | Zornitza Stark Gene: nav3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.39 | NAV3 |
Zornitza Stark gene: NAV3 was added gene: NAV3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAV3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAV3 were set to 39708122; 38977784 Phenotypes for gene: NAV3 were set to Neurodevelopmental disorder, MONDO:0700092, NAV3-related Review for gene: NAV3 was set to GREEN Added comment: 17 individuals from 11 families reported with bi-allelic variants and neurodevelopmental phenotypes, including DD/ID and behavioural abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.38 | EEFSEC | Zornitza Stark Marked gene: EEFSEC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.38 | EEFSEC | Zornitza Stark Gene: eefsec has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.38 | EEFSEC | Zornitza Stark Classified gene: EEFSEC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.38 | EEFSEC | Zornitza Stark Gene: eefsec has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.37 | EEFSEC |
Zornitza Stark gene: EEFSEC was added gene: EEFSEC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EEFSEC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EEFSEC were set to 39753114 Phenotypes for gene: EEFSEC were set to Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related Review for gene: EEFSEC was set to GREEN Added comment: Nine individuals from 8 unrelated families reported with bi-allelic variants in this gene and progressive neurodevelopmental disorder manifesting with global developmental delay, progressive spasticity, ataxia, and seizures. Cerebral MRI primarily demonstrated a cerebellar pathology, including hypoplasia and progressive atrophy. In line with the clinical phenotype, an eEFSec-RNAi Drosophila model displays progressive impairment of motor function, which is reflected in the synaptic defects in this model organisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.36 | LRRC8C | Zornitza Stark Marked gene: LRRC8C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.36 | LRRC8C | Zornitza Stark Gene: lrrc8c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.36 | LRRC8C | Zornitza Stark Classified gene: LRRC8C as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.36 | LRRC8C | Zornitza Stark Gene: lrrc8c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.35 | CCT3 | Zornitza Stark reviewed gene: CCT3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with speech or visual impairment and brain hypomyelination, MIM# 621034; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.35 | TCP1 | Zornitza Stark Phenotypes for gene: TCP1 were changed from neurodevelopmental disorder MONDO:0700092, TCP1-related to Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.34 | TCP1 | Zornitza Stark reviewed gene: TCP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.34 | EP400 | Bryony Thompson Marked gene: EP400 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.34 | EP400 | Bryony Thompson Gene: ep400 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.34 | EP400 | Bryony Thompson Classified gene: EP400 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.34 | EP400 | Bryony Thompson Gene: ep400 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.33 | EP400 |
Sangavi Sivagnanasundram gene: EP400 was added gene: EP400 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EP400 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EP400 were set to 39708813 Phenotypes for gene: EP400 were set to neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930 Review for gene: EP400 was set to GREEN Added comment: 6 unrelated probands presenting with epilepsy with NDD (including ID and DD) had compound heterozygous variants in EP400. They were confirmed in trans and inherited from their asymptomatic parents. Knockdown of EP400 ortholog in Drosophila showed an increase in seizure-like susceptibility and abnormal neurological behaviour. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.33 | LRRC8C |
Sangavi Sivagnanasundram gene: LRRC8C was added gene: LRRC8C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC8C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LRRC8C were set to 39623139 Phenotypes for gene: LRRC8C were set to TIMES syndrome MIM#621056 Mode of pathogenicity for gene: LRRC8C was set to Other Review for gene: LRRC8C was set to AMBER Added comment: TIMES syndrome is a multisystem disorder characterised by considerable phenotypic variability, but overlapping features include telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature. Patients exhibit striking cutis marmorata in infancy. Two individuals from unrelated families presenting with similar features consistent with TIMES syndrome. Leu400IlefsTer8 and Val390Leu variants were identified however the proposed mechanism of disease is GoF. Supporting in vitro functional assay was conducted however further evidence is required to upgrade the gene classification. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.33 | RICTOR | Bryony Thompson Marked gene: RICTOR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.33 | RICTOR | Bryony Thompson Gene: rictor has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.33 | RICTOR | Bryony Thompson Classified gene: RICTOR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.33 | RICTOR | Bryony Thompson Gene: rictor has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.32 | RICTOR |
Bryony Thompson gene: RICTOR was added gene: RICTOR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RICTOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RICTOR were set to 39738822 Phenotypes for gene: RICTOR were set to Neurodevelopmental disorder MONDO:0700092, RICTOR-related Review for gene: RICTOR was set to GREEN Added comment: 8 unrelated cases presenting with ID and/or developmental delay with de novo or heterozygous variants inherited from one affected parent, including three missense variants, four loss-of-function variants and one 3 kb deletion encompassing RICTOR. Possible gain of function and loss of function mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.31 | UBR5 | Bryony Thompson Marked gene: UBR5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.31 | UBR5 | Bryony Thompson Gene: ubr5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.31 | UBR5 | Bryony Thompson Classified gene: UBR5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.31 | UBR5 | Bryony Thompson Gene: ubr5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.30 | UBR5 |
Bryony Thompson gene: UBR5 was added gene: UBR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBR5 were set to 39721588 Phenotypes for gene: UBR5 were set to Neurodevelopmental disorder MONDO:0700092, UBR5-related Review for gene: UBR5 was set to GREEN Added comment: 29 individuals with a neurodevelopment syndrome (24 de novo variants) with a core phenotype characterised by developmental delay (26/28), autism (16/26), and intellectual disability (56%). Additionally, some individuals presented with epilepsy/seizures (11/27), movement disorders, and/or genital anomalies (35%). Loss of function is the expected mechanism of disease with functional experiments in C. elegans and in vitro ubiquitination assays. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.29 | ZNF711 | Zornitza Stark Phenotypes for gene: ZNF711 were changed from Mental retardation, X-linked 97; OMIM #300803 to Intellectual developmental disorder, X-linked 97, MIM# 300803 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.28 | ZNF711 | Zornitza Stark reviewed gene: ZNF711: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 97, MIM# 300803; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.28 | FRYL | Zornitza Stark Phenotypes for gene: FRYL were changed from neurodevelopmental disorder MONDO:0700092, FRYL-related to Pan-Chung-Bellen syndrome, MIM# 621049 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.27 | FRYL | Zornitza Stark reviewed gene: FRYL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pan-Chung-Bellen syndrome, MIM# 621049; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.27 | PIGG | Ain Roesley Phenotypes for gene: PIGG were changed from Mental retardation, autosomal recessive 53, MIM#616917 to Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy MIM#616917 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.26 | RUNX1T1 | Zornitza Stark Marked gene: RUNX1T1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.26 | RUNX1T1 | Zornitza Stark Gene: runx1t1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.26 | RUNX1T1 | Zornitza Stark Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.25 | RUNX1T1 | Zornitza Stark Phenotypes for gene: RUNX1T1 were changed from Neurodevelopmental disorder MONDO:0700092 to Neurodevelopmental disorder MONDO:0700092, RUNX1T1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.24 | RUNX1T1 | Chirag Patel Classified gene: RUNX1T1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.24 | RUNX1T1 | Chirag Patel Gene: runx1t1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.23 | RUNX1T1 |
Chirag Patel gene: RUNX1T1 was added gene: RUNX1T1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RUNX1T1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340 Phenotypes for gene: RUNX1T1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: RUNX1T1 was set to GREEN Added comment: RUNX1T1 encodes a transcription regulator for hematopoietic genes and is well-known for its involvement in hematologic malignancies. Germline RUNX1T1 variants may also play a role in human congenital neurodevelopmental disorders. PMID: 39568205 3 unrelated individuals with developmental delay, learning disability, ASD, ADHD, and dysmorphism (1 x heart defects). Trio WES identified de novo variants in RUNX1T1 gene (1 x nonsense variant in 5' region [p.Gln36Ter], 2 x missense variants in C-terminus [p.Gly412Arg and p.His521Tyr]). PMID: 19172993 1 individual with mild-moderate ID and congenital heart disease, and chromosome t(5;8)(q32;q21.3) translocation. Molecular characterization revealed that one of the break points was within the RUNX1T1 gene. Analysis of RUNX1T1 expression in human embryonic and fetal tissues suggests a role of RUNX1T1 in brain and heart development. PMID: 22644616 1 individual with mild ID and dysmorphism, and de novo deletion exons 3-7 in RUNX1T1. PMID: 31223340 1 individual with ID, anaemia, atrial septal defect, dysmorphism, and seizures. Found to have a 2.1 Mb deletion at 8q21.3q22.1 involving entire RUNX1T1 gene (and 2 adjacent genes - SLC26A7 and TRIQK), and a benign familial 4.3 Mb duplication at 1p22.1p21.3 (present in unaffected healthy brother). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.22 | CAPZA2 | Zornitza Stark Phenotypes for gene: CAPZA2 were changed from Intellectual disability to Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.21 | CAPZA2 | Zornitza Stark Publications for gene: CAPZA2 were set to 32338762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.20 | CAPZA2 | Zornitza Stark Classified gene: CAPZA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.20 | CAPZA2 | Zornitza Stark Gene: capza2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.19 | CAPZA2 | Chris Ciotta reviewed gene: CAPZA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32338762, 38374166, 35856264; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.19 | CCT6A | Ain Roesley Classified gene: CCT6A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.19 | CCT6A | Ain Roesley Gene: cct6a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.18 | CCT6A | Ain Roesley Marked gene: CCT6A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.18 | CCT6A | Ain Roesley Gene: cct6a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.18 | CCT6A |
Ain Roesley gene: CCT6A was added gene: CCT6A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCT6A were set to 39480921 Phenotypes for gene: CCT6A were set to neurodevelopmental disorder MONDO:0700092, CCT6A-related Penetrance for gene: CCT6A were set to Complete Review for gene: CCT6A was set to GREEN gene: CCT6A was marked as current diagnostic Added comment: previously known as CCT6 5x individuals including 4x de novo 3x PTCS + 1x +5C>G + 1x missense 4/5 DD/ID 2/5 visual impairment 2/5 seizures Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Marked gene: TCP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Classified gene: TCP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Classified gene: TCP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.16 | TCP1 |
Ain Roesley gene: TCP1 was added gene: TCP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TCP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TCP1 were set to 39480921 Phenotypes for gene: TCP1 were set to neurodevelopmental disorder MONDO:0700092, TCP1-related Penetrance for gene: TCP1 were set to Complete Review for gene: TCP1 was set to GREEN gene: TCP1 was marked as current diagnostic Added comment: previously known as CCT1 8x individuals including 5x de novo 6x PTCs + 2x missense 6/8 DD/ID 2/8 visual impairment 6/8 seizures 6/8 polymicrogyria + 1x Ventriculomegaly, white matter hyperintensities Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.15 | CCT3 | Ain Roesley Classified gene: CCT3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.15 | CCT3 | Ain Roesley Gene: cct3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.15 | CCT3 | Ain Roesley Marked gene: CCT3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.15 | CCT3 | Ain Roesley Gene: cct3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.15 | CCT3 | Ain Roesley Classified gene: CCT3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.15 | CCT3 | Ain Roesley Gene: cct3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.14 | CCT3 |
Ain Roesley gene: CCT3 was added gene: CCT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCT3 were set to 39480921 Phenotypes for gene: CCT3 were set to neurodevelopmental disorder MONDO:0700092, CCT3-related Penetrance for gene: CCT3 were set to Complete Review for gene: CCT3 was set to GREEN gene: CCT3 was marked as current diagnostic Added comment: 4x de novo - 3x PTCs and 1x missense overlapping phenotypes: 4/4 ID/DD 3/4 visual impairment 2/4 seizures 4/4 Hypomyelination of white matter Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.13 | CLASP1 | Ain Roesley Marked gene: CLASP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.13 | CLASP1 | Ain Roesley Gene: clasp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.13 | CLASP1 |
Ain Roesley gene: CLASP1 was added gene: CLASP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLASP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CLASP1 were set to 39040917 Phenotypes for gene: CLASP1 were set to neurodevelopmental disorder MONDO:0700092, CLASP1-related Review for gene: CLASP1 was set to RED gene: CLASP1 was marked as current diagnostic Added comment: 3 siblings from a consanguineous family, homozygous for p.(Arg1481His) at birth, all had low weight and microcephaly (< 3-4SD), profound dev delay, spasticity, seizures and lissencephaly Arg1481His - 3 hets 0 Homs in v4 codon is highly conserved with a high REVEL score 0.83 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.12 | GPATCH11 | Zornitza Stark Publications for gene: GPATCH11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.11 | GPATCH11 | Zornitza Stark reviewed gene: GPATCH11: Rating: GREEN; Mode of pathogenicity: None; Publications: 39572588; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.11 | MGA | Zornitza Stark Marked gene: MGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.11 | MGA | Zornitza Stark Gene: mga has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.11 | MGA | Zornitza Stark Classified gene: MGA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.11 | MGA | Zornitza Stark Gene: mga has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.10 | MGA |
Zornitza Stark gene: MGA was added gene: MGA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MGA were set to 39600096; 20044811 Phenotypes for gene: MGA were set to Syndromic disease, MONDO:0002254, MGA-related Review for gene: MGA was set to GREEN Added comment: Three individuals with de novo LoF variants reported in individuals with ID and congenital anomalies. Zebrafish model supports role of this transcription factor in organogenesis. Note there are previous, less clear reports of association with NDD/CHD. Gene is constrained for LoF variants in gnomad v4; however, note there are ~30 individuals with LoF variants present. Borderline Green/Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.9 | PPP2R2B | Bryony Thompson Marked gene: PPP2R2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.9 | PPP2R2B | Bryony Thompson Gene: ppp2r2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.9 | PPP2R2B | Bryony Thompson Classified gene: PPP2R2B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.9 | PPP2R2B | Bryony Thompson Gene: ppp2r2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.8 | PPP2R2B | Bryony Thompson Classified gene: PPP2R2B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.8 | PPP2R2B | Bryony Thompson Gene: ppp2r2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.7 | PPP2R2B |
Bryony Thompson gene: PPP2R2B was added gene: PPP2R2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP2R2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R2B were set to 25356899; 39565297 Phenotypes for gene: PPP2R2B were set to Neurodevelopmental disorder MONDO:0700092, PPP2R2B-related Review for gene: PPP2R2B was set to AMBER Added comment: 5 cases with NDD and heterozygous missense (4/5 confirmed de novo): p.Thr246Lys (unknown inheritance), p.Asn310Lys (confirmed de novo), p.Glu37Lys (confirmed de novo, also had RNU4-2 path de novo Path variant), p.Ile427Thr (confirmed de novo, also had TAOK1 inherited Path variant), p.Arg149Pro (confirmed de novo). 5/5 with intellectual disability and developmental delay, 4/5 with seizures, 2/5 with hearing loss/auditory neuropathy. Study includes in vitro functional assays supporting a possible loss of function mechanism of disease. The 2 missense with additional diagnoses (E37K & I427T) demonstrated a partial reduction in PP2A holoenzyme assembly. Only 3 cases with a possible diagnosis that could be attributed to the PPP2R2B only, and only 2 were confirmed de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.6 | WDR47 | Bryony Thompson Marked gene: WDR47 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.6 | WDR47 | Bryony Thompson Gene: wdr47 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.6 | WDR47 | Bryony Thompson Classified gene: WDR47 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.6 | WDR47 | Bryony Thompson Gene: wdr47 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.5 | WDR47 |
Bryony Thompson gene: WDR47 was added gene: WDR47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR47 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR47 were set to 39609633 Phenotypes for gene: WDR47 were set to Complex neurodevelopmental disorder MONDO:0100038, WDR47-related Review for gene: WDR47 was set to GREEN Added comment: 7 cases from 5 unrelated families with biallelic variants and a complex neurodevelopmental syndrome. The most frequent phenotypes were corpus callosum dysgenesis (7/7), microcephaly (7/7), mild to severe intellectual disability (7/7), epilepsy (7/7). Additionally, mouse models recapitulate the human phenotype. Loss of function is the mechanism of disease. Heterozygous parents had no phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.4 | PPP5C | Bryony Thompson Marked gene: PPP5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.4 | PPP5C | Bryony Thompson Gene: ppp5c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.4 | PPP5C | Bryony Thompson Classified gene: PPP5C as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.4 | PPP5C | Bryony Thompson Gene: ppp5c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.3 | PPP5C |
Lucy Spencer gene: PPP5C was added gene: PPP5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP5C were set to 35361529; 25363768; 33057194 Phenotypes for gene: PPP5C were set to Neurodevelopmental disorder, MONDO:0700092, PPP5C-related Review for gene: PPP5C was set to AMBER Added comment: PMID: 35361529 - reported a de novo missense in a proband with microcephaly, developmental delay and epilepsy. However, after personal communication with the undiagnosed disease network this proband has since been found to have a different diagnosis with a nonsense and a missense in VARS1 identified, so unclear if the PPP5C variant is contributing to their phenotype. 3 more probands with de novo missense variants have been published in large autism or developmental disorder cohort with limited information (PMIDs: 25363768, 33057194) An internal VCGS proband with intellectual disability and failure to thrive was also found to have a de novo missense variant in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.3 | WDR83OS | Zornitza Stark Phenotypes for gene: WDR83OS were changed from complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia to Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.2 | WDR83OS | Zornitza Stark reviewed gene: WDR83OS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.2 | SLC35F1 | Zornitza Stark Classified gene: SLC35F1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.2 | SLC35F1 | Zornitza Stark Gene: slc35f1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.1 | SLC35F1 | Zornitza Stark edited their review of gene: SLC35F1: Added comment: Likely second individual identified internally at VCGS, AS/Rett-like phenotype and de novo Gly226Arg variant.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.1 | LINC01578 | Zornitza Stark Phenotypes for gene: LINC01578 were changed from Neurodevelopmental disorder, MONDO:0700092, CHASERR-related to Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.0 | LINC01578 | Zornitza Stark edited their review of gene: LINC01578: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6911 | FMR1 | Zornitza Stark Marked gene: FMR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6911 | FMR1 | Zornitza Stark Gene: fmr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6911 | FMR1 | Zornitza Stark Phenotypes for gene: FMR1 were changed from to fragile X syndrome MONDO:0010383 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6910 | FMR1 | Zornitza Stark Publications for gene: FMR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6909 | FMR1 | Zornitza Stark Mode of inheritance for gene: FMR1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6908 | FRAXE | Zornitza Stark Marked STR: FRAXE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6908 | FRAXE | Zornitza Stark Str: fraxe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6908 | FRAXE | Zornitza Stark Tag STR tag was added to STR: FRAXE. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6908 | HADHA | Zornitza Stark Marked gene: HADHA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6908 | HADHA | Zornitza Stark Gene: hadha has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6908 | HADHA | Zornitza Stark Phenotypes for gene: HADHA were changed from to long chain 3-hydroxyacyl-CoA dehydrogenase deficiency MONDO:0012173 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6907 | HADHA | Zornitza Stark Publications for gene: HADHA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6906 | HADHA | Zornitza Stark Mode of inheritance for gene: HADHA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6905 | PEX14 | Zornitza Stark Marked gene: PEX14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6905 | PEX14 | Zornitza Stark Gene: pex14 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6905 | AHSG | Zornitza Stark Marked gene: AHSG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6905 | AHSG | Zornitza Stark Gene: ahsg has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6905 | STN1 | Zornitza Stark Marked gene: STN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6905 | STN1 | Zornitza Stark Gene: stn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6905 | STN1 | Zornitza Stark Phenotypes for gene: STN1 were changed from cerebral calcification; premature ageing; bone marrow failure; retinal telangiactasia; hepatic fibrosis to Cerebroretinal microangiopathy with calcification and cysts 2, MIM#617341 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6904 | PCNT | Zornitza Stark Marked gene: PCNT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6904 | PCNT | Zornitza Stark Gene: pcnt has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6904 | PCNT | Zornitza Stark Phenotypes for gene: PCNT were changed from to Microcephalic osteodysplastic primordial dwarfism, type II MIM#210720 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6903 | PCNT | Zornitza Stark Publications for gene: PCNT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6902 | PCNT | Zornitza Stark Mode of inheritance for gene: PCNT was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6901 | PCNT | Zornitza Stark Mode of inheritance for gene: PCNT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6901 | PCNT | Zornitza Stark Classified gene: PCNT as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6901 | PCNT | Zornitza Stark Gene: pcnt has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6900 | PCNT | Zornitza Stark Classified gene: PCNT as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6900 | PCNT | Zornitza Stark Gene: pcnt has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6899 | PC | Zornitza Stark Marked gene: PC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6899 | PC | Zornitza Stark Gene: pc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6899 | PC | Zornitza Stark Phenotypes for gene: PC were changed from to Pyruvate carboxylase deficiency - MIM#266150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6898 | PC | Zornitza Stark Publications for gene: PC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6897 | PC | Zornitza Stark Mode of inheritance for gene: PC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6896 | PAX8 | Zornitza Stark Marked gene: PAX8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6896 | PAX8 | Zornitza Stark Gene: pax8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6896 | PAX8 | Zornitza Stark Phenotypes for gene: PAX8 were changed from to Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6895 | PAX8 | Zornitza Stark Publications for gene: PAX8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6894 | PAX8 | Zornitza Stark Mode of inheritance for gene: PAX8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6893 | PAX6 | Zornitza Stark Marked gene: PAX6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6893 | PAX6 | Zornitza Stark Gene: pax6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6893 | PAX6 | Zornitza Stark Phenotypes for gene: PAX6 were changed from Microphthalmia/coloboma 12, OMIM #120200 to Microphthalmia/coloboma 12, OMIM #120200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6892 | PAX6 | Zornitza Stark Phenotypes for gene: PAX6 were changed from to Microphthalmia/coloboma 12, OMIM #120200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6891 | PAX6 | Zornitza Stark Publications for gene: PAX6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6890 | PAX6 | Zornitza Stark Mode of inheritance for gene: PAX6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6889 | PARN | Zornitza Stark Marked gene: PARN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6889 | PARN | Zornitza Stark Gene: parn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6889 | PARN | Zornitza Stark Phenotypes for gene: PARN were changed from to Dyskeratosis congenita, autosomal recessive 6, MIM# 616353 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6888 | PARN | Zornitza Stark Publications for gene: PARN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6887 | PARN | Zornitza Stark Mode of inheritance for gene: PARN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6886 | OTX2 | Zornitza Stark Marked gene: OTX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6886 | OTX2 | Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6886 | OTX2 | Zornitza Stark Phenotypes for gene: OTX2 were changed from to Microphthalmia, syndromic 5, MIM# 610125; Pituitary hormone deficiency, combined, 6, MIM# 613986; Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125; Otocephaly-dysgnathia complex | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6885 | OTX2 | Zornitza Stark Publications for gene: OTX2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6884 | OTX2 | Zornitza Stark Mode of inheritance for gene: OTX2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6883 | OPA3 | Zornitza Stark Marked gene: OPA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6883 | OPA3 | Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6883 | OPA3 | Zornitza Stark Phenotypes for gene: OPA3 were changed from to 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR; Optic atrophy 3 with cataract (MIM#165300), AD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6882 | OPA3 | Zornitza Stark Publications for gene: OPA3 were set to 25159689; 31119193; 31928268 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6881 | OPA3 | Zornitza Stark Publications for gene: OPA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6880 | OPA3 | Zornitza Stark Mode of inheritance for gene: OPA3 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6879 | OPA3 | Zornitza Stark Mode of inheritance for gene: OPA3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6878 | OCLN | Zornitza Stark Marked gene: OCLN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6878 | OCLN | Zornitza Stark Gene: ocln has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6878 | OCLN | Zornitza Stark Phenotypes for gene: OCLN were changed from to Pseudo-TORCH syndrome 1, MIM#251290 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6877 | OCLN | Zornitza Stark Publications for gene: OCLN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6876 | OCLN | Zornitza Stark Mode of inheritance for gene: OCLN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6875 | NRAS | Zornitza Stark Marked gene: NRAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6875 | NRAS | Zornitza Stark Gene: nras has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6875 | NRAS | Zornitza Stark Phenotypes for gene: NRAS were changed from to Noonan syndrome 6, MIM# 613224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6874 | NRAS | Zornitza Stark Publications for gene: NRAS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6873 | NRAS | Zornitza Stark Mode of pathogenicity for gene: NRAS was changed from Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6872 | NRAS | Zornitza Stark Mode of pathogenicity for gene: NRAS was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6871 | NRAS | Zornitza Stark Mode of inheritance for gene: NRAS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6870 | NPHP1 | Zornitza Stark Marked gene: NPHP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6870 | NPHP1 | Zornitza Stark Gene: nphp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6870 | NPHP1 | Zornitza Stark Phenotypes for gene: NPHP1 were changed from to Joubert syndrome 4, MIM# 609583; Nephronophthisis 1, juvenile, MIM# 256100; Senior-Loken syndrome-1, MIM# 266900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6869 | NPHP1 | Zornitza Stark Publications for gene: NPHP1 were set to 15138899; 32139166; 28347285; 8852662; 9856524 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6868 | NPHP1 | Zornitza Stark Publications for gene: NPHP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6867 | NPHP1 | Zornitza Stark Mode of inheritance for gene: NPHP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6866 | NF1 | Zornitza Stark Marked gene: NF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6866 | NF1 | Zornitza Stark Gene: nf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6866 | NF1 | Zornitza Stark Phenotypes for gene: NF1 were changed from to Neurofibromatosis, type 1 (MIM#162200) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6865 | NF1 | Zornitza Stark Publications for gene: NF1 were set to 23931823; 10762507 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6864 | NF1 | Zornitza Stark Publications for gene: NF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6863 | NF1 | Zornitza Stark Mode of inheritance for gene: NF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6862 | NDUFS8 | Zornitza Stark Marked gene: NDUFS8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6862 | NDUFS8 | Zornitza Stark Gene: ndufs8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6862 | NDUFS8 | Zornitza Stark Phenotypes for gene: NDUFS8 were changed from Mitochondrial complex I deficiency, nuclear type 2 MIM#618222 to Mitochondrial complex I deficiency, nuclear type 2 MIM#618222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6861 | NDUFS8 | Zornitza Stark Phenotypes for gene: NDUFS8 were changed from to Mitochondrial complex I deficiency, nuclear type 2 MIM#618222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6861 | NDUFS8 | Zornitza Stark Publications for gene: NDUFS8 were set to 23430795; 9837812; 15159508; 22499348; 20818383; 20819849 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6860 | NDUFS8 | Zornitza Stark Publications for gene: NDUFS8 were set to 23430795; 9837812; 15159508; 22499348; 20818383; 20819849 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6859 | NDUFS8 | Zornitza Stark Publications for gene: NDUFS8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6858 | NDUFS8 | Zornitza Stark Mode of inheritance for gene: NDUFS8 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6857 | NDUFS8 | Zornitza Stark Mode of inheritance for gene: NDUFS8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6856 | NDUFS4 | Zornitza Stark Phenotypes for gene: NDUFS4 were changed from Mitochondrial complex I deficiency, nuclear type 1, 252010; Leigh syndrome, MIM#252010 to Mitochondrial complex I deficiency, nuclear type 1, 252010; Leigh syndrome, MIM#252010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6856 | NDUFS4 | Zornitza Stark Marked gene: NDUFS4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6856 | NDUFS4 | Zornitza Stark Gene: ndufs4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6856 | NDUFS4 | Zornitza Stark Phenotypes for gene: NDUFS4 were changed from to Mitochondrial complex I deficiency, nuclear type 1, 252010; Leigh syndrome, MIM#252010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6855 | NDUFS4 | Zornitza Stark Publications for gene: NDUFS4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6854 | NDUFS4 | Zornitza Stark Mode of inheritance for gene: NDUFS4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6853 | NDUFS4 | Zornitza Stark Mode of inheritance for gene: NDUFS4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6852 | NACC1 | Zornitza Stark Marked gene: NACC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6852 | NACC1 | Zornitza Stark Gene: nacc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6852 | MYCN | Zornitza Stark Marked gene: MYCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6852 | MYCN | Zornitza Stark Gene: mycn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6852 | MYCN | Zornitza Stark Phenotypes for gene: MYCN were changed from to Feingold syndrome 1 MIM#164280; Megalencephaly-polydactyly syndrome, MIM# 620748 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6851 | MYCN | Zornitza Stark reviewed gene: MYCN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Feingold syndrome 1 MIM#164280; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6851 | MYCN | Zornitza Stark Publications for gene: MYCN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6850 | MYCN | Zornitza Stark Mode of inheritance for gene: MYCN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6849 | MED12L | Zornitza Stark Marked gene: MED12L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6849 | MED12L | Zornitza Stark Gene: med12l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6849 | MED12L | Zornitza Stark Phenotypes for gene: MED12L were changed from Intellectual disability; Seizures; Autism to Neurodevelopmental disorder, MONDO:0700092, MED12L-related; Intellectual disability; Seizures; Autism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6848 | LARS2 | Zornitza Stark Marked gene: LARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6848 | LARS2 | Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6848 | LARS2 | Zornitza Stark Phenotypes for gene: LARS2 were changed from to Perrault syndrome 4, MIM# 615300; Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6847 | LARS2 | Zornitza Stark Publications for gene: LARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6846 | LARS2 | Zornitza Stark Mode of inheritance for gene: LARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6845 | LARGE1 | Zornitza Stark Marked gene: LARGE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6845 | LARGE1 | Zornitza Stark Gene: large1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6845 | LARGE1 | Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6844 | LARGE1 | Zornitza Stark Publications for gene: LARGE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6843 | LARGE1 | Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6842 | LAMP2 | Zornitza Stark Marked gene: LAMP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6842 | LAMP2 | Zornitza Stark Gene: lamp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6842 | LAMP2 | Zornitza Stark Phenotypes for gene: LAMP2 were changed from Danon disease, MIM# 300257; MONDO:0010281 to Danon disease, MIM# 300257; MONDO:0010281 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6841 | LAMP2 | Zornitza Stark Phenotypes for gene: LAMP2 were changed from to Danon disease, MIM# 300257; MONDO:0010281 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6840 | LAMP2 | Zornitza Stark Publications for gene: LAMP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6839 | LAMP2 | Zornitza Stark Mode of inheritance for gene: LAMP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6838 | KRAS | Zornitza Stark Marked gene: KRAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6838 | KRAS | Zornitza Stark Gene: kras has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6838 | KRAS | Zornitza Stark Phenotypes for gene: KRAS were changed from to Noonan syndrome 3, MIM# 609942; Cardiofaciocutaneous syndrome 2, MIM# 615278 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6837 | KRAS | Zornitza Stark Publications for gene: KRAS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6836 | KRAS | Zornitza Stark Mode of pathogenicity for gene: KRAS was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6835 | KRAS | Zornitza Stark Mode of inheritance for gene: KRAS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6834 | KMT2E | Zornitza Stark Marked gene: KMT2E as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6834 | KMT2E | Zornitza Stark Gene: kmt2e has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6834 | KMT2E | Zornitza Stark Phenotypes for gene: KMT2E were changed from to O'Donnell-Luria-Rodan syndrome, MIM# 618512; Intellectual disability; Autism; Seizures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6833 | KMT2E | Zornitza Stark Publications for gene: KMT2E were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6832 | KMT2E | Zornitza Stark Mode of inheritance for gene: KMT2E was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6831 | KAT6B | Zornitza Stark Marked gene: KAT6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6831 | KAT6B | Zornitza Stark Gene: kat6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6831 | KAT6B | Zornitza Stark Phenotypes for gene: KAT6B were changed from KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 to KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6830 | KAT6B | Zornitza Stark Phenotypes for gene: KAT6B were changed from to KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6829 | KAT6B | Zornitza Stark Publications for gene: KAT6B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6828 | KAT6B | Zornitza Stark Mode of inheritance for gene: KAT6B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6827 | KAT6A | Zornitza Stark Marked gene: KAT6A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6827 | KAT6A | Zornitza Stark Gene: kat6a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6827 | KAT6A | Zornitza Stark Phenotypes for gene: KAT6A were changed from to syndromic intellectual disability MONDO:0000508 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6826 | KAT6A | Zornitza Stark Publications for gene: KAT6A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6825 | KAT6A | Zornitza Stark Mode of inheritance for gene: KAT6A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6824 | INPP5K | Zornitza Stark Marked gene: INPP5K as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6824 | INPP5K | Zornitza Stark Gene: inpp5k has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6824 | INPP5K | Zornitza Stark Phenotypes for gene: INPP5K were changed from to congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6823 | INPP5K | Zornitza Stark Publications for gene: INPP5K were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6822 | INPP5K | Zornitza Stark Mode of inheritance for gene: INPP5K was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6821 | IKBKG | Zornitza Stark Marked gene: IKBKG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6821 | IKBKG | Zornitza Stark Gene: ikbkg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6821 | IKBKG | Zornitza Stark Phenotypes for gene: IKBKG were changed from to Incontinentia pigmenti MONDO:0010631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6820 | IKBKG | Zornitza Stark Publications for gene: IKBKG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6819 | IKBKG | Zornitza Stark Mode of inheritance for gene: IKBKG was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6818 | DHRSX | Zornitza Stark Phenotypes for gene: DHRSX were changed from congenital disorder of glycosylation, MONDO:0015286, DHRSX-related to Congenital disorder of glycosylation, type 1DD, MIM# 301133 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6817 | DHRSX | Zornitza Stark edited their review of gene: DHRSX: Changed phenotypes: Congenital disorder of glycosylation, type 1DD, MIM# 301133 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6817 | IFT172 | Zornitza Stark Marked gene: IFT172 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6817 | IFT172 | Zornitza Stark Gene: ift172 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6817 | IFT172 | Zornitza Stark Phenotypes for gene: IFT172 were changed from to Bardet-Biedl syndrome MONDO:0015229 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6816 | IFT172 | Zornitza Stark Publications for gene: IFT172 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6815 | IFT172 | Zornitza Stark Mode of inheritance for gene: IFT172 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6814 | IFIH1 | Zornitza Stark Marked gene: IFIH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6814 | IFIH1 | Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6814 | IFIH1 | Zornitza Stark Phenotypes for gene: IFIH1 were changed from to IFIH1-related type 1 interferonopathy MONDO:0700262 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6813 | IFIH1 | Zornitza Stark Publications for gene: IFIH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6812 | IFIH1 | Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6811 | IDUA | Zornitza Stark Marked gene: IDUA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6811 | IDUA | Zornitza Stark Gene: idua has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6811 | IDUA | Zornitza Stark Phenotypes for gene: IDUA were changed from to mucopolysaccharidosis type 1 MONDO:0001586 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6810 | IDUA | Zornitza Stark Publications for gene: IDUA were set to 20301341 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6809 | IDUA | Zornitza Stark Publications for gene: IDUA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6808 | IDUA | Zornitza Stark Mode of inheritance for gene: IDUA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6807 | IDS | Zornitza Stark Marked gene: IDS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6807 | IDS | Zornitza Stark Gene: ids has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6807 | IDS | Zornitza Stark Phenotypes for gene: IDS were changed from to mucopolysaccharidosis type 2 MONDO:0010674 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6806 | IDS | Zornitza Stark Publications for gene: IDS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6805 | IDS | Zornitza Stark Mode of inheritance for gene: IDS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6804 | IDH2 | Zornitza Stark Marked gene: IDH2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6804 | IDH2 | Zornitza Stark Gene: idh2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6804 | IDH2 | Zornitza Stark Phenotypes for gene: IDH2 were changed from to mitochondrial disease MONDO:0044970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6803 | IDH2 | Zornitza Stark Publications for gene: IDH2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6802 | IDH2 | Zornitza Stark Mode of inheritance for gene: IDH2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6801 | HTRA2 | Zornitza Stark Marked gene: HTRA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6801 | HTRA2 | Zornitza Stark Gene: htra2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6801 | HTRA2 | Zornitza Stark Phenotypes for gene: HTRA2 were changed from to 3-methylglutaconic aciduria type 8 MONDO:0044723 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6800 | HTRA2 | Zornitza Stark Publications for gene: HTRA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6799 | HTRA2 | Zornitza Stark Mode of inheritance for gene: HTRA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6798 | HSPD1 | Zornitza Stark Marked gene: HSPD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6798 | HSPD1 | Zornitza Stark Gene: hspd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6798 | HSPD1 | Zornitza Stark Phenotypes for gene: HSPD1 were changed from Leukodystrophy, hypomyelinating, 4, MIM# 612233 to Leukodystrophy, hypomyelinating, 4, MIM# 612233 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6797 | HSPD1 | Zornitza Stark Phenotypes for gene: HSPD1 were changed from Leukodystrophy, hypomyelinating, 4, MIM# 612233 to Leukodystrophy, hypomyelinating, 4, MIM# 612233 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6796 | HSPD1 | Zornitza Stark Phenotypes for gene: HSPD1 were changed from to Leukodystrophy, hypomyelinating, 4, MIM# 612233 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6795 | HSPD1 | Zornitza Stark Publications for gene: HSPD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6794 | HSPD1 | Zornitza Stark Mode of inheritance for gene: HSPD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6793 | HSPD1 | Zornitza Stark reviewed gene: HSPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571143, 27405012, 32532876, 28377887, 27405012, 11898127, 17420924; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM# 612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6793 | HSD17B10 | Zornitza Stark Phenotypes for gene: HSD17B10 were changed from HSD10 mitochondrial disease MONDO:0010327 to HSD10 mitochondrial disease MONDO:0010327 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6792 | HSD17B10 | Zornitza Stark Marked gene: HSD17B10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6792 | HSD17B10 | Zornitza Stark Gene: hsd17b10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6792 | HSD17B10 | Zornitza Stark Phenotypes for gene: HSD17B10 were changed from to HSD10 mitochondrial disease MONDO:0010327 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6791 | HSD17B10 | Zornitza Stark Publications for gene: HSD17B10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6790 | HSD17B10 | Zornitza Stark Mode of inheritance for gene: HSD17B10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6789 | HPRT1 | Zornitza Stark Marked gene: HPRT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6789 | HPRT1 | Zornitza Stark Gene: hprt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6789 | HPRT1 | Zornitza Stark Phenotypes for gene: HPRT1 were changed from to Lesch-Nyhan syndrome MONDO:0010298 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6788 | HPRT1 | Zornitza Stark Publications for gene: HPRT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6787 | HPRT1 | Zornitza Stark Mode of inheritance for gene: HPRT1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6786 | HPD | Zornitza Stark Marked gene: HPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6786 | HPD | Zornitza Stark Gene: hpd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6786 | HPD | Zornitza Stark Phenotypes for gene: HPD were changed from to tyrosinemia type III MONDO:0010162 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6785 | HPD | Zornitza Stark Publications for gene: HPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6784 | HPD | Zornitza Stark Mode of inheritance for gene: HPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6783 | HPD | Zornitza Stark reviewed gene: HPD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6783 | HOXA1 | Zornitza Stark Marked gene: HOXA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6783 | HOXA1 | Zornitza Stark Gene: hoxa1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6783 | HOXA1 | Zornitza Stark Mode of inheritance for gene: HOXA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6782 | HOXA1 | Zornitza Stark Publications for gene: HOXA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6781 | HOXA1 | Zornitza Stark Phenotypes for gene: HOXA1 were changed from to Bosley-Salih-Alorainy syndrome, MIM#601536 and Athabaskan brainstem dysgenesis syndrome, MIM#601536 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6780 | HNRNPK | Zornitza Stark Marked gene: HNRNPK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6780 | HNRNPK | Zornitza Stark Gene: hnrnpk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6780 | HNRNPK | Zornitza Stark Phenotypes for gene: HNRNPK were changed from to neurodevelopmental disorder-craniofacial dysmorphism-cardiac defect-hip dysplasia syndrome (Au-Kline syndrome) MONDO:0018681 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6779 | HNRNPK | Zornitza Stark Publications for gene: HNRNPK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6778 | HNRNPK | Zornitza Stark Mode of inheritance for gene: HNRNPK was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6777 | HMGCL | Zornitza Stark Marked gene: HMGCL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6777 | HMGCL | Zornitza Stark Gene: hmgcl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6777 | HMGCL | Zornitza Stark Phenotypes for gene: HMGCL were changed from to 3-hydroxy-3-methylglutaric aciduria MONDO:0009520 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6776 | HMGCL | Zornitza Stark Publications for gene: HMGCL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6775 | HMGCL | Zornitza Stark Mode of inheritance for gene: HMGCL was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6774 | HLCS | Zornitza Stark Marked gene: HLCS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6774 | HLCS | Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6774 | HLCS | Zornitza Stark Phenotypes for gene: HLCS were changed from to holocarboxylase synthetase deficiency MONDO:0009666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6773 | HLCS | Zornitza Stark Publications for gene: HLCS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6772 | HLCS | Zornitza Stark Mode of inheritance for gene: HLCS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6771 | HLCS | Zornitza Stark Mode of inheritance for gene: HLCS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6770 | HIBCH | Zornitza Stark Marked gene: HIBCH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6770 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6770 | HIBCH | Zornitza Stark Phenotypes for gene: HIBCH were changed from 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603; Leigh syndrome MONDO:0009723 to 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603; Leigh syndrome MONDO:0009723 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6769 | HIBCH | Zornitza Stark Phenotypes for gene: HIBCH were changed from to 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603; Leigh syndrome MONDO:0009723 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6768 | HIBCH | Zornitza Stark Publications for gene: HIBCH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6767 | HIBCH | Zornitza Stark Mode of inheritance for gene: HIBCH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6766 | HEXB | Zornitza Stark Marked gene: HEXB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6766 | HEXB | Zornitza Stark Gene: hexb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6766 | HEXB | Zornitza Stark Phenotypes for gene: HEXB were changed from Sandhoff disease MONDO:0010006 to Sandhoff disease MONDO:0010006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6765 | HEXB | Zornitza Stark Phenotypes for gene: HEXB were changed from to Sandhoff disease MONDO:0010006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6764 | HEXB | Zornitza Stark Publications for gene: HEXB were set to 35420740 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6764 | HEXB | Zornitza Stark Publications for gene: HEXB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6763 | HEXB | Zornitza Stark Mode of inheritance for gene: HEXB was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6762 | HEXB | Zornitza Stark Mode of inheritance for gene: HEXB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6761 | HEXA | Zornitza Stark Marked gene: HEXA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6761 | HEXA | Zornitza Stark Gene: hexa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6761 | HEXA | Zornitza Stark Phenotypes for gene: HEXA were changed from to Tay-Sachs disease MONDO:0010100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6760 | HEXA | Zornitza Stark Publications for gene: HEXA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6759 | HEXA | Zornitza Stark Mode of inheritance for gene: HEXA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6758 | HESX1 | Zornitza Stark Phenotypes for gene: HESX1 were changed from septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099 to septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6758 | HESX1 | Zornitza Stark Marked gene: HESX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6758 | HESX1 | Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6758 | HESX1 | Zornitza Stark Phenotypes for gene: HESX1 were changed from to septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6757 | HESX1 | Zornitza Stark Publications for gene: HESX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6756 | HESX1 | Zornitza Stark Mode of inheritance for gene: HESX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6755 | HESX1 | Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6755 | HEPACAM | Zornitza Stark Marked gene: HEPACAM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6755 | HEPACAM | Zornitza Stark Gene: hepacam has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6755 | HEPACAM | Zornitza Stark Phenotypes for gene: HEPACAM were changed from to Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490; Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6754 | HEPACAM | Zornitza Stark Publications for gene: HEPACAM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6753 | HEPACAM | Zornitza Stark Mode of inheritance for gene: HEPACAM was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6752 | HCCS | Zornitza Stark Marked gene: HCCS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6752 | HCCS | Zornitza Stark Gene: hccs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6752 | HCCS | Zornitza Stark Phenotypes for gene: HCCS were changed from to linear skin defects with multiple congenital anomalies 1 (MONDO:0024552) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6751 | HCCS | Zornitza Stark Publications for gene: HCCS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6750 | HCCS | Zornitza Stark Mode of inheritance for gene: HCCS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6749 | HCCS | Zornitza Stark reviewed gene: HCCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6749 | GTF2H5 | Zornitza Stark Marked gene: GTF2H5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6749 | GTF2H5 | Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6749 | GTF2H5 | Zornitza Stark Phenotypes for gene: GTF2H5 were changed from to Trichothiodystrophy 3, photosensitive MIM#616395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6748 | GTF2H5 | Zornitza Stark Publications for gene: GTF2H5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6747 | GTF2H5 | Zornitza Stark Mode of inheritance for gene: GTF2H5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6746 | GTF2H5 | Zornitza Stark reviewed gene: GTF2H5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6746 | GRM1 | Zornitza Stark Marked gene: GRM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6746 | GRM1 | Zornitza Stark Gene: grm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6746 | GRM1 | Zornitza Stark Phenotypes for gene: GRM1 were changed from to autosomal recessive spinocerebellar ataxia 13 MONDO:0013905 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6745 | GRM1 | Zornitza Stark Publications for gene: GRM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6744 | GRM1 | Zornitza Stark Mode of inheritance for gene: GRM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6743 | GRM1 | Zornitza Stark reviewed gene: GRM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6743 | GPC3 | Zornitza Stark Marked gene: GPC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6743 | GPC3 | Zornitza Stark Gene: gpc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6743 | GPC3 | Zornitza Stark Phenotypes for gene: GPC3 were changed from to Simpson-Golabi-Behmel syndrome MONDO:0010731 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6742 | GPC3 | Zornitza Stark Publications for gene: GPC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6741 | GPC3 | Zornitza Stark Mode of inheritance for gene: GPC3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6740 | GNS | Zornitza Stark Marked gene: GNS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6740 | GNS | Zornitza Stark Gene: gns has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6740 | GNS | Zornitza Stark Phenotypes for gene: GNS were changed from to mucopolysaccharidosis type 3D MONDO:0009658 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6739 | GNS | Zornitza Stark Publications for gene: GNS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6738 | GNS | Zornitza Stark Mode of inheritance for gene: GNS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6737 | GNPTAB | Zornitza Stark Marked gene: GNPTAB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6737 | GNPTAB | Zornitza Stark Gene: gnptab has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6737 | GNPTAB | Zornitza Stark Phenotypes for gene: GNPTAB were changed from to GNPTAB-mucolipidosis MONDO:0100122 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6736 | GNPTAB | Zornitza Stark Publications for gene: GNPTAB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6735 | GNPTAB | Zornitza Stark Mode of inheritance for gene: GNPTAB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6734 | GNPAT | Zornitza Stark Marked gene: GNPAT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6734 | GNPAT | Zornitza Stark Gene: gnpat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6734 | GNPAT | Zornitza Stark Phenotypes for gene: GNPAT were changed from to glyceronephosphate O-acyltransferase deficiency MONDO:0100273 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6733 | GNPAT | Zornitza Stark Publications for gene: GNPAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6732 | GNPAT | Zornitza Stark Mode of inheritance for gene: GNPAT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6731 | GMPPB | Zornitza Stark Marked gene: GMPPB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6731 | GMPPB | Zornitza Stark Gene: gmppb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6731 | GMPPB | Zornitza Stark Phenotypes for gene: GMPPB were changed from to myopathy caused by variation in GMPPB MONDO:0700084 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6730 | GMPPB | Zornitza Stark Publications for gene: GMPPB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6729 | GMPPB | Zornitza Stark Mode of inheritance for gene: GMPPB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6728 | GMPPA | Zornitza Stark Marked gene: GMPPA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6728 | GMPPA | Zornitza Stark Gene: gmppa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6728 | GMPPA | Zornitza Stark Phenotypes for gene: GMPPA were changed from to alacrima, achalasia, and intellectual disability syndrome MONDO:0014219 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6727 | GMPPA | Zornitza Stark Publications for gene: GMPPA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6726 | GMPPA | Zornitza Stark Mode of inheritance for gene: GMPPA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6725 | GM2A | Zornitza Stark Marked gene: GM2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6725 | GM2A | Zornitza Stark Gene: gm2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6725 | GM2A | Zornitza Stark Phenotypes for gene: GM2A were changed from to Tay-Sachs disease AB variant MONDO:0010099 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6724 | GM2A | Zornitza Stark Publications for gene: GM2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6723 | GM2A | Zornitza Stark Mode of inheritance for gene: GM2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6722 | PSPH | Ain Roesley Marked gene: PSPH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6722 | PSPH | Ain Roesley Gene: psph has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6722 | PSPH | Ain Roesley Phenotypes for gene: PSPH were changed from Phosphoserine phosphatase deficiency MIM#614023 to Phosphoserine phosphatase deficiency MIM#614023 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6722 | PSPH | Ain Roesley Phenotypes for gene: PSPH were changed from to Phosphoserine phosphatase deficiency MIM#614023 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6721 | PSPH | Ain Roesley Publications for gene: PSPH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6721 | PSPH | Ain Roesley Mode of inheritance for gene: PSPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6720 | PSPH | Ain Roesley reviewed gene: PSPH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Phosphoserine phosphatase deficiency MIM#614023; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6720 | PRPS1 | Ain Roesley Phenotypes for gene: PRPS1 were changed from PRPS1 deficiency disorder MONDO:0100061 to PRPS1 deficiency disorder MONDO:0100061 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6720 | PRPS1 | Ain Roesley Publications for gene: PRPS1 were set to 24961627 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6719 | PRPS1 | Ain Roesley Marked gene: PRPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6719 | PRPS1 | Ain Roesley Gene: prps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6719 | PRPS1 | Ain Roesley Phenotypes for gene: PRPS1 were changed from to PRPS1 deficiency disorder MONDO:0100061 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6719 | PRPS1 | Ain Roesley Publications for gene: PRPS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6719 | PRPS1 | Ain Roesley Mode of inheritance for gene: PRPS1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6718 | PRPS1 | Ain Roesley reviewed gene: PRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24961627; Phenotypes: PRPS1 deficiency disorder MONDO:0100061; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6718 | PRODH | Ain Roesley Mode of inheritance for gene: PRODH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6718 | PRODH | Ain Roesley Marked gene: PRODH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6718 | PRODH | Ain Roesley Gene: prodh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6718 | PRODH | Ain Roesley Mode of inheritance for gene: PRODH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6718 | PRODH | Ain Roesley Publications for gene: PRODH were set to 17412540; 12217952 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6717 | PRODH | Ain Roesley Mode of inheritance for gene: PRODH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6717 | PRODH | Ain Roesley Publications for gene: PRODH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6717 | PRODH | Ain Roesley Phenotypes for gene: PRODH were changed from to Hyperprolinemia, type I MIM#239500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6716 | PRODH | Ain Roesley reviewed gene: PRODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 17412540, 12217952; Phenotypes: Hyperprolinemia, type I MIM#239500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6716 | PPT1 | Ain Roesley Phenotypes for gene: PPT1 were changed from Ceroid lipofuscinosis, neuronal, 1 MIM#256730 to Ceroid lipofuscinosis, neuronal, 1 MIM#256730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6716 | PPT1 | Ain Roesley Mode of inheritance for gene: PPT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6715 | PPT1 | Ain Roesley Marked gene: PPT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6715 | PPT1 | Ain Roesley Gene: ppt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6715 | PPT1 | Ain Roesley Phenotypes for gene: PPT1 were changed from to Ceroid lipofuscinosis, neuronal, 1 MIM#256730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6715 | PPT1 | Ain Roesley Mode of inheritance for gene: PPT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6715 | PPT1 | Ain Roesley Publications for gene: PPT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6714 | PPT1 | Ain Roesley reviewed gene: PPT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7637805, 9425237, 9664077; Phenotypes: Ceroid lipofuscinosis, neuronal, 1 MIM#256730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6714 | FTSJ1 | Zornitza Stark Marked gene: FTSJ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6714 | FTSJ1 | Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6714 | FTSJ1 | Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Intellectual developmental disorder, X-linked 9, MIM# 309549 to Intellectual developmental disorder, X-linked 9, MIM# 309549; X-linked complex neurodevelopmental disorder MONDO:0100148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6713 | FTSJ1 | Zornitza Stark Phenotypes for gene: FTSJ1 were changed from to Intellectual developmental disorder, X-linked 9, MIM# 309549 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6712 | FTSJ1 | Zornitza Stark Publications for gene: FTSJ1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6711 | FTSJ1 | Zornitza Stark Mode of inheritance for gene: FTSJ1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6710 | PPP3CA | Ain Roesley Marked gene: PPP3CA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6710 | PPP3CA | Ain Roesley Gene: ppp3ca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6710 | PPP3CA | Ain Roesley Publications for gene: PPP3CA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6710 | PPP3CA | Ain Roesley Phenotypes for gene: PPP3CA were changed from to Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265; Developmental and epileptic encephalopathy 91 MIM617711 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6710 | PPP3CA | Ain Roesley Mode of inheritance for gene: PPP3CA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6709 | PPP3CA | Ain Roesley reviewed gene: PPP3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 29432562, 32593294; Phenotypes: Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265, Developmental and epileptic encephalopathy 91 MIM617711; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6709 | POMT2 | Ain Roesley Marked gene: POMT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6709 | POMT2 | Ain Roesley Gene: pomt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6709 | POMT2 | Ain Roesley Phenotypes for gene: POMT2 were changed from myopathy caused by variation in POMT2 MONDO:0700071 to myopathy caused by variation in POMT2 MONDO:0700071 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6708 | POMT2 | Ain Roesley Phenotypes for gene: POMT2 were changed from to myopathy caused by variation in POMT2 MONDO:0700071 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6708 | POMT2 | Ain Roesley Mode of inheritance for gene: POMT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6707 | POMT1 | Ain Roesley Marked gene: POMT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6707 | POMT1 | Ain Roesley Gene: pomt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6707 | POMT2 | Ain Roesley reviewed gene: POMT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT2 MONDO:0700071; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6707 | POMT1 | Ain Roesley Phenotypes for gene: POMT1 were changed from to myopathy caused by variation in POMT1 MONDO:0700070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6707 | POMT1 | Ain Roesley Mode of inheritance for gene: POMT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6706 | POMT1 | Ain Roesley reviewed gene: POMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT1 MONDO:0700070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6706 | POMGNT2 | Ain Roesley Marked gene: POMGNT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6706 | POMGNT2 | Ain Roesley Gene: pomgnt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6706 | POMGNT2 | Ain Roesley Phenotypes for gene: POMGNT2 were changed from to myopathy caused by variation in POMGNT2 MONDO:0700069 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6706 | POMGNT2 | Ain Roesley Mode of inheritance for gene: POMGNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6705 | POMGNT2 | Ain Roesley reviewed gene: POMGNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT2 MONDO:0700069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6705 | POMGNT1 | Ain Roesley Marked gene: POMGNT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6705 | POMGNT1 | Ain Roesley Gene: pomgnt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6705 | POMGNT1 | Ain Roesley Phenotypes for gene: POMGNT1 were changed from myopathy caused by variation in POMGNT1 MONDO:0700068 to myopathy caused by variation in POMGNT1 MONDO:0700068 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6705 | POMGNT1 | Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6704 | POMGNT1 | Ain Roesley Phenotypes for gene: POMGNT1 were changed from myopathy caused by variation in POMGNT1 MONDO:0700068 to myopathy caused by variation in POMGNT1 MONDO:0700068 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6704 | POMGNT1 | Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6704 | POMGNT1 | Ain Roesley Phenotypes for gene: POMGNT1 were changed from to myopathy caused by variation in POMGNT1 MONDO:0700068 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6704 | POMGNT1 | Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6703 | POMGNT1 |
Ain Roesley changed review comment from: DD/ID is a feature the following has been lumped by clingen as one entity Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280 Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151 Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157; to: DD/ID is a feature the following has been lumped by clingen as one entity Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280 Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151 Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157 https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_03bb8479-2ed3-4b15-9e54-378ea0729ab2-2024-08-14T190000.000Z?page=1&size=25&search= |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6703 | POMGNT1 | Ain Roesley reviewed gene: POMGNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT1 MONDO:0700068; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6703 | POLR3B | Ain Roesley Marked gene: POLR3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6703 | POLR3B | Ain Roesley Gene: polr3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6703 | POLR3B | Ain Roesley Mode of inheritance for gene: POLR3B was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6702 | POLR3B | Ain Roesley Mode of inheritance for gene: POLR3B was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6702 | POLR3K | Ain Roesley Marked gene: POLR3K as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6702 | POLR3K | Ain Roesley Gene: polr3k has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6702 | POLR3B | Ain Roesley Phenotypes for gene: POLR3B were changed from to POLR3B-related disorder MONDO:0700277; Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742; Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6702 | POLR3B | Ain Roesley Publications for gene: POLR3B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6701 | POLR3B | Ain Roesley reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33417887; Phenotypes: POLR3B-related disorder MONDO:0700277, Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742, Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6701 | POLR3A | Ain Roesley Marked gene: POLR3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6701 | POLR3A | Ain Roesley Gene: polr3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6701 | POLR3A | Ain Roesley Phenotypes for gene: POLR3A were changed from POLR3A-related disorder MONDO:0700276 to POLR3A-related disorder MONDO:0700276 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6700 | POLR3A | Ain Roesley Phenotypes for gene: POLR3A were changed from to POLR3A-related disorder MONDO:0700276 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6700 | POLR3A | Ain Roesley Mode of inheritance for gene: POLR3A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6699 | POLR3A | Ain Roesley reviewed gene: POLR3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: POLR3A-related disorder MONDO:0700276; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6699 | POLG | Ain Roesley Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6699 | POLG | Ain Roesley Marked gene: POLG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6699 | POLG | Ain Roesley Gene: polg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6699 | POLG | Ain Roesley Publications for gene: POLG were set to 20301791 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6698 | POLG | Ain Roesley Publications for gene: POLG were set to 20301791 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6698 | POLG | Ain Roesley Publications for gene: POLG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6698 | POLG | Ain Roesley Phenotypes for gene: POLG were changed from to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6698 | POLG | Ain Roesley Mode of inheritance for gene: POLG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6697 | POLG | Ain Roesley reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301791; Phenotypes: Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700, Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662, Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459, Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450, Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6697 | PNPLA6 | Ain Roesley Publications for gene: PNPLA6 were set to 25299038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6697 | PNPLA6 | Ain Roesley Phenotypes for gene: PNPLA6 were changed from retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6697 | PNPLA6 | Ain Roesley Phenotypes for gene: PNPLA6 were changed from retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Mode of inheritance for gene: PNPLA6 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Marked gene: PNPLA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Gene: pnpla6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Phenotypes for gene: PNPLA6 were changed from to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Publications for gene: PNPLA6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Mode of inheritance for gene: PNPLA6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PNPLA6 | Ain Roesley reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25299038; Phenotypes: retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Publications for gene: PMM2 were set to 20301289 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Phenotypes for gene: PMM2 were changed from Congenital disorder of glycosylation, type Ia MIM#212065 to Congenital disorder of glycosylation, type Ia MIM#212065 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Phenotypes for gene: PMM2 were changed from Congenital disorder of glycosylation, type Ia MIM#212065 to Congenital disorder of glycosylation, type Ia MIM#212065 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Marked gene: PMM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Gene: pmm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6694 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6694 | PMM2 | Ain Roesley Phenotypes for gene: PMM2 were changed from to Congenital disorder of glycosylation, type Ia MIM#212065 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6694 | PMM2 | Ain Roesley Publications for gene: PMM2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6693 | PLA2G6 | Ain Roesley Phenotypes for gene: PLA2G6 were changed from Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217 to Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6693 | PLA2G6 | Ain Roesley Publications for gene: PLA2G6 were set to 20301718 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6692 | PLA2G6 | Ain Roesley Marked gene: PLA2G6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6692 | PLA2G6 | Ain Roesley Gene: pla2g6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6692 | PLA2G6 | Ain Roesley Phenotypes for gene: PLA2G6 were changed from to Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6692 | PMM2 | Ain Roesley reviewed gene: PMM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301289; Phenotypes: Congenital disorder of glycosylation, type Ia MIM#212065; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6692 | PLA2G6 | Ain Roesley Publications for gene: PLA2G6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6692 | PLA2G6 | Ain Roesley Mode of inheritance for gene: PLA2G6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6691 | PLA2G6 | Ain Roesley reviewed gene: PLA2G6: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301718; Phenotypes: nfantile neuroaxonal dystrophy 1 MIM#256600, Neurodegeneration with brain iron accumulation 2B MIM#610217; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6691 | PIK3CA | Ain Roesley Marked gene: PIK3CA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6691 | PIK3CA | Ain Roesley Gene: pik3ca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6691 | PIK3CA | Ain Roesley Phenotypes for gene: PIK3CA were changed from PIK3CA-related overgrowth spectrum MONDO:1040002 to PIK3CA-related overgrowth spectrum MONDO:1040002 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6691 | PIK3CA | Ain Roesley Publications for gene: PIK3CA were set to 23946963 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6691 | PIK3CA | Ain Roesley Phenotypes for gene: PIK3CA were changed from PIK3CA-related overgrowth spectrum MONDO:1040002 to PIK3CA-related overgrowth spectrum MONDO:1040002 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6690 | PIK3CA | Ain Roesley Phenotypes for gene: PIK3CA were changed from to PIK3CA-related overgrowth spectrum MONDO:1040002 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6690 | PIK3CA | Ain Roesley Publications for gene: PIK3CA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6690 | PIK3CA | Ain Roesley Mode of inheritance for gene: PIK3CA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6689 | PIK3CA | Ain Roesley reviewed gene: PIK3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 23946963; Phenotypes: PIK3CA-related overgrowth spectrum MONDO:1040002; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6689 | PHGDH | Ain Roesley Phenotypes for gene: PHGDH were changed from Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815 to Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6688 | PHGDH | Ain Roesley Marked gene: PHGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6688 | PHGDH | Ain Roesley Gene: phgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6689 | PHGDH | Ain Roesley Publications for gene: PHGDH were set to 37347880 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6688 | PHGDH | Ain Roesley Phenotypes for gene: PHGDH were changed from to Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6688 | PHGDH | Ain Roesley Publications for gene: PHGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6688 | PHGDH | Ain Roesley Mode of inheritance for gene: PHGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6687 | PHGDH | Ain Roesley reviewed gene: PHGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Neu-Laxova syndrome 1 MIM#256520, Phosphoglycerate dehydrogenase deficiency MIM#601815; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6687 | PEX7 | Ain Roesley Phenotypes for gene: PEX7 were changed from Peroxisome biogenesis disorder 9B MIM#614879; Rhizomelic chondrodysplasia punctata, type 1 MIM#215100 to Peroxisome biogenesis disorder 9B MIM#614879; Rhizomelic chondrodysplasia punctata, type 1 MIM#215100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6687 | PEX7 | Ain Roesley Publications for gene: PEX7 were set to 20301447 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6686 | PEX7 | Ain Roesley Marked gene: PEX7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6686 | PEX7 | Ain Roesley Gene: pex7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6686 | PEX7 | Ain Roesley Phenotypes for gene: PEX7 were changed from to Peroxisome biogenesis disorder 9B MIM#614879; Rhizomelic chondrodysplasia punctata, type 1 MIM#215100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6686 | PEX7 | Ain Roesley Publications for gene: PEX7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6686 | PEX7 | Ain Roesley Mode of inheritance for gene: PEX7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6685 | PEX7 | Ain Roesley reviewed gene: PEX7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301447; Phenotypes: Peroxisome biogenesis disorder 9B MIM#614879, Rhizomelic chondrodysplasia punctata, type 1 MIM#215100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6685 | PEX6 | Ain Roesley Marked gene: PEX6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6685 | PEX6 | Ain Roesley Gene: pex6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6685 | PEX6 | Ain Roesley Publications for gene: PEX6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6684 | PEX6 | Ain Roesley Phenotypes for gene: PEX6 were changed from to Peroxisome biogenesis disorder 4A (Zellweger) MIM#614862; Peroxisome biogenesis disorder 4B MIM#614863 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6684 | PEX6 | Ain Roesley edited their review of gene: PEX6: Changed publications: 29220678, 20301621 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6684 | PEX6 | Ain Roesley Mode of inheritance for gene: PEX6 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX6 | Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX6 | Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX5 | Ain Roesley Phenotypes for gene: PEX5 were changed from Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110; Peroxisome biogenesis disorder 2B MIM#202370 to Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110; Peroxisome biogenesis disorder 2B MIM#202370 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX5 | Ain Roesley Marked gene: PEX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX5 | Ain Roesley Gene: pex5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX6 | Ain Roesley reviewed gene: PEX6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Peroxisome biogenesis disorder 4A (Zellweger) MIM#614862, Peroxisome biogenesis disorder 4B MIM#614863; Mode of inheritance: None; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX5 | Ain Roesley Mode of inheritance for gene: PEX5 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6683 | PEX5 | Ain Roesley Publications for gene: PEX5 were set to 20301621 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6682 | PEX5 | Ain Roesley Publications for gene: PEX5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6682 | PEX5 | Ain Roesley Phenotypes for gene: PEX5 were changed from to Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110; Peroxisome biogenesis disorder 2B MIM#202370 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6682 | PEX5 | Ain Roesley Mode of inheritance for gene: PEX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6682 | PEX3 | Ain Roesley Marked gene: PEX3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6682 | PEX3 | Ain Roesley Gene: pex3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6682 | PEX3 | Ain Roesley Phenotypes for gene: PEX3 were changed from Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882; Peroxisome biogenesis disorder 10B , MIM# 617370 to Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882; Peroxisome biogenesis disorder 10B , MIM# 617370 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6681 | PEX3 | Ain Roesley Phenotypes for gene: PEX3 were changed from to Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882; Peroxisome biogenesis disorder 10B , MIM# 617370 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6681 | PEX5 | Ain Roesley reviewed gene: PEX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110, Peroxisome biogenesis disorder 2B MIM#202370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6681 | PEX3 | Ain Roesley Publications for gene: PEX3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6681 | PEX3 | Ain Roesley Mode of inheritance for gene: PEX3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6680 | PEX26 | Ain Roesley Marked gene: PEX26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6680 | PEX26 | Ain Roesley Gene: pex26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6680 | PEX3 | Ain Roesley reviewed gene: PEX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10942428, 10958759, 10968777, 27557811, 33101983, 20301621; Phenotypes: Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882, Peroxisome biogenesis disorder 10B , MIM# 617370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6680 | PEX26 | Ain Roesley Phenotypes for gene: PEX26 were changed from Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872; Peroxisome biogenesis disorder 7B MIM614873 to Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872; Peroxisome biogenesis disorder 7B MIM614873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6679 | PEX26 | Ain Roesley Phenotypes for gene: PEX26 were changed from to Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872; Peroxisome biogenesis disorder 7B MIM614873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6679 | PEX26 | Ain Roesley Mode of inheritance for gene: PEX26 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6679 | PEX26 | Ain Roesley Publications for gene: PEX26 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6678 | PEX2 | Ain Roesley Phenotypes for gene: PEX2 were changed from Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866; Peroxisome biogenesis disorder 5B MIM#614867 to Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866; Peroxisome biogenesis disorder 5B MIM#614867 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6678 | PEX26 | Ain Roesley Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6678 | PEX2 | Ain Roesley Marked gene: PEX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6678 | PEX2 | Ain Roesley Gene: pex2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6678 | PEX2 | Ain Roesley Publications for gene: PEX2 were set to 20301621 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6677 | PEX26 | Ain Roesley commented on gene: PEX26: ID/DD is part of the Zellweger spectrum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6677 | PEX2 | Ain Roesley Phenotypes for gene: PEX2 were changed from to Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866; Peroxisome biogenesis disorder 5B MIM#614867 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6677 | PEX2 | Ain Roesley Publications for gene: PEX2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6677 | PEX26 | Ain Roesley reviewed gene: PEX26: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872, Peroxisome biogenesis disorder 7B MIM614873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6677 | PEX2 | Ain Roesley Mode of inheritance for gene: PEX2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6677 | PEX2 | Ain Roesley Mode of inheritance for gene: PEX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6676 | PEX2 | Ain Roesley changed review comment from: Few individuals reported with variants in PEX19 however,; to: ID/DD is part of the Zellweger spectrum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6676 | PEX2 | Ain Roesley commented on gene: PEX2: Few individuals reported with variants in PEX19 however, | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6676 | PEX2 | Ain Roesley reviewed gene: PEX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866, Peroxisome biogenesis disorder 5B MIM#614867; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6676 | PEX19 | Ain Roesley Marked gene: PEX19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6676 | PEX19 | Ain Roesley Gene: pex19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6676 | PEX19 | Ain Roesley Phenotypes for gene: PEX19 were changed from Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886 to Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6675 | PEX19 | Ain Roesley Phenotypes for gene: PEX19 were changed from to Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6675 | PEX19 | Ain Roesley Publications for gene: PEX19 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6675 | PEX19 | Ain Roesley Mode of inheritance for gene: PEX19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6674 | PEX19 | Ain Roesley reviewed gene: PEX19: Rating: GREEN; Mode of pathogenicity: None; Publications: 10051604, 20683989, 11883941, 28391327; Phenotypes: Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6674 | PEX16 | Ain Roesley Mode of inheritance for gene: PEX16 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6673 | PEX16 | Ain Roesley Marked gene: PEX16 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6673 | PEX16 | Ain Roesley Gene: pex16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6673 | PEX16 | Ain Roesley Mode of inheritance for gene: PEX16 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6673 | PEX16 | Ain Roesley Publications for gene: PEX16 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6673 | PEX16 | Ain Roesley Phenotypes for gene: PEX16 were changed from to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876; Peroxisome biogenesis disorder 8B MIM#614877 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6672 | PEX16 | Ain Roesley edited their review of gene: PEX16: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6672 | PEX14 | Ain Roesley Publications for gene: PEX14 were set to 37493040; 20301621 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6672 | PEX16 | Ain Roesley reviewed gene: PEX16: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876, Peroxisome biogenesis disorder 8B MIM#614877; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6672 | PEX14 | Ain Roesley Phenotypes for gene: PEX14 were changed from Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887; peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268 to Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887; peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6671 | PEX14 | Ain Roesley Phenotypes for gene: PEX14 were changed from to Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887; peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6671 | PEX14 | Ain Roesley Publications for gene: PEX14 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6671 | PEX14 | Ain Roesley Mode of inheritance for gene: PEX14 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6670 | PEX14 | Ain Roesley reviewed gene: PEX14: Rating: GREEN; Mode of pathogenicity: None; Publications: 37493040, 20301621; Phenotypes: Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887, peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6670 | PEX13 | Ain Roesley Mode of inheritance for gene: PEX13 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6669 | PEX13 | Ain Roesley Marked gene: PEX13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6669 | PEX13 | Ain Roesley Gene: pex13 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6669 | PEX13 | Ain Roesley Mode of inheritance for gene: PEX13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6669 | PEX13 | Ain Roesley Publications for gene: PEX13 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6669 | PEX13 | Ain Roesley Phenotypes for gene: PEX13 were changed from to Peroxisome biogenesis disorder 11A (Zellweger) MIM#614883; Peroxisome biogenesis disorder 11B MIM#614885 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6668 | PEX13 | Ain Roesley reviewed gene: PEX13: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 11A (Zellweger) MIM#614883, Peroxisome biogenesis disorder 11B MIM#614885; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6668 | PEX12 | Ain Roesley Phenotypes for gene: PEX12 were changed from Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510 to Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6668 | PEX12 | Ain Roesley Marked gene: PEX12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6668 | PEX12 | Ain Roesley Gene: pex12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6668 | PEX12 | Ain Roesley Phenotypes for gene: PEX12 were changed from Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510 to Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6667 | PEX12 | Ain Roesley Phenotypes for gene: PEX12 were changed from to Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6667 | PEX12 | Ain Roesley Publications for gene: PEX12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6667 | PEX12 | Ain Roesley Mode of inheritance for gene: PEX12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6666 | PEX12 | Ain Roesley reviewed gene: PEX12: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859, Peroxisome biogenesis disorder 3B MIM#266510; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6666 | TSHZ3 | Bryony Thompson Marked gene: TSHZ3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6666 | TSHZ3 | Bryony Thompson Gene: tshz3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6666 | TSHZ3 | Bryony Thompson Classified gene: TSHZ3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6666 | TSHZ3 | Bryony Thompson Gene: tshz3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6666 | TSHZ3 | Bryony Thompson Classified gene: TSHZ3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6666 | TSHZ3 | Bryony Thompson Gene: tshz3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6665 | TSHZ3 |
Bryony Thompson gene: TSHZ3 was added gene: TSHZ3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TSHZ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TSHZ3 were set to 27668656; 34919690; 36553458; 39420202 Phenotypes for gene: TSHZ3 were set to congenital anomaly of kidney and urinary tract MONDO:0019719 Review for gene: TSHZ3 was set to AMBER Added comment: More evidence for the gene-disease association is required PMID: 27668656 - TSHZ3 is included in the region deleted in chromosome 19q13.11 Deletion Syndrome, which includes intellectual disability and behavioural issues, congenital anomalies of the kidney and urinary tract (CAKUT) PMID: 34919690 - haploinsufficient mouse model leads to kidney defects PMID: 36553458 - heterozygous frameshift variant c.119_120dup p.Pro41SerfsTer79 in a case with intellectual disability, behavioural issues, pyelocaliceal dilatation, and mild urethral stenosis. PMID: 39420202 - 12 CAKUT patients from 9/301 (3%) families carried 5 different rare heterozygous TSHZ3 missense variants. However, 1 of the variants (p.Ser58Gly) present in 5 of the families is more common in gnomAD v4.1 than you would expect for a dominant disease including 5 homozygotes (1,408/1,612,114 alleles, 5 hom, AF=0.0008734). The authors state this is not unexpected in a condition, such as CAKUT. However, the different missense variants are inherited from unaffected parents in at least 2/9 families (there was no phenotype information available for an additional 3 parents). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6664 | WDR83OS | Bryony Thompson Marked gene: WDR83OS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6664 | WDR83OS | Bryony Thompson Gene: wdr83os has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6664 | WDR83OS | Bryony Thompson Classified gene: WDR83OS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6664 | WDR83OS | Bryony Thompson Gene: wdr83os has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6663 | WDR83OS |
Bryony Thompson gene: WDR83OS was added gene: WDR83OS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR83OS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR83OS were set to 39471804; 30250217 Phenotypes for gene: WDR83OS were set to complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia Review for gene: WDR83OS was set to GREEN Added comment: Now 14 cases from 9 unrelated families with homozygous LoF variants, including the family reported in 2019. Consistent clinical features include NDD (14/14), facial dysmorphism (13/14), intractable itching (9/14), and elevated bile acids (5/6). Also, supporting null zebrafish model that recapitulates the human phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6662 | GON4L | Bryony Thompson Marked gene: GON4L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6662 | GON4L | Bryony Thompson Gene: gon4l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6662 | GON4L | Bryony Thompson Classified gene: GON4L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6662 | GON4L | Bryony Thompson Gene: gon4l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6661 | GON4L |
Bryony Thompson gene: GON4L was added gene: GON4L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GON4L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GON4L were set to 39500882; 21937992 Phenotypes for gene: GON4L were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: GON4L was set to GREEN Added comment: 2 LoF variants in 4 cases from 3 unrelated consanguineous families, and supporting null zebrafish model PMID: 39500882 - 2 homozygous truncating GON4L variants [NM_001282860.2: c.62_63del, p.(Gln21Argfs*12) and c.5517+1G>A] in 3 patients from 2 consanguineous families with prenatal-onset growth impairment, developmental delay, mild intellectual disability, speech impairment, progressive and disproportionate microcephaly, facial asymmetry, congenital heart anomaly, and brain structure abnormalities. Null zebrafish model had distinct morphological and size abnormalities in the craniofacial cartilage of zebrafish larvae Heterozygous carriers in biallelic families were unaffected PMID: 21937992 - a case from Iran from a consanguineous family homozygous for c.5517+1G>A with syndromic ID. No other clinical details provided Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6660 | SGSM3 | Zornitza Stark Publications for gene: SGSM3 were set to PMID: 37833060 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6659 | SGSM3 | Zornitza Stark Classified gene: SGSM3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6659 | SGSM3 | Zornitza Stark Gene: sgsm3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6658 | UBTF | Zornitza Stark Phenotypes for gene: UBTF were changed from Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701 to Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701; Neurodevelopmental disorder, MONDO:0700092, UBTF-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6657 | UBTF | Zornitza Stark Publications for gene: UBTF were set to 28777933; 29300972 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6656 | MARK2 | Zornitza Stark Marked gene: MARK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6656 | MARK2 | Zornitza Stark Gene: mark2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6656 | BHLHE22 | Zornitza Stark Classified gene: BHLHE22 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6656 | BHLHE22 | Zornitza Stark Gene: bhlhe22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6655 | BHLHE22 | Zornitza Stark Marked gene: BHLHE22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6655 | BHLHE22 | Zornitza Stark Gene: bhlhe22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6655 | BHLHE22 | Zornitza Stark Classified gene: BHLHE22 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6655 | BHLHE22 | Zornitza Stark Gene: bhlhe22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6654 | BHLHE22 |
Zornitza Stark gene: BHLHE22 was added gene: BHLHE22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BHLHE22 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: BHLHE22 were set to 39502664 Phenotypes for gene: BHLHE22 were set to Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related Review for gene: BHLHE22 was set to GREEN Added comment: Four individuals with de novo missense variants within the highly conserved helix-loop-helix domain and seven individuals from five unrelated families with a recurrent homozygous frameshift variant, p.(Gly74Alafs*18). Individuals presented with absent or limited speech, severely impaired motor abilities, intellectual disability (ID), involuntary movements, autistic traits with stereotypies, abnormal muscle tone. The majority of individuals had partial or complete agenesis of the corpus callosum (ACC). Additional symptoms comprised epilepsy, variable dysmorphic features, and eye anomalies. One additional individual had spastic paraplegia without delayed development and ACC, expanding the phenotype to milder and later onset forms. Mice lacking bhlhe22 show nearly complete loss of three brain comminsure, including the corpus callosum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6653 | MRPL49 | Zornitza Stark Marked gene: MRPL49 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6653 | MRPL49 | Zornitza Stark Gene: mrpl49 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6653 | MRPL49 | Zornitza Stark Classified gene: MRPL49 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6653 | MRPL49 | Zornitza Stark Gene: mrpl49 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6652 | MRPL49 |
Zornitza Stark gene: MRPL49 was added gene: MRPL49 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRPL49 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPL49 were set to 39417135 Phenotypes for gene: MRPL49 were set to Mitochondrial disease, MONDO:0044970, MRPL49-related Review for gene: MRPL49 was set to GREEN Added comment: Five unrelated families with presentations ranging from Perrault syndrome (primary ovarian insufficiency and sensorineural hearing loss) to severe childhood onset of leukodystrophy, learning disability, microcephaly and retinal dystrophy and bi-allelic variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6651 | SATB1 | Sangavi Sivagnanasundram reviewed gene: SATB1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008481; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6651 | PEX11B | Ain Roesley Marked gene: PEX11B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6651 | PEX11B | Ain Roesley Gene: pex11b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6651 | PEX11B | Ain Roesley Publications for gene: PEX11B were set to 28129423; 22581968 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6650 | PEX11B | Ain Roesley Phenotypes for gene: PEX11B were changed from to Peroxisome biogenesis disorder 14B MIM#614920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6649 | PEX11B | Ain Roesley Publications for gene: PEX11B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6648 | PEX11B | Ain Roesley Mode of inheritance for gene: PEX11B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6647 | PEX11B | Ain Roesley reviewed gene: PEX11B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28129423, 22581968; Phenotypes: Peroxisome biogenesis disorder 14B MIM#614920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6647 | PEX10 | Ain Roesley Marked gene: PEX10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6647 | PEX10 | Ain Roesley Gene: pex10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6647 | PEX10 | Ain Roesley Publications for gene: PEX10 were set to 20301621 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6647 | PEX10 | Ain Roesley Phenotypes for gene: PEX10 were changed from to Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870; Peroxisome biogenesis disorder 6B MIM#614871 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6646 | PEX10 | Ain Roesley Publications for gene: PEX10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6646 | PEX10 | Ain Roesley Mode of inheritance for gene: PEX10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6645 | PEX10 | Ain Roesley reviewed gene: PEX10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870, Peroxisome biogenesis disorder 6B MIM#614871; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6645 | PEX1 | Ain Roesley Marked gene: PEX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6645 | PEX1 | Ain Roesley Gene: pex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6645 | PEX1 | Ain Roesley Publications for gene: PEX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6645 | PEX1 | Ain Roesley Phenotypes for gene: PEX1 were changed from to Heimler syndrome 1 MIM#234580; Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100; Peroxisome biogenesis disorder 1B (NALD/IRD) MIM#601539 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6645 | PEX1 | Ain Roesley Mode of inheritance for gene: PEX1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6644 | PEX1 | Ain Roesley edited their review of gene: PEX1: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6644 | PEX1 | Ain Roesley reviewed gene: PEX1: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Heimler syndrome 1 MIM#234580, Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100, Peroxisome biogenesis disorder 1B (NALD/IRD) MIM#601539; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6644 | PEPD | Ain Roesley Publications for gene: PEPD were set to 26110198; 32455636 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6644 | PEPD | Ain Roesley Phenotypes for gene: PEPD were changed from Prolidase deficiency MIM#170100 to Prolidase deficiency MIM#170100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6643 | PEPD | Ain Roesley Marked gene: PEPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6643 | PEPD | Ain Roesley Gene: pepd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6643 | PEPD | Ain Roesley Phenotypes for gene: PEPD were changed from to Prolidase deficiency MIM#170100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6643 | PEPD | Ain Roesley Publications for gene: PEPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6643 | PEPD | Ain Roesley Mode of inheritance for gene: PEPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6642 | PEPD | Ain Roesley reviewed gene: PEPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26110198, 32455636; Phenotypes: Prolidase deficiency MIM#170100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6642 | PDSS2 | Ain Roesley Phenotypes for gene: PDSS2 were changed from Coenzyme Q10 deficiency, primary, 3 MIM#614652 to Coenzyme Q10 deficiency, primary, 3 MIM#614652 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6641 | PDSS2 | Ain Roesley Marked gene: PDSS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6641 | PDSS2 | Ain Roesley Gene: pdss2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6641 | PDSS2 | Ain Roesley Phenotypes for gene: PDSS2 were changed from Coenzyme Q10 deficiency, primary, 3 MIM#614652 to Coenzyme Q10 deficiency, primary, 3 MIM#614652 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6640 | PDSS2 | Ain Roesley Phenotypes for gene: PDSS2 were changed from to Coenzyme Q10 deficiency, primary, 3 MIM#614652 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6640 | PDSS2 | Ain Roesley Publications for gene: PDSS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6639 | PDSS2 | Ain Roesley Mode of inheritance for gene: PDSS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6639 | PDSS2 | Ain Roesley Classified gene: PDSS2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6639 | PDSS2 | Ain Roesley Gene: pdss2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6638 | PDSS2 | Ain Roesley reviewed gene: PDSS2: Rating: RED; Mode of pathogenicity: None; Publications: 28125198, 29032433, 25349199, 17186472, 21723727, 10972372; Phenotypes: Coenzyme Q10 deficiency, primary, 3 MIM#614652; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6638 | PDHX | Ain Roesley Phenotypes for gene: PDHX were changed from Lacticacidemia due to PDX1 deficiency MIM#245349 to Lacticacidemia due to PDX1 deficiency MIM#245349 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6638 | PDHX | Ain Roesley Marked gene: PDHX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6638 | PDHX | Ain Roesley Gene: pdhx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6638 | PDHX | Ain Roesley Phenotypes for gene: PDHX were changed from Lacticacidemia due to PDX1 deficiency MIM#245349 to Lacticacidemia due to PDX1 deficiency MIM#245349 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6638 | PDHX | Ain Roesley Phenotypes for gene: PDHX were changed from to Lacticacidemia due to PDX1 deficiency MIM#245349 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6637 | PDHX | Ain Roesley Publications for gene: PDHX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6637 | PDHX | Ain Roesley Mode of inheritance for gene: PDHX was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6636 | PDHX | Ain Roesley reviewed gene: PDHX: Rating: GREEN; Mode of pathogenicity: None; Publications: 34138529; Phenotypes: Lacticacidemia due to PDX1 deficiency MIM#245349; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6636 | PDHA1 | Ain Roesley Publications for gene: PDHA1 were set to 23021068 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6636 | PDHA1 | Ain Roesley Marked gene: PDHA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6636 | PDHA1 | Ain Roesley Gene: pdha1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6636 | PDHA1 | Ain Roesley Phenotypes for gene: PDHA1 were changed from Pyruvate dehydrogenase E1-alpha deficiency MIM#312170 to Pyruvate dehydrogenase E1-alpha deficiency MIM#312170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6635 | PDHA1 | Ain Roesley Phenotypes for gene: PDHA1 were changed from to Pyruvate dehydrogenase E1-alpha deficiency MIM#312170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6635 | PDHA1 | Ain Roesley Publications for gene: PDHA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6635 | PDHA1 | Ain Roesley Mode of inheritance for gene: PDHA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6634 | PDHA1 |
Ain Roesley changed review comment from: In subjects surviving past 6 months, a broad range of intellectual outcomes was observed.; to: ID is a feature of this condition. PMID:23021068 "In subjects surviving past 6 months, a broad range of intellectual outcomes was observed." |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6634 | PDHA1 | Ain Roesley reviewed gene: PDHA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23021068; Phenotypes: Pyruvate dehydrogenase E1-alpha deficiency MIM#312170; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6634 | MED16 | Zornitza Stark Marked gene: MED16 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6634 | MED16 | Zornitza Stark Gene: med16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6634 | PDGFRB | Ain Roesley Publications for gene: PDGFRB were set to 31710779; 35221873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6634 | PDGFRB | Ain Roesley Phenotypes for gene: PDGFRB were changed from Kosaki overgrowth syndrome MIM#616592 to Kosaki overgrowth syndrome MIM#616592 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6633 | PDGFRB | Ain Roesley Publications for gene: PDGFRB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6633 | PDGFRB | Ain Roesley Phenotypes for gene: PDGFRB were changed from to Kosaki overgrowth syndrome MIM#616592 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6633 | PDGFRB | Ain Roesley Mode of inheritance for gene: PDGFRB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6632 | PDGFRB | Ain Roesley Marked gene: PDGFRB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6632 | PDGFRB | Ain Roesley Gene: pdgfrb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6632 | PDGFRB | Ain Roesley reviewed gene: PDGFRB: Rating: GREEN; Mode of pathogenicity: None; Publications: 31710779, 35221873; Phenotypes: Kosaki overgrowth syndrome MIM#616592; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6632 | PCNT | Ain Roesley reviewed gene: PCNT: Rating: AMBER; Mode of pathogenicity: None; Publications: 34978779; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II MIM#210720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6632 | PCCA | Ain Roesley Mode of inheritance for gene: PCCA was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6631 | PCCA | Ain Roesley Mode of inheritance for gene: PCCA was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6632 | PCCB | Ain Roesley Mode of inheritance for gene: PCCB was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6632 | PCCB | Ain Roesley Publications for gene: PCCB were set to 22593918 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6631 | PCCB | Ain Roesley Publications for gene: PCCB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6631 | PCCA | Ain Roesley Publications for gene: PCCA were set to 22593918 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6631 | PCCA | Ain Roesley Mode of inheritance for gene: PCCA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6631 | PCCB | Ain Roesley Phenotypes for gene: PCCB were changed from Propionicacidemia MIM#606054 to Propionicacidemia MIM#606054 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6631 | PCCB | Ain Roesley Phenotypes for gene: PCCB were changed from to Propionicacidemia MIM#606054 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCCB | Ain Roesley Mode of inheritance for gene: PCCB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6631 | PCDH19 | Ain Roesley Publications for gene: PCDH19 were set to 28669061 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCCA | Ain Roesley Publications for gene: PCCA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCDH19 | Ain Roesley Marked gene: PCDH19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCDH19 | Ain Roesley Gene: pcdh19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCCA | Ain Roesley Phenotypes for gene: PCCA were changed from to Propionicacidemia MIM#606054 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCDH19 | Ain Roesley Phenotypes for gene: PCDH19 were changed from to Developmental and epileptic encephalopathy 9 MIM#300088 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCDH19 | Ain Roesley Publications for gene: PCDH19 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6630 | PCDH19 | Ain Roesley Mode of inheritance for gene: PCDH19 was changed from Unknown to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6629 | PCDH19 | Ain Roesley reviewed gene: PCDH19: Rating: GREEN; Mode of pathogenicity: None; Publications: 28669061; Phenotypes: Developmental and epileptic encephalopathy 9 MIM#300088; Mode of inheritance: Other; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6629 | PCCB | Ain Roesley Marked gene: PCCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6629 | PCCB | Ain Roesley Gene: pccb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6629 | PCCB | Ain Roesley reviewed gene: PCCB: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6629 | MARK2 | Chirag Patel Classified gene: MARK2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6629 | MARK2 | Chirag Patel Gene: mark2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6628 | PCCA | Ain Roesley Marked gene: PCCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6628 | PCCA | Ain Roesley Gene: pcca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6628 | PCCA | Ain Roesley reviewed gene: PCCA: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6628 | MARK2 |
Chirag Patel gene: MARK2 was added gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MARK2 were set to PMID: 39419027, 39436150 Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: MARK2 was set to GREEN Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears). WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains. The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6627 | UBTF | Chirag Patel reviewed gene: UBTF: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 39366741; Phenotypes: Global developmental delay without neuroregression; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6627 | SGSM3 | Sangavi Sivagnanasundram reviewed gene: SGSM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 39390489; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), SGSM3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6627 | LINC01578 | Zornitza Stark Tag SV/CNV tag was added to gene: LINC01578. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6627 | LINC01578 | Zornitza Stark Marked gene: LINC01578 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6627 | LINC01578 | Zornitza Stark Gene: linc01578 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6627 | LINC01578 | Zornitza Stark Classified gene: LINC01578 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6627 | LINC01578 | Zornitza Stark Gene: linc01578 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6626 | LINC01578 |
Zornitza Stark gene: LINC01578 was added gene: LINC01578 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: LINC01578. Mode of inheritance for gene: LINC01578 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LINC01578 were set to 39442041 Phenotypes for gene: LINC01578 were set to Neurodevelopmental disorder, MONDO:0700092, CHASERR-related Review for gene: LINC01578 was set to GREEN Added comment: CHASERR encodes a human long noncoding RNA (lncRNA) adjacent to CHD2, a coding gene in which de novo loss-of-function variants cause developmental and epileptic encephalopathy. Three unrelated children reported with a syndromic, early-onset neurodevelopmental disorder, each of whom had a de novo deletion in the CHASERR locus. The children had severe encephalopathy, shared facial dysmorphisms, cortical atrophy, and cerebral hypomyelination - a phenotype that is distinct from the phenotypes of patients with CHD2 haploinsufficiency. CHASERR deletion results in increased CHD2 protein abundance in patient-derived cell lines and increased expression of the CHD2 transcript in cis, indicating bidirectional dosage sensitivity in human disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6625 | RNU5B-1 | Zornitza Stark Marked gene: RNU5B-1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6625 | RNU5B-1 | Zornitza Stark Gene: rnu5b-1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6625 | RNU5B-1 | Zornitza Stark Phenotypes for gene: RNU5B-1 were changed from to Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6624 | RNU5B-1 | Zornitza Stark Classified gene: RNU5B-1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6624 | RNU5B-1 | Zornitza Stark Gene: rnu5b-1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6623 | RNU5B-1 | Zornitza Stark edited their review of gene: RNU5B-1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6623 | RNU5B-1 |
Zornitza Stark gene: RNU5B-1 was added gene: RNU5B-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU5B-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1 Review for gene: RNU5B-1 was set to GREEN Added comment: 20 individuals reported in two preprints with de novo variants in this gene and a neurodevelopmental phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6622 | MBOAT7 | Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6621 | MBOAT7 | Zornitza Stark reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6621 | SRPK3 | Zornitza Stark Phenotypes for gene: SRPK3 were changed from Neurodevelopmental disorder, MONDO:0700092, SRPK3-related to Intellectual developmental disorder, X-linked, 114, MIM#301134 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6620 | SRPK3 | Zornitza Stark edited their review of gene: SRPK3: Changed phenotypes: Intellectual developmental disorder, X-linked, 114, MIM#301134 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6620 | KCNJ11 | Zornitza Stark Phenotypes for gene: KCNJ11 were changed from to {Diabetes mellitus, type 2, susceptibility to} 125853; Diabetes mellitus, transient neonatal, 3 610582; Diabetes, permanent neonatal, with or without neurologic features 606176; Hyperinsulinemic hypoglycemia, familial, 2 601820; Maturity-onset diabetes of the young, type 13 616329 AD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6619 | KCNJ11 | Zornitza Stark Mode of inheritance for gene: KCNJ11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6618 | KCNJ11 | Zornitza Stark Marked gene: KCNJ11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6618 | KCNJ11 | Zornitza Stark Gene: kcnj11 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6618 | YAP1 | Zornitza Stark Marked gene: YAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6618 | YAP1 | Zornitza Stark Gene: yap1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6618 | YAP1 | Zornitza Stark Phenotypes for gene: YAP1 were changed from to Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation OMIM #120433 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6617 | YAP1 | Zornitza Stark Publications for gene: YAP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6616 | YAP1 | Zornitza Stark Mode of inheritance for gene: YAP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | TGFB1 | Zornitza Stark Marked gene: TGFB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | TGFB1 | Zornitza Stark Gene: tgfb1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | RSPRY1 | Zornitza Stark Marked gene: RSPRY1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | RSPRY1 | Zornitza Stark Gene: rspry1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | RAB1A | Zornitza Stark Marked gene: RAB1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | RAB1A | Zornitza Stark Gene: rab1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | NUP85 | Zornitza Stark Marked gene: NUP85 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | NUP85 | Zornitza Stark Gene: nup85 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | CACNB4 | Zornitza Stark Marked gene: CACNB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | CACNB4 | Zornitza Stark Gene: cacnb4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | AASS | Zornitza Stark Marked gene: AASS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | AASS | Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | SUOX | Zornitza Stark Marked gene: SUOX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | SUOX | Zornitza Stark Gene: suox has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6615 | SUOX | Zornitza Stark Phenotypes for gene: SUOX were changed from to isolated sulfite oxidase deficiency MONDO:0010089 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6614 | SUOX | Zornitza Stark Publications for gene: SUOX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6613 | SUOX | Zornitza Stark Mode of inheritance for gene: SUOX was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6612 | SPTBN2 | Zornitza Stark Marked gene: SPTBN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6612 | SPTBN2 | Zornitza Stark Gene: sptbn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6612 | SPTBN2 | Zornitza Stark Phenotypes for gene: SPTBN2 were changed from to Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386; Spinocerebellar ataxia 5, MIM# 600224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6611 | SPTBN2 | Zornitza Stark Publications for gene: SPTBN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6610 | SLC6A19 | Zornitza Stark Marked gene: SLC6A19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6610 | SLC6A19 | Zornitza Stark Gene: slc6a19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6610 | SLC6A19 | Zornitza Stark Phenotypes for gene: SLC6A19 were changed from to Hartnup disorder, MIM# 234500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6609 | SLC6A19 | Zornitza Stark Mode of inheritance for gene: SLC6A19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6608 | SLC6A19 | Zornitza Stark commented on gene: SLC6A19: Well established gene-disease association with several neurological manifestations, including DD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6608 | SLC6A19 | Zornitza Stark reviewed gene: SLC6A19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hartnup disorder, MIM# 234500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6608 | DHX9 | Zornitza Stark Phenotypes for gene: DHX9 were changed from Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 to Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6607 | DHX9 | Zornitza Stark Phenotypes for gene: DHX9 were changed from Neurodevelopmental disorder, MONDO:0700092, DHX9-related to Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6606 | DHX9 | Zornitza Stark edited their review of gene: DHX9: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6606 | ANKRD31 | Zornitza Stark Marked gene: ANKRD31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6606 | ANKRD31 | Zornitza Stark Gene: ankrd31 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6606 | ANKRD31 | Zornitza Stark Phenotypes for gene: ANKRD31 were changed from to Neurodevelopmental disorder, MONDO:0700092, ANKRD31-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6605 | ANKRD31 | Zornitza Stark Classified gene: ANKRD31 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6605 | ANKRD31 | Zornitza Stark Gene: ankrd31 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6604 | ANKRD31 |
Megan Ball gene: ANKRD31 was added gene: ANKRD31 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ANKRD31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKRD31 were set to 27541642 Review for gene: ANKRD31 was set to RED Added comment: 1 individual with Rett-like phenotype. De novo missense. C.196A>T, p.Ile66Phe. Onset of features at 3 years, delayed ambulation, epilepsy, developmental regression, stereotypies, non-verbal. 17 years old at time of publication. A C.elegans model of ANKRD31 with a deletion showed significantly defective locomotion and asymmetric dynamics of axonal and dendritic microtubule defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6604 | SLC35A2 | Zornitza Stark Marked gene: SLC35A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6604 | SLC35A2 | Zornitza Stark Gene: slc35a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6604 | SLC35A2 | Zornitza Stark Phenotypes for gene: SLC35A2 were changed from to Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854; Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6603 | SLC35A2 | Zornitza Stark Publications for gene: SLC35A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6602 | SLC35A2 | Zornitza Stark Mode of inheritance for gene: SLC35A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6601 | SLC35A2 | Zornitza Stark Tag somatic tag was added to gene: SLC35A2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6601 | SLC35A2 | Zornitza Stark reviewed gene: SLC35A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23561849, 24115232, 27743886, 25778940, 33407896; Phenotypes: Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854, Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6601 | SLC33A1 | Zornitza Stark Marked gene: SLC33A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6601 | SLC33A1 | Zornitza Stark Gene: slc33a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6601 | SLC33A1 | Zornitza Stark Phenotypes for gene: SLC33A1 were changed from to Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6601 | SLC33A1 | Zornitza Stark Publications for gene: SLC33A1 were set to 31194315 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6600 | SLC33A1 | Zornitza Stark Publications for gene: SLC33A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6599 | SLC33A1 | Zornitza Stark Mode of inheritance for gene: SLC33A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6598 | SLC33A1 | Zornitza Stark reviewed gene: SLC33A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31194315; Phenotypes: Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6598 | SLC2A1 | Zornitza Stark Marked gene: SLC2A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6598 | SLC2A1 | Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6598 | SLC2A1 | Zornitza Stark Phenotypes for gene: SLC2A1 were changed from to GLUT1-deficiency syndrome, MONDO:0000188; Dystonia 9 601042; GLUT1 deficiency syndrome 1, infantile onset, severe 606777; GLUT1 deficiency syndrome 2, childhood onset 612126; Stomatin-deficient cryohydrocytosis with neurologic defects 608885 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6597 | SLC2A1 | Zornitza Stark Publications for gene: SLC2A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6596 | SLC2A1 | Zornitza Stark Mode of inheritance for gene: SLC2A1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6595 | SLC2A1 | Zornitza Stark reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32913944; Phenotypes: GLUT1-deficiency syndrome, MONDO:0000188, Dystonia 9 601042, GLUT1 deficiency syndrome 1, infantile onset, severe 606777, GLUT1 deficiency syndrome 2, childhood onset 612126, Stomatin-deficient cryohydrocytosis with neurologic defects 608885; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6595 | SLC25A22 | Zornitza Stark Marked gene: SLC25A22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6595 | SLC25A22 | Zornitza Stark Gene: slc25a22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6595 | SLC25A22 | Zornitza Stark Phenotypes for gene: SLC25A22 were changed from to Developmental and epileptic encephalopathy 3, MIM# 609304 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6594 | SLC25A22 | Zornitza Stark Publications for gene: SLC25A22 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6593 | SLC25A22 | Zornitza Stark Mode of inheritance for gene: SLC25A22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6592 | SLC25A22 | Zornitza Stark reviewed gene: SLC25A22: Rating: GREEN; Mode of pathogenicity: None; Publications: 15592994, 19780765, 24596948, 33821742, 33342683, 31285529; Phenotypes: Developmental and epileptic encephalopathy 3, MIM# 609304; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6592 | ZRSR2 | Zornitza Stark Phenotypes for gene: ZRSR2 were changed from Orofacialdigital syndrome MONDO:0015375, ZRSR2-related to Orofaciodigital syndrome XXI, MIM# 301132 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6591 | ZRSR2 | Zornitza Stark reviewed gene: ZRSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Orofaciodigital syndrome XXI, MIM# 301132; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6591 | SLC25A12 | Zornitza Stark Marked gene: SLC25A12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6591 | SLC25A12 | Zornitza Stark Gene: slc25a12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6591 | SLC25A12 | Zornitza Stark Phenotypes for gene: SLC25A12 were changed from to Developmental and epileptic encephalopathy 39, MIM# 612949 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6590 | SLC25A12 | Zornitza Stark Publications for gene: SLC25A12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6589 | SLC25A12 | Zornitza Stark Mode of inheritance for gene: SLC25A12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6588 | SLC25A12 | Zornitza Stark reviewed gene: SLC25A12: Rating: GREEN; Mode of pathogenicity: None; Publications: 19641205, 24515575, 35008954, 32700846, 31766059, 31514314; Phenotypes: Developmental and epileptic encephalopathy 39, MIM# 612949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6588 | SLC17A5 | Zornitza Stark Marked gene: SLC17A5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6588 | SLC17A5 | Zornitza Stark Gene: slc17a5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6588 | SLC17A5 | Zornitza Stark Phenotypes for gene: SLC17A5 were changed from to Sialic acid storage disorder, infantile, MIM# 269920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6587 | SLC17A5 | Zornitza Stark Publications for gene: SLC17A5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6586 | SLC17A5 | Zornitza Stark Mode of inheritance for gene: SLC17A5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6585 | SLC17A5 | Zornitza Stark edited their review of gene: SLC17A5: Changed publications: 10581036, 10947946 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6585 | SLC17A5 | Zornitza Stark commented on gene: SLC17A5: Sialic acid storage diseases are autosomal recessive neurodegenerative disorders that may present as a severe infantile form, including DD/IDD or a slowly progressive adult form, which is prevalent in Finland and referred to as Salla disease. p.Arg39Cys is a founder Finnish variant. Multiple families reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6585 | SLC17A5 | Zornitza Stark reviewed gene: SLC17A5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sialic acid storage disorder, infantile, MIM# 269920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6585 | SLC12A6 | Zornitza Stark Marked gene: SLC12A6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6585 | SLC12A6 | Zornitza Stark Gene: slc12a6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6585 | SLC12A6 | Zornitza Stark Phenotypes for gene: SLC12A6 were changed from to Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6584 | SLC12A6 | Zornitza Stark Publications for gene: SLC12A6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6583 | SLC12A6 | Zornitza Stark Mode of inheritance for gene: SLC12A6 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6582 | SLC12A6 | Zornitza Stark Mode of inheritance for gene: SLC12A6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6581 | SLC12A6 | Zornitza Stark reviewed gene: SLC12A6: Rating: GREEN; Mode of pathogenicity: None; Publications: 31439721, 27485015, 16606917, 21628467, 12368912, 17893295; Phenotypes: Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6581 | AJAP1 | Zornitza Stark Marked gene: AJAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6581 | AJAP1 | Zornitza Stark Gene: ajap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6581 | AJAP1 | Zornitza Stark Classified gene: AJAP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6581 | AJAP1 | Zornitza Stark Gene: ajap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6580 | AJAP1 |
Zornitza Stark gene: AJAP1 was added gene: AJAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AJAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AJAP1 were set to 38985877 Phenotypes for gene: AJAP1 were set to neurodevelopmental disorder, MONDO:0700092, AJAP1-related Review for gene: AJAP1 was set to GREEN Added comment: PMID:38985877 reported five unrelated individuals with monoallelic variants or a deletion in AJAP1 gene and they presented with epilepsy, neurodevelopmental problems, or intellectual disability. There is also supporting functional evidence available. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6579 | KIF5A | Zornitza Stark Marked gene: KIF5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6579 | KIF5A | Zornitza Stark Gene: kif5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6579 | KIF5A | Zornitza Stark Phenotypes for gene: KIF5A were changed from Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237 to Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6578 | KIF5A | Zornitza Stark Phenotypes for gene: KIF5A were changed from to Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6577 | KIF5A | Zornitza Stark Publications for gene: KIF5A were set to 18853458 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6576 | KIF5A | Zornitza Stark Publications for gene: KIF5A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6575 | KIF5A | Zornitza Stark Mode of inheritance for gene: KIF5A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6574 | KIF5A | Zornitza Stark Classified gene: KIF5A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6574 | KIF5A | Zornitza Stark Gene: kif5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6573 | KIF5A | Zornitza Stark Classified gene: KIF5A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6573 | KIF5A | Zornitza Stark Gene: kif5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6572 | KIF7 | Zornitza Stark Marked gene: KIF7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6572 | KIF7 | Zornitza Stark Gene: kif7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6572 | KIF7 | Zornitza Stark Phenotypes for gene: KIF7 were changed from acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990 to acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6571 | KIF7 | Zornitza Stark Phenotypes for gene: KIF7 were changed from to acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6570 | KIF7 | Zornitza Stark Publications for gene: KIF7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6569 | KIF7 | Zornitza Stark Mode of inheritance for gene: KIF7 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6569 | KIF7 | Zornitza Stark Mode of inheritance for gene: KIF7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6568 | KLHL7 | Zornitza Stark Marked gene: KLHL7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6568 | KLHL7 | Zornitza Stark Gene: klhl7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6568 | KLHL7 | Zornitza Stark Phenotypes for gene: KLHL7 were changed from to PERCHING syndrome MONDO:0014890; acrocallosal syndrome MONDO:0008708 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6567 | KLHL7 | Zornitza Stark Publications for gene: KLHL7 were set to 27392078; 30142437; 29074562 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6566 | KLHL7 | Zornitza Stark Publications for gene: KLHL7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6565 | KLHL7 | Zornitza Stark Mode of inheritance for gene: KLHL7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6564 | L2HGDH | Zornitza Stark Marked gene: L2HGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6564 | L2HGDH | Zornitza Stark Gene: l2hgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6564 | L2HGDH | Zornitza Stark Phenotypes for gene: L2HGDH were changed from to L-2-hydroxyglutaric aciduria, MIM#236792 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6563 | L2HGDH | Zornitza Stark Publications for gene: L2HGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6562 | L2HGDH | Zornitza Stark Mode of inheritance for gene: L2HGDH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6561 | L2HGDH | Zornitza Stark Mode of inheritance for gene: L2HGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6560 | LAMA1 | Zornitza Stark Marked gene: LAMA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6560 | LAMA1 | Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6560 | LAMA1 | Zornitza Stark Phenotypes for gene: LAMA1 were changed from to ataxia - intellectual disability - oculomotor apraxia - cerebellar cysts syndrome MONDO:0014419 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6559 | LAMA1 | Zornitza Stark Publications for gene: LAMA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6558 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6557 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6556 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6555 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6554 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6554 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6554 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6553 | ISPD | Zornitza Stark Publications for gene: ISPD were set to 23288328 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6552 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6551 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6550 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | ISPD | Zornitza Stark Tag new gene name tag was added to gene: ISPD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | ISPD | Sangavi Sivagnanasundram reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23288328; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | LAMA1 | Sangavi Sivagnanasundram reviewed gene: LAMA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24013853; Phenotypes: ataxia - intellectual disability - oculomotor apraxia - cerebellar cysts syndrome MONDO:0014419; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | L2HGDH | Sangavi Sivagnanasundram reviewed gene: L2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37113859; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | KLHL7 | Sangavi Sivagnanasundram reviewed gene: KLHL7: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392078, 30142437, 29074562; Phenotypes: PERCHING syndrome MONDO:0014890, acrocallosal syndrome MONDO:0008708; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | KIF7 | Sangavi Sivagnanasundram reviewed gene: KIF7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301500; Phenotypes: acrocallosal syndrome MONDO:0008708, KIF7-related ciliopathy MONDO:0800463, Joubert syndrome 12 MIM#200990; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | KIF5A | Sangavi Sivagnanasundram reviewed gene: KIF5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 18853458; Phenotypes: Spastic paraplegia 10, autosomal dominant, MIM# 604187, inherited neurodegenerative disorder MONDO:0024237; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | DHRSX | Zornitza Stark Marked gene: DHRSX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | DHRSX | Zornitza Stark Gene: dhrsx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | DHRSX | Zornitza Stark Classified gene: DHRSX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6549 | DHRSX | Zornitza Stark Gene: dhrsx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6548 | DHRSX | Zornitza Stark edited their review of gene: DHRSX: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6548 | DHRSX |
Zornitza Stark gene: DHRSX was added gene: DHRSX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DHRSX was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DHRSX were set to 38821050 Phenotypes for gene: DHRSX were set to congenital disorder of glycosylation, MONDO:0015286, DHRSX-related Added comment: PMID:38821050 reported the identification of biallelic missense variants in DHRSX gene in four patients from three unrelated families with a congenital disorder of glycosylation. They displayed distinct facial features, severe neurological involvement including hypotonia, scoliosis, contractures, profound intellectual disability, epilepsy, and sensorineural hearing loss. These patients also experienced severe failure to thrive (requiring tube feeding); variable respiratory insufficiency; and involvement of the eyes, the gastrointestinal system, and other organs. Gene located in PAR. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6547 | ITPR1 | Zornitza Stark Marked gene: ITPR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6547 | ITPR1 | Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6547 | ITPR1 | Zornitza Stark Phenotypes for gene: ITPR1 were changed from to aniridia-cerebellar ataxia-intellectual disability syndrome MONDO:0008795; spinocerebellar ataxia type 29 MONDO:0007298 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6546 | ITPR1 | Zornitza Stark Publications for gene: ITPR1 were set to 27108797; 27108798; 15623688; 22986007; 28488678 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6545 | ITPR1 | Zornitza Stark Publications for gene: ITPR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6544 | ITPR1 | Zornitza Stark Mode of inheritance for gene: ITPR1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6543 | IVD | Zornitza Stark Marked gene: IVD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6543 | IVD | Zornitza Stark Gene: ivd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6543 | IVD | Zornitza Stark Phenotypes for gene: IVD were changed from to isovaleric acidaemia MONDO:0009475 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6542 | IVD | Zornitza Stark Publications for gene: IVD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6541 | IVD | Zornitza Stark Mode of inheritance for gene: IVD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6540 | KCNT1 | Zornitza Stark Marked gene: KCNT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6540 | KCNT1 | Zornitza Stark Gene: kcnt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6540 | KCNT1 | Zornitza Stark Phenotypes for gene: KCNT1 were changed from to Developmental and epileptic encephalopathy MIM#614959; childhood-onset epilepsy syndrome MONDO:0020072 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6539 | KCNT1 | Zornitza Stark Publications for gene: KCNT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6538 | KCNT1 | Zornitza Stark Mode of inheritance for gene: KCNT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6537 | KCTD7 | Zornitza Stark Marked gene: KCTD7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6537 | KCTD7 | Zornitza Stark Gene: kctd7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6537 | KCTD7 | Zornitza Stark Phenotypes for gene: KCTD7 were changed from Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726); progressive myoclonus epilepsy MONDO:0020074 to progressive myoclonus epilepsy MONDO:0020074; Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6536 | KCTD7 | Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726); progressive myoclonus epilepsy MONDO:0020074 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6535 | KCTD7 | Zornitza Stark Publications for gene: KCTD7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6534 | KCTD7 | Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6533 | KDM6A | Zornitza Stark Marked gene: KDM6A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6533 | KDM6A | Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6533 | KDM6A | Zornitza Stark Phenotypes for gene: KDM6A were changed from to Kabuki syndrome 2 MONDO:0010465 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6532 | KDM6A | Zornitza Stark Publications for gene: KDM6A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6531 | KDM6A | Zornitza Stark Mode of inheritance for gene: KDM6A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6530 | KIAA0586 | Zornitza Stark Marked gene: KIAA0586 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6530 | KIAA0586 | Zornitza Stark Added comment: Comment when marking as ready: HGNC approved name KATNIP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6530 | KIAA0586 | Zornitza Stark Gene: kiaa0586 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6530 | KIAA0586 | Zornitza Stark Marked gene: KIAA0586 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6530 | KIAA0586 | Zornitza Stark Gene: kiaa0586 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6530 | KIAA0586 | Zornitza Stark Publications for gene: KIAA0586 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6530 | KIAA0586 | Zornitza Stark Phenotypes for gene: KIAA0586 were changed from Joubert syndrome 23 MIM#616490 to Joubert syndrome 23 MIM#616490 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6529 | KIAA0586 | Zornitza Stark Phenotypes for gene: KIAA0586 were changed from to Joubert syndrome 23 MIM#616490 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6529 | KIAA0586 | Zornitza Stark Mode of inheritance for gene: KIAA0586 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | KIAA0586 | Zornitza Stark Tag new gene name tag was added to gene: KIAA0586. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | KIAA0586 | Sangavi Sivagnanasundram reviewed gene: KIAA0586: Rating: GREEN; Mode of pathogenicity: None; Publications: 26096313; Phenotypes: Joubert syndrome 23 MIM#616490; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | KDM6A | Sangavi Sivagnanasundram reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33674768; Phenotypes: Kabuki syndrome 2 MONDO:0010465; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | KCTD7 | Sangavi Sivagnanasundram reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 30295347, 31197948; Phenotypes: progressive myoclonus epilepsy MONDO:0020074; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | KCNT1 | Sangavi Sivagnanasundram reviewed gene: KCNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23086397, 24029078; Phenotypes: childhood-onset epilepsy syndrome MONDO:0020072; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | IVD | Sangavi Sivagnanasundram reviewed gene: IVD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26018748; Phenotypes: isovaleric acidemia MONDO:0009475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | ITPR1 | Sangavi Sivagnanasundram reviewed gene: ITPR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108797, 27108798, 15623688, 22986007, 28488678; Phenotypes: aniridia-cerebellar ataxia-intellectual disability syndrome MONDO:0008795, spinocerebellar ataxia type 29 MONDO:0007298; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6528 | MSL2 | Zornitza Stark Phenotypes for gene: MSL2 were changed from Neurodevelopmental disorder, MONDO:0700092, MSL2-related to Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6527 | MSL2 | Zornitza Stark edited their review of gene: MSL2: Changed phenotypes: Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6527 | BORCS8 | Zornitza Stark Phenotypes for gene: BORCS8 were changed from Neurodevelopmental disorder (MONDO#0700092), BORCS8-related to Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6526 | BORCS8 | Zornitza Stark reviewed gene: BORCS8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6526 | GLYCTK | Bryony Thompson Marked gene: GLYCTK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6526 | GLYCTK | Bryony Thompson Gene: glyctk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6526 | GLYCTK | Bryony Thompson Phenotypes for gene: GLYCTK were changed from to D-glyceric aciduria MONDO:0009070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6525 | GLYCTK | Bryony Thompson Publications for gene: GLYCTK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6524 | GLYCTK | Bryony Thompson Mode of inheritance for gene: GLYCTK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6523 | GLYCTK | Bryony Thompson Classified gene: GLYCTK as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6523 | GLYCTK | Bryony Thompson Gene: glyctk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6522 | GLYCTK | Bryony Thompson reviewed gene: GLYCTK: Rating: AMBER; Mode of pathogenicity: None; Publications: 20949620, 31837836, 3588091, 30637540, 28462797, 20949620, 28190537; Phenotypes: D-glyceric aciduria MONDO:0009070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6522 | GLI3 | Bryony Thompson Marked gene: GLI3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6522 | GLI3 | Bryony Thompson Gene: gli3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6522 | GLI3 | Bryony Thompson Phenotypes for gene: GLI3 were changed from to Greig cephalopolysyndactyly syndrome MONDO:0008287 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6521 | GLI3 | Bryony Thompson Publications for gene: GLI3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6520 | GLI3 | Bryony Thompson Mode of inheritance for gene: GLI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6519 | GLI3 | Bryony Thompson reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301619, 20301638; Phenotypes: Greig cephalopolysyndactyly syndrome MONDO:0008287; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6519 | GLI2 | Bryony Thompson Marked gene: GLI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6519 | GLI2 | Bryony Thompson Gene: gli2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6519 | GLI2 | Bryony Thompson Phenotypes for gene: GLI2 were changed from to postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6518 | GLI2 | Bryony Thompson Publications for gene: GLI2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6517 | GLI2 | Bryony Thompson Mode of inheritance for gene: GLI2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6516 | GLI2 | Bryony Thompson reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24744436; Phenotypes: postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6516 | GLDC | Bryony Thompson Marked gene: GLDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6516 | GLDC | Bryony Thompson Gene: gldc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6516 | GLDC | Bryony Thompson Phenotypes for gene: GLDC were changed from to glycine encephalopathy MONDO:0011612 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6515 | GLDC | Bryony Thompson Publications for gene: GLDC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6514 | GLDC | Bryony Thompson Mode of inheritance for gene: GLDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6513 | GLDC | Bryony Thompson reviewed gene: GLDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301531; Phenotypes: glycine encephalopathy MONDO:0011612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6513 | GLB1 | Bryony Thompson Marked gene: GLB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6513 | GLB1 | Bryony Thompson Gene: glb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6513 | GLB1 | Bryony Thompson Phenotypes for gene: GLB1 were changed from to GM1 gangliosidosis MONDO:0018149; mucopolysaccharidosis type 4B MONDO:0009660 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6512 | GLB1 | Bryony Thompson Publications for gene: GLB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6511 | GLB1 | Bryony Thompson Mode of inheritance for gene: GLB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6510 | GLB1 | Bryony Thompson reviewed gene: GLB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24156116; Phenotypes: GM1 gangliosidosis MONDO:0018149, mucopolysaccharidosis type 4B MONDO:0009660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6510 | GK | Bryony Thompson Marked gene: GK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6510 | GK | Bryony Thompson Gene: gk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6510 | GK | Bryony Thompson Phenotypes for gene: GK were changed from to inborn glycerol kinase deficiency MONDO:0010613; X-linked adrenal hypoplasia congenita MONDO:0010264 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6509 | GK | Bryony Thompson Publications for gene: GK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6508 | GK | Bryony Thompson Mode of inheritance for gene: GK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6507 | GK | Bryony Thompson Tag SV/CNV tag was added to gene: GK. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6507 | GK | Bryony Thompson reviewed gene: GK: Rating: GREEN; Mode of pathogenicity: None; Publications: 37091526, 33212314; Phenotypes: inborn glycerol kinase deficiency MONDO:0010613, X-linked adrenal hypoplasia congenita MONDO:0010264; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6507 | MAL | Zornitza Stark Phenotypes for gene: MAL were changed from Leukodystrophy MONDO:0019046, MAL-related to Leukodystrophy, hypomyelinating, 28, MIM# 620978 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6506 | MAL | Zornitza Stark edited their review of gene: MAL: Changed phenotypes: Leukodystrophy, hypomyelinating, 28, MIM# 620978 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6506 | GJC2 | Bryony Thompson Marked gene: GJC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6506 | GJC2 | Bryony Thompson Gene: gjc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6506 | GJC2 | Bryony Thompson Phenotypes for gene: GJC2 were changed from to hypomyelinating leukodystrophy 2 MONDO:0012125; hereditary spastic paraplegia 44 MONDO:0013179 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6505 | GJC2 | Bryony Thompson reviewed gene: GJC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29276893; Phenotypes: hypomyelinating leukodystrophy 2 MONDO:0012125, hereditary spastic paraplegia 44 MONDO:0013179; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6505 | GJC2 | Bryony Thompson Publications for gene: GJC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6504 | GJC2 | Bryony Thompson Mode of inheritance for gene: GJC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6503 | GFM1 | Bryony Thompson Marked gene: GFM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6503 | GFM1 | Bryony Thompson Gene: gfm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6503 | GFM1 | Bryony Thompson Phenotypes for gene: GFM1 were changed from to Leigh syndrome MONDO:0009723 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6502 | GFM1 | Bryony Thompson Publications for gene: GFM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6501 | GFM1 | Bryony Thompson Mode of inheritance for gene: GFM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6500 | GFM1 | Bryony Thompson reviewed gene: GFM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25852744, 31680380, 21986555, 32776492; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6500 | SLC12A5 | Zornitza Stark Marked gene: SLC12A5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6500 | SLC12A5 | Zornitza Stark Gene: slc12a5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6500 | SLC12A5 | Zornitza Stark Phenotypes for gene: SLC12A5 were changed from to Developmental and epileptic encephalopathy 34, MIM# 616645 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6499 | SLC12A5 | Zornitza Stark Publications for gene: SLC12A5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6498 | SLC12A5 | Zornitza Stark Mode of inheritance for gene: SLC12A5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6497 | SLC12A5 |
Zornitza Stark changed review comment from: Note LIMITED by ClinGen. However, note functional evidence including mouse model. Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship.; to: LIMITED by ClinGen. However, note functional evidence including mouse model and additional family in 38660387, again with supportive functional data. Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6497 | SLC12A5 | Zornitza Stark edited their review of gene: SLC12A5: Changed publications: 26333769, 27436767, 31618474, 12000122, 38660387 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6497 | SLC12A5 | Zornitza Stark reviewed gene: SLC12A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26333769, 27436767, 31618474, 12000122; Phenotypes: Developmental and epileptic encephalopathy 34, MIM# 616645; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6497 | SC5D | Zornitza Stark Marked gene: SC5D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6497 | SC5D | Zornitza Stark Gene: sc5d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6497 | SC5D | Zornitza Stark Phenotypes for gene: SC5D were changed from to Lathosterolosis, MIM#607330 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6496 | SC5D | Zornitza Stark Publications for gene: SC5D were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6495 | SC5D | Zornitza Stark Mode of inheritance for gene: SC5D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6494 | SC5D | Zornitza Stark changed review comment from: Well established gene-disease association. DD/ID is part of the phenotype.; to: Well established gene-disease association. DD/ID is part of the phenotype. More than 5 families reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6494 | SC5D | Zornitza Stark edited their review of gene: SC5D: Changed publications: 17853487, 12189593, 12812989, 24142275 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6494 | SC5D | Zornitza Stark reviewed gene: SC5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lathosterolosis, MIM#607330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6494 | RTEL1 | Zornitza Stark Marked gene: RTEL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6494 | RTEL1 | Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6494 | RTEL1 | Zornitza Stark Phenotypes for gene: RTEL1 were changed from Dyskeratosis congenita, autosomal recessive 5, MIM#615190 to Dyskeratosis congenita, autosomal recessive 5, MIM#615190 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6493 | RTEL1 | Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal recessive 5, MIM#615190 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6492 | RTEL1 | Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6491 | RTEL1 | Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dyskeratosis congenita, autosomal recessive 5, MIM#615190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6491 | RRM2B | Zornitza Stark Marked gene: RRM2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6491 | RRM2B | Zornitza Stark Gene: rrm2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6491 | RRM2B | Zornitza Stark Phenotypes for gene: RRM2B were changed from to Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075; Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6490 | RRM2B | Zornitza Stark Mode of inheritance for gene: RRM2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6489 | RRM2B | Zornitza Stark reviewed gene: RRM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075, Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6489 | UFC1 | Zornitza Stark Tag deep intronic tag was added to gene: UFC1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6489 | UFC1 | Zornitza Stark reviewed gene: UFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with spasticity and poor growth, OMIM #618076; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6489 | RPS6KA3 | Zornitza Stark Marked gene: RPS6KA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6489 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6489 | RPS6KA3 | Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from to Coffin-Lowry syndrome MIM# 303600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6488 | RPS6KA3 | Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6487 | RPS6KA3 | Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Lowry syndrome MIM# 303600; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6487 | RPGRIP1L | Zornitza Stark Marked gene: RPGRIP1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6487 | RPGRIP1L | Zornitza Stark Gene: rpgrip1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6487 | RPGRIP1L | Zornitza Stark Phenotypes for gene: RPGRIP1L were changed from to Joubert syndrome 7, MIM# 611560; Meckel syndrome 5, MIM# 611561 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6486 | RPGRIP1L | Zornitza Stark Mode of inheritance for gene: RPGRIP1L was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6485 | RPGRIP1L | Zornitza Stark reviewed gene: RPGRIP1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Joubert syndrome 7, MIM# 611560, Meckel syndrome 5, MIM# 611561; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6485 | RNASET2 | Zornitza Stark Marked gene: RNASET2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6485 | RNASET2 | Zornitza Stark Gene: rnaset2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6485 | RNASET2 | Zornitza Stark Phenotypes for gene: RNASET2 were changed from to Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6484 | RNASET2 | Zornitza Stark Publications for gene: RNASET2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6483 | RNASET2 | Zornitza Stark Mode of inheritance for gene: RNASET2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6482 | RNASET2 | Zornitza Stark edited their review of gene: RNASET2: Added comment: More than 10 families reported, DD/ID is part of the phenotype.; Changed publications: 31349848, 19525954, 27091087, 29336640, 18545798, 15851732 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6482 | RNASET2 | Zornitza Stark reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6482 | RNASEH2C | Zornitza Stark Marked gene: RNASEH2C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6482 | RNASEH2C | Zornitza Stark Gene: rnaseh2c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6482 | RNASEH2C | Zornitza Stark Phenotypes for gene: RNASEH2C were changed from to Aicardi-Goutieres syndrome 3, MIM# 610329 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6481 | RNASEH2C | Zornitza Stark Mode of inheritance for gene: RNASEH2C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6480 | RNASEH2C | Zornitza Stark reviewed gene: RNASEH2C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 3, MIM# 610329; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6480 | RNASEH2B | Zornitza Stark Marked gene: RNASEH2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6480 | RNASEH2B | Zornitza Stark Gene: rnaseh2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6480 | RNASEH2B | Zornitza Stark Phenotypes for gene: RNASEH2B were changed from to Aicardi-Goutieres syndrome 2, MIM# 610181 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6479 | RNASEH2B | Zornitza Stark Mode of inheritance for gene: RNASEH2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6478 | RNASEH2B | Zornitza Stark reviewed gene: RNASEH2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 2, MIM# 610181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6478 | RNASEH2A | Zornitza Stark Marked gene: RNASEH2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6478 | RNASEH2A | Zornitza Stark Gene: rnaseh2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6478 | RNASEH2A | Zornitza Stark Phenotypes for gene: RNASEH2A were changed from to Aicardi-Goutieres syndrome 4, MIM# 610333 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6477 | RNASEH2A | Zornitza Stark Mode of inheritance for gene: RNASEH2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6476 | RNASEH2A | Zornitza Stark reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 4, MIM# 610333; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6476 | RMND1 | Zornitza Stark Marked gene: RMND1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6476 | RMND1 | Zornitza Stark Gene: rmnd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6476 | RMND1 | Zornitza Stark Phenotypes for gene: RMND1 were changed from to Combined oxidative phosphorylation deficiency 11 MIM#614922 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6475 | RMND1 | Zornitza Stark Publications for gene: RMND1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6474 | RMND1 | Zornitza Stark Mode of inheritance for gene: RMND1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6473 | RMND1 | Zornitza Stark reviewed gene: RMND1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 11 MIM#614922; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6473 | RIT1 | Zornitza Stark Marked gene: RIT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6473 | RIT1 | Zornitza Stark Gene: rit1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6473 | RIT1 | Zornitza Stark Phenotypes for gene: RIT1 were changed from to Noonan syndrome 8, MIM# 615355 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6472 | RIT1 | Zornitza Stark Publications for gene: RIT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6471 | RIT1 | Zornitza Stark Mode of pathogenicity for gene: RIT1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6470 | RIT1 | Zornitza Stark Mode of inheritance for gene: RIT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6469 | RFC4 | Zornitza Stark Marked gene: RFC4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6469 | RFC4 | Zornitza Stark Gene: rfc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6469 | RFC4 | Zornitza Stark Phenotypes for gene: RFC4 were changed from RFC4-related multisystem disorder to Neurodevelopmental disorder, MONDO:0700092, RFC4-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6468 | RFC4 | Zornitza Stark reviewed gene: RFC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RFC4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6468 | RARS2 | Zornitza Stark Marked gene: RARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6468 | RARS2 | Zornitza Stark Gene: rars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6468 | RARS2 | Zornitza Stark Phenotypes for gene: RARS2 were changed from to Pontocerebellar hypoplasia, type 6, MIM# 611523 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6467 | RARS2 | Zornitza Stark Publications for gene: RARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6466 | RARS2 | Zornitza Stark Mode of inheritance for gene: RARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6465 | RARS2 | Zornitza Stark reviewed gene: RARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17847012, 20635367, 25809939; Phenotypes: Pontocerebellar hypoplasia, type 6, MIM# 611523; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6465 | IPO8 | Zornitza Stark Marked gene: IPO8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6465 | IPO8 | Zornitza Stark Gene: ipo8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6465 | IPO8 | Zornitza Stark Classified gene: IPO8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6465 | IPO8 | Zornitza Stark Gene: ipo8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6464 | IPO8 |
Zornitza Stark gene: IPO8 was added gene: IPO8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IPO8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IPO8 were set to 34010604; 33875846; 34010605 Phenotypes for gene: IPO8 were set to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities Review for gene: IPO8 was set to GREEN Added comment: There are 35 unrelated cases with a IPO8 variant, 4/35 with mild ID, 1/35 with severe ID and 7 global developmental delay. There is a further case with severe ID, but the patient also has a 1.779Mb deletion in 19q13.4, which could be responsible for the ID (PMID: 34010605). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6463 | PRKACB | Zornitza Stark Publications for gene: PRKACB were set to 33058759 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6462 | PRKACB | Zornitza Stark Classified gene: PRKACB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6462 | PRKACB | Zornitza Stark Gene: prkacb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6461 | PRKACB | Zornitza Stark edited their review of gene: PRKACB: Added comment: Additional individual reported with ID and de novo missense variant.; Changed rating: GREEN; Changed publications: 39095811 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6461 | RAF1 | Zornitza Stark Marked gene: RAF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6461 | RAF1 | Zornitza Stark Gene: raf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6461 | RAF1 | Zornitza Stark Phenotypes for gene: RAF1 were changed from Noonan syndrome 5, MIM# 611553 to Noonan syndrome 5, MIM# 611553 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6460 | RAF1 | Zornitza Stark Phenotypes for gene: RAF1 were changed from to Noonan syndrome 5, MIM# 611553 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6459 | RAF1 | Zornitza Stark Publications for gene: RAF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6458 | RAF1 | Zornitza Stark Mode of pathogenicity for gene: RAF1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6457 | RAF1 | Zornitza Stark Mode of inheritance for gene: RAF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6456 | RAB18 | Zornitza Stark changed review comment from: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln; to: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe ID, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6456 | RAB18 | Zornitza Stark Marked gene: RAB18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6456 | RAB18 | Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6456 | RAB18 | Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6455 | RAB18 | Zornitza Stark Publications for gene: RAB18 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6454 | RAB18 | Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6453 | RAB18 | Zornitza Stark Tag founder tag was added to gene: RAB18. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6453 | RAB18 | Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6453 | PYCR1 | Zornitza Stark Marked gene: PYCR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6453 | PYCR1 | Zornitza Stark Gene: pycr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6453 | PYCR1 | Zornitza Stark Phenotypes for gene: PYCR1 were changed from to Cutis laxa, autosomal recessive, type IIB, MIM# 612940; Cutis laxa, autosomal recessive, type IIIB, MIM# 614438 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6452 | PYCR1 | Zornitza Stark Publications for gene: PYCR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6451 | PYCR1 | Zornitza Stark Mode of inheritance for gene: PYCR1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6450 | PYCR1 | Zornitza Stark reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19648921, 4076251, 22052856, 19576563, 19648921, 9648921, 22052856, 28294978, 27756598; Phenotypes: Cutis laxa, autosomal recessive, type IIB, MIM# 612940, Cutis laxa, autosomal recessive, type IIIB, MIM# 614438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6450 | PUS1 | Zornitza Stark Marked gene: PUS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6450 | PUS1 | Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6450 | PUS1 | Zornitza Stark Phenotypes for gene: PUS1 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6449 | PUS1 | Zornitza Stark Publications for gene: PUS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6448 | PUS1 | Zornitza Stark Mode of inheritance for gene: PUS1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6448 | PUS1 | Zornitza Stark Mode of inheritance for gene: PUS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6447 | PUS1 | Zornitza Stark edited their review of gene: PUS1: Changed phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6447 | PUS1 | Zornitza Stark reviewed gene: PUS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25227147, 17056637, 15108122, 32287105, 31641589, 28832011; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6447 | PTS | Zornitza Stark Marked gene: PTS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6447 | PTS | Zornitza Stark Gene: pts has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6447 | PTS | Zornitza Stark Phenotypes for gene: PTS were changed from Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 to Hyperphenylalaninaemia, BH4-deficient, A, MIM# 261640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6446 | PTS | Zornitza Stark Phenotypes for gene: PTS were changed from to Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6445 | PTS | Zornitza Stark Mode of inheritance for gene: PTS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6444 | PTS | Zornitza Stark reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6444 | PTPN11 | Zornitza Stark Marked gene: PTPN11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6444 | PTPN11 | Zornitza Stark Gene: ptpn11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6444 | PTPN11 | Zornitza Stark Phenotypes for gene: PTPN11 were changed from to Noonan syndrome 1, MIM#163950 AD; LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6443 | PTPN11 | Zornitza Stark Publications for gene: PTPN11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6442 | PTPN11 | Zornitza Stark Mode of pathogenicity for gene: PTPN11 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6441 | PTPN11 | Zornitza Stark Mode of inheritance for gene: PTPN11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6440 | PTF1A | Zornitza Stark Marked gene: PTF1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6440 | PTF1A | Zornitza Stark Gene: ptf1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6440 | PTF1A | Zornitza Stark Phenotypes for gene: PTF1A were changed from to Pancreatic and cerebellar agenesis, MIM# 609069 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6439 | PTF1A | Zornitza Stark Publications for gene: PTF1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6438 | PTF1A | Zornitza Stark Mode of inheritance for gene: PTF1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6437 | PTF1A | Zornitza Stark reviewed gene: PTF1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 21749365, 10507728, 15543146, 19650412; Phenotypes: Pancreatic and cerebellar agenesis, MIM# 609069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6437 | PTDSS1 | Zornitza Stark Marked gene: PTDSS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6437 | PTDSS1 | Zornitza Stark Gene: ptdss1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6437 | PTDSS1 | Zornitza Stark Phenotypes for gene: PTDSS1 were changed from Lenz-Majewski hyperostotic dwarfism MIM#151050 to Lenz-Majewski hyperostotic dwarfism MIM#151050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6436 | PTDSS1 | Zornitza Stark Phenotypes for gene: PTDSS1 were changed from to Lenz-Majewski hyperostotic dwarfism MIM#151050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6435 | PTDSS1 | Zornitza Stark Publications for gene: PTDSS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6434 | PTDSS1 | Zornitza Stark Mode of inheritance for gene: PTDSS1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6433 | PTDSS1 |
Zornitza Stark commented on gene: PTDSS1: Lenz-Majewski hyperostotic dwarfism is a rare condition characterized by intellectual disability, sclerosing bone dysplasia, distinct craniofacial and dental anomalies, loose skin, and distal limb anomalies, particularly brachydactyly and symphalangism. Patients have multiple radiographic abnormalities due to progressive generalized hyperostosis that affects the cranium, vertebrae, and diaphyses of tubular bones, leading to severe growth retardation. Multiple families. Gain-of-function is the established or expected mechanism of disease for these variants. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6433 | PTDSS1 | Zornitza Stark edited their review of gene: PTDSS1: Changed publications: 24241535, 29341480, 31403251 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6433 | PTDSS1 | Zornitza Stark reviewed gene: PTDSS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lenz-Majewski hyperostotic dwarfism MIM#151050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6433 | PTCH1 | Zornitza Stark Marked gene: PTCH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6433 | PTCH1 | Zornitza Stark Gene: ptch1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6433 | PTCH1 | Zornitza Stark Phenotypes for gene: PTCH1 were changed from to Holoprosencephaly 7, MIM# 610828 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6432 | PTCH1 | Zornitza Stark Mode of inheritance for gene: PTCH1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6431 | PTCH1 | Zornitza Stark Mode of inheritance for gene: PTCH1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6430 | PTCH1 | Zornitza Stark reviewed gene: PTCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holoprosencephaly 7, MIM# 610828; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6430 | KBTBD2 | Zornitza Stark Marked gene: KBTBD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6430 | KBTBD2 | Zornitza Stark Gene: kbtbd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6430 | KBTBD2 | Zornitza Stark Classified gene: KBTBD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6430 | KBTBD2 | Zornitza Stark Gene: kbtbd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6429 | KBTBD2 |
Zornitza Stark gene: KBTBD2 was added gene: KBTBD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KBTBD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KBTBD2 were set to 39313616 Phenotypes for gene: KBTBD2 were set to neurodevelopmental disorder MONDO:0700092, KBTBD2-related Review for gene: KBTBD2 was set to GREEN Added comment: 3 families - 2 compound hets and 1 hom phenotypes include: Microcephaly, hypotonia, failure to thrive, IUGR, delayed gross motor development, dysmorphism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6428 | MAP2K1 | Zornitza Stark Marked gene: MAP2K1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6428 | MAP2K1 | Zornitza Stark Gene: map2k1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6428 | MAP2K1 | Zornitza Stark Phenotypes for gene: MAP2K1 were changed from to Cardiofaciocutaneous syndrome 3, MIM# 615279 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6427 | MAP2K1 | Zornitza Stark Publications for gene: MAP2K1 were set to 16439621; 17551924; 18042262; 20301365 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6426 | MAP2K1 | Zornitza Stark Publications for gene: MAP2K1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6425 | MAP2K1 | Zornitza Stark Mode of pathogenicity for gene: MAP2K1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6424 | MAP2K1 | Zornitza Stark Mode of inheritance for gene: MAP2K1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6423 | MAP2K1 | Zornitza Stark Mode of inheritance for gene: MAP2K1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6422 | MAP2K2 | Zornitza Stark Marked gene: MAP2K2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6422 | MAP2K2 | Zornitza Stark Gene: map2k2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6422 | MAP2K2 | Zornitza Stark Phenotypes for gene: MAP2K2 were changed from to Cardiofaciocutaneous syndrome 3, MIM# 615279 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6421 | MAP2K2 | Zornitza Stark Mode of pathogenicity for gene: MAP2K2 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6420 | MAP2K2 | Zornitza Stark Publications for gene: MAP2K2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6419 | MAP2K2 | Zornitza Stark Mode of inheritance for gene: MAP2K2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6418 | MAT1A | Zornitza Stark Marked gene: MAT1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6418 | MAT1A | Zornitza Stark Gene: mat1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6418 | MAT1A | Zornitza Stark Phenotypes for gene: MAT1A were changed from to Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850; Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850; Disorders of the metabolism of sulphur amino acids | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6417 | MAT1A | Zornitza Stark Publications for gene: MAT1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6416 | MAT1A | Zornitza Stark Mode of inheritance for gene: MAT1A was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6415 | MBOAT7 | Zornitza Stark Marked gene: MBOAT7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6415 | MBOAT7 | Zornitza Stark Gene: mboat7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6415 | MBOAT7 | Zornitza Stark Phenotypes for gene: MBOAT7 were changed from to Intellectual disability MIM#617188 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6414 | MBOAT7 | Zornitza Stark Publications for gene: MBOAT7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6413 | MBOAT7 | Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6412 | MKKS | Zornitza Stark Marked gene: MKKS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6412 | MKKS | Zornitza Stark Gene: mkks has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6412 | MKKS | Zornitza Stark Phenotypes for gene: MKKS were changed from to McKusick-Kaufman syndrome, MIM# 236700; Bardet-Biedl syndrome 6, MIM# 605231; Retinitis pigmentosa | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6411 | MKKS | Zornitza Stark Publications for gene: MKKS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6410 | MKKS | Zornitza Stark Mode of inheritance for gene: MKKS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6409 | MKS1 | Zornitza Stark Marked gene: MKS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6409 | MKS1 | Zornitza Stark Gene: mks1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6409 | MKS1 | Zornitza Stark Phenotypes for gene: MKS1 were changed from to Joubert syndrome 28, MIM# 617121; MONDO:0014928; Meckel syndrome 1, MIM# 249000; MONDO:0009571; Bardet-Biedl syndrome 13, MIM# 615990; MONDO:0014441 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6408 | MKS1 | Zornitza Stark Publications for gene: MKS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6407 | MKS1 | Zornitza Stark Mode of inheritance for gene: MKS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6406 | MLC1 | Zornitza Stark Marked gene: MLC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6406 | MLC1 | Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6406 | MLC1 | Zornitza Stark Phenotypes for gene: MLC1 were changed from to Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6405 | MLC1 | Zornitza Stark Publications for gene: MLC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6404 | MLC1 | Zornitza Stark Mode of inheritance for gene: MLC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6403 | MMAA | Zornitza Stark Marked gene: MMAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6403 | MMAA | Zornitza Stark Gene: mmaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6403 | MMAA | Zornitza Stark Phenotypes for gene: MMAA were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6402 | MMAA | Zornitza Stark Publications for gene: MMAA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6401 | MMAA | Zornitza Stark Mode of inheritance for gene: MMAA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6400 | MMAB | Zornitza Stark Marked gene: MMAB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6400 | MMAB | Zornitza Stark Gene: mmab has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6400 | MMAB | Zornitza Stark Phenotypes for gene: MMAB were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6399 | MMAB | Zornitza Stark Publications for gene: MMAB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6398 | MMAB | Zornitza Stark Mode of inheritance for gene: MMAB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6397 | MMADHC | Zornitza Stark Marked gene: MMADHC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6397 | MMADHC | Zornitza Stark Gene: mmadhc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6397 | MMADHC | Zornitza Stark Phenotypes for gene: MMADHC were changed from to Homocystinuria, cblD type, variant 1 MIM#277410; Methylmalonic aciduria and homocystinuria, cblD type MIM#277410; Methylmalonic aciduria, cblD type, variant 2 MIM#277410; Disorders of cobalamin absorption, transport and metabolism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6396 | MMADHC | Zornitza Stark Publications for gene: MMADHC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6395 | MMADHC | Zornitza Stark Mode of inheritance for gene: MMADHC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6394 | MUT | Zornitza Stark Marked gene: MUT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6394 | MUT | Zornitza Stark Gene: mut has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6394 | MUT | Zornitza Stark Phenotypes for gene: MUT were changed from to Methylmalonic aciduria, mut(0) type, MIM# 251000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6393 | MUT | Zornitza Stark Publications for gene: MUT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6392 | MUT | Zornitza Stark Mode of inheritance for gene: MUT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6391 | MOCS2 | Zornitza Stark Marked gene: MOCS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6391 | MOCS2 | Zornitza Stark Gene: mocs2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6391 | MOCS2 | Zornitza Stark Phenotypes for gene: MOCS2 were changed from to Molybdenum cofactor deficiency B MIM#252160; Disorders of molybdenum cofactor metabolism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6390 | MOCS2 | Zornitza Stark Publications for gene: MOCS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6389 | MOCS2 | Zornitza Stark Mode of inheritance for gene: MOCS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6388 | ATAD2B | Zornitza Stark Marked gene: ATAD2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6388 | ATAD2B | Zornitza Stark Gene: atad2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6388 | ATAD2B | Zornitza Stark Classified gene: ATAD2B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6388 | ATAD2B | Zornitza Stark Gene: atad2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6387 | POLR3K | Bryony Thompson Classified gene: POLR3K as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6387 | POLR3K | Bryony Thompson Gene: polr3k has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6386 | POLR3K |
Bryony Thompson gene: POLR3K was added gene: POLR3K was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POLR3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLR3K were set to https://doi.org/10.1155/2024/8807171; 30584594 Phenotypes for gene: POLR3K were set to POLR3-related leukodystrophy MONDO:0700282 Review for gene: POLR3K was set to GREEN Added comment: 3 apparently unrelated cases (1 compound het & 2 homozygous for the same missense & supporting functional assays) with phenotypes consistent with POLR3-related leukodystrophy which includes ID and DD as part of the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6385 | GFAP | Bryony Thompson Marked gene: GFAP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6385 | GFAP | Bryony Thompson Gene: gfap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6385 | GFAP | Bryony Thompson Phenotypes for gene: GFAP were changed from to Alexander disease MONDO:0008752 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6384 | GFAP | Bryony Thompson Publications for gene: GFAP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6383 | GFAP | Bryony Thompson Mode of inheritance for gene: GFAP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6382 | GFAP | Bryony Thompson reviewed gene: GFAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301351; Phenotypes: Alexander disease MONDO:0008752; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6382 | ATAD2B |
Zornitza Stark gene: ATAD2B was added gene: ATAD2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATAD2B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATAD2B were set to 39313616 Phenotypes for gene: ATAD2B were set to neurodevelopmental disorder MONDO:0700092, ATAD2B-related Review for gene: ATAD2B was set to AMBER Added comment: 3 families including 2 siblings 1 fam is hom for a highly conserved missense Amber because of the lack of specific phenotypes: Abnormality of the nervous system and Abnormality of the eye Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6381 | MRPS22 | Zornitza Stark Marked gene: MRPS22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6381 | MRPS22 | Zornitza Stark Gene: mrps22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6381 | MRPS22 | Zornitza Stark Phenotypes for gene: MRPS22 were changed from to Combined oxidative phosphorylation deficiency 5 MIM#611719 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6380 | MRPS22 | Zornitza Stark Publications for gene: MRPS22 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6379 | MRPS22 | Zornitza Stark Mode of inheritance for gene: MRPS22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6378 | MTFMT | Zornitza Stark Marked gene: MTFMT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6378 | MTFMT | Zornitza Stark Gene: mtfmt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6378 | MTFMT | Zornitza Stark Phenotypes for gene: MTFMT were changed from to Combined oxidative phosphorylation deficiency 15, MIM# 614947; Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6377 | MTFMT | Zornitza Stark Publications for gene: MTFMT were set to 21907147; 23499752; 24461907; 22499348 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6376 | MTFMT | Zornitza Stark Publications for gene: MTFMT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6375 | MTFMT | Zornitza Stark Mode of inheritance for gene: MTFMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6374 | MVK | Zornitza Stark Marked gene: MVK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6374 | MVK | Zornitza Stark Gene: mvk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6374 | MVK | Zornitza Stark Phenotypes for gene: MVK were changed from to Hyper-IgD syndrome (MIM#260920); Mevalonic aciduria (MIM#610377) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6374 | MVK | Zornitza Stark Publications for gene: MVK were set to 29047407; 26409462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6373 | MVK | Zornitza Stark Publications for gene: MVK were set to 29047407; 26409462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6373 | MVK | Zornitza Stark Publications for gene: MVK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6373 | MVK | Zornitza Stark Mode of inheritance for gene: MVK was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6372 | MVK | Zornitza Stark Mode of inheritance for gene: MVK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6371 | MYO5A | Zornitza Stark Marked gene: MYO5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6371 | MYO5A | Zornitza Stark Gene: myo5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6371 | MYO5A | Zornitza Stark Phenotypes for gene: MYO5A were changed from to Griscelli syndrome, type 1 MIM#214450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6370 | MYO5A | Zornitza Stark Publications for gene: MYO5A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6369 | MYO5A | Zornitza Stark Mode of inheritance for gene: MYO5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6368 | MTHFR | Zornitza Stark Marked gene: MTHFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6368 | MTHFR | Zornitza Stark Gene: mthfr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6368 | MTHFR | Zornitza Stark Phenotypes for gene: MTHFR were changed from to Homocystinuria due to MTHFR deficiency MIM#236250; Disorders of folate metabolism and transport | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6367 | MTHFR | Zornitza Stark Publications for gene: MTHFR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6366 | MTHFR | Zornitza Stark Mode of inheritance for gene: MTHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6365 | NPC2 | Zornitza Stark Marked gene: NPC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6365 | NPC2 | Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6365 | NPC2 | Zornitza Stark Phenotypes for gene: NPC2 were changed from to Niemann-pick disease, type C2, MIM# 607625; MONDO:0011873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6364 | NPC2 | Zornitza Stark Publications for gene: NPC2 were set to 11125141; 17470133 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6363 | NPC2 | Zornitza Stark Publications for gene: NPC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6362 | NPC2 | Zornitza Stark Mode of inheritance for gene: NPC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6361 | NPC1 | Zornitza Stark Marked gene: NPC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6361 | NPC1 | Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6361 | NPC1 | Zornitza Stark Phenotypes for gene: NPC1 were changed from to Niemann-Pick disease, type C1 and type D, MIM# 257220; MONDO:0009757 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6360 | NPC1 | Zornitza Stark Publications for gene: NPC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6359 | NPC1 | Zornitza Stark Mode of inheritance for gene: NPC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6358 | NKX2-1 | Zornitza Stark Marked gene: NKX2-1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6358 | NKX2-1 | Zornitza Stark Gene: nkx2-1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6358 | NKX2-1 | Zornitza Stark Phenotypes for gene: NKX2-1 were changed from Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 to Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6357 | NKX2-1 | Zornitza Stark Phenotypes for gene: NKX2-1 were changed from to Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6356 | NKX2-1 | Zornitza Stark Publications for gene: NKX2-1 were set to 10931427; 27066577; 26839702; 26103969; 23911641; 11854319; 24714694 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6355 | NKX2-1 | Zornitza Stark Publications for gene: NKX2-1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6354 | NKX2-1 | Zornitza Stark Mode of inheritance for gene: NKX2-1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6353 | NGLY1 | Zornitza Stark Marked gene: NGLY1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6353 | NGLY1 | Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6353 | NGLY1 | Zornitza Stark Phenotypes for gene: NGLY1 were changed from to Congenital disorder of deglycosylation (OMIM 615273) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6352 | NGLY1 | Zornitza Stark reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24651605, 27388694, 32259258; Phenotypes: Congenital disorder of deglycosylation (OMIM 615273); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6352 | NGLY1 | Zornitza Stark Publications for gene: NGLY1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6351 | NGLY1 | Zornitza Stark Mode of inheritance for gene: NGLY1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6350 | NFIX | Zornitza Stark Marked gene: NFIX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6350 | NFIX | Zornitza Stark Gene: nfix has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6350 | NFIX | Zornitza Stark Phenotypes for gene: NFIX were changed from to Sotos syndrome 2 (MIM#614753); Marshall-Smith syndrome, MIM# 602535 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6349 | NFIX | Zornitza Stark Publications for gene: NFIX were set to 33034087; 29897170; 30548146; 25118028 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6348 | NFIX | Zornitza Stark Publications for gene: NFIX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6347 | NFIX | Zornitza Stark Mode of inheritance for gene: NFIX was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6346 | NEU1 | Zornitza Stark Marked gene: NEU1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6346 | NEU1 | Zornitza Stark Gene: neu1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6346 | NEU1 | Zornitza Stark Phenotypes for gene: NEU1 were changed from to Sialidosis, type I and type II, MIM# 256550; MONDO:0009738 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6345 | NEU1 | Zornitza Stark Publications for gene: NEU1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6344 | NEU1 | Zornitza Stark Mode of inheritance for gene: NEU1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6343 | NDUFV1 | Zornitza Stark Marked gene: NDUFV1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6343 | NDUFV1 | Zornitza Stark Gene: ndufv1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6343 | NDUFV1 | Zornitza Stark Phenotypes for gene: NDUFV1 were changed from to Mitochondrial complex I deficiency, nuclear type 4 MIM#618225 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6342 | NDUFV1 | Zornitza Stark Publications for gene: NDUFV1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6341 | NDUFV1 | Zornitza Stark Mode of inheritance for gene: NDUFV1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6340 | NDUFS7 | Zornitza Stark Marked gene: NDUFS7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6340 | NDUFS7 | Zornitza Stark Gene: ndufs7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6340 | NDUFS7 | Zornitza Stark Phenotypes for gene: NDUFS7 were changed from to Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6339 | NDUFS7 | Zornitza Stark Publications for gene: NDUFS7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6338 | NDUFS7 | Zornitza Stark Mode of inheritance for gene: NDUFS7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6337 | NDUFA1 | Zornitza Stark Marked gene: NDUFA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6337 | NDUFA1 | Zornitza Stark Gene: ndufa1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6337 | NDUFA1 | Zornitza Stark Phenotypes for gene: NDUFA1 were changed from Mitochondrial complex I deficiency, nuclear type 12 MIM#301020 to Mitochondrial complex I deficiency, nuclear type 12 MIM#301020 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6336 | NDUFA1 | Zornitza Stark Phenotypes for gene: NDUFA1 were changed from to Mitochondrial complex I deficiency, nuclear type 12 MIM#301020 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6335 | NDUFA1 | Zornitza Stark Publications for gene: NDUFA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6334 | NDUFA1 | Zornitza Stark Mode of inheritance for gene: NDUFA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6333 | NALCN | Zornitza Stark Marked gene: NALCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6333 | NALCN | Zornitza Stark Gene: nalcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6333 | NALCN | Zornitza Stark Phenotypes for gene: NALCN were changed from to Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266; Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6332 | NALCN | Zornitza Stark Publications for gene: NALCN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6331 | NALCN | Zornitza Stark Mode of inheritance for gene: NALCN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6330 | NAGLU | Zornitza Stark Marked gene: NAGLU as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6330 | NAGLU | Zornitza Stark Gene: naglu has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6330 | NAGLU | Zornitza Stark Phenotypes for gene: NAGLU were changed from to Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6329 | NAGLU | Zornitza Stark Publications for gene: NAGLU were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6328 | NAGLU | Zornitza Stark Mode of inheritance for gene: NAGLU was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6327 | NAGA | Zornitza Stark Marked gene: NAGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6327 | NAGA | Zornitza Stark Gene: naga has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6327 | NAGA | Zornitza Stark Phenotypes for gene: NAGA were changed from Kanzaki disease, MIM# 609242; Schindler disease, type I and type II 609241; alpha-N-acetylgalactosaminidase deficiency MONDO:0017779 to Kanzaki disease, MIM# 609242; Schindler disease, type I and type II 609241; alpha-N-acetylgalactosaminidase deficiency MONDO:0017779 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6327 | NAGA | Zornitza Stark Phenotypes for gene: NAGA were changed from to Kanzaki disease, MIM# 609242; Schindler disease, type I and type II 609241; alpha-N-acetylgalactosaminidase deficiency MONDO:0017779 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6326 | NAGA | Zornitza Stark Publications for gene: NAGA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6325 | NAGA | Zornitza Stark Mode of inheritance for gene: NAGA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6324 | SCO2 | Zornitza Stark Marked gene: SCO2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6324 | SCO2 | Zornitza Stark Gene: sco2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6324 | SCO2 | Zornitza Stark Phenotypes for gene: SCO2 were changed from to Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6323 | SCO2 | Zornitza Stark Publications for gene: SCO2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6322 | SCO2 | Zornitza Stark Mode of inheritance for gene: SCO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6321 | SKI | Zornitza Stark Marked gene: SKI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6321 | SKI | Zornitza Stark Gene: ski has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6321 | SKI | Zornitza Stark Phenotypes for gene: SKI were changed from to Shprintzen-Goldberg syndrome, MIM# 182212; Neurodevelopmental disorder, MONDO:0700092, SKI-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6320 | SKI | Zornitza Stark Publications for gene: SKI were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6319 | SKI | Zornitza Stark Mode of inheritance for gene: SKI was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6318 | SKI | Zornitza Stark reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SKI-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6318 | SHH | Zornitza Stark Marked gene: SHH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6318 | SHH | Zornitza Stark Gene: shh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6318 | SHH | Zornitza Stark Phenotypes for gene: SHH were changed from to Holoprosencephaly 3 (MIM#142945) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6317 | SHH | Zornitza Stark Publications for gene: SHH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6316 | SHH | Zornitza Stark Mode of inheritance for gene: SHH was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6315 | LRRC7 | Zornitza Stark Marked gene: LRRC7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6315 | LRRC7 | Zornitza Stark Gene: lrrc7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6315 | LRRC7 | Zornitza Stark Phenotypes for gene: LRRC7 were changed from neurodevelopmental disorder (MONDO:0700092) to neurodevelopmental disorder (MONDO:0700092), LRRC7-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6314 | LRRC7 | Zornitza Stark reviewed gene: LRRC7: Rating: GREEN; Mode of pathogenicity: None; Publications: 39256359; Phenotypes: neurodevelopmental disorder (MONDO:0700092), LRRC7-related; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6314 | LRRC7 | Zornitza Stark Classified gene: LRRC7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6314 | LRRC7 | Zornitza Stark Gene: lrrc7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6313 | SECISBP2 | Zornitza Stark Phenotypes for gene: SECISBP2 were changed from #609698 THYROID HORMONE METABOLISM, ABNORMAL to Thyroid hormone metabolism, abnormal, 1, MIM# 609698 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6312 | SECISBP2 | Zornitza Stark Publications for gene: SECISBP2 were set to 16228000; 19602558; 21084748; 22247018 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6311 | SECISBP2 | Zornitza Stark Classified gene: SECISBP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6311 | SECISBP2 | Zornitza Stark Gene: secisbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6310 | SECISBP2 | Zornitza Stark reviewed gene: SECISBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 39315526; Phenotypes: Thyroid hormone metabolism, abnormal, 1, MIM# 609698; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6310 | FLVCR1 | Bryony Thompson Phenotypes for gene: FLVCR1 were changed from Ataxia, posterior column, with retinitis pigmentosa, MIM#609033 to neurodevelopmental disorder MONDO:0700092, FLVCR1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6309 | FLVCR1 | Bryony Thompson Publications for gene: FLVCR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6308 | FLVCR1 | Bryony Thompson Classified gene: FLVCR1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6308 | FLVCR1 | Bryony Thompson Gene: flvcr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | FLVCR1 | Bryony Thompson reviewed gene: FLVCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39306721; Phenotypes: neurodevelopmental disorder MONDO:0700092, FLVCR1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | LRRC7 |
Sangavi Sivagnanasundram gene: LRRC7 was added gene: LRRC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LRRC7 were set to 39256359 Phenotypes for gene: LRRC7 were set to neurodevelopmental disorder (MONDO:0700092) Review for gene: LRRC7 was set to GREEN Added comment: Well established gene-disease association. Neurodevelopmental disorder with a clinical spectrum - symptoms include ID, ADHD, aggression and in many cases, hyperphagia associate obesity. Heterozygous missense and LoF variants have been reported and functional assays were conducted on missense and truncating variants that support LoF mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | SHH | Chirag Patel reviewed gene: SHH: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22791840, 19057928; Phenotypes: Holoprosencephaly 3 (MIM#142945); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | SKI | Chirag Patel reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23023332, 23103230, 24736733, 30071989; Phenotypes: Shprintzen-Goldberg syndrome, MIM# 182212; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | SCO2 | Chirag Patel reviewed gene: SCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10545952, 10749987, 18924171; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | NAGA | Chirag Patel reviewed gene: NAGA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11313741, 31468281, 15619430, 8782044; Phenotypes: Kanzaki disease, MIM# 609242, Schindler disease, type I and type II 609241, alpha-N-acetylgalactosaminidase deficiency MONDO:0017779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | NAGLU | Chirag Patel reviewed gene: NAGLU: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8650226; Phenotypes: Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | NALCN | Chirag Patel reviewed gene: NALCN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25683120, 30167850, 23749988, 24075186; Phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266, Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6307 | USP9X | Ain Roesley Phenotypes for gene: USP9X were changed from Mental retardation, X-linked 99, XLR (MIM#300919) and XLD (MIM#300968) to Intellectual developmental disorder 99 MIM#300919; syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6306 | SGPL1 | Ain Roesley Phenotypes for gene: SGPL1 were changed from Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575) to Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6305 | SGPL1 | Ain Roesley Phenotypes for gene: SGPL1 were changed from Sphingosine Phosphate Lyase Insufficiency Syndrome; Nephrotic syndrome, type 14, MIM#617575 to Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NDUFA1 | Chirag Patel reviewed gene: NDUFA1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29506883, 19185523, 17262856, 21596602; Phenotypes: Mitochondrial complex I deficiency, nuclear type 12 MIM#301020; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NDUFS7 | Chirag Patel reviewed gene: NDUFS7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22644603; Phenotypes: Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NDUFS8 | Chirag Patel reviewed gene: NDUFS8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23430795, 9837812, 15159508, 22499348, 20818383, 20819849; Phenotypes: Mitochondrial complex I deficiency, nuclear type 2 MIM#618222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NDUFV1 | Chirag Patel reviewed gene: NDUFV1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34807224; Phenotypes: Mitochondrial complex I deficiency, nuclear type 4 MIM#618225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NEU1 | Chirag Patel reviewed gene: NEU1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8985184, 9054950, 11063730; Phenotypes: Sialidosis, type I and type II, MIM# 256550, MONDO:0009738; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NFIX | Chirag Patel reviewed gene: NFIX: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33034087, 29897170, 30548146, 25118028; Phenotypes: Sotos syndrome 2 (MIM#614753), Marshall-Smith syndrome, MIM# 602535; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NGLY1 | Chirag Patel reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: Congenital disorder of deglycosylation (OMIM 615273); Phenotypes: PMID: 24651605, 27388694, 32259258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | NKX2-1 | Chirag Patel reviewed gene: NKX2-1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10931427, 27066577, 26839702, 26103969, 23911641, 11854319, 24714694; Phenotypes: Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978, Chorea, hereditary benign MIM#118700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6304 | PPP2R5D | Ain Roesley Phenotypes for gene: PPP2R5D were changed from Mental retardation, autosomal dominant 35, MIM#616355 to Houge-Janssens syndrome 1, MIM#616355 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | NPC1 | Chirag Patel reviewed gene: NPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9211849, 11333381; Phenotypes: Niemann-Pick disease, type C1 and type D, MIM# 257220, MONDO:0009757; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | NPC2 | Chirag Patel reviewed gene: NPC2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11125141, 17470133; Phenotypes: Niemann-pick disease, type C2, MIM# 607625, MONDO:0011873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MTHFR | Chirag Patel commented on gene: MTHFR: Well-established gene-disease association (see OMIM entry). Homocystinuria due to MTHFR deficiency is classified as a metabolic disorder by NIH GARD (https://rarediseases.info.nih.gov/diseases/diseases-by-category/14/metabolic-disorders) and is an inborn error of folate metabolism. DD/ID can be seen in condition. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MTHFR | Chirag Patel reviewed gene: MTHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7920641; Phenotypes: Homocystinuria due to MTHFR deficiency MIM#236250, Disorders of folate metabolism and transport; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MYO5A | Chirag Patel reviewed gene: MYO5A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 32275080, 22711375, 25283056; Phenotypes: Griscelli syndrome, type 1 MIM#214450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | RAB27A | Chirag Patel reviewed gene: RAB27A: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MVK | Chirag Patel reviewed gene: MVK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29047407, 26409462; Phenotypes: Hyper-IgD syndrome (MIM#260920), Mevalonic aciduria (MIM#610377); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MTFMT | Chirag Patel reviewed gene: MTFMT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21907147, 23499752, 24461907, 22499348; Phenotypes: Combined oxidative phosphorylation deficiency 15, MIM# 614947, Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MRPS22 | Chirag Patel reviewed gene: MRPS22: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29566152,17873122, 25663021, 28752220; Phenotypes: Combined oxidative phosphorylation deficiency 5 MIM#611719, Ovarian dysgenesis 7 MIM#618117; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MOCS2 | Chirag Patel reviewed gene: MOCS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 10053004; Phenotypes: Molybdenum cofactor deficiency B MIM#252160, Disorders of molybdenum cofactor metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MUT | Chirag Patel reviewed gene: MUT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116, 1977311, 11528502, 12948746; Phenotypes: Methylmalonic aciduria, mut(0) type, MIM# 251000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MMADHC | Chirag Patel reviewed gene: MMADHC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116,27604308, 18385497; Phenotypes: Homocystinuria, cblD type, variant 1 MIM#277410, Methylmalonic aciduria and homocystinuria, cblD type MIM#277410, Methylmalonic aciduria, cblD type, variant 2 MIM#277410, Disorders of cobalamin absorption, transport and metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MMAB | Chirag Patel reviewed gene: MMAB: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MMAA | Chirag Patel reviewed gene: MMAA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MLC1 | Chirag Patel reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11254442, 18757878, 16652334; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MKS1 | Chirag Patel reviewed gene: MKS1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 17377820, 24886560, 19776033, 33193692, 27570071, 27377014, 18327255, 24608809; Phenotypes: Joubert syndrome 28, MIM# 617121, MONDO:0014928, Meckel syndrome 1, MIM# 249000, MONDO:0009571, Bardet-Biedl syndrome 13, MIM# 615990, MONDO:0014441; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MKKS | Chirag Patel reviewed gene: MKKS: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10973251, 10802661, 26900326; Phenotypes: McKusick-Kaufman syndrome, MIM# 236700, Bardet-Biedl syndrome 6, MIM# 605231, Retinitis pigmentosa; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MBOAT7 | Chirag Patel reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33335874, 32645526, 32744787, 31852446, 31282596, 30701556; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MAT1A | Chirag Patel reviewed gene: MAT1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7560086; Phenotypes: Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850, Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850, Disorders of the metabolism of sulphur amino acids; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MAP2K2 | Chirag Patel reviewed gene: MAP2K2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20358587, 16439621, 18042262; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | MAP2K1 | Chirag Patel reviewed gene: MAP2K1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 16439621, 17551924, 18042262, 20301365; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | ZDHHC16 | Ain Roesley Classified gene: ZDHHC16 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | ZDHHC16 | Ain Roesley Gene: zdhhc16 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | ZDHHC16 | Ain Roesley Marked gene: ZDHHC16 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | ZDHHC16 | Ain Roesley Gene: zdhhc16 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | ZDHHC16 | Ain Roesley Classified gene: ZDHHC16 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6303 | ZDHHC16 | Ain Roesley Gene: zdhhc16 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6302 | ZDHHC16 |
Ain Roesley gene: ZDHHC16 was added gene: ZDHHC16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZDHHC16 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZDHHC16 were set to 39313616 Phenotypes for gene: ZDHHC16 were set to neurodevelopmental disorder MONDO:0700092, ZDHHC16-related Review for gene: ZDHHC16 was set to AMBER gene: ZDHHC16 was marked as current diagnostic Added comment: 6 families including a pair of siblings Amber because 5 of the families had non specific phenotypes listed Abnormality of: the nervous system, metabolism/homeostasis, head/neck, immune system, the integument, the digestive system, the respiratory system, the endocrine system, Growth abnormality the skeletal system, the musculature, the eye Specific HPOs were provided for one individual (homoyzygous for a canonical splice) Abnormality of the face; Cerebellar hypoplasia; Developmental regression; Encephalopathy; Hyperreflexia; Hypertonia; Hypotonia; Inguinal hernia; Laryngomalacia; Microcephaly; Motor delay; Optic atrophy; Seizure; Spastic paraparesis; Spasticity; Talipes equinovarus; Umbilical hernia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6301 | EPB41L3 | Bryony Thompson Marked gene: EPB41L3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6301 | EPB41L3 | Bryony Thompson Gene: epb41l3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6301 | EPB41L3 | Bryony Thompson Classified gene: EPB41L3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6301 | EPB41L3 | Bryony Thompson Gene: epb41l3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6300 | EPB41L3 |
Bryony Thompson gene: EPB41L3 was added gene: EPB41L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EPB41L3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EPB41L3 were set to 39292993 Phenotypes for gene: EPB41L3 were set to neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063 Review for gene: EPB41L3 was set to GREEN Added comment: 6 cases from 5 unrelated consanguineous families (2nd & 3rd degree) with homozygous LoF variants and a neurodevelopmental condition, including ID and seizures. Epb41l3 shRNA-mediated downregulation in mouse oligodendroglia demonstrated impaired oligodendrocyte function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6299 | GCH1 | Bryony Thompson Marked gene: GCH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6299 | GCH1 | Bryony Thompson Gene: gch1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6299 | GCH1 | Bryony Thompson Phenotypes for gene: GCH1 were changed from to GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6298 | GCH1 | Bryony Thompson Publications for gene: GCH1 were set to 22473768; 7869202 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6297 | GCH1 | Bryony Thompson Publications for gene: GCH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6296 | GCH1 | Bryony Thompson Mode of inheritance for gene: GCH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6295 | GCH1 | Bryony Thompson reviewed gene: GCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22473768, 7869202; Phenotypes: GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6295 | GAMT | Bryony Thompson Marked gene: GAMT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6295 | GAMT | Bryony Thompson Gene: gamt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6295 | GAMT | Bryony Thompson Phenotypes for gene: GAMT were changed from to guanidinoacetate methyltransferase deficiency MONDO:0012999 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6294 | GAMT | Bryony Thompson Publications for gene: GAMT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6293 | GAMT | Bryony Thompson Mode of inheritance for gene: GAMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6292 | GAMT | Bryony Thompson reviewed gene: GAMT: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301745; Phenotypes: guanidinoacetate methyltransferase deficiency MONDO:0012999; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6292 | GALE | Bryony Thompson Marked gene: GALE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6292 | GALE | Bryony Thompson Gene: gale has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6292 | GALE | Bryony Thompson Phenotypes for gene: GALE were changed from to galactose epimerase deficiency MONDO:0009257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6291 | GALE | Bryony Thompson Publications for gene: GALE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6290 | GALE | Bryony Thompson Mode of inheritance for gene: GALE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6289 | GALE | Bryony Thompson reviewed gene: GALE: Rating: GREEN; Mode of pathogenicity: None; Publications: 21290786; Phenotypes: galactose epimerase deficiency MONDO:0009257; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6289 | GALC | Bryony Thompson Marked gene: GALC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6289 | GALC | Bryony Thompson Gene: galc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6289 | GALC | Bryony Thompson Phenotypes for gene: GALC were changed from to Krabbe disease MONDO:000949 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6288 | GALC | Bryony Thompson Publications for gene: GALC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6287 | GALC | Bryony Thompson Mode of inheritance for gene: GALC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6286 | GALC | Bryony Thompson reviewed gene: GALC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301416; Phenotypes: Krabbe disease MONDO:000949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6286 | GABRB2 | Bryony Thompson Marked gene: GABRB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6286 | GABRB2 | Bryony Thompson Gene: gabrb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6286 | GABRB2 | Bryony Thompson Phenotypes for gene: GABRB2 were changed from to epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6285 | GABRB2 | Bryony Thompson Publications for gene: GABRB2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6284 | GABRB2 | Bryony Thompson Mode of inheritance for gene: GABRB2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6283 | GABRB2 | Bryony Thompson reviewed gene: GABRB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 38996765; Phenotypes: epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6283 | FUCA1 | Bryony Thompson Marked gene: FUCA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6283 | FUCA1 | Bryony Thompson Gene: fuca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6283 | FUCA1 | Bryony Thompson Phenotypes for gene: FUCA1 were changed from to Fucosidosis MONDO:0009254 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6282 | FUCA1 | Bryony Thompson Publications for gene: FUCA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6281 | FUCA1 | Bryony Thompson Mode of inheritance for gene: FUCA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6280 | FUCA1 | Bryony Thompson reviewed gene: FUCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33266441; Phenotypes: Fucosidosis MONDO:0009254; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6280 | FOXRED1 | Bryony Thompson Marked gene: FOXRED1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6280 | FOXRED1 | Bryony Thompson Gene: foxred1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6280 | FOXRED1 | Bryony Thompson Phenotypes for gene: FOXRED1 were changed from to Mitochondrial disease MONDO:0044970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6279 | FOXRED1 | Bryony Thompson Publications for gene: FOXRED1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6278 | FOXRED1 | Bryony Thompson Mode of inheritance for gene: FOXRED1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6277 | FOXRED1 | Bryony Thompson reviewed gene: FOXRED1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31434271, 20818383, 20858599; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6277 | FOXG1 | Bryony Thompson Marked gene: FOXG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6277 | FOXG1 | Bryony Thompson Gene: foxg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6277 | FOXG1 | Bryony Thompson Phenotypes for gene: FOXG1 were changed from to FOXG1 disorder MONDO:0100040 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6276 | FOXG1 | Bryony Thompson Publications for gene: FOXG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6275 | FOXG1 | Bryony Thompson Mode of inheritance for gene: FOXG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6274 | FOXG1 | Bryony Thompson reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571142, 19578037, 19564653, 28661489; Phenotypes: FOXG1 disorder MONDO:0100040; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6274 | FKTN | Bryony Thompson Marked gene: FKTN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6274 | FKTN | Bryony Thompson Gene: fktn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6274 | FKTN | Bryony Thompson Phenotypes for gene: FKTN were changed from to Myopathy caused by variation in FKTN MONDO:0700067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6273 | FKTN | Bryony Thompson Publications for gene: FKTN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6272 | FKTN | Bryony Thompson Mode of inheritance for gene: FKTN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6271 | FKTN | Bryony Thompson reviewed gene: FKTN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301385; Phenotypes: Myopathy caused by variation in FKTN MONDO:0700067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6271 | FKRP | Bryony Thompson Marked gene: FKRP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6271 | FKRP | Bryony Thompson Gene: fkrp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6271 | FKRP | Bryony Thompson Phenotypes for gene: FKRP were changed from myopathy caused by variation in FKRP MONDO:0700066 to myopathy caused by variation in FKRP MONDO:0700066 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6270 | FKRP | Bryony Thompson Phenotypes for gene: FKRP were changed from to myopathy caused by variation in FKRP MONDO:0700066 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6269 | FKRP | Bryony Thompson Publications for gene: FKRP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6268 | FKRP | Bryony Thompson Mode of inheritance for gene: FKRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6267 | FKRP | Bryony Thompson reviewed gene: FKRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 33200426, 11053680, 12654965, 14652796, 15121789; Phenotypes: myopathy caused by variation in FKRP MONDO:0700066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6267 | FIG4 | Bryony Thompson Marked gene: FIG4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6267 | FIG4 | Bryony Thompson Gene: fig4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6267 | FIG4 | Bryony Thompson Phenotypes for gene: FIG4 were changed from to Charcot-Marie-Tooth disease MONDO:0015626 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6266 | FIG4 | Bryony Thompson Publications for gene: FIG4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6265 | FIG4 | Bryony Thompson Mode of inheritance for gene: FIG4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6264 | FIG4 | Bryony Thompson reviewed gene: FIG4: Rating: GREEN; Mode of pathogenicity: None; Publications: 32385905, 34122524, 36529678; Phenotypes: Charcot-Marie-Tooth disease MONDO:0015626; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6264 | FBXL4 | Bryony Thompson Marked gene: FBXL4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6264 | FBXL4 | Bryony Thompson Gene: fbxl4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6264 | FBXL4 | Bryony Thompson Phenotypes for gene: FBXL4 were changed from to Leigh syndrome MONDO:0009723 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6263 | FBXL4 | Bryony Thompson Publications for gene: FBXL4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6262 | FBXL4 | Bryony Thompson reviewed gene: FBXL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 28383868; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6262 | FBXL4 | Bryony Thompson Mode of inheritance for gene: FBXL4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6261 | FAT4 | Bryony Thompson Marked gene: FAT4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6261 | FAT4 | Bryony Thompson Gene: fat4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6261 | FAT4 | Bryony Thompson Phenotypes for gene: FAT4 were changed from to Hennekam syndrome MONDO:0016256; van Maldergem syndrome MONDO:0017813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6260 | FAT4 | Bryony Thompson Publications for gene: FAT4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6259 | FAT4 | Bryony Thompson Mode of inheritance for gene: FAT4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6258 | FAT4 | Bryony Thompson reviewed gene: FAT4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681106; Phenotypes: Hennekam syndrome MONDO:0016256, van Maldergem syndrome MONDO:0017813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6258 | FAM20C | Bryony Thompson Marked gene: FAM20C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6258 | FAM20C | Bryony Thompson Gene: fam20c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6258 | FAM20C | Bryony Thompson Phenotypes for gene: FAM20C were changed from to lethal osteosclerotic bone dysplasia MONDO:0009821 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6257 | FAM20C | Bryony Thompson Publications for gene: FAM20C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6256 | FAM20C | Bryony Thompson Mode of inheritance for gene: FAM20C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6255 | FAM20C | Bryony Thompson reviewed gene: FAM20C: Rating: GREEN; Mode of pathogenicity: None; Publications: 34360805; Phenotypes: lethal osteosclerotic bone dysplasia MONDO:0009821; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6255 | FAM126A | Bryony Thompson Marked gene: FAM126A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6255 | FAM126A | Bryony Thompson Gene: fam126a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6255 | FAM126A | Bryony Thompson Phenotypes for gene: FAM126A were changed from to hypomyelinating leukodystrophy 5 MONDO:0012514 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6254 | FAM126A | Bryony Thompson Publications for gene: FAM126A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6253 | FAM126A | Bryony Thompson Mode of inheritance for gene: FAM126A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6252 | FAM126A | Bryony Thompson reviewed gene: FAM126A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301737; Phenotypes: hypomyelinating leukodystrophy 5 MONDO:0012514; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6252 | ESCO2 | Bryony Thompson Marked gene: ESCO2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6252 | ESCO2 | Bryony Thompson Gene: esco2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6252 | ESCO2 | Bryony Thompson Phenotypes for gene: ESCO2 were changed from to Roberts-SC phocomelia syndrome MONDO:0100253 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6251 | ESCO2 | Bryony Thompson Publications for gene: ESCO2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6250 | ESCO2 | Bryony Thompson Mode of inheritance for gene: ESCO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6249 | ESCO2 | Bryony Thompson reviewed gene: ESCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301332; Phenotypes: Roberts-SC phocomelia syndrome MONDO:0100253; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6249 | INPP5K | Sangavi Sivagnanasundram reviewed gene: INPP5K: Rating: GREEN; Mode of pathogenicity: None; Publications: 28190456, 28190459; Phenotypes: congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6249 | IKBKG | Sangavi Sivagnanasundram reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301645; Phenotypes: Incontinentia pigmenti MONDO:0010631; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6249 | RAF1 | Chirag Patel reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 17603483, 17603482, 31145547, 31030682, 29271604; Phenotypes: Noonan syndrome 5, MIM# 611553; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6249 | RIT1 | Chirag Patel reviewed gene: RIT1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 23791108, 25124994, 24939608, 27101134; Phenotypes: Noonan syndrome 8, MIM# 615355; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6249 | RRAS2 | Chirag Patel Classified gene: RRAS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6249 | RRAS2 | Chirag Patel Gene: rras2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | RRAS2 | Chirag Patel reviewed gene: RRAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | PTPN11 | Chirag Patel reviewed gene: PTPN11: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 11992261,21533187, 24935154; Phenotypes: LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines), Metachondromatosis, 156250 AD, Noonan syndrome 1, 163950 AD, Leukemia, juvenile myelomonocytic, somatic, 607785; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | KRAS | Chirag Patel reviewed gene: KRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 21797849, 16474404, 16474405, 16773572, 17056636; Phenotypes: Noonan syndrome 3, MIM# 609942, Cardiofaciocutaneous syndrome 2, MIM# 615278; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | NRAS | Chirag Patel reviewed gene: NRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 19966803, 26467218, 28594414; Phenotypes: Noonan syndrome 6, MIM# 613224; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | NPHP1 | Chirag Patel reviewed gene: NPHP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15138899, 32139166, 28347285, 8852662, 9856524; Phenotypes: Joubert syndrome 4, MIM# 609583, Nephronophthisis 1, juvenile, MIM# 256100, Senior-Loken syndrome-1, MIM# 266900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | OTX2 | Chirag Patel reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24167467, 25589041, 31969185,; Phenotypes: Microphthalmia, syndromic 5, MIM# 610125, Pituitary hormone deficiency, combined, 6, MIM# 613986, Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125, Otocephaly-dysgnathia complex; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | OPA3 | Chirag Patel reviewed gene: OPA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25159689, 31119193, 31928268; Phenotypes: 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR, Optic atrophy 3 with cataract (MIM#165300), AD; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | OCLN | Chirag Patel reviewed gene: OCLN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20727516, 32240828, 29192239, 28386946; Phenotypes: Pseudo-TORCH syndrome 1, MIM#251290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | ERCC8 | Bryony Thompson Marked gene: ERCC8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | ERCC8 | Bryony Thompson Gene: ercc8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6248 | ERCC8 | Bryony Thompson Phenotypes for gene: ERCC8 were changed from to Cockayne syndrome type 1 MONDO:0019569 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6247 | ERCC8 | Bryony Thompson Publications for gene: ERCC8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6246 | ERCC8 | Bryony Thompson Mode of inheritance for gene: ERCC8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6245 | ERCC8 | Bryony Thompson reviewed gene: ERCC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301516; Phenotypes: Cockayne syndrome type 1 MONDO:0019569; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6245 | ERCC6L2 | Bryony Thompson Marked gene: ERCC6L2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6245 | ERCC6L2 | Bryony Thompson Gene: ercc6l2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6245 | ERCC6L2 | Bryony Thompson Phenotypes for gene: ERCC6L2 were changed from to pancytopenia-developmental delay syndrome MONDO:0014317 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6244 | ERCC6L2 | Bryony Thompson Publications for gene: ERCC6L2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6243 | ERCC6L2 | Bryony Thompson Mode of inheritance for gene: ERCC6L2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6242 | ERCC6L2 | Bryony Thompson reviewed gene: ERCC6L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36790458; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6242 | ERCC6 | Bryony Thompson Marked gene: ERCC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6242 | ERCC6 | Bryony Thompson Gene: ercc6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6242 | ERCC6 | Bryony Thompson Phenotypes for gene: ERCC6 were changed from to Cockayne spectrum with or without cerebrooculofacioskeletal syndrome MONDO:0100506 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6241 | ERCC6 | Bryony Thompson Publications for gene: ERCC6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6240 | ERCC6 | Bryony Thompson Mode of inheritance for gene: ERCC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6239 | ERCC3 | Bryony Thompson Marked gene: ERCC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6239 | ERCC3 | Bryony Thompson Gene: ercc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6239 | ERCC3 | Bryony Thompson Phenotypes for gene: ERCC3 were changed from to xeroderma pigmentosum group B MONDO:0012531 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6238 | ERCC3 | Bryony Thompson Publications for gene: ERCC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6237 | ERCC3 | Bryony Thompson Mode of inheritance for gene: ERCC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6236 | ERCC2 | Bryony Thompson Phenotypes for gene: ERCC2 were changed from xeroderma pigmentosum group D MONDO:0010212 to xeroderma pigmentosum group D MONDO:0010212; trichothiodystrophy 1, photosensitive MONDO:0011125; cerebrooculofacioskeletal syndrome 2 MONDO:0012553 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6235 | ERCC2 | Bryony Thompson Marked gene: ERCC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6235 | ERCC2 | Bryony Thompson Gene: ercc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6235 | ERCC2 | Bryony Thompson Phenotypes for gene: ERCC2 were changed from to xeroderma pigmentosum group D MONDO:0010212 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6234 | ERCC2 | Bryony Thompson Publications for gene: ERCC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6233 | ERCC2 | Bryony Thompson Mode of inheritance for gene: ERCC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6232 | EP300 | Bryony Thompson Marked gene: EP300 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6232 | EP300 | Bryony Thompson Gene: ep300 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6232 | EP300 | Bryony Thompson Phenotypes for gene: EP300 were changed from to Rubinstein-Taybi syndrome MONDO:0019188 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6231 | EP300 | Bryony Thompson Publications for gene: EP300 were set to https://search.clinicalgenome.org/CCID:004751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6230 | EP300 | Bryony Thompson Publications for gene: EP300 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6229 | EP300 | Bryony Thompson Mode of inheritance for gene: EP300 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6228 | ELOVL4 | Bryony Thompson Marked gene: ELOVL4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6228 | ELOVL4 | Bryony Thompson Gene: elovl4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6228 | ELOVL4 | Bryony Thompson Phenotypes for gene: ELOVL4 were changed from to congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6227 | ELOVL4 | Bryony Thompson Publications for gene: ELOVL4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6226 | ELOVL4 | Bryony Thompson Mode of inheritance for gene: ELOVL4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6225 | EIF2AK3 | Bryony Thompson Marked gene: EIF2AK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6225 | EIF2AK3 | Bryony Thompson Gene: eif2ak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6225 | EIF2AK3 | Bryony Thompson Mode of inheritance for gene: EIF2AK3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6224 | EIF2AK3 | Bryony Thompson Publications for gene: EIF2AK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6223 | DIAPH1 | Bryony Thompson Publications for gene: DIAPH1 were set to 24781755; 26463574 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | DIAPH1 | Bryony Thompson reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39076976, 24781755, 26463574, 33662367; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | ERCC6L2 | Ken Lee Wan reviewed gene: ERCC6L2: Rating: AMBER; Mode of pathogenicity: None; Publications: 24507776, 27185855, 28815563, 29633571; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | ERCC3 | Ken Lee Wan reviewed gene: ERCC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group B MONDO:0012531; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | ERCC2 | Ken Lee Wan reviewed gene: ERCC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group D MONDO:0010212, trichothiodystrophy 1, photosensitive MONDO:0011125, cerebrooculofacioskeletal syndrome 2 MONDO:0012553; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | EP300 |
Ken Lee Wan changed review comment from: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature, and intellectual disability (https://search.clinicalgenome.org/CCID:004751). Mechanism of disease: loss of function; to: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature and intellectual disability (https://search.clinicalgenome.org/CCID:004751). Mechanism of disease: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | EP300 | Ken Lee Wan reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rubinstein-Taybi syndrome MONDO:0019188; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | ELOVL4 | Ken Lee Wan reviewed gene: ELOVL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 37592902; Phenotypes: congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | IFT172 | Sangavi Sivagnanasundram reviewed gene: IFT172: Rating: AMBER; Mode of pathogenicity: None; Publications: 24290075, 26763875; Phenotypes: Bardet-Biedl syndrome MONDO:0015229; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | IFIH1 |
Sangavi Sivagnanasundram changed review comment from: ID is a prominent feature of this condition in most cases and those affected will likely have severe intellectual and physical disability. GoF is the mechanism of disease.; to: ID is a prominent feature of this condition in most cases and those affected will likely have severe intellectual and physical disability. GoF is the mechanism of disease. Classified as DEFINITIVE by ClinGen's Leukodystrophy and Leukoencephalopathy GCEP on 23/08/2024 - https://search.clinicalgenome.org/CCID:008354 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | IFIH1 | Sangavi Sivagnanasundram reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 20301648, 25620204; Phenotypes: IFIH1-related type 1 interferonopathy MONDO:0700262; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | ERCC6 | Mark Cleghorn reviewed gene: ERCC6: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301516; Phenotypes: Cockayne syndrome type B, Cerebrooculofacioskeletal syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | IDUA | Sangavi Sivagnanasundram reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301341; Phenotypes: mucopolysaccharidosis type 1 MONDO:0001586; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | IDH2 | Sangavi Sivagnanasundram reviewed gene: IDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20847235, 35359529; Phenotypes: mitochondrial disease MONDO:0044970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HTRA2 | Sangavi Sivagnanasundram reviewed gene: HTRA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27208207, 27696117, 30114719, 32445293; Phenotypes: 3-methylglutaconic aciduria type 8 MONDO:0044723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HSPD1 | Sangavi Sivagnanasundram reviewed gene: HSPD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 18571143, 27405012; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM #612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HSD17B10 | Sangavi Sivagnanasundram reviewed gene: HSD17B10: Rating: GREEN; Mode of pathogenicity: None; Publications: 22132097, 17618155; Phenotypes: HSD10 mitochondrial disease MONDO:0010327; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HPD | Sangavi Sivagnanasundram reviewed gene: HPD: Rating: AMBER; Mode of pathogenicity: None; Publications: 31537781; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HMGCL | Sangavi Sivagnanasundram reviewed gene: HMGCL: Rating: AMBER; Mode of pathogenicity: None; Publications: 36771238, 35646072; Phenotypes: 3-hydroxy-3-methylglutaric aciduria MONDO:0009520; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HLCS | Sangavi Sivagnanasundram reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: 18974016, 18429047, 12124727; Phenotypes: holocarboxylase synthetase deficiency MONDO:0009666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HIBCH | Sangavi Sivagnanasundram reviewed gene: HIBCH: Rating: GREEN; Mode of pathogenicity: None; Publications: 24299452, 30847210, 17160907, 26163321, 26026795, 31523596, 32022391, 24299452, 32677093; Phenotypes: 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603, Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HEXB | Sangavi Sivagnanasundram reviewed gene: HEXB: Rating: GREEN; Mode of pathogenicity: None; Publications: 35420740; Phenotypes: Sandhoff disease MONDO:0010006; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HEXA | Sangavi Sivagnanasundram reviewed gene: HEXA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301397; Phenotypes: Tay-Sachs disease MONDO:0010100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HESX1 | Sangavi Sivagnanasundram reviewed gene: HESX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 19623216, 30888394; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HEPACAM | Sangavi Sivagnanasundram reviewed gene: HEPACAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 21419380, 24202401, 27389245, 31372844, 21419380, 24202401, 27322623; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490, Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HCCS | Sangavi Sivagnanasundram reviewed gene: HCCS: Rating: AMBER; Mode of pathogenicity: None; Publications: 18950397; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | HADHA | Sangavi Sivagnanasundram reviewed gene: HADHA: Rating: AMBER; Mode of pathogenicity: None; Publications: 36063482; Phenotypes: long chain 3-hydroxyacyl-CoA dehydrogenase deficiency MONDO:0012173; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GTF2H5 | Sangavi Sivagnanasundram reviewed gene: GTF2H5: Rating: AMBER; Mode of pathogenicity: None; Publications: 30359777, 24986372; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GRM1 | Sangavi Sivagnanasundram reviewed gene: GRM1: Rating: AMBER; Mode of pathogenicity: None; Publications: 26308914, 22901947, 31319223, 36675067; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GNS | Sangavi Sivagnanasundram reviewed gene: GNS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31536183, 25851924, 17998446, 6450420; Phenotypes: mucopolysaccharidosis type 3D MONDO:0009658; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GNPTAB | Sangavi Sivagnanasundram reviewed gene: GNPTAB: Rating: ; Mode of pathogenicity: None; Publications: 20301728; Phenotypes: GNPTAB-mucolipidosis MONDO:0100122; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GNPAT | Sangavi Sivagnanasundram reviewed gene: GNPAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843043, 19270340, 21990100; Phenotypes: glyceronephosphate O-acyltransferase deficiency MONDO:0100273; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GMPPB | Sangavi Sivagnanasundram reviewed gene: GMPPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23768512, 26133662, 27147698; Phenotypes: myopathy caused by variation in GMPPB MONDO:0700084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GMPPA | Sangavi Sivagnanasundram reviewed gene: GMPPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 31898852, 35607266; Phenotypes: alacrima, achalasia, and intellectual disability syndrome MONDO:0014219; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | GM2A | Sangavi Sivagnanasundram reviewed gene: GM2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33819415, 20301397; Phenotypes: Tay-Sachs disease AB variant MONDO:0010099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | DIAPH1 | Zornitza Stark Marked gene: DIAPH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | DIAPH1 | Zornitza Stark Gene: diaph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | DIAPH1 | Zornitza Stark Phenotypes for gene: DIAPH1 were changed from to progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6221 | DIAPH1 | Zornitza Stark Publications for gene: DIAPH1 were set to 24781755; 26463574 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6220 | DIAPH1 | Zornitza Stark Publications for gene: DIAPH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6220 | DIAPH1 | Zornitza Stark Mode of inheritance for gene: DIAPH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6219 | DIAPH1 | Zornitza Stark reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6219 | EIF2AK3 | Ken Lee Wan reviewed gene: EIF2AK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20202148; Phenotypes: Wolcott-Rallison syndrome MONDO:0009192; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6219 | DYNC1H1 | Zornitza Stark Marked gene: DYNC1H1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6219 | DYNC1H1 | Zornitza Stark Gene: dync1h1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6219 | DYNC1H1 | Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to dyneinopathy MONDO:1040031 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6218 | DYNC1H1 | Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6217 | DYNC1H1 |
Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism. Mechanism of disease: gain of function (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6217 | DIS3L2 | Zornitza Stark Marked gene: DIS3L2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6217 | DIS3L2 | Zornitza Stark Gene: dis3l2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6217 | DIS3L2 | Zornitza Stark Phenotypes for gene: DIS3L2 were changed from to Perlman syndrome MONDO:0009965 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6216 | DIS3L2 | Zornitza Stark Publications for gene: DIS3L2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6215 | DIAPH1 |
Ken Lee Wan changed review comment from: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development, and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632). Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).; to: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632). Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6215 | DIS3L2 | Zornitza Stark Mode of inheritance for gene: DIS3L2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6214 | DNMT3B |
Ken Lee Wan changed review comment from: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function; to: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9 and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6214 | DYNC1H1 |
Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6214 | DYNC1H1 |
Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM#600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6214 | DYNC1H1 | Ken Lee Wan reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: dyneinopathy MONDO:1040031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6214 | DIS3L2 | Zornitza Stark Mode of inheritance for gene: DIS3L2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6213 | DNAJC19 | Zornitza Stark Marked gene: DNAJC19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6213 | DNAJC19 | Zornitza Stark Gene: dnajc19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6213 | DNAJC19 | Zornitza Stark Phenotypes for gene: DNAJC19 were changed from 3-methylglutaconic aciduria type 5 MONDO:0012435 to 3-methylglutaconic aciduria type 5 MONDO:0012435 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6212 | DNAJC19 | Zornitza Stark Phenotypes for gene: DNAJC19 were changed from to 3-methylglutaconic aciduria type 5 MONDO:0012435 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6211 | DNAJC19 | Zornitza Stark Mode of inheritance for gene: DNAJC19 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6210 | DNAJC19 | Zornitza Stark Mode of inheritance for gene: DNAJC19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6209 | DNMT3B | Zornitza Stark Marked gene: DNMT3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6209 | DNMT3B | Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6209 | DNMT3B | Zornitza Stark Phenotypes for gene: DNMT3B were changed from to immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6208 | DNMT3B | Zornitza Stark Mode of inheritance for gene: DNMT3B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6207 | DNMT3B | Ken Lee Wan reviewed gene: DNMT3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6207 | DNAJC19 | Ken Lee Wan reviewed gene: DNAJC19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria type 5 MONDO:0012435; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6207 | DIS3L2 |
Ken Lee Wan changed review comment from: Perlman syndrome is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649) Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000). PMID 16278893: 6 out of 22 patients have developmental delay PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay. PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay Mechanism of disease causation: loss of function; to: DIS3L2 is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649) Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000). PMID 16278893: 6 out of 22 patients have developmental delay PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay. PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay Mechanism of disease causation: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6207 | DIS3L2 | Ken Lee Wan reviewed gene: DIS3L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16278893, 22306653, 28328139; Phenotypes: Perlman syndrome MONDO:0009965; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6207 | DIAPH1 | Ken Lee Wan reviewed gene: DIAPH1: Rating: AMBER; Mode of pathogenicity: None; Publications: 24781755, 26463574; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6207 | RBSN | Zornitza Stark Phenotypes for gene: RBSN were changed from intellectual disability, MONDO:0001071 to Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6206 | RBSN | Zornitza Stark reviewed gene: RBSN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6206 | RNU2-2P | Zornitza Stark Marked gene: RNU2-2P as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6206 | RNU2-2P | Zornitza Stark Gene: rnu2-2p has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6206 | RNU2-2P | Zornitza Stark Classified gene: RNU2-2P as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6206 | RNU2-2P | Zornitza Stark Gene: rnu2-2p has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6205 | RNU2-2P |
Zornitza Stark gene: RNU2-2P was added gene: RNU2-2P was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU2-2P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 Phenotypes for gene: RNU2-2P were set to Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related Review for gene: RNU2-2P was set to GREEN Added comment: 15 individuals reported with de novo, recurrent variants in this gene at nucleotide positions 4 and 35. The disorder is characterized by intellectual disability, neurodevelopmental delay, autistic behavior, microcephaly, hypotonia, epilepsy and hyperventilation. All cases display a severe and complex seizure phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6204 | REPS2 | Bryony Thompson Marked gene: REPS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6204 | REPS2 | Bryony Thompson Gene: reps2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6204 | REPS2 | Bryony Thompson Classified gene: REPS2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6204 | REPS2 | Bryony Thompson Gene: reps2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6203 | TTL | Bryony Thompson Marked gene: TTL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6203 | TTL | Bryony Thompson Gene: ttl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6203 | TTL | Bryony Thompson Classified gene: TTL as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6203 | TTL | Bryony Thompson Gene: ttl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6202 | GPN2 | Bryony Thompson Marked gene: GPN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6202 | GPN2 | Bryony Thompson Gene: gpn2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6202 | GPN2 | Bryony Thompson Classified gene: GPN2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6202 | GPN2 | Bryony Thompson Gene: gpn2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6201 | FKBP4 | Bryony Thompson Marked gene: FKBP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6201 | FKBP4 | Bryony Thompson Gene: fkbp4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6201 | FKBP4 | Bryony Thompson Classified gene: FKBP4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6201 | FKBP4 | Bryony Thompson Gene: fkbp4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6200 | EIF3I | Bryony Thompson Marked gene: EIF3I as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6200 | EIF3I | Bryony Thompson Gene: eif3i has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6200 | EIF3I | Bryony Thompson Classified gene: EIF3I as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6200 | EIF3I | Bryony Thompson Gene: eif3i has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6199 | EIF3I | Bryony Thompson Classified gene: EIF3I as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6199 | EIF3I | Bryony Thompson Gene: eif3i has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6198 | CEP76 | Bryony Thompson Marked gene: CEP76 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6198 | CEP76 | Bryony Thompson Gene: cep76 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6198 | CEP76 | Bryony Thompson Classified gene: CEP76 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6198 | CEP76 | Bryony Thompson Gene: cep76 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6197 | MRAS | Krithika Murali Mode of inheritance for gene: MRAS was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6197 | MRAS | Krithika Murali Classified gene: MRAS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6197 | MRAS | Krithika Murali Gene: mras has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6196 | MRAS | Krithika Murali Marked gene: MRAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6196 | MRAS | Krithika Murali Gene: mras has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6196 | MRAS |
Krithika Murali gene: MRAS was added gene: MRAS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MRAS were set to Noonan syndrome 11 - MIM#618499 Review for gene: MRAS was set to GREEN Added comment: Developmental delay is a phenotypic feature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6195 | CEP76 |
Mark Cleghorn gene: CEP76 was added gene: CEP76 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038; Joubert syndrome; Bardet-Biedl syndrome; retinitis pigmentosa Penetrance for gene: CEP76 were set to unknown Review for gene: CEP76 was set to GREEN Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago ESHG presentation 4/6/24, unpublished CEP76 associated with syndromic ciliopathy CEP76 localizes to centrioles and basal body primary cilia Role in normal centriolar duplication Index case Bardet Biedl syndrome Compound heterozygous pLoF variants in CEP76 Via Gene matcher 7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum: Obesity Ocular phenotype Structural brain anomalies Renal? 3/7 families clinical Dx Joubert syndrome 1/7 BBS 1/7 GDD/ID NOS 2/7 retinitis pigmentosa (1 of these with learning difficulties) Mixture of biallelic pLOF and missense variant CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6195 | EIF3I |
Mark Cleghorn gene: EIF3I was added gene: EIF3I was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EIF3I were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: EIF3I were set to unknown Review for gene: EIF3I was set to AMBER Added comment: Marcello Scala, Genoa ESHG presentation 4/6/24, unpublished De novo EIF3I missense variants as a cause for novel NDD syndrome EIF3 complex involved in regulating initiation of mRNA translation Negative regulator of the TGF beta pathway 8 individuals from 8 families Mod/severe GDD or ID Short stature Midline brain anomalies (hypoplasia/agenesis of corpus callosum and pituitary hypoplasia) Frontal bossing, hypertelorism, long philtrum All w rare de novo missense variants om EIF3I, clustering within highly conserved WD repeats Functional studies Transfected HEK293 cell studies suggested EIF3I protein from variant alleles (from patients above) had disrupted interaction with other EIF subunits, and cells had reduced protein synthesis overall No animal models Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6195 | DDHD2 | Bryony Thompson Phenotypes for gene: DDHD2 were changed from hereditary spastic paraplegia 54 MONDO:0014018 to hereditary spastic paraplegia 54 MONDO:0014018 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6194 | DDHD2 | Bryony Thompson Marked gene: DDHD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6194 | DDHD2 | Bryony Thompson Gene: ddhd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6194 | DDHD2 | Bryony Thompson Phenotypes for gene: DDHD2 were changed from to hereditary spastic paraplegia 54 MONDO:0014018 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6193 | DDHD2 | Bryony Thompson Publications for gene: DDHD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6192 | DDHD2 | Bryony Thompson Mode of inheritance for gene: DDHD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6191 | DDHD2 | Bryony Thompson reviewed gene: DDHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23486545, 23176823, 36090575, 26113134, 25417924; Phenotypes: hereditary spastic paraplegia 54 MONDO:0014018; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6191 | DDC | Bryony Thompson Marked gene: DDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6191 | DDC | Bryony Thompson Gene: ddc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6191 | DDC | Bryony Thompson Publications for gene: DDC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6190 | DDC | Bryony Thompson Mode of inheritance for gene: DDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6189 | DDC | Bryony Thompson reviewed gene: DDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 37824694; Phenotypes: Aromatic L-amino acid decarboxylase deficiency MONDO:0012084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6189 | FKBP4 |
Mark Cleghorn gene: FKBP4 was added gene: FKBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: FKBP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FKBP4 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: FKBP4 were set to unknown Review for gene: FKBP4 was set to AMBER Added comment: Rebecca Yarwood, University of Manchester ESHG presentation 4/6/24, unpublished Bilalleic FKBP4 w NDD + DSD Protein has functions in hormone receptor trafficking FKPB4 highly expressed in stem cell and progenitor cells in gonad and neuronal degeneration Index case Severe GDD abN external genitalia CV AbN FBBP4 p.E196* Via GeneMatcher 7 families (12 individuals) 12/12 severe GDD/ID 9/10 microcephaly 11/12 external genital abnormalities (details not provided) All w homozygous pLoF variants (mixture of canonical splice, frameshift, nonsense) Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6189 | MED16 | Bryony Thompson Classified gene: MED16 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6189 | MED16 | Bryony Thompson Gene: med16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | MED16 |
Mark Cleghorn gene: MED16 was added gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED16 were set to unknown Review for gene: MED16 was set to GREEN Added comment: MED16 Charlotte Guillouet, Imagine institute Paris ESHG presentation 4/6/24, unpublished MED16 is part of tail of ‘mediator complex’ Plays a role in enhancer/promotor regions Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders Cases index family Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly WES: biallelic MED16 p.Asp217Asn Via genematcher 16 families total, 22 individuals, homozygous or compound het rare MED16 variants Mixture of pLoF and missense variants Motor delay in 16/17 DD or ID in 17/17 Speech delay in 15/15 6/19 ToF 7/19 other septal/aortic defects 6/18 deafness 11/18 microretognathia 6/17 cleft palate 8/19 preauricular tags 9/20 puffy eyelids 12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip) 7/20 corpus callosum anomalies Not clear that functional work recapitulated phenotype as yet? Immunofluroescence on HeLa cells transfected with variants observed ?conclusion MED16 knockout mouse > growth delay, pre weaning lethality MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | LARS2 | Chirag Patel reviewed gene: LARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29205794, 32423379, 30737337, 26537577, 23541342; Phenotypes: Perrault syndrome 4, MIM# 615300, Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | LARGE1 | Chirag Patel reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 12966029, 19067344, 17436019, 21248746, 19299310; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | LAMP2 | Chirag Patel reviewed gene: LAMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 10972294; Phenotypes: Danon disease, MIM# 300257, MONDO:0010281; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | PARN | Chirag Patel reviewed gene: PARN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25893599, 26342108; Phenotypes: Dyskeratosis congenita, autosomal recessive 6, MIM# 616353; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | PAX6 | Chirag Patel reviewed gene: PAX6: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 26130484, 31700164; Phenotypes: Microphthalmia/coloboma 12, OMIM #120200; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | PAX8 | Chirag Patel reviewed gene: PAX8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33272083, 9590296 11232006 15356023 15718293; Phenotypes: Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | PC | Chirag Patel reviewed gene: PC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9585612, 12112657; Phenotypes: Pyruvate carboxylase deficiency - MIM#266150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | SLC6A3 | Zornitza Stark Marked gene: SLC6A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | SLC6A3 | Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | SLC6A3 | Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6187 | SLC6A3 | Zornitza Stark Publications for gene: SLC6A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6186 | SLC6A3 | Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6185 | SLC6A3 | Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6185 | SRD5A3 | Zornitza Stark Marked gene: SRD5A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6185 | SRD5A3 | Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6185 | SRD5A3 | Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM#612379; Kahrizi syndrome, MIM# 612713 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6184 | SRD5A3 | Zornitza Stark Publications for gene: SRD5A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6183 | SRD5A3 | Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6182 | SRD5A3 | Zornitza Stark reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323; Phenotypes: Congenital disorder of glycosylation, type Iq, MIM#612379, Kahrizi syndrome, MIM# 612713; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6182 | SLC6A8 | Zornitza Stark Marked gene: SLC6A8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6182 | SLC6A8 | Zornitza Stark Gene: slc6a8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6182 | SLC6A8 | Zornitza Stark Phenotypes for gene: SLC6A8 were changed from to Cerebral creatine deficiency syndrome 1, MIM# 300352 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6181 | SLC6A8 | Zornitza Stark Publications for gene: SLC6A8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6180 | SLC6A8 | Zornitza Stark Mode of inheritance for gene: SLC6A8 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6179 | SLC6A8 | Zornitza Stark reviewed gene: SLC6A8: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 16738945; Phenotypes: Cerebral creatine deficiency syndrome 1, MIM# 300352; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6179 | SPTBN2 | Zornitza Stark Mode of inheritance for gene: SPTBN2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6178 | SPTBN2 | Zornitza Stark reviewed gene: SPTBN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23236289, 23838597, 22781464, 31617442, 31066025; Phenotypes: Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386, Spinocerebellar ataxia 5, MIM# 600224; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6178 | ST3GAL3 | Zornitza Stark Marked gene: ST3GAL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6178 | ST3GAL3 | Zornitza Stark Gene: st3gal3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6178 | ST3GAL3 | Zornitza Stark Phenotypes for gene: ST3GAL3 were changed from to Intellectual disability, autosomal recessive 12 MIM# 611090 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6177 | ST3GAL3 | Zornitza Stark Publications for gene: ST3GAL3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6176 | ST3GAL3 | Zornitza Stark Mode of inheritance for gene: ST3GAL3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6175 | ST3GAL3 | Zornitza Stark reviewed gene: ST3GAL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23252400, 21907012, 31584066, 37938134; Phenotypes: Intellectual disability, autosomal recessive 12 MIM# 611090; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6175 | SUCLG1 | Zornitza Stark Marked gene: SUCLG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6175 | SUCLG1 | Zornitza Stark Gene: suclg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6175 | SUCLG1 | Zornitza Stark Phenotypes for gene: SUCLG1 were changed from Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6174 | SUCLG1 | Zornitza Stark Phenotypes for gene: SUCLG1 were changed from to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6173 | SUCLG1 | Zornitza Stark Publications for gene: SUCLG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6172 | SUCLG1 | Zornitza Stark Mode of inheritance for gene: SUCLG1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6171 | SUCLG1 | Zornitza Stark Mode of inheritance for gene: SUCLG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6170 | SUCLG1 | Zornitza Stark reviewed gene: SUCLG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33230783, 28358460; Phenotypes: Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6170 | SURF1 | Zornitza Stark Marked gene: SURF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6170 | SURF1 | Zornitza Stark Gene: surf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6170 | SURF1 | Zornitza Stark Phenotypes for gene: SURF1 were changed from to Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6169 | SURF1 | Zornitza Stark Publications for gene: SURF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6168 | SURF1 | Zornitza Stark Mode of inheritance for gene: SURF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6167 | SURF1 | Zornitza Stark reviewed gene: SURF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843204, 9837813; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6167 | TMEM5 | Zornitza Stark Tag new gene name tag was added to gene: TMEM5. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6167 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6167 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6167 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6166 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to 23217329; 23519211 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6165 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6164 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6163 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6163 | TSEN2 | Zornitza Stark Marked gene: TSEN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6163 | TSEN2 | Zornitza Stark Gene: tsen2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6163 | TSEN2 | Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B, MIM# 612389 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6162 | TSEN2 | Zornitza Stark Publications for gene: TSEN2 were set to 23562994; 20952379 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6161 | TSEN2 | Zornitza Stark Publications for gene: TSEN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6160 | TSEN2 | Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6159 | TSEN2 | Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6158 | TSEN2 | Zornitza Stark reviewed gene: TSEN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23562994, 20952379; Phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6158 | TTC19 | Zornitza Stark Marked gene: TTC19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6158 | TTC19 | Zornitza Stark Gene: ttc19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6158 | TTC19 | Zornitza Stark Phenotypes for gene: TTC19 were changed from to Mitochondrial complex III deficiency, nuclear type 2, MIM#615157 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6157 | TTC19 | Zornitza Stark Publications for gene: TTC19 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6156 | TTC19 | Zornitza Stark Mode of inheritance for gene: TTC19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6155 | TTC19 |
Zornitza Stark changed review comment from: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances. At least 4 unrelated families reported.; to: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances. Included due to phenotypic overlap. At least 4 unrelated families reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6155 | TTC19 | Zornitza Stark reviewed gene: TTC19: Rating: GREEN; Mode of pathogenicity: None; Publications: 21278747, 23532514, 24368687, 24397319; Phenotypes: Mitochondrial complex III deficiency, nuclear type 2, MIM#615157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6155 | TUBA1A | Zornitza Stark Marked gene: TUBA1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6155 | TUBA1A | Zornitza Stark Gene: tuba1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6155 | TUBA1A | Zornitza Stark Phenotypes for gene: TUBA1A were changed from to Lissencephaly 3, MIM# 611603 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6154 | TUBA1A | Zornitza Stark Mode of inheritance for gene: TUBA1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6153 | TUBA1A | Zornitza Stark reviewed gene: TUBA1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly 3, MIM# 611603; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6153 | ZNRF3 | Bryony Thompson Marked gene: ZNRF3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6153 | ZNRF3 | Bryony Thompson Gene: znrf3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6153 | ZNRF3 | Bryony Thompson Classified gene: ZNRF3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6153 | ZNRF3 | Bryony Thompson Gene: znrf3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6152 | ZNRF3 |
Bryony Thompson gene: ZNRF3 was added gene: ZNRF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNRF3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNRF3 were set to 39168120 Phenotypes for gene: ZNRF3 were set to Complex neurodevelopmental disorder MONDO:0100038 Review for gene: ZNRF3 was set to GREEN Added comment: 12 individuals with ZNRF3 variants and various phenotypes. 8 individuals with de novo missense and neurodevelopment disorders (NDD), including cluster of variants in the RING ligase domain with macrocephalic NDD. Plus 4 individuals from 3 families with de novo truncating or de novo/inherited large in-frame deletion variants with non-NDD phenotypes, including heart, adrenal, or nephrotic problems. Overall, 4 individuals had congenital heart defects and 2 had microcephaly. Also, supporting in vitro functional assays. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6151 | NFIA | Zornitza Stark Marked gene: NFIA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6151 | NFIA | Zornitza Stark Gene: nfia has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6151 | DHTKD1 | Zornitza Stark Marked gene: DHTKD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6151 | DHTKD1 | Zornitza Stark Gene: dhtkd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6151 | DHTKD1 | Zornitza Stark Phenotypes for gene: DHTKD1 were changed from to 2-aminoadipic 2-oxoadipic aciduria MIM#204750; Disorders of histidine, tryptophan or lysine metabolism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6150 | DHTKD1 | Zornitza Stark Publications for gene: DHTKD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6149 | DHTKD1 | Zornitza Stark Mode of inheritance for gene: DHTKD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6148 | DHTKD1 | Zornitza Stark Classified gene: DHTKD1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6148 | DHTKD1 | Zornitza Stark Gene: dhtkd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6147 | DCX | Zornitza Stark Marked gene: DCX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6147 | DCX | Zornitza Stark Gene: dcx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6147 | DCX | Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6146 | DCX | Zornitza Stark Publications for gene: DCX were set to 26743950; 11468322; 20726879; 20301364; 12552055; 9489699 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6145 | DCX | Zornitza Stark Publications for gene: DCX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6144 | DCX | Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6143 | DARS2 | Zornitza Stark Marked gene: DARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6143 | DARS2 | Zornitza Stark Gene: dars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6143 | DARS2 | Zornitza Stark Phenotypes for gene: DARS2 were changed from to Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6142 | DARS2 | Zornitza Stark Publications for gene: DARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6141 | DARS2 | Zornitza Stark Mode of inheritance for gene: DARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6140 | D2HGDH | Zornitza Stark Marked gene: D2HGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6140 | D2HGDH | Zornitza Stark Gene: d2hgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6140 | D2HGDH | Zornitza Stark Phenotypes for gene: D2HGDH were changed from to D-2-hydroxyglutaric aciduria MIM#600721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6139 | D2HGDH | Zornitza Stark Publications for gene: D2HGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6138 | D2HGDH | Zornitza Stark Mode of inheritance for gene: D2HGDH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6137 | D2HGDH | Zornitza Stark Mode of inheritance for gene: D2HGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6136 | COX15 | Zornitza Stark Phenotypes for gene: COX15 were changed from Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119 to Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6136 | COX15 | Zornitza Stark Marked gene: COX15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6136 | COX15 | Zornitza Stark Gene: cox15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6136 | COX15 | Zornitza Stark Phenotypes for gene: COX15 were changed from Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119 to Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6135 | COX15 | Zornitza Stark Phenotypes for gene: COX15 were changed from to Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6134 | GPN2 |
Mark Cleghorn gene: GPN2 was added gene: GPN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: GPN2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPN2 were set to complex neurodevelopmental disorder MONDO:0100038; Perrault syndrome Review for gene: GPN2 was set to AMBER Added comment: GPN2 ESHG talk 2/6/24, unpublished Thomas Smith, University of Manchester Biallelic GPN2 proposed to cause Perrault syndrome (SNHL, ovarian dysfunction, NDD) RNA polymerase assembly factor 4 families (14 affected individuals) w biallalic GPN2 rare missense variants Segregated w phenotype Fam 2 and 3 may be distantly related (leaving 3 distinct kindreds) Clinical features 13/14 SNHL 3/4 families all females of adolescent age or older had primary ovarian insufficiency 4/4 GDD, ataxia (no data on family w 10 affected indiv.) Some functional work, not conclusive Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6134 | ATP6V1C1 | Zornitza Stark Marked gene: ATP6V1C1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6134 | ATP6V1C1 | Zornitza Stark Gene: atp6v1c1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6134 | ATP6V1C1 |
Zornitza Stark gene: ATP6V1C1 was added gene: ATP6V1C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP6V1C1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V1C1 were set to 39210597 Phenotypes for gene: ATP6V1C1 were set to neurodevelopmental disorder MONDO:0700092, ATP6V1C1-related Review for gene: ATP6V1C1 was set to RED Added comment: 1x de novo missense p.Glu289Lys (absent in v4 gnomad). Manual inspection of IGV found the dad was mosaic 7% VAF and he shared some of the clinical features (minor digit anomalies). Some functional studies using patient fibroblasts were performed, demonstrating similar effects as known pathogenic variants in ATP6V1B2. - lysosomal morphology - autophagic flux dysregulation - increased acidification of lysosome borderline red/amber Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6133 | C12orf66 | Zornitza Stark Marked gene: C12orf66 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6133 | C12orf66 | Zornitza Stark Gene: c12orf66 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6133 | C12orf66 | Zornitza Stark Classified gene: C12orf66 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6133 | C12orf66 | Zornitza Stark Gene: c12orf66 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6132 | SF3B1 | Zornitza Stark Marked gene: SF3B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6132 | SF3B1 | Zornitza Stark Gene: sf3b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6132 | SF3B1 | Zornitza Stark Classified gene: SF3B1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6132 | SF3B1 | Zornitza Stark Gene: sf3b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6131 | RFC4 | Chirag Patel Classified gene: RFC4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6131 | RFC4 | Chirag Patel Gene: rfc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6131 | RFC4 | Chirag Patel Classified gene: RFC4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6131 | RFC4 | Chirag Patel Gene: rfc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6130 | MED22 | Zornitza Stark Marked gene: MED22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6130 | MED22 | Zornitza Stark Gene: med22 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6130 | MED22 | Zornitza Stark Classified gene: MED22 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6130 | MED22 | Zornitza Stark Gene: med22 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6129 | LARP1 | Zornitza Stark Marked gene: LARP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6129 | LARP1 | Zornitza Stark Gene: larp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6129 | LARP1 | Zornitza Stark Classified gene: LARP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6129 | LARP1 | Zornitza Stark Gene: larp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6128 | PNPLA8 | Zornitza Stark Marked gene: PNPLA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6128 | PNPLA8 | Zornitza Stark Gene: pnpla8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6128 | PNPLA8 | Zornitza Stark Phenotypes for gene: PNPLA8 were changed from PNPLA8-related neurological diseases to Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6127 | RFC4 |
Chirag Patel gene: RFC4 was added gene: RFC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RFC4 were set to PMID: 39106866 Phenotypes for gene: RFC4 were set to RFC4-related multisystem disorder Review for gene: RFC4 was set to GREEN gene: RFC4 was marked as current diagnostic Added comment: 9 affected individuals (aged birth to 47yrs) from 8 unrelated families with a multisystem disorder. Clinical features included: muscle weakness/myopathy (9/9), motor incoordination/gait disturbance (8/8), delayed gross motor development (6/9), dysarthria (5/5), peripheral neuropathy (3/3 adults), bilateral sensorineural hearing impairment (6/9), decreased body weight (8/9), short stature (5/9), microcephaly (4/9), respiratory issues/insufficiency (6/9), cerebellar atrophy (4/9), pituitary hypoplasia (3/9). WES or WGS identified biallelic loss-of-function variants in RFC4 (3 frameshift, 2 splice site, 1 single AA duplication, 2 single AA deletions, 2 missense), and almost all are likely to disrupt the C-terminal domain indispensable for Replication factor C (RFC) complex formation. All variants segregated with the disease. The RFC complex (with 5 subunits) is central to process of regulation of DNA replication, and it loads proliferating cell nuclear antigen onto DNA to facilitate the recruitment of replication and repair proteins and enhance DNA polymerase processivity. RFC1 is associated with CANVAS but the contributions of RFC2-5 subunits on human Mendelian disorders is unknown. Analysis of a previously determined cryo-EM structure of RFC bound to proliferating cell nuclear antigen suggested that the variants disrupt interactions within RFC4 and/or destabilize the RFC complex. Cellular studies using RFC4-deficient HeLa cells and primary fibroblasts demonstrated decreased RFC4 protein, compromised stability of the other RFC complex subunits, and perturbed RFC complex formation. Additionally, functional studies of the RFC4 variants affirmed diminished RFC complex formation, and cell cycle studies suggested perturbation of DNA replication and cell cycle progression. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6126 | LARP1 |
Sangavi Sivagnanasundram gene: LARP1 was added gene: LARP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: LARP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LARP1 were set to 39182167 Phenotypes for gene: LARP1 were set to Neurodevelopmental disorder; MONDO:0700092 Review for gene: LARP1 was set to GREEN Added comment: Seven unrelated probands (6 males and 1 female) with ASD or another variable NDD phenotype (ID, hypotonia, motor delay and/or ASD). Variants were showed to be de novo null variants or missense variants that resulted in haploinsufficiency. Ex vivo (knockout CRISPR-Cas9) functional assay using lymphoblasts that was collected and immortilised from one proband was conducted to assess the functional impact of the LARP1 variant. The results showed a reduction in protein compared to WT causing reduced rates of aerobic respiration and glycolysis Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6126 | PNPLA8 | Chirag Patel Classified gene: PNPLA8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6126 | PNPLA8 | Chirag Patel Gene: pnpla8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6125 | PNPLA8 | Chirag Patel Classified gene: PNPLA8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6125 | PNPLA8 | Chirag Patel Gene: pnpla8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6124 | PNPLA8 |
Chirag Patel gene: PNPLA8 was added gene: PNPLA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PNPLA8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PNPLA8 were set to PMID: 39082157 Phenotypes for gene: PNPLA8 were set to PNPLA8-related neurological diseases Review for gene: PNPLA8 was set to GREEN gene: PNPLA8 was marked as current diagnostic Added comment: Cohort analysis of clinical features of new and previously reported individuals with biallelic PNPLA8 variants (25 affected individuals across 20 families). They showed that PNPLA8-related neurological diseases manifest as a continuum ranging from variable developmental and/or degenerative epileptic-dyskinetic encephalopathy to childhood-onset neurodegeneration. Complete loss of PNPLA8 was associated with the more profound end of the spectrum. 13/19 individuals (info available) had developmental delay and/or severe intellectual disability. Using cerebral organoids generated from human induced pluripotent stem cells, they found that loss of PNPLA8 led to developmental defects by reducing the number of basal radial glial cells and upper-layer neurons. Neural progenitor cells lacking PNPLA8 showed a reduced amount of lysophosphatidic acid, lysophosphatidylethanolamine and phosphatidic acid. They show that PNPLA8 is crucial to meet phospholipid synthetic needs and to produce abundant basal radial glial cells in human brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | MED22 |
Mark Cleghorn gene: MED22 was added gene: MED22 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED22 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED22 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED22 were set to unknown Review for gene: MED22 was set to AMBER Added comment: ESHG talk 2/6/24, unpublished Elisa Cali, UCL Recurrent homozygous MED22:c.397_399del (p.Glu133del) inframe variant in 8 individuals from 6 families w progressive NDD, microcepahly, cerebellar atrophy, dystonia, seizures Rare in gnomad v4.1 (9 het alleles, no homozygotes) Functional work on patient fibroblasts: quantity of protein comparable to controls, did not mentioned assays of protein function (?mechanism proposed) Drosophilia heterozygous model with equivalent of p.Glu133del variant: structural anomalies, less movements, all died prior to pupae stage Zebrafish: MED22 mutants less mobile, died prior to adulthood, reduced brain size Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | BICRA | Mark Cleghorn reviewed gene: BICRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Siris syndrome-12, MIM#619325; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | SF3B1 |
Mark Cleghorn gene: SF3B1 was added gene: SF3B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: SF3B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SF3B1 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: SF3B1 were set to unknown Review for gene: SF3B1 was set to AMBER Added comment: SF3B1 Delphine Bernard, University of Brest ESHG talk 2/6/24, unpublished De novo germline SF3B1 variants, proposed spliceosomopathy/NDD gene SF3B1 is an RNA binding protein that stabilizes the U2 snRNP complex at branchpoint sequences Somatic SF3B1 missense commonly occur in haematological malignancy (K700E recurrent) 25 patients with syndromic NDD + de novo heterozygous rare SF3B1 variants identified on WES, genematcher 13 missense (incl recurrent xxx and xxx) within HEAT domain 5 nonsense 4 splicing 1 frameshift Patients w missense variants may have more severe phenotype incl mircocepahly, palate anomalies, cerebral anomalies, GI/cardiac anomalies Cellular models of missense variants: erythroluekaemia K562, HEK293T Suggest missense variants do not cause loss of function, but increase exon skipping and alternative 3’ splice sites Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | C12orf66 |
Mark Cleghorn gene: C12orf66 was added gene: C12orf66 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: C12orf66 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C12orf66 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: C12orf66 were set to unknown Review for gene: C12orf66 was set to AMBER Added comment: KICS2 (previously known as C12ORF66) Rebecca Buchert, Universitatklinikum Tubingen ESHG talk 2/6/24, unpublished Proposed ID + epilepsy gene 8 families w 11 affected individuals Phenotypes: 11/11 ID, 9/11 epilepsy, 3/11 hearing impairment 3/8 homozygous missense variants (p.Asp296Glu, p.Tyr393Cys, p.Tyr393Cys), all highly conserved 1/8 compound het PTC (p.Lys262*) with 1.1Mb deletion 4/8 homozygous PTC (p.Glu3*, p.Gly79Valfs*18, p.Gly79Valfs*18, p.Lys260Asnfs*18) Gene appears to be involved in mTOR pathway, and cilia function mTORC1 activity in CRISPR-HEK293T cells – reduced activity in cells w variants above Zebrafish model: otolith defects, ciliary dysfunction ?not clear if truly mimics phenotype observed in patient cohort described Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | REPS2 |
Mark Cleghorn gene: REPS2 was added gene: REPS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: REPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: REPS2 were set to complex neurodevelopmental disorder MONDO:0100038; Cerebral palsy HP:0100021 Penetrance for gene: REPS2 were set to unknown Review for gene: REPS2 was set to AMBER Added comment: REPS2 Hao Hu, Guangzhou Women and Children’s MC ESHG talk 1/6/24, unpublished Proposed X-linked cerebral palsy + NDD gene 4 unrelated males with predicted deleterious hemizygous REPS2 variants, 2 PTC, 2 missense. 2 de novo, 2 maternally inherited Phenotypes: 2 w CP + moderate ID/ASD, 2 w NDD NOS Variants described: c.1050_1052delGAA;p.K351del c.1040T>C; p.I347T c.962C>G; p.S321C c.1736delA; p.N579Tfs*17 In vitro assay of above 4 variants suggest reduced REPS2 protein stability Zebrafish model: REPS2 expressed in neuronal cells, REPS2 knock down have reduced motor activity and abN neuronal morphology Mouse model hemizygous w one of above variants (not specified): reduced performance in cognitive tasks, abnormal neuronal migration pattern on post mortem examination Mechanism may relate to dopamine signalling? Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | TTL |
Mark Cleghorn gene: TTL was added gene: TTL was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: TTL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTL were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: TTL was set to AMBER Added comment: TTL Valentina Serpieri, University of Pavia ESHG talk 1/6/24 FAM1 (Italy) 2 affected sisters born to consanguineous Pakistani parents GDD, spastic tetraparesis, optic atrophy, brain anomalies resembling tubulinopathies (dysplasia of corpus callosum, basal ganglia, brainstem) WES: homozygous TTL:c.1013G>A; p.Cys338Tyr in both affected sisters Via genematcher 5 more families (9 individuals) w similar phenotypes and biallelic variants in TTL FAM2 (Egypt): homozygous p.Arg46Pro FAM3 (Egypt): homozygous p.Arg46Pro FAM4 (Australia): homozygous p.Gln183Arg FAM5 (France): homozygous p.Trp147* FAM6 (Saudi Arabia): homozygous p.His243Tyr TTL KO mice: death soon after birth, no overt malformations, but defects in organisation of cerebral layers Functional work on patient fibroblasts FAM1 – reduced quantity of TTL protein compared to control on Western blot, decreased function of TTL protein (increase in detyrosinated tubulin) compared to controls – infer LoF as mechanism FAM3 – mentioned but no details FAM4– mentioned but no details Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | DHTKD1 | Sumudu Perera reviewed gene: DHTKD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 23141293, 37499576, 1112064, 6434826, 4442872, 4430147; Phenotypes: 2-aminoadipic 2-oxoadipic aciduria MIM#204750, Disorders of histidine, tryptophan or lysine metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | DCX | Sumudu Perera edited their review of gene: DCX: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | DARS2 | Sumudu Perera reviewed gene: DARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17384640, 21815884, 20506600; Phenotypes: Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | DCX |
Sumudu Perera changed review comment from: Pathology: PMID: 26743950 - DCX mutations usually cause anterior dominant lissencephaly in males and subcortical band heterotopia (SBH) in females Phenotype: Demelas et al. (2001) (PMID:11468322) demonstrated three brothers with phenotype of microcephaly, mild to moderate developmental delay, seizures and other neurologic abnormalities, as well as classic lissencephaly on MRI. Lawrence et al. (2010) (PMID: 20726879) discuss 3 male members had severe epilepsy and intellectual disability; finding of missense mutation in DCX. Of note all 3 had been diagnosed with Lennox-Gastaut syndrome. GeneReviews (PMID: 20301364): "Males with classic DCX-related lissencephaly typically have early and profound cognitive and language impairment, cerebral palsy, and epileptic seizures. The clinical phenotype in females with SBH varies widely with cognitive abilities that range from average or mild cognitive impairment to severe intellectual disability and language impairment." Other papers: 1) Somatic mosaicism and variable penetrance - PMID: 12552055 2) Functional testing: PMID: 9489699; to: Pathology: PMID: 26743950 - DCX mutations usually cause anterior dominant lissencephaly in males and subcortical band heterotopia (SBH) in females Phenotype: Demelas et al. (2001) (PMID:11468322) demonstrated three brothers with phenotype of microcephaly, mild to moderate developmental delay, seizures and other neurologic abnormalities, as well as classic lissencephaly on MRI. Lawrence et al. (2010) (PMID: 20726879) discuss 3 male members had severe epilepsy and intellectual disability; finding of missense mutation in DCX. Of note all 3 had been diagnosed with Lennox-Gastaut syndrome. GeneReviews (PMID: 20301364): "Males with classic DCX-related lissencephaly typically have early and profound cognitive and language impairment, cerebral palsy, and epileptic seizures. The clinical phenotype in females with SBH varies widely with cognitive abilities that range from average or mild cognitive impairment to severe intellectual disability and language impairment." Other papers: 1) Somatic mosaicism and variable penetrance - PMID: 12552055 2) Functional testing: PMID: 9489699 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | DCX | Sumudu Perera reviewed gene: DCX: Rating: ; Mode of pathogenicity: None; Publications: 26743950, 11468322, 20726879, 20301364, 12552055, 9489699; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | D2HGDH | Sumudu Perera reviewed gene: D2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 15609246, 16081310, 31349060, 20020533, 38825343; Phenotypes: D-2-hydroxyglutaric aciduria MIM#600721; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | GTPBP1 | Zornitza Stark Phenotypes for gene: GTPBP1 were changed from Neurodevelopmental disorder (MONDO#0700092), GTPBP1-related to Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6122 | GTPBP1 | Zornitza Stark reviewed gene: GTPBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6122 | CSNK1G1 | Rylee Peters reviewed gene: CSNK1G1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 33009664; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CSNK1G-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6122 | CSMD1 | Zornitza Stark Marked gene: CSMD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6122 | CSMD1 | Zornitza Stark Gene: csmd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6122 | CSMD1 | Zornitza Stark Classified gene: CSMD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6122 | CSMD1 | Zornitza Stark Gene: csmd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6121 | CSMD1 |
Krithika Murali gene: CSMD1 was added gene: CSMD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD1 were set to PMID 38816421 Phenotypes for gene: CSMD1 were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: CSMD1 was set to GREEN Added comment: PMID 38816421 Werren et al 2024 report 8 individuals from 6 families with biallelic missense CSMD1 variants identified through exome sequencing and subsequent gene-sharing efforts. Shared phenotypic features included: GDD, ID, microcephaly and polymicrogyria. Other features included dysmorphism, IUGR, hypotonia, arthrogryposis, seizures, opthalmological anomalies and other brain white matter anomalies Heterozygous parents were unaffected. Loss of function is the postulated mechanism based on experimental data involving early-stage forebrain organoids differentiated from CSMD1 knockout human embryonic stem cells. ClinGen haploinsufficiency score of 1, however, this curation was last reviewed in 2018. This gene is within the scope of review for the ClinGen Autisim and ID GCEP. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6120 | ZSCAN10 | Zornitza Stark reviewed gene: ZSCAN10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Otofacial neurodevelopmental syndrome, MIM# 620910; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6120 | COQ8A | Zornitza Stark Marked gene: COQ8A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6120 | COQ8A | Zornitza Stark Gene: coq8a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6120 | COQ8A | Zornitza Stark Phenotypes for gene: COQ8A were changed from to coenzyme Q10 deficiency MONDO:0018151 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6119 | COQ8A | Zornitza Stark Publications for gene: COQ8A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6118 | COQ8A | Zornitza Stark Mode of inheritance for gene: COQ8A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6117 | CTDP1 | Zornitza Stark Marked gene: CTDP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6117 | CTDP1 | Zornitza Stark Gene: ctdp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6117 | CTDP1 | Zornitza Stark Phenotypes for gene: CTDP1 were changed from to congenital cataracts-facial dysmorphism-neuropathy syndrome MONDO:0011402 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6116 | CTDP1 | Zornitza Stark Publications for gene: CTDP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6115 | CTDP1 | Zornitza Stark Mode of inheritance for gene: CTDP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6114 | CTSA | Zornitza Stark Marked gene: CTSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6114 | CTSA | Zornitza Stark Gene: ctsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6114 | CTSA | Zornitza Stark Phenotypes for gene: CTSA were changed from to Galactosialidosis MONDO:0009737 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6113 | CTSA | Zornitza Stark Publications for gene: CTSA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6112 | CTSA | Zornitza Stark Mode of inheritance for gene: CTSA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6111 | CTSD | Zornitza Stark Marked gene: CTSD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6111 | CTSD | Zornitza Stark Gene: ctsd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6111 | CTSD | Zornitza Stark Phenotypes for gene: CTSD were changed from to neuronal ceroid lipofuscinosis MONDO:0016295 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6110 | CTSD | Zornitza Stark Mode of inheritance for gene: CTSD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6109 | CYB5R3 | Zornitza Stark Marked gene: CYB5R3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6109 | CYB5R3 | Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6109 | CYB5R3 | Zornitza Stark Phenotypes for gene: CYB5R3 were changed from to Methemoglobinemia MONDO:0001117 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6108 | CYB5R3 | Zornitza Stark Publications for gene: CYB5R3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6107 | CYB5R3 | Zornitza Stark Mode of inheritance for gene: CYB5R3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6106 | SOX9 | Zornitza Stark Marked gene: SOX9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6106 | SOX9 | Zornitza Stark Gene: sox9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6106 | SOX9 | Zornitza Stark Phenotypes for gene: SOX9 were changed from to campomelic dysplasia MONDO:0007251 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6105 | SOX9 | Zornitza Stark Publications for gene: SOX9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6104 | SOX9 | Zornitza Stark Mode of inheritance for gene: SOX9 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6103 | SOX9 | Zornitza Stark Classified gene: SOX9 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6103 | SOX9 | Zornitza Stark Gene: sox9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6102 | SOX9 | Zornitza Stark changed review comment from: Agree ID typically not part of the phenotype. Note reports of milder cases and DD/ID reported in some survivors, therefore downgraded to Amber.; to: Agree ID typically not part of the phenotype. Note reports of milder cases and DD/ID reported in some survivors (this publication suggests >80%), therefore downgraded to Amber. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6102 | SOX9 | Zornitza Stark reviewed gene: SOX9: Rating: AMBER; Mode of pathogenicity: None; Publications: 21373255; Phenotypes: campomelic dysplasia MONDO:0007251; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6102 | SOX9 | Zornitza Stark Classified gene: SOX9 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6102 | SOX9 | Zornitza Stark Gene: sox9 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6101 | GLS | Zornitza Stark Phenotypes for gene: GLS were changed from Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412 to Epileptic encephalopathy, early infantile, 71, MIM# 618328; Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6100 | GLS | Zornitza Stark Mode of inheritance for gene: GLS was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6099 | HDAC3 | Zornitza Stark Marked gene: HDAC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6099 | HDAC3 | Zornitza Stark Gene: hdac3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6099 | SOX9 | Ken Lee Wan reviewed gene: SOX9: Rating: RED; Mode of pathogenicity: None; Publications: 20301724, 26663529; Phenotypes: campomelic dysplasia MONDO:0007251; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6099 | TBC1D7 | Zornitza Stark Publications for gene: TBC1D7 were set to 24515783; 23687350 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6098 | TBC1D7 | Zornitza Stark Classified gene: TBC1D7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6098 | TBC1D7 | Zornitza Stark Gene: tbc1d7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6097 | TBC1D7 | Zornitza Stark edited their review of gene: TBC1D7: Added comment: PMID: 36669495 reports additional individuals with compound het variants identified via trio RNASeq.; Changed rating: GREEN; Changed publications: 24515783, 23687350, 36669495 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6097 | MSL2 | Zornitza Stark Classified gene: MSL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6097 | MSL2 | Zornitza Stark Gene: msl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6096 | CYB5R3 | Ken Lee Wan reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 38303731; Phenotypes: Methemoglobinemia MONDO:0001117; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6096 | CTSD | Ken Lee Wan reviewed gene: CTSD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neuronal ceroid lipofuscinosis MONDO:0016295; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6096 | CTSA | Ken Lee Wan reviewed gene: CTSA: Rating: GREEN; Mode of pathogenicity: None; Publications: 23915561, 36713078; Phenotypes: Galactosialidosis MONDO:0009737; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6096 | CTDP1 | Ken Lee Wan reviewed gene: CTDP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301787; Phenotypes: congenital cataracts-facial dysmorphism-neuropathy syndrome MONDO:0011402; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6096 | HDAC3 | Zornitza Stark edited their review of gene: HDAC3: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, HDAC3-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6096 | HDAC3 | Zornitza Stark Phenotypes for gene: HDAC3 were changed from to Neurodevelopmental disorder, MONDO:0700092, HDAC3-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6095 | HDAC3 | Zornitza Stark Classified gene: HDAC3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6095 | HDAC3 | Zornitza Stark Gene: hdac3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6094 | HDAC3 | Zornitza Stark Classified gene: HDAC3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6094 | HDAC3 | Zornitza Stark Gene: hdac3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6093 | HDAC3 |
Zornitza Stark gene: HDAC3 was added gene: HDAC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HDAC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HDAC3 were set to 39047730 Review for gene: HDAC3 was set to GREEN Added comment: Six individuals with de novo missense variants in this gene and variable NDD phenotypes, including ID, seizures. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6092 | SLC39A14 | Zornitza Stark Marked gene: SLC39A14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6092 | SLC39A14 | Zornitza Stark Gene: slc39a14 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6092 | SLC39A14 | Zornitza Stark Mode of inheritance for gene: SLC39A14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6091 | SLC39A14 | Zornitza Stark Publications for gene: SLC39A14 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6090 | SLC39A14 | Zornitza Stark Phenotypes for gene: SLC39A14 were changed from to Hypermanganesemia with dystonia 2 (MIM# 617013) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6089 | COQ8A | Ken Lee Wan reviewed gene: COQ8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31621627, 31741144; Phenotypes: coenzyme Q10 deficiency MONDO:0018151; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6089 | COL4A2 | Zornitza Stark Marked gene: COL4A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6089 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6089 | COL4A2 | Zornitza Stark Phenotypes for gene: COL4A2 were changed from Brain small vessel disease 2, MIM# 614483; familial porencephaly MONDO:0020496 to Brain small vessel disease 2, MIM# 614483; familial porencephaly MONDO:0020496 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6088 | COL4A2 | Zornitza Stark Phenotypes for gene: COL4A2 were changed from to Brain small vessel disease 2, MIM# 614483; familial porencephaly MONDO:0020496 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6087 | COL4A2 | Zornitza Stark Publications for gene: COL4A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6086 | COL4A2 | Zornitza Stark Mode of inheritance for gene: COL4A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6085 | COQ4 | Zornitza Stark Marked gene: COQ4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6085 | COQ4 | Zornitza Stark Gene: coq4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6085 | COQ4 | Zornitza Stark Phenotypes for gene: COQ4 were changed from Coenzyme Q10 deficiency, primary, 7, MIM# 616276; neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562 to Coenzyme Q10 deficiency, primary, 7, MIM# 616276; neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6084 | COQ4 | Zornitza Stark Phenotypes for gene: COQ4 were changed from Coenzyme Q10 deficiency, primary, 7, MIM# 616276 to Coenzyme Q10 deficiency, primary, 7, MIM# 616276; neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6084 | COQ4 | Zornitza Stark Phenotypes for gene: COQ4 were changed from to Coenzyme Q10 deficiency, primary, 7, MIM# 616276 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6083 | COQ4 | Zornitza Stark Publications for gene: COQ4 were set to 34656997 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6083 | COQ4 | Zornitza Stark Publications for gene: COQ4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6082 | COQ4 | Zornitza Stark Mode of inheritance for gene: COQ4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6081 | COQ4 | Ken Lee Wan reviewed gene: COQ4: Rating: GREEN; Mode of pathogenicity: None; Publications: 34656997; Phenotypes: mitochondrial disease MONDO:0044970, neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6081 | COL4A2 | Ken Lee Wan reviewed gene: COL4A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36324412, 39016117; Phenotypes: familial porencephaly MONDO:0020496; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6081 | CLN8 | Zornitza Stark Marked gene: CLN8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6081 | CLN8 | Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6081 | CLN8 | Zornitza Stark Phenotypes for gene: CLN8 were changed from to neuronal ceroid lipofuscinosis MONDO:0016295 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6080 | CLN8 | Zornitza Stark Mode of inheritance for gene: CLN8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6079 | CLN8 | Ken Lee Wan reviewed gene: CLN8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neuronal ceroid lipofuscinosis MONDO:0016295; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6079 | LEO1 | Zornitza Stark Marked gene: LEO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6079 | LEO1 | Zornitza Stark Gene: leo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6079 | LEO1 | Zornitza Stark Classified gene: LEO1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6079 | LEO1 | Zornitza Stark Gene: leo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6078 | LEO1 |
Zornitza Stark gene: LEO1 was added gene: LEO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LEO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LEO1 were set to 38965372 Phenotypes for gene: LEO1 were set to neurodevelopmental disorder MONDO:0700092, LEO-1 related Review for gene: LEO1 was set to AMBER Added comment: cohort of individuals with delayed motor and speech development, ASD 8x de novo – 6x missense + 2x PTC 1x pat splice (father unaffected) 2x unknown_inh PTCs Of the missense variants, G370E has 8 hets in gnomad v4 This gene is not constraint for LoF with 4 hets with an NMD variant in gnomad v4 3 of the missense are said to lie within a region of missense constraint, however this isn't the case in v4 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6077 | CHD2 | Zornitza Stark Phenotypes for gene: CHD2 were changed from Epileptic encephalopathy, childhood-onset (MIM # 615369) to Developmental and epileptic encephalopathy 94, MIM# 615369 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6076 | CHD2 | Zornitza Stark Publications for gene: CHD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6075 | CHD2 | Zornitza Stark reviewed gene: CHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 94, MIM# 615369; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6075 | CHD2 | Ken Lee Wan reviewed gene: CHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26677509; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6075 | RBBP5 | Ain Roesley Phenotypes for gene: RBBP5 were changed from to neurodevelopmental disorder MONDO:0700092, RBBP5-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6074 | RBBP5 | Ain Roesley edited their review of gene: RBBP5: Changed phenotypes: neurodevelopmental disorder MONDO:0700092, RBBP5-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6074 | PCBP2 | Ain Roesley Marked gene: PCBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6074 | PCBP2 | Ain Roesley Gene: pcbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6074 | PCBP2 | Ain Roesley Classified gene: PCBP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6074 | PCBP2 | Ain Roesley Gene: pcbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6073 | PCBP2 |
Ain Roesley gene: PCBP2 was added gene: PCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PCBP2 were set to 38965372 Phenotypes for gene: PCBP2 were set to neurodevelopmental disorder MONDO:0700092, PCBP2-related Review for gene: PCBP2 was set to GREEN gene: PCBP2 was marked as current diagnostic Added comment: 3x individuals with de novo variants Motor and speech delay and ASD 2x missense + 1x fs There are 2 NMD variants with 9 and 8 hets respectively in gnomad v4, however the IGV looks to be low quality Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6072 | SLC45A1 | Zornitza Stark Publications for gene: SLC45A1 were set to 28434495 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6071 | SLC45A1 | Zornitza Stark Classified gene: SLC45A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6071 | SLC45A1 | Zornitza Stark Gene: slc45a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6070 | SLC45A1 | Zornitza Stark edited their review of gene: SLC45A1: Added comment: PMID 39003656: additional individual with compound het missense variants and supportive functional data.; Changed rating: GREEN; Changed publications: 28434495, 39003656 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6070 | SRPK3 | Zornitza Stark Publications for gene: SRPK3 were set to 38429495; 39073169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6069 | SRPK3 | Zornitza Stark edited their review of gene: SRPK3: Changed publications: 39073169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6069 | SRPK3 | Zornitza Stark Marked gene: SRPK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6069 | SRPK3 | Zornitza Stark Gene: srpk3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6069 | SRPK3 | Zornitza Stark Classified gene: SRPK3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6069 | SRPK3 | Zornitza Stark Gene: srpk3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6068 | SRPK3 |
Zornitza Stark gene: SRPK3 was added gene: SRPK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRPK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SRPK3 were set to 38429495; 39073169 Phenotypes for gene: SRPK3 were set to Neurodevelopmental disorder, MONDO:0700092, SRPK3-related Review for gene: SRPK3 was set to GREEN Added comment: PMID 39073169: 9 individuals from 5 unrelated families reported with 4 missense and 1 putative truncating variant and a neurodevelopmental phenotype. The 8 patients ascertained postnatally shared common clinical features including intellectual disability, agenesis of the corpus callosum, abnormal eye movement, and ataxia. A ninth case, ascertained prenatally, had a complex structural brain phenotype. Supportive animal model data (mouse and zebrafish). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6067 | RBBP5 | Ain Roesley Marked gene: RBBP5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6067 | RBBP5 | Ain Roesley Gene: rbbp5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6067 | RBBP5 | Ain Roesley Classified gene: RBBP5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6067 | RBBP5 | Ain Roesley Gene: rbbp5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6067 | RBBP5 | Ain Roesley Classified gene: RBBP5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6067 | RBBP5 | Ain Roesley Gene: rbbp5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6066 | RBBP5 |
Ain Roesley gene: RBBP5 was added gene: RBBP5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RBBP5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RBBP5 were set to 39036895 Review for gene: RBBP5 was set to GREEN gene: RBBP5 was marked as current diagnostic Added comment: 5x Indivs (4x de novo) = 3x PTCs + 2x missense 4/5 dev delay/ID 2/5 short stature (<=-3 SD) + 2/5 <= -2 SD 1/5 microcephaly (<= -3 SD) + 3/5 <= -2 SD 2/5 SNHL 2/5 seizures 3/5 hypotonia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6065 | NDC1 | Bryony Thompson Marked gene: NDC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6065 | NDC1 | Bryony Thompson Gene: ndc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6065 | NDC1 | Bryony Thompson Classified gene: NDC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6065 | NDC1 | Bryony Thompson Gene: ndc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6064 | NDC1 |
Bryony Thompson gene: NDC1 was added gene: NDC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NDC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDC1 were set to 39003500; 19782045 Phenotypes for gene: NDC1 were set to triple-A syndrome MONDO:0009279 Review for gene: NDC1 was set to GREEN Added comment: 7 cases from 4 consanguineous families (3 different variants: 1 intronic variants that causes in-frame RNA splice impact, 2 missense) with a Triple-A-like syndrome (including ID and neuropathy). Supporting cellular localisation studies were conducted in patient cell lines with the splice variant. NDC1 is required to anchor ALADIN (encoded by AAAS, the gene that causes Triple-A syndrome) in the nuclear pore complex. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | SLC39A14 | Kushani Jayasinghe reviewed gene: SLC39A14: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27231142, 29685658; Phenotypes: Hypermanganesemia with dystonia 2; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | SPATA5 | Zornitza Stark Marked gene: SPATA5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | SPATA5 | Zornitza Stark Added comment: Comment when marking as ready: New HGNC approved name is AFG2A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | SPATA5 | Zornitza Stark Gene: spata5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | SPATA5 | Zornitza Stark Tag new gene name tag was added to gene: SPATA5. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | CRNKL1 | Zornitza Stark Marked gene: CRNKL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | CRNKL1 | Zornitza Stark Gene: crnkl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | CRNKL1 | Zornitza Stark Classified gene: CRNKL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6063 | CRNKL1 | Zornitza Stark Gene: crnkl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6062 | CRNKL1 |
Mark Cleghorn gene: CRNKL1 was added gene: CRNKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CRNKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CRNKL1 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: CRNKL1 were set to Complete Review for gene: CRNKL1 was set to GREEN Added comment: Unpublished, presented at ESHG June 2024 - Louise Bicknell, University of Otago NZ 8 unrelated families via gene matcher with rare, de novo, missense variants in CRNKL1 severe microcephaly (all, -8 to -11 SD) ID/epilepsy pontocerebellar hypoplasia (6/8) simplified gyration (8/8) 7 variants are missense at p.Arg267 residue 1 variant missense at p.Arg301 RNA-seq on patient fibroblasts - no alteration in gene expression Zebrafish homolog of Arg267 and Arg301 - mimics observed phenotype (reduced brain development), increased in embryo apoptosis RNQ seq on affected zebrafish embryos - transcriptome strongly disrupted Splicing analysis in progress CRKNL1 supports U6 structure in spliceosome Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6062 | B9D1 | Achchuthan Shanmugasundram reviewed gene: B9D1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 32622957; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6062 | RNU4-2 | Zornitza Stark Publications for gene: RNU4-2 were set to 38645094 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6061 | RNU4-2 | Zornitza Stark edited their review of gene: RNU4-2: Changed publications: 38991538 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6061 | FDXR | Zornitza Stark Publications for gene: FDXR were set to 30250212 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6060 | FDXR | Zornitza Stark Phenotypes for gene: FDXR were changed from Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717 to Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6059 | FDXR | Zornitza Stark Phenotypes for gene: FDXR were changed from Auditory neuropathy and optic atrophy, MIM# 617717 to Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6058 | FDXR | Zornitza Stark Classified gene: FDXR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6058 | FDXR | Zornitza Stark Gene: fdxr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6057 | FDXR | Zornitza Stark edited their review of gene: FDXR: Added comment: Multiple reports of individuals with extra-ocular features, including ID and regression.; Changed rating: GREEN; Changed publications: 30250212, 29040572, 33348459, 37046037, 37481223; Changed phenotypes: Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887, Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6057 | RNU4-2 | Zornitza Stark Phenotypes for gene: RNU4-2 were changed from Neurodevelopmental disorder, MONDO:0700092, RNU4-2 related to Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6056 | RNU4-2 | Zornitza Stark edited their review of gene: RNU4-2: Changed phenotypes: Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6056 | SREBF2 | Zornitza Stark Marked gene: SREBF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6056 | SREBF2 | Zornitza Stark Gene: srebf2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6056 | SREBF2 | Zornitza Stark Classified gene: SREBF2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6056 | SREBF2 | Zornitza Stark Gene: srebf2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6055 | SREBF2 |
Zornitza Stark gene: SREBF2 was added gene: SREBF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SREBF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SREBF2 were set to 38847193 Phenotypes for gene: SREBF2 were set to Neurocutaneous syndrome, MONDO:0042983, SREBF2-related Review for gene: SREBF2 was set to AMBER Added comment: Two individuals with de novo missense variants, presenting with neurological, cutaneous and skeletal features; supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6054 | PSMC5 | Zornitza Stark Phenotypes for gene: PSMC5 were changed from Developmental disorders to Neurodevelopmental disorder (MONDO#0700092), PSMC5-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6053 | PSMC5 | Zornitza Stark Classified gene: PSMC5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6053 | PSMC5 | Zornitza Stark Gene: psmc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6052 | PSMF1 | Zornitza Stark Marked gene: PSMF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6052 | PSMF1 | Zornitza Stark Gene: psmf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6052 | PSMF1 | Zornitza Stark Classified gene: PSMF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6052 | PSMF1 | Zornitza Stark Gene: psmf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6051 | PSMF1 |
Zornitza Stark gene: PSMF1 was added gene: PSMF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMF1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMF1 were set to https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 Phenotypes for gene: PSMF1 were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related Review for gene: PSMF1 was set to GREEN Added comment: 22 individuals from 15 families reported with a range of neurological phenotypes ranging from early-onset Parkinson's disease; childhood conditions typified by ID and a range of movement disorders; through to perinatal lethal presentations with arthrogryposis multiplex. Genotype-phenotype correlation: biallelic missense variants resulted in the milder phenotypes, while bi-allelic LoF variants in the more severe phenotypes. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6050 | PSMC5 | Rylee Peters reviewed gene: PSMC5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38776958, 38293138; Phenotypes: Neurodevelopmental disorder (MONDO#0700092), PSMC5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6050 | VPS50 | Ain Roesley Classified gene: VPS50 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6050 | VPS50 | Ain Roesley Gene: vps50 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6050 | VPS50 | Ain Roesley Publications for gene: VPS50 were set to 34037727 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6049 | VPS50 | Ain Roesley reviewed gene: VPS50: Rating: GREEN; Mode of pathogenicity: None; Publications: 38876772; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis MIM#619685; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6049 | PSMD11 | Bryony Thompson Marked gene: PSMD11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6049 | PSMD11 | Bryony Thompson Gene: psmd11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6049 | PSMD11 | Bryony Thompson Classified gene: PSMD11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6049 | PSMD11 | Bryony Thompson Gene: psmd11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6048 | PSMD11 |
Bryony Thompson gene: PSMD11 was added gene: PSMD11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PSMD11 were set to 38866022; 30733659 Phenotypes for gene: PSMD11 were set to Neurodevelopmental disorder, MONDO:0700092, PSMD11-related Review for gene: PSMD11 was set to GREEN Added comment: PMID: 38866022 - 10 unrelated children with early-onset syndromic intellectual disability and neurodevelopmental delay with recurrent obesity. Cognitive impairment is recapitulated in a drosophila model. Loss of function is the mechanism of disease PMID: 30733659 - 4 probands with ID and different 17q11.2 deletions spanning PSMD11 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6047 | PAK2 | Ain Roesley Marked gene: PAK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6047 | PAK2 | Ain Roesley Gene: pak2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6047 | PAK2 | Ain Roesley Classified gene: PAK2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6047 | PAK2 | Ain Roesley Gene: pak2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6046 | PAK2 |
Ain Roesley gene: PAK2 was added gene: PAK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PAK2 were set to 33693784; 38894571; 38712026 Phenotypes for gene: PAK2 were set to Knobloch 2 syndrome MIM#618458 Review for gene: PAK2 was set to GREEN gene: PAK2 was marked as current diagnostic Added comment: total of 3 families including 2 siblings with intra-familial variability Siblings' phenotypes: Both had retinal detachment and interstitial parenchymal pulmonary changes on chest X-rays, but only one child had additional significant features such as cataract, posterior encephalocele, severe DD/ID with ASD, and epilepsy. Other 2 pro bands: GDD, delayed motor (but normal verbal) skills, hypotonia Missense variants with in vitro functional demonstrating reduction in PAK2 auto phosphorylation Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6045 | MTSS1L | Ain Roesley Phenotypes for gene: MTSS1L were changed from ntellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086 to Intellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6044 | MTSS1L | Ain Roesley Phenotypes for gene: MTSS1L were changed from Intellectual disability, MTSS2-related (MONDO#0001071) to ntellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6043 | ZNF292 | Ain Roesley Phenotypes for gene: ZNF292 were changed from Intellectual developmental disorder, autosomal dominant 63, MIM# 619188; Intellectual disability; autism; ADHD to Intellectual developmental disorder, autosomal dominant 64 MIM#619188 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6042 | MYH10 | Zornitza Stark Phenotypes for gene: MYH10 were changed from Microcephaly; Intellectual Disability to AD complex neurodevelopmental disorder with or without congenital anomalies (MONDO:0100465) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6041 | AFF2 | Zornitza Stark Phenotypes for gene: AFF2 were changed from Mental retardation, X-linked, FRAXE type 309548 to Intellectual disability, X-linked, FRAXE type 309548 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6040 | AFF2 | Zornitza Stark Mode of inheritance for gene: AFF2 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6039 | AFF2 | Zornitza Stark Mode of inheritance for gene: AFF2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6038 | AFF2 | Zornitza Stark edited their review of gene: AFF2: Changed phenotypes: Intellectual disability, X-linked, FRAXE type 309548; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6038 | RDH14 | Zornitza Stark Marked gene: RDH14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6038 | RDH14 | Zornitza Stark Gene: rdh14 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6038 | RDH14 |
Zornitza Stark gene: RDH14 was added gene: RDH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RDH14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RDH14 were set to 34848785 Phenotypes for gene: RDH14 were set to Neurodevelopmental disorder, MONDO:0700092, RDH14-related Review for gene: RDH14 was set to RED Added comment: Two related individuals with ID and cerebellar atrophy and homozygous LoF variant reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6037 | ATXN7L3 | Zornitza Stark Marked gene: ATXN7L3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6037 | ATXN7L3 | Zornitza Stark Gene: atxn7l3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6037 | ATXN7L3 | Zornitza Stark Phenotypes for gene: ATXN7L3 were changed from Neurodevelopmental disorder, MONDO_0100500 to Neurodevelopmental disorder, MONDO_0100500, ATXN7L3-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6036 | PTEN | Ain Roesley Phenotypes for gene: PTEN were changed from Cowden syndrome 1 MIM#158350; Macrocephaly/autism syndrome MIM#605309 to Cowden syndrome 1 MIM#158350; Macrocephaly/autism syndrome MIM#605309; PTEN hamartoma tumor syndrome MONDO:0017623 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6035 | FAM177A1 | Zornitza Stark Marked gene: FAM177A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6035 | FAM177A1 | Zornitza Stark Gene: fam177a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6035 | FAM177A1 | Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500 to Neurodevelopmental disorder, MONDO_0100500, FAM177a1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6034 | SLC6A1 | Zornitza Stark Publications for gene: SLC6A1 were set to 29315614 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6033 | SLC6A1 | Zornitza Stark edited their review of gene: SLC6A1: Added comment: Haploinsufficiency established as the mechanism.; Changed publications: 29315614, 38781976 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6033 | MSL2 | Zornitza Stark Phenotypes for gene: MSL2 were changed from Developmental disorders; autism to Neurodevelopmental disorder, MONDO:0700092, MSL2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6032 | MSL2 | Sangavi Sivagnanasundram reviewed gene: MSL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 38815585, 38702431; Phenotypes: MSL2-Related Developmental Disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6032 | ANO4 | Ain Roesley Classified gene: ANO4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6032 | ANO4 | Ain Roesley Gene: ano4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6031 | ANO4 | Ain Roesley Classified gene: ANO4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6031 | ANO4 | Ain Roesley Gene: ano4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6031 | ANO4 | Ain Roesley Marked gene: ANO4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6031 | ANO4 | Ain Roesley Gene: ano4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6031 | ANO4 | Ain Roesley Classified gene: ANO4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6031 | ANO4 | Ain Roesley Gene: ano4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6030 | ANO4 |
Ain Roesley gene: ANO4 was added gene: ANO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ANO4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANO4 were set to 38744284 Phenotypes for gene: ANO4 were set to neurodevelopmental disorder MONDO:0700092, ANO4-related Review for gene: ANO4 was set to GREEN gene: ANO4 was marked as current diagnostic Added comment: aka TMEM16D 5x de novo + 2x inherited missense (73% penetrance + asymptomatic) the ones with de novo variants: all had ID, hypotonia 4x skeletal features (scoliosis, funnel chest, pet plants, hyper extensible joints) all had epilepsy all had abnormal MRI Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6029 | KCND1 | Ain Roesley Classified gene: KCND1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6029 | KCND1 | Ain Roesley Gene: kcnd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6028 | KCND1 | Ain Roesley Marked gene: KCND1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6028 | KCND1 | Ain Roesley Gene: kcnd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6028 | KCND1 | Ain Roesley Classified gene: KCND1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6028 | KCND1 | Ain Roesley Gene: kcnd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6027 | KCND1 |
Ain Roesley gene: KCND1 was added gene: KCND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCND1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: KCND1 were set to 38772379 Phenotypes for gene: KCND1 were set to neurodevelopmental disorder MONDO:0700092, KCND1-related Review for gene: KCND1 was set to GREEN gene: KCND1 was marked as current diagnostic Added comment: 18 males from 17 families 2x de novo missense + 3x maternal NMDs + 12x maternal missense Some functional studies were done 14x ID 4x delayed motor dev 7x muscular hypotonia 6x epilepsy Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6026 | ATXN7L3 | Chirag Patel Classified gene: ATXN7L3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6026 | ATXN7L3 | Chirag Patel Gene: atxn7l3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6025 | ATXN7L3 |
Chirag Patel gene: ATXN7L3 was added gene: ATXN7L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATXN7L3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN7L3 were set to PMID: 38753057 Phenotypes for gene: ATXN7L3 were set to Neurodevelopmental disorder, MONDO_0100500 Review for gene: ATXN7L3 was set to GREEN gene: ATXN7L3 was marked as current diagnostic Added comment: This study reports 9 unrelated individuals with de novo heterozygous variants in ATXN7L3 identified through WES testing and GeneMatcher. Core clinical features included: global motor and language developmental delay, hypotonia, and dysmorphic features (hypertelorism, epicanthal folds, blepharoptosis, small nose, small mouth, and low-set posteriorly rotated ears). Variable features included: feeding difficulties, seizures, mild periventricular leukomalacia, and structural cardiac abnormalities. A recurrent nonsense variant [p.(Arg114Ter)] was found in 5/9 individuals. The other variants were 1 frameshift [p.(Ser112LysfsTer12)] and 3 missense variants [p.(Ile71Thr), p.(Ser92Arg), and p.(Leu106Pro)]. They investigated the effects of the recurrent nonsense variant [p.(Arg114Ter)] in fibroblasts of an affected individual. ATXN7L3 protein levels were reduced, and deubiquitylation was impaired (as indicated by an increase in histone H2Bub1 levels). This is consistent with the previous observation of increased H2Bub1 levels in Atxn7l3-null mouse embryos, which have developmental delay and embryonic lethality. Pathogenic variants in deubiquitinating enzymes (DUBs) have been implicated in neurodevelopmental disorders (ND) and congenital abnormalities. ATXN7L3 is a component of the DUB module of the SAGA complex, and two other related DUB modules, and serves as an obligate adaptor protein of 3 ubiquitin-specific proteases (USP22, USP27X or USP51). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6024 | FAM177A1 | Chirag Patel Classified gene: FAM177A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6024 | FAM177A1 | Chirag Patel Gene: fam177a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6023 | FAM177A1 | Chirag Patel Classified gene: FAM177A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6023 | FAM177A1 | Chirag Patel Gene: fam177a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6022 | FAM177A1 |
Chirag Patel gene: FAM177A1 was added gene: FAM177A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM177A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM177A1 were set to PMID: 38767059, 25558065 Phenotypes for gene: FAM177A1 were set to Neurodevelopmental disorder, MONDO_0100500 Review for gene: FAM177A1 was set to GREEN gene: FAM177A1 was marked as current diagnostic Added comment: PMID: 38767059 5 individuals from 3 unrelated families reported with with biallelic loss of function variants in FAM177A1. Clinical features included: global developmental delay, intellectual disability, seizures, behavioural abnormalities, hypotonia, gait disturbance, and macrocephaly. They showed that FAM177A1 localizes to the Golgi complex in mammalian and zebrafish cells. Intersection of the RNA-seq and metabolomic datasets from FAM177A1-deficient human fibroblasts and whole zebrafish larvae demonstrated dysregulation of pathways associated with apoptosis, inflammation, and negative regulation of cell proliferation. PMID: 25558065 A study of 143 multiplex consanguineous families identified a homozygous frameshift variant in FAM177A1 in 1 family with 4 affected siblings with intellectual disability, dolicocephaly, obesity, and macrocephaly. The variant segregated with all 4 affected siblings and parents were confirmed heterozygous carriers. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6021 | ERF | Chirag Patel Classified gene: ERF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6021 | ERF | Chirag Patel Gene: erf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6020 | ERF | Chirag Patel reviewed gene: ERF: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38824261; Phenotypes: Noonan syndrome-like with or without craniosynostosis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6020 | PPFIA3 | Zornitza Stark Publications for gene: PPFIA3 were set to 37034625 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6019 | PPFIA3 | Zornitza Stark edited their review of gene: PPFIA3: Changed publications: 38723631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6019 | SSR4 | Zornitza Stark Marked gene: SSR4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6019 | SSR4 | Zornitza Stark Gene: ssr4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6019 | SSR4 | Zornitza Stark Phenotypes for gene: SSR4 were changed from to Congenital disorder of glycosylation, type Iy, MIM# 300934 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6018 | SSR4 | Zornitza Stark Publications for gene: SSR4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6017 | SSR4 | Zornitza Stark Mode of inheritance for gene: SSR4 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6016 | SSR4 | Zornitza Stark reviewed gene: SSR4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type Iy, MIM# 300934; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6016 | RELN | Zornitza Stark Marked gene: RELN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6016 | RELN | Zornitza Stark Gene: reln has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6016 | RELN | Zornitza Stark Publications for gene: RELN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6015 | RELN | Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly 2 (Norman-Roberts type), MIM# 257320; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6015 | RELN | Zornitza Stark Phenotypes for gene: RELN were changed from to Lissencephaly 2 (Norman-Roberts type), MIM# 257320 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6014 | RELN | Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6013 | SLC35A1 | Anissa Johnson Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6013 | RELN |
Tashunka Taylor-Miller changed review comment from: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20) Variant spectrum includes: loss of function, missense, splice-site variants. MRI features include: anterior-predominant “thin”lisencephaly pachygyria with cerebellar hypoplasia Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia. Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile).; to: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20) Variant spectrum includes: loss of function, missense, splice-site variants. MRI features include: anterior-predominant “thin” lisencephaly pachygyria with cerebellar hypoplasia. Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia. Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6013 | RELN | Tashunka Taylor-Miller edited their review of gene: RELN: Changed publications: PMID: 35769015, PMID: 29671837 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6013 | RELN | Tashunka Taylor-Miller reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35769015, 29671837; Phenotypes: OMIM *600514, HP:0001339, DOID:0070338; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6013 | DPYD | Zornitza Stark Marked gene: DPYD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6013 | DPYD | Zornitza Stark Gene: dpyd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6013 | DPYD | Zornitza Stark Phenotypes for gene: DPYD were changed from to Dihydropyrimidine dehydrogenase deficiency (MIM#274270) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6012 | DPYD | Zornitza Stark Publications for gene: DPYD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6011 | DPYD | Zornitza Stark Mode of inheritance for gene: DPYD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6010 | DPYD | Zornitza Stark Classified gene: DPYD as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6010 | DPYD | Zornitza Stark Gene: dpyd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6009 | DMD | Zornitza Stark Marked gene: DMD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6009 | DMD | Zornitza Stark Gene: dmd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6009 | DMD | Zornitza Stark Phenotypes for gene: DMD were changed from to Duchenne muscular dystrophy MIM#310200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6008 | DMD | Zornitza Stark Mode of inheritance for gene: DMD was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6007 | DMD | Zornitza Stark Tag SV/CNV tag was added to gene: DMD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6007 | DMD | Zornitza Stark reviewed gene: DMD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Duchenne muscular dystrophy MIM#310200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6007 | SSR4 |
Katie Thompson changed review comment from: Decipher - only disorder of glycosolation (XLR) ORPHA:370927 OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females Western blot showed complete loss of protein; to: Decipher - disorder of glycosolation (XLR), strong evidence ORPHA:370927 GenCC strong. Not in gene2phenotype. OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females Western blot showed complete loss of protein. All variants caused loss of function mainly from premature termination. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6007 | COG7 | Zornitza Stark Marked gene: COG7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6007 | COG7 | Zornitza Stark Gene: cog7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6007 | COG7 | Zornitza Stark Phenotypes for gene: COG7 were changed from to Congenital disorder of glycosylation, type IIe , MIM#608779 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6006 | COG7 | Zornitza Stark Publications for gene: COG7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6005 | COG7 | Zornitza Stark Mode of inheritance for gene: COG7 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6005 | COG7 | Zornitza Stark Mode of inheritance for gene: COG7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6004 | COG7 | Zornitza Stark reviewed gene: COG7: Rating: GREEN; Mode of pathogenicity: None; Publications: 15107842, 17356545, 28883096; Phenotypes: Congenital disorder of glycosylation, type IIe , MIM#608779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6004 | SSR4 |
Katie Thompson changed review comment from: PMID: 24218363; 26264460 SSR4 Decipher - only disorder of glycosolation (XLR) ORPHA:370927 OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females; to: Decipher - only disorder of glycosolation (XLR) ORPHA:370927 OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females Western blot showed complete loss of protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6004 | COG1 | Zornitza Stark Marked gene: COG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6004 | COG1 | Zornitza Stark Gene: cog1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6004 | COG1 | Zornitza Stark Phenotypes for gene: COG1 were changed from to Congenital disorder of glycosylation, type IIg, MIM# 611209 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6003 | COG1 | Zornitza Stark Publications for gene: COG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6002 | COG1 | Zornitza Stark Mode of inheritance for gene: COG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6001 | SSR4 | Katie Thompson reviewed gene: SSR4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24218363, 26264460; Phenotypes: intellectual disabilities, hypotonia, microcephaly, seizures, Feeding problems, Facial dysmorphism, Gastrointestinal abnormalities, Failure to thrive, strabismus; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6001 | COG1 | Zornitza Stark reviewed gene: COG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16537452, 19008299, 17904886, 11980916; Phenotypes: Congenital disorder of glycosylation, type IIg, MIM# 611209; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6001 | COL4A1 | Zornitza Stark Marked gene: COL4A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6001 | COL4A1 | Zornitza Stark Gene: col4a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6001 | COL4A1 | Zornitza Stark Phenotypes for gene: COL4A1 were changed from to COL4A1-related disorder MONDO:0800461 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6000 | COL4A1 | Zornitza Stark Publications for gene: COL4A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5999 | COL4A1 | Zornitza Stark Mode of inheritance for gene: COL4A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5998 | SNAP29 | Zornitza Stark Marked gene: SNAP29 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5998 | SNAP29 | Zornitza Stark Gene: snap29 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5998 | SNAP29 | Zornitza Stark Phenotypes for gene: SNAP29 were changed from to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5997 | SNAP29 | Zornitza Stark Publications for gene: SNAP29 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5997 | SNAP29 | Zornitza Stark Mode of inheritance for gene: SNAP29 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5996 | SNAP29 | Zornitza Stark Mode of inheritance for gene: SNAP29 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5995 | SNAP29 | Zornitza Stark reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5995 | GABRA4 | Zornitza Stark Marked gene: GABRA4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5995 | GABRA4 | Zornitza Stark Gene: gabra4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5995 | GABRA4 | Zornitza Stark Phenotypes for gene: GABRA4 were changed from Developmental delay; Intellectual disability; Epileptic seizures to Neurodevelopmental disorder MONDO:0700092, GABRA4-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5994 | GABRA4 | Zornitza Stark Classified gene: GABRA4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5994 | GABRA4 | Zornitza Stark Gene: gabra4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5993 | GABRA4 | Zornitza Stark reviewed gene: GABRA4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder MONDO:0700092, GABRA4-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5993 | SNAP29 | Gunjan Garg reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33977139, 30793783, 29051910; Phenotypes: cerebral dysgenesis, 609528, Global developmental delay, schizencephaly, polymicrogyria, intellectual disability, neurodevelopment delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5993 | COL4A1 | Hali Van Niel reviewed gene: COL4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30413629, 33912663, 36786861, 32042920; Phenotypes: COL4A1-related disorder MONDO:0800461, brain small vessel disease 1 with or without ocular anomalies MONDO:0008289, microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5993 | CLN6 | Zornitza Stark Marked gene: CLN6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5993 | CLN6 | Zornitza Stark Gene: cln6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5993 | CLN6 | Zornitza Stark Phenotypes for gene: CLN6 were changed from to Ceroid lipofuscinosis, neuronal, 6, MIM# 601780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5992 | CLN6 | Zornitza Stark Mode of inheritance for gene: CLN6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5991 | CLN6 | Zornitza Stark reviewed gene: CLN6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 6, MIM# 601780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5991 | CLN3 | Zornitza Stark Marked gene: CLN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5991 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5991 | CLN3 | Zornitza Stark Phenotypes for gene: CLN3 were changed from to Ceroid lipofuscinosis, neuronal, 3 MIM#204200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5990 | CLN3 | Zornitza Stark Mode of inheritance for gene: CLN3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5989 | CLN3 | Zornitza Stark reviewed gene: CLN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 3 MIM#204200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5989 | CHD7 | Zornitza Stark Marked gene: CHD7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5989 | CHD7 | Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5989 | CHD7 | Zornitza Stark Phenotypes for gene: CHD7 were changed from to CHARGE syndrome, MIM# 214800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5988 | CHD7 | Zornitza Stark Mode of inheritance for gene: CHD7 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5987 | CHD7 | Zornitza Stark reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: CHARGE syndrome, MIM# 214800; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5987 | CC2D2A | Zornitza Stark Marked gene: CC2D2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5987 | CC2D2A | Zornitza Stark Gene: cc2d2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5987 | CC2D2A | Zornitza Stark Phenotypes for gene: CC2D2A were changed from to COACH syndrome 2, MIM# 619111; Joubert syndrome 9, MIM#612285; Meckel syndrome 6, MIM#612284 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5986 | CC2D2A | Zornitza Stark Mode of inheritance for gene: CC2D2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5985 | CC2D2A | Zornitza Stark reviewed gene: CC2D2A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: COACH syndrome 2, MIM# 619111, Joubert syndrome 9, 612285, Meckel syndrome 6, 612284; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5985 | CBL | Zornitza Stark Marked gene: CBL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5985 | CBL | Zornitza Stark Gene: cbl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5985 | CBL | Zornitza Stark Mode of pathogenicity for gene: CBL was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5985 | CBL | Zornitza Stark Phenotypes for gene: CBL were changed from to CBL-related disorder MONDO:0013308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5984 | CBL | Zornitza Stark Publications for gene: CBL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5983 | CBL | Zornitza Stark Mode of inheritance for gene: CBL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5982 | CACNA1A | Zornitza Stark Marked gene: CACNA1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5982 | CACNA1A | Zornitza Stark Gene: cacna1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5982 | CACNA1A | Zornitza Stark Phenotypes for gene: CACNA1A were changed from to developmental and epileptic encephalopathy, 42 MONDO:0014917 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5981 | CACNA1A | Zornitza Stark Publications for gene: CACNA1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5980 | CACNA1A | Zornitza Stark Mode of inheritance for gene: CACNA1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5979 | C12orf65 | Zornitza Stark Marked gene: C12orf65 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5979 | C12orf65 | Zornitza Stark Gene: c12orf65 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5979 | C12orf65 | Zornitza Stark Phenotypes for gene: C12orf65 were changed from to hereditary spastic paraplegia 55 MONDO:0014020 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5978 | C12orf65 | Zornitza Stark Publications for gene: C12orf65 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5977 | C12orf65 | Zornitza Stark Mode of inheritance for gene: C12orf65 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5976 | BTD | Zornitza Stark Marked gene: BTD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5976 | BTD | Zornitza Stark Gene: btd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5976 | BTD | Zornitza Stark Phenotypes for gene: BTD were changed from to biotinidase deficiency MONDO:0009665 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5975 | BTD | Zornitza Stark Publications for gene: BTD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5974 | BTD | Zornitza Stark Mode of inheritance for gene: BTD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5973 | BSCL2 | Zornitza Stark Marked gene: BSCL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5973 | BSCL2 | Zornitza Stark Gene: bscl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5973 | BSCL2 | Zornitza Stark Phenotypes for gene: BSCL2 were changed from to congenital generalized lipodystrophy type 2 MONDO:0010020 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5972 | BSCL2 | Zornitza Stark Publications for gene: BSCL2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5971 | BSCL2 | Zornitza Stark Mode of inheritance for gene: BSCL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5970 | BCS1L | Zornitza Stark Marked gene: BCS1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5970 | BCS1L | Zornitza Stark Gene: bcs1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5970 | BCS1L | Zornitza Stark Phenotypes for gene: BCS1L were changed from to Bjornstad syndrome MONDO:0009872 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5969 | BCS1L | Zornitza Stark Publications for gene: BCS1L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5968 | BCS1L | Zornitza Stark Mode of inheritance for gene: BCS1L was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5967 | BCKDHB | Zornitza Stark Marked gene: BCKDHB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5967 | BCKDHB | Zornitza Stark Gene: bckdhb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5967 | BCKDHB | Zornitza Stark Phenotypes for gene: BCKDHB were changed from to maple syrup urine disease type 1B MONDO:0023692 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5966 | BCKDHB | Zornitza Stark Publications for gene: BCKDHB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5965 | BCKDHB | Zornitza Stark Mode of inheritance for gene: BCKDHB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5964 | BCKDHA | Zornitza Stark Marked gene: BCKDHA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5964 | BCKDHA | Zornitza Stark Gene: bckdha has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5964 | BCKDHA | Zornitza Stark Phenotypes for gene: BCKDHA were changed from to maple syrup urine disease type 1A MONDO:0023691 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5963 | BCKDHA | Zornitza Stark Publications for gene: BCKDHA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5962 | BCKDHA | Zornitza Stark Mode of inheritance for gene: BCKDHA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5961 | BBS2 | Zornitza Stark Marked gene: BBS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5961 | BBS2 | Zornitza Stark Gene: bbs2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5961 | BBS2 | Zornitza Stark Phenotypes for gene: BBS2 were changed from to Bardet-Biedl syndrome 2 MONDO:0014432 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5960 | BBS2 | Zornitza Stark Publications for gene: BBS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5959 | BBS2 | Zornitza Stark Mode of inheritance for gene: BBS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5958 | BBS12 | Zornitza Stark Marked gene: BBS12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5958 | BBS12 | Zornitza Stark Gene: bbs12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5958 | BBS12 | Zornitza Stark Phenotypes for gene: BBS12 were changed from to Bardet-Biedl syndrome 12 MONDO:0014440 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5957 | BBS12 | Zornitza Stark Publications for gene: BBS12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5956 | BBS12 | Zornitza Stark Mode of inheritance for gene: BBS12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5955 | BBS10 | Zornitza Stark Marked gene: BBS10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5955 | BBS10 | Zornitza Stark Gene: bbs10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5955 | BBS10 | Zornitza Stark Phenotypes for gene: BBS10 were changed from to Bardet-Biedl syndrome 10 MONDO:0014438 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5954 | BBS10 | Zornitza Stark Publications for gene: BBS10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5953 | BBS10 | Zornitza Stark Mode of inheritance for gene: BBS10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5952 | BBS1 | Zornitza Stark Marked gene: BBS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5952 | BBS1 | Zornitza Stark Gene: bbs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5952 | BBS1 | Zornitza Stark Phenotypes for gene: BBS1 were changed from to Bardet-Biedl syndrome 1 MONDO:0008854 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5951 | BBS1 | Zornitza Stark Publications for gene: BBS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5950 | BBS1 | Zornitza Stark Mode of inheritance for gene: BBS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5949 | TBCE | Zornitza Stark Marked gene: TBCE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5949 | TBCE | Zornitza Stark Gene: tbce has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5949 | TBCE | Zornitza Stark Phenotypes for gene: TBCE were changed from to Encephalopathy, progressive, with amyotrophy and optic atrophy MIM:617207; Hypoparathyroidism-retardation-dysmorphism syndrome MIM:241410 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5948 | TBCE | Zornitza Stark Publications for gene: TBCE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5947 | TBCE | Zornitza Stark Mode of inheritance for gene: TBCE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5946 | SLC25A1 | Zornitza Stark Marked gene: SLC25A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5946 | SLC25A1 | Zornitza Stark Gene: slc25a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5946 | SLC25A1 | Zornitza Stark Phenotypes for gene: SLC25A1 were changed from to Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072; Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5945 | SLC25A1 | Zornitza Stark Publications for gene: SLC25A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5944 | SLC25A1 | Zornitza Stark Mode of inheritance for gene: SLC25A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5943 | SLC25A1 | Zornitza Stark reviewed gene: SLC25A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072, Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5943 | ROR2 | Zornitza Stark Marked gene: ROR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5943 | ROR2 | Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5943 | ROR2 | Zornitza Stark Phenotypes for gene: ROR2 were changed from to Robinow syndrome, autosomal recessive, MIM#268310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5942 | ROR2 | Zornitza Stark Publications for gene: ROR2 were set to 33937263, 32954672, 32172608 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5941 | ROR2 | Zornitza Stark Publications for gene: ROR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5940 | ROR2 | Zornitza Stark Mode of inheritance for gene: ROR2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5939 | ROR2 | Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Robinow syndrome, autosomal recessive, MIM#268310; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5939 | SOX10 | Zornitza Stark Marked gene: SOX10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5939 | SOX10 | Zornitza Stark Gene: sox10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5939 | SOX10 | Zornitza Stark Phenotypes for gene: SOX10 were changed from to Peripheral demyelinating neuropathy Central demyelination, Waardenburg and Hirschsprung disease, OMIM #609136; Waardenburg syndrome, type 2E, with or without neurologic involvement (OMIM #611584) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5938 | SOX10 | Zornitza Stark Publications for gene: SOX10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5937 | SOX10 | Zornitza Stark Mode of inheritance for gene: SOX10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5936 | SLC4A4 | Zornitza Stark Marked gene: SLC4A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5936 | SLC4A4 | Zornitza Stark Gene: slc4a4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5936 | SLC4A4 | Zornitza Stark Mode of inheritance for gene: SLC4A4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5935 | SLC4A4 | Zornitza Stark Mode of inheritance for gene: SLC4A4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5934 | SLC4A4 | Zornitza Stark Publications for gene: SLC4A4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5933 | SLC4A4 | Zornitza Stark Phenotypes for gene: SLC4A4 were changed from to Renal tubular acidosis, proximal, with ocular abnormalities MIM#604278 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5932 | SLX4 | Zornitza Stark Marked gene: SLX4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5932 | SLX4 | Zornitza Stark Gene: slx4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5932 | SLX4 | Zornitza Stark Phenotypes for gene: SLX4 were changed from to Fanconi anaemia, complementation group P, MIM# 613951 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5931 | SLX4 | Zornitza Stark Publications for gene: SLX4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5930 | SLX4 | Zornitza Stark Mode of inheritance for gene: SLX4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5929 | SLX4 | Zornitza Stark Classified gene: SLX4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5929 | SLX4 | Zornitza Stark Gene: slx4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5928 | SLX4 | Zornitza Stark reviewed gene: SLX4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Fanconi anemia, complementation group P, MIM# 613951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5928 | SCN8A | Zornitza Stark Marked gene: SCN8A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5928 | SCN8A | Zornitza Stark Gene: scn8a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5928 | SCN8A | Zornitza Stark Phenotypes for gene: SCN8A were changed from to Developmental and epileptic encephalopathy 13, MIM# 614558 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5927 | SCN8A | Zornitza Stark Publications for gene: SCN8A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5926 | SCN8A | Zornitza Stark Mode of inheritance for gene: SCN8A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5925 | THRA | Zornitza Stark Marked gene: THRA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5925 | THRA | Zornitza Stark Gene: thra has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5925 | THRA | Zornitza Stark Phenotypes for gene: THRA were changed from to Hypothyroidism congenital nongoitrous 6 (MIM 614450) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5924 | THRA | Zornitza Stark Publications for gene: THRA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5923 | THRA | Zornitza Stark Mode of inheritance for gene: THRA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5922 | SIX3 | Zornitza Stark Marked gene: SIX3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5922 | SIX3 | Zornitza Stark Gene: six3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5922 | SIX3 | Zornitza Stark Phenotypes for gene: SIX3 were changed from to Holoprosencephaly 2, autosomal dominant, MIM#157170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5921 | SIX3 | Zornitza Stark Publications for gene: SIX3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5920 | SIX3 | Zornitza Stark Mode of inheritance for gene: SIX3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5919 | SIX3 | Zornitza Stark reviewed gene: SIX3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holoprosencephaly 2, autosomal dominant, MIM#157170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5919 | SAMHD1 | Zornitza Stark Marked gene: SAMHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5919 | SAMHD1 | Zornitza Stark Gene: samhd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5919 | SAMHD1 | Zornitza Stark Phenotypes for gene: SAMHD1 were changed from to Aicardi-Goutieres syndrome 5, MIM# 612952 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5918 | SAMHD1 | Zornitza Stark Publications for gene: SAMHD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5917 | SAMHD1 | Zornitza Stark Mode of inheritance for gene: SAMHD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5916 | SCN2A | Zornitza Stark Marked gene: SCN2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5916 | SCN2A | Zornitza Stark Gene: scn2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5916 | SCN2A | Zornitza Stark Publications for gene: SCN2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5915 | SCN2A | Zornitza Stark Phenotypes for gene: SCN2A were changed from to Developmental and epileptic encephalopathy 11, MIM# 613721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5914 | SCN2A | Zornitza Stark Mode of inheritance for gene: SCN2A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5913 | SCN2A | Zornitza Stark Mode of inheritance for gene: SCN2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5912 | BMP4 | Zornitza Stark Phenotypes for gene: BMP4 were changed from Microphthalmia, syndromic 6, MIM# 607932 to Microphthalmia, syndromic 6, MIM# 607932 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5911 | BMP4 | Zornitza Stark Marked gene: BMP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5911 | BMP4 | Zornitza Stark Gene: bmp4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5911 | BMP4 | Zornitza Stark Phenotypes for gene: BMP4 were changed from to Microphthalmia, syndromic 6, MIM# 607932 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5910 | BMP4 | Zornitza Stark Publications for gene: BMP4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5909 | BMP4 | Zornitza Stark Mode of inheritance for gene: BMP4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5908 | BMP4 | Zornitza Stark edited their review of gene: BMP4: Changed publications: 31053785 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5908 | BMP4 | Zornitza Stark reviewed gene: BMP4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Microphthalmia, syndromic 6, MIM# 607932; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5908 | CDON | Zornitza Stark Marked gene: CDON as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5908 | CDON | Zornitza Stark Gene: cdon has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5908 | CDON | Zornitza Stark Phenotypes for gene: CDON were changed from to holoprosencephaly 11 MONDO:0013642 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5907 | CDON | Zornitza Stark Publications for gene: CDON were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5906 | CDON | Zornitza Stark Mode of inheritance for gene: CDON was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5905 | RBBP8 | Zornitza Stark Marked gene: RBBP8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5905 | RBBP8 | Zornitza Stark Gene: rbbp8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5905 | RBBP8 | Zornitza Stark Phenotypes for gene: RBBP8 were changed from to Jawad syndrome, MIM#251255; Seckel syndrome 2, MIM#606744 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5904 | RBBP8 | Zornitza Stark Publications for gene: RBBP8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5903 | RBBP8 | Zornitza Stark Mode of inheritance for gene: RBBP8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5902 | RBBP8 | Zornitza Stark reviewed gene: RBBP8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Jawad syndrome, MIM#251255, Seckel syndrome 2, MIM#606744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5902 | RBBP8 | James The reviewed gene: RBBP8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:30561437, 34270086, 32379725; Phenotypes: 606744, 251255, 113705; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5902 | CDON | Hali Van Niel reviewed gene: CDON: Rating: GREEN; Mode of pathogenicity: None; Publications: 21802063, 26728615, 31502381, 32729136, 26529631; Phenotypes: holoprosencephaly 11 MONDO:0013642; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5902 | SAMD9 | Zornitza Stark Marked gene: SAMD9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5902 | SAMD9 | Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5902 | SAMD9 | Zornitza Stark Phenotypes for gene: SAMD9 were changed from MIRAGE Syndrome, MIM#617053 to MIRAGE Syndrome, MIM#617053 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5901 | SAMD9 | Zornitza Stark Phenotypes for gene: SAMD9 were changed from to MIRAGE Syndrome, MIM#617053 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5900 | SAMD9 | Zornitza Stark Publications for gene: SAMD9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5899 | SAMD9 | Zornitza Stark Mode of inheritance for gene: SAMD9 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5898 | SAMD9 | Zornitza Stark reviewed gene: SAMD9: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: MIRAGE Syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5898 | BMP4 | Hali Van Niel reviewed gene: BMP4: Rating: AMBER; Mode of pathogenicity: None; Publications: 22581619, 31053785, 30568244, 18252212, 21340693, 34926457, 36140739, 37107605; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5898 | LIG4 | Zornitza Stark Marked gene: LIG4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5898 | LIG4 | Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5898 | LIG4 | Zornitza Stark Publications for gene: LIG4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5897 | LIG4 | Zornitza Stark Phenotypes for gene: LIG4 were changed from to LIG4 syndrome, MIM# 606593 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5896 | LIG4 | Zornitza Stark Mode of inheritance for gene: LIG4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5895 | LIG4 | Zornitza Stark Mode of inheritance for gene: LIG4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5894 | SLC35A1 | Zornitza Stark Marked gene: SLC35A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5894 | SLC35A1 | Zornitza Stark Gene: slc35a1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5894 | SLC35A1 | Zornitza Stark Phenotypes for gene: SLC35A1 were changed from to Congenital disorder of glycosylation, type IIf, MIM# 603585 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5893 | SLC35A1 | Zornitza Stark Publications for gene: SLC35A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5892 | SLC35A1 | Zornitza Stark Mode of inheritance for gene: SLC35A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5891 | SLC35A1 | Zornitza Stark Classified gene: SLC35A1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5891 | SLC35A1 | Zornitza Stark Gene: slc35a1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5890 | SLC35A1 | Zornitza Stark edited their review of gene: SLC35A1: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5890 | SLC35A1 | Zornitza Stark changed review comment from: At least 3 families reported.; to: At least 3 families reported, neurological presentation in two. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5890 | SLC35A1 | Zornitza Stark reviewed gene: SLC35A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28856833, 23873973, 11157507; Phenotypes: Congenital disorder of glycosylation, type IIf, MIM# 603585; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5890 | LRPPRC | Zornitza Stark Marked gene: LRPPRC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5890 | LRPPRC | Zornitza Stark Gene: lrpprc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5890 | LRPPRC | Zornitza Stark Phenotypes for gene: LRPPRC were changed from to Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), MIM#220111 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5889 | LRPPRC | Zornitza Stark Publications for gene: LRPPRC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5888 | LRPPRC | Zornitza Stark Mode of inheritance for gene: LRPPRC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5887 | LRPPRC | Zornitza Stark reviewed gene: LRPPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), MIM#220111; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5887 | TREX1 | Zornitza Stark Marked gene: TREX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5887 | TREX1 | Zornitza Stark Gene: trex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5887 | TREX1 | Zornitza Stark Phenotypes for gene: TREX1 were changed from to Aicardi-Goutieres syndrome MONDO:0018866 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5886 | TREX1 | Zornitza Stark Publications for gene: TREX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5885 | TREX1 | Zornitza Stark Mode of inheritance for gene: TREX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5884 | SERAC1 | Zornitza Stark Marked gene: SERAC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5884 | SERAC1 | Zornitza Stark Gene: serac1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5884 | SERAC1 | Zornitza Stark Phenotypes for gene: SERAC1 were changed from to 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL), MIM#614739 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5883 | SERAC1 | Zornitza Stark Publications for gene: SERAC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5883 | SERAC1 | Zornitza Stark Mode of inheritance for gene: SERAC1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5882 | SERAC1 | Zornitza Stark Mode of inheritance for gene: SERAC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SERAC1 | Zornitza Stark reviewed gene: SERAC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24741715, 37711114, 37090937, 28916646, 32684373; Phenotypes: 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL), MIM#614739; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | TREX1 |
Hali Van Niel changed review comment from: Established gene disease association with Aicardi-Goutières Syndrome Heterogeneity with variable phenotype, ranges from preserved cognition to severe intellectual disability TREX1-related Aicardi Goutières syndrome have higher impairment (31559893) ID common presenting feature (PMID: 25604658); to: Established gene disease association with Aicardi-Goutières Syndrome Heterogeneity with variable phenotype, ranges from preserved cognition to severe intellectual disability TREX1-related Aicardi Goutières syndrome have higher impairment (PMID: 31559893) ID common presenting feature (PMID: 25604658) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | TREX1 | Hali Van Niel edited their review of gene: TREX1: Changed publications: 25604658, 16845398, 17357087, 31559893 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | TREX1 | Hali Van Niel reviewed gene: TREX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25604658, 16845398, 17357087; Phenotypes: Aicardi-Goutieres syndrome MONDO:0018866; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | LRPPRC | Kirsty Choi reviewed gene: LRPPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21266382, 8392290, 8392291, 26510951; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), 220111, developmental delay, hypotonia, mild facial dysmorphism, chronic well-compensated metabolic acidosis, high mortality due to episodes of severe acidosis and coma, hypertension, cerebrospinal fluid lactate levels, decreased blood bicarbonate levels, microvesicular steatosis, psychomotor delay, ataxia, hypotonia, transient tachypnea of the newborn, poor sucking, tremor, hypoglycemia, seizures; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 |
Anissa Johnson changed review comment from: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". AR inheritance.; to: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents, consanguineous, were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". AR inheritance. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 |
Anissa Johnson changed review comment from: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation".; to: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". AR inheritance. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 | Anissa Johnson commented on gene: SLC35A1: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 | Anissa Johnson reviewed gene: SLC35A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23873973; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | LIG4 | Santosh Varughese reviewed gene: LIG4: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 16088910, 9823897, 10911993, 15333585, 9809069, 12023982, 11040211, 15175260, 19451691, 17554302; Phenotypes: lIG4 syndrome, MULTIPLE MYELOMA, RESISTANCE TO; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SAMD9 | Raluca Rusu reviewed gene: SAMD9: Rating: RED; Mode of pathogenicity: Other; Publications: PMID: 27182967, 34659124, 32194975, 29175836, 37195360, 30900330, 37745698; Phenotypes: MIRAGE Syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SCN2A | sabitha sateesh reviewed gene: SCN2A: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 31230762, 31904126, 28256214, 31904120, 31924505, 31205438, 1325650, 17021166; Phenotypes: Intellectual disability, autism, motor delay, epileptic seizures, uncoordinated oral movements, gastrointestinal disturbances, sleep problems.; Mode of inheritance: Unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SAMHD1 | Reetoo Ramessur reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301648, 29239743, 25246298, 19525956, 21102625, 33307271, 35418820; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SIX3 | Laura Mazurkijevic reviewed gene: SIX3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20531442, 19346217, 20157829, 15635066; Phenotypes: Holoprosencephaly 2, autosomal dominant, MIM#157170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | THRA |
Hnin Aung changed review comment from: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].; to: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestations for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899]. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | THRA |
Hnin Aung changed review comment from: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].; to: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899]. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | THRA | Hnin Aung reviewed gene: THRA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22494134, 23940126, 24847461, 25670821, 26037512, 25621899, 27144938, 28856816, 30842990, 37469961; Phenotypes: Hypothyroidism congenital nongoitrous 6 (MIM 614450), Intellectual disability syndromic, Growth retardation, Facial dysmorphism, Constipation; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SCN8A | Tinashe Nhindiri reviewed gene: SCN8A: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 34353676, 38233770, 30171078; Phenotypes: Epileptic encephalopathy, Developmental delay, Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLX4 | Lovepreet Gill reviewed gene: SLX4: Rating: RED; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: (PMID: 21240277, 21240275, 23093618, 26453996); Phenotypes: Franconia anemia, complementation group P; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC4A4 | Adam Ivey reviewed gene: SLC4A4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29914390, 11274232, 15930088; Phenotypes: OMIM:604278-RENAL TUBULAR ACIDOSIS, PROXIMAL, WITH OCULAR ABNORMALITIES AND IMPAIRED INTELLECTUAL DEVELOPMENT; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SOX10 | David Fairbairn changed review comment from: Main mutation mechanism: truncated proteins, potent dominant-negative activity and more severe phenotype only when escapes NMD. Decipher: SOX 10 copy number losses and gains associated with intellectual disability. PCWH Gene2Phenotype: monoallelic-altered gene product structure, DD definitive. Waardenburg syndrome, type 2E Gene2Phenotype: monoallelic-absent gene product, DD definitive. GenCC definitive. OMIM #609136: dominant-negative heterozygous SOX 10 variants in multiple (>3) unrelated cases resulting in neurologic features.; to: Main mutation mechanism: truncated proteins, potent dominant-negative activity and more severe phenotype only when escapes NMD. Decipher: SOX 10 copy number losses and gains associated with intellectual disability. PCWH Gene2Phenotype: monoallelic-altered gene product structure, DD definitive. Waardenburg syndrome, type 2E Gene2Phenotype: monoallelic-absent gene product, DD definitive. GenCC definitive. OMIM #609136: dominant-negative heterozygous SOX 10 variants in multiple (>3) unrelated cases resulting in neurologic features. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SOX10 | David Fairbairn reviewed gene: SOX10: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10762540, 34667088, 38132479; Phenotypes: PCWH (Peripheral demyelinating neuropathy Central demyelination, Waardenburg and Hirschsprung disease) syndrome (OMIM #609136), Waardenburg syndrome, type 2E, with or without neurologic involvement (OMIM #611584); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | ROR2 | Shani Stuart reviewed gene: ROR2: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 33937263, 32954672, 32172608; Phenotypes: Intellectual disability; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC25A1 | Alyson Lewis reviewed gene: SLC25A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31527857, PMID: 26870663; Phenotypes: Impaired intellectual development, mild, Learning disabilities, Delayed motor development; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | TBCE | Leanne Baxter reviewed gene: TBCE: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID:27666369: PMID:17699660: PMID:34356170: PMID: 34134906; Phenotypes: Encephalopathy, progressive, with amyotrophy and optic atrophy MIM:617207, Hypoparathyroidism-retardation-dysmorphism syndrome MIM:241410, Kenny-Caffey syndrome, type 1 MIM:244460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC19A3 | Zornitza Stark Marked gene: SLC19A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC19A3 | Zornitza Stark Gene: slc19a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SLC19A3 | Zornitza Stark Publications for gene: SLC19A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5880 | SLC19A3 | Zornitza Stark Phenotypes for gene: SLC19A3 were changed from to Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5879 | SLC19A3 | Zornitza Stark Mode of inheritance for gene: SLC19A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SPECC1L | Zornitza Stark Marked gene: SPECC1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SPECC1L | Zornitza Stark Gene: specc1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SLC19A3 | Jane Lin changed review comment from: Rare disorder of thiamine metabolism and transport. Has well characterised gene-phenotype link in more than 3 families (multiple publications, in different subpopulations). Many symptoms in this disorder, for example confusion, seizures, ataxia, dystonia, supranuclear facial palsy, external ophthalmoplegia, and dysphagia. ID has been described as a sequela in many cases.; to: Rare disorder of thiamine metabolism and transport. Has well characterised gene-phenotype link for THMD2 in more than 3 families (multiple publications, in different subpopulations). Many CNS related symptoms in this disorder, for example confusion, seizures, ataxia, dystonia, supranuclear facial palsy, external ophthalmoplegia, and dysphagia. ID has been described as a sequela in many cases. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SLC19A3 | Jane Lin reviewed gene: SLC19A3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15871139, PMID: 34276785, PMID: 23482991, PMID: 20065143; Phenotypes: # 607483 BASAL GANGLIA DISEASE, BIOTIN-THIAMINE RESPONSIVE (BBTGD), THIAMINE METABOLISM DYSFUNCTION SYNDROME 2; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SASS6 | Zornitza Stark Marked gene: SASS6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SASS6 | Zornitza Stark Gene: sass6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SASS6 | Zornitza Stark Classified gene: SASS6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5878 | SASS6 | Zornitza Stark Gene: sass6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5877 | SASS6 |
Zornitza Stark gene: SASS6 was added gene: SASS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: SASS6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SASS6 were set to 24951542; 30639237 Phenotypes for gene: SASS6 were set to Microcephaly 14, primary, autosomal recessive, MIM# 616402 Review for gene: SASS6 was set to GREEN Added comment: At least 3 unrelated families reported, severe ID is part of the phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5876 | SPECC1L | Zornitza Stark Phenotypes for gene: SPECC1L were changed from to Teebi hypertelorism syndrome 1, MIM# 145420 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5875 | SPECC1L | Zornitza Stark Publications for gene: SPECC1L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5874 | SPECC1L | Zornitza Stark Mode of inheritance for gene: SPECC1L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5873 | SPECC1L | Zornitza Stark reviewed gene: SPECC1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Teebi hypertelorism syndrome 1, MIM# 145420; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5873 | SPECC1L | Ibrahim El-Deek changed review comment from: There is paucity of literature directly linking SPECC1L variants to intellectual disability and developmental delay. However, Zhang et al. (PMID: 31953237) reviewed 33 patients from 14 families with SPECC1L variants, noting that the most common features were dysmorphic facial characteristics. Developmental delays were reported in 24.2% of patients (8/33), with some achieving normal development during childhood.; to: There is paucity of literature directly linking SPECC1L variants to intellectual disability and developmental delay. However, Zhang et al. (PMID: 31953237) reviewed 33 patients from 14 families with SPECC1L variants (including 10 missense point mutation and 1 deletion), noting that the most common features were dysmorphic facial characteristics. Developmental delays were reported in 24.2% of patients (8/33), with some achieving normal development during childhood. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5873 | SPECC1L | Ibrahim El-Deek reviewed gene: SPECC1L: Rating: RED; Mode of pathogenicity: Other; Publications: 31953237, 30472488; Phenotypes: Teebi hypertelorism syndrome 1, Oblique Facial Clefting 1, Opitz GBBB syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5873 | GABRA4 |
Adam Ivey gene: GABRA4 was added gene: GABRA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABRA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRA4 were set to PMID: 38565639 Phenotypes for gene: GABRA4 were set to Developmental delay; Intellectual disability; Epileptic seizures Penetrance for gene: GABRA4 were set to Complete Review for gene: GABRA4 was set to GREEN Added comment: Four unrelated individuals with unique de novo missense variants in the transmembrane domain of GABRA4 have developmental delay and varying degrees of intellectual disability (PMID: 38565639). These variants are not present in gnomAD and three of the four variants have pathogenic REVEL scores. Two of the GABRA4 variants were heterozygous, while the remaining two were mosaic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5873 | L1CAM | Zornitza Stark Marked gene: L1CAM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5873 | L1CAM | Zornitza Stark Gene: l1cam has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5873 | L1CAM | Zornitza Stark Phenotypes for gene: L1CAM were changed from to L1 syndrome MONDO:0017140 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5872 | L1CAM | Zornitza Stark Mode of inheritance for gene: L1CAM was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5871 | LAMC3 | Zornitza Stark Marked gene: LAMC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5871 | LAMC3 | Zornitza Stark Gene: lamc3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5871 | LAMC3 | Zornitza Stark Phenotypes for gene: LAMC3 were changed from to complex neurodevelopmental disorder MONDO:0100038; Cortical malformations, occipital, MIM# 614115 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5870 | LAMC3 | Zornitza Stark Publications for gene: LAMC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5869 | LAMC3 | Zornitza Stark Mode of inheritance for gene: LAMC3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5868 | LAMC3 | Zornitza Stark Classified gene: LAMC3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5868 | LAMC3 | Zornitza Stark Gene: lamc3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5867 | LAMC3 | Zornitza Stark reviewed gene: LAMC3: Rating: AMBER; Mode of pathogenicity: None; Publications: 38758065, 21572413; Phenotypes: complex neurodevelopmental disorder MONDO:0100038, Cortical malformations, occipital, MIM# 614115; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5867 | MAGT1 | Zornitza Stark Phenotypes for gene: MAGT1 were changed from Congenital disorder of glycosylation, type Icc, OMIM #301031; Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia, OMIM #300853 to X-linked intellectual disability MONDO:0100284; Congenital disorder of glycosylation, type Icc, OMIM #301031 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5866 | MAGT1 | Zornitza Stark Classified gene: MAGT1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5866 | MAGT1 | Zornitza Stark Gene: magt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5865 | MAGT1 | Zornitza Stark Tag disputed tag was added to gene: MAGT1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5865 | MBTPS2 | Zornitza Stark Marked gene: MBTPS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5865 | MBTPS2 | Zornitza Stark Gene: mbtps2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5865 | MBTPS2 | Zornitza Stark Phenotypes for gene: MBTPS2 were changed from to IFAP syndrome 1, with or without BRESHECK syndrome MONDO:0100213 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5864 | MBTPS2 | Zornitza Stark Mode of inheritance for gene: MBTPS2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5863 | MED12 | Zornitza Stark Marked gene: MED12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5863 | MED12 | Zornitza Stark Gene: med12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5863 | MED12 | Zornitza Stark Phenotypes for gene: MED12 were changed from to MED12-related intellectual disability syndrome MONDO:0100000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5862 | MED12 | Zornitza Stark Mode of inheritance for gene: MED12 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5861 | MED13L | Zornitza Stark Marked gene: MED13L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5861 | MED13L | Zornitza Stark Gene: med13l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5861 | MED13L | Zornitza Stark Phenotypes for gene: MED13L were changed from to syndromic intellectual disability MONDO:0000508 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5860 | MED13L | Zornitza Stark Publications for gene: MED13L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5859 | MED13L | Zornitza Stark Mode of inheritance for gene: MED13L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5858 | MED23 | Zornitza Stark Marked gene: MED23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5858 | MED23 | Zornitza Stark Gene: med23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5858 | MED23 | Zornitza Stark Phenotypes for gene: MED23 were changed from to syndromic intellectual disability MONDO:0000508 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5857 | MED23 | Zornitza Stark Publications for gene: MED23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5856 | MED23 | Zornitza Stark Mode of inheritance for gene: MED23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5855 | MID1 | Zornitza Stark Marked gene: MID1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5855 | MID1 | Zornitza Stark Gene: mid1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5855 | MID1 | Zornitza Stark Phenotypes for gene: MID1 were changed from to X-linked Opitz G/BBB syndrome MONDO:0010222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5854 | MID1 | Zornitza Stark Mode of inheritance for gene: MID1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5853 | NDP | Zornitza Stark Marked gene: NDP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5853 | NDP | Zornitza Stark Gene: ndp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5853 | NDP | Zornitza Stark Phenotypes for gene: NDP were changed from to Norrie disease MONDO:0010691 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5852 | NDP | Zornitza Stark Mode of inheritance for gene: NDP was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5851 | NSD1 | Zornitza Stark Marked gene: NSD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5851 | NSD1 | Zornitza Stark Gene: nsd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5851 | NSD1 | Zornitza Stark Phenotypes for gene: NSD1 were changed from to Sotos syndrome MONDO:0019349 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5850 | NSD1 | Zornitza Stark Mode of inheritance for gene: NSD1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5849 | OCRL | Zornitza Stark Marked gene: OCRL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5849 | OCRL | Zornitza Stark Gene: ocrl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5849 | OCRL | Zornitza Stark Phenotypes for gene: OCRL were changed from to oculocerebrorenal syndrome MONDO:0010645 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5848 | OCRL | Zornitza Stark Mode of inheritance for gene: OCRL was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5847 | OFD1 | Zornitza Stark Marked gene: OFD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5847 | OFD1 | Zornitza Stark Gene: ofd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5847 | OFD1 | Zornitza Stark Phenotypes for gene: OFD1 were changed from to ciliopathy MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5846 | OFD1 | Zornitza Stark Publications for gene: OFD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5845 | OFD1 | Zornitza Stark Mode of inheritance for gene: OFD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5844 | PLP1 | Zornitza Stark Marked gene: PLP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5844 | PLP1 | Zornitza Stark Gene: plp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5844 | PLP1 | Zornitza Stark Phenotypes for gene: PLP1 were changed from to Pelizeaus-Merzbacher spectrum disorder MONDO:0010714 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5843 | PLP1 | Zornitza Stark Mode of inheritance for gene: PLP1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5842 | PORCN | Zornitza Stark Marked gene: PORCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5842 | PORCN | Zornitza Stark Gene: porcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5842 | PORCN | Zornitza Stark Phenotypes for gene: PORCN were changed from to focal dermal hypoplasia MONDO:0010592 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5841 | PORCN | Zornitza Stark Publications for gene: PORCN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5840 | PORCN | Zornitza Stark Mode of inheritance for gene: PORCN was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5839 | PTCHD1 | Zornitza Stark Marked gene: PTCHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5839 | PTCHD1 | Zornitza Stark Gene: ptchd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5839 | PTCHD1 | Zornitza Stark Phenotypes for gene: PTCHD1 were changed from to non-syndromic X-linked intellectual disability MONDO:0019181 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5838 | PTCHD1 | Zornitza Stark Mode of inheritance for gene: PTCHD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5837 | SETBP1 | Zornitza Stark Marked gene: SETBP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5837 | SETBP1 | Zornitza Stark Gene: setbp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5837 | SETBP1 | Zornitza Stark Phenotypes for gene: SETBP1 were changed from to Schinzel-Giedion syndrome MONDO:0010010; complex neurodevelopmental disorder MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5836 | SETBP1 | Zornitza Stark Publications for gene: SETBP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5835 | SETBP1 | Zornitza Stark Mode of inheritance for gene: SETBP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5834 | SHROOM4 | Zornitza Stark Classified gene: SHROOM4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5834 | SHROOM4 | Zornitza Stark Gene: shroom4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5833 | SHROOM4 | Zornitza Stark Tag disputed tag was added to gene: SHROOM4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5833 | SLC25A15 | Zornitza Stark Marked gene: SLC25A15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5833 | SLC25A15 | Zornitza Stark Gene: slc25a15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5833 | SLC25A15 | Zornitza Stark Phenotypes for gene: SLC25A15 were changed from to Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, MIM#238970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5832 | SLC25A15 | Zornitza Stark Publications for gene: SLC25A15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5831 | SLC25A15 | Zornitza Stark Mode of inheritance for gene: SLC25A15 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5830 | SLC6A4 | Zornitza Stark Phenotypes for gene: SLC6A4 were changed from {Obsessive-compulsive disorder}, MIM# 164230; depression; alcohol dependence to autism spectrum disorder MONDO:0005258; {Obsessive-compulsive disorder}, MIM# 164230 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5829 | SLC6A4 | Zornitza Stark Tag disputed tag was added to gene: SLC6A4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5829 | WAC | Zornitza Stark Publications for gene: WAC were set to 26264232 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5828 | ZDHHC15 | Zornitza Stark Phenotypes for gene: ZDHHC15 were changed from Mental retardation, X-linked 91, 300577 to Intellectual disability, X-linked 91, 300577 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5827 | ZDHHC15 | Zornitza Stark Tag disputed tag was added to gene: ZDHHC15. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5827 | ZNF41 | Zornitza Stark Phenotypes for gene: ZNF41 were changed from to non-syndromic X-linked intellectual disability MONDO:0019181 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5826 | ZNF41 | Zornitza Stark Mode of inheritance for gene: ZNF41 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5825 | ZNF41 | Zornitza Stark Tag disputed tag was added to gene: ZNF41. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5825 | ZNF674 | Zornitza Stark Tag disputed tag was added to gene: ZNF674. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5825 | ZNF81 | Zornitza Stark Phenotypes for gene: ZNF81 were changed from Intellectual disability to X-linked intellectual disability MONDO:0100284 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5824 | SHANK2 | Zornitza Stark Marked gene: SHANK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5824 | SHANK2 | Zornitza Stark Gene: shank2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5824 | SHANK2 | Zornitza Stark Phenotypes for gene: SHANK2 were changed from to Autism, susceptibility to, 17, MIM#613436; complex neurodevelopmental disorder MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5823 | SHANK2 | Zornitza Stark Publications for gene: SHANK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5822 | SHANK2 | Zornitza Stark Mode of inheritance for gene: SHANK2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SHANK2 | Zornitza Stark reviewed gene: SHANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SHANK2 | Aaron Meyers reviewed gene: SHANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20473310, 22346768, 20531469, 35456494, 32987185, 25188300, 22699619, 22699620; Phenotypes: Autism, susceptibility to, 17, MIM#613436, Autism spectrum disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | ZNF81 | Sangavi Sivagnanasundram reviewed gene: ZNF81: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006590; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | ZNF674 | Sangavi Sivagnanasundram reviewed gene: ZNF674: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006588; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | ZNF41 | Sangavi Sivagnanasundram reviewed gene: ZNF41: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006585; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | ZDHHC15 | Sangavi Sivagnanasundram reviewed gene: ZDHHC15: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006573; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | WAC | Sangavi Sivagnanasundram reviewed gene: WAC: Rating: GREEN; Mode of pathogenicity: None; Publications: 26757981, https://search.clinicalgenome.org/CCID:006532; Phenotypes: DeSanto-Shinawi syndrome MONDO:0018760; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | TCF7L2 | Sangavi Sivagnanasundram reviewed gene: TCF7L2: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006339; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SLC6A4 | Sangavi Sivagnanasundram changed review comment from: DISPUTED classification by ClinGen ID and Autism GCEP on 06/01/2021 due to variants association with ASD having high frequencies in gnomAD - https://search.clinicalgenome.org/CCID:006198; to: DISPUTED classification by ClinGen ID and Autism GCEP on 06/01/2021. Variants in this gene associated with ASD having high frequencies in gnomAD - https://search.clinicalgenome.org/CCID:006198 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SLC6A4 | Sangavi Sivagnanasundram reviewed gene: SLC6A4: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006198; Phenotypes: autism spectrum disorder MONDO:0005258; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SLC25A15 |
Rajkumar Krishnaswamy changed review comment from: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported. ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in the childhood or as adult onset.; to: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Lethargy, feeding difficulties, seizures, pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported with various features exhibited at various stages of life e.g. neonates, infantile/childhood and adults. ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in childhood or adults. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SHROOM4 | Sangavi Sivagnanasundram reviewed gene: SHROOM4: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006141; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 | Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SLC25A15 | Rajkumar Krishnaswamy reviewed gene: SLC25A15: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 18978333, 25874378; Phenotypes: Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, 238970, hyperammonemia, lethargy, somnolence, refusal to feed, vomiting, tachypnea with respiratory alkalosis, seizures, protein intolerance, developmental delay, spasticity, intellectual disability / mental retardation, dysarthria, learning disabilities, spasticity, liver dysfunction; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 | Sangavi Sivagnanasundram Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 |
Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP. SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117 Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116 LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions) GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 |
Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP. SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117 Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116 LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions) GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 | Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | PTCHD1 | Sangavi Sivagnanasundram reviewed gene: PTCHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005921; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | PORCN | Sangavi Sivagnanasundram reviewed gene: PORCN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301712; Phenotypes: focal dermal hypoplasia MONDO:0010592; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | PLP1 | Sangavi Sivagnanasundram reviewed gene: PLP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: https://search.clinicalgenome.org/CCID:005834; Phenotypes: Pelizeaus-Merzbacher spectrum disorder MONDO:0010714; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | OFD1 | Sangavi Sivagnanasundram reviewed gene: OFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24884629; Phenotypes: ciliopathy MONDO:0005308; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | OCRL | Sangavi Sivagnanasundram reviewed gene: OCRL: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005696; Phenotypes: oculocerebrorenal syndrome MONDO:0010645; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | NSD1 | Sangavi Sivagnanasundram reviewed gene: NSD1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005680; Phenotypes: Sotos syndrome MONDO:0019349; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | NDP | Sangavi Sivagnanasundram edited their review of gene: NDP: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | NDP | Sangavi Sivagnanasundram reviewed gene: NDP: Rating: AMBER; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005574; Phenotypes: Norrie disease MONDO:0010691; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | MID1 | Sangavi Sivagnanasundram reviewed gene: MID1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005386; Phenotypes: X-linked Opitz G/BBB syndrome MONDO:0010222; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | MED23 | Sangavi Sivagnanasundram reviewed gene: MED23: Rating: GREEN; Mode of pathogenicity: None; Publications: 21868677, 25845469, 27311965, 27457812, 30847200, 31164858; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | MED13L | Sangavi Sivagnanasundram reviewed gene: MED13L: Rating: GREEN; Mode of pathogenicity: None; Publications: 28645799, 29511999; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | MED12 | Sangavi Sivagnanasundram reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005361; Phenotypes: MED12-related intellectual disability syndrome MONDO:0100000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | MBTPS2 | Sangavi Sivagnanasundram reviewed gene: MBTPS2: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005345; Phenotypes: IFAP syndrome 1, with or without BRESHECK syndrome MONDO:0100213; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | MAN1B1 | Sangavi Sivagnanasundram reviewed gene: MAN1B1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: MAN1B1-congenital disorder of glycosylation MONDO:0018349; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | MAGT1 | Sangavi Sivagnanasundram reviewed gene: MAGT1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005319; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | LAMC3 | Sangavi Sivagnanasundram reviewed gene: LAMC3: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005265; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | L1CAM | Sangavi Sivagnanasundram reviewed gene: L1CAM: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005260; Phenotypes: L1 syndrome MONDO:0017140; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | KIRREL3 | Sangavi Sivagnanasundram reviewed gene: KIRREL3: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005235; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | KATNAL2 | Sangavi Sivagnanasundram reviewed gene: KATNAL2: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005176; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | KAT6B | Sangavi Sivagnanasundram reviewed gene: KAT6B: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005174; Phenotypes: KAT6B-related multiple congenital anomalies syndrome MONDO:0036042; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | KAT6A | Sangavi Sivagnanasundram reviewed gene: KAT6A: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005173; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | IGBP1 | Sangavi Sivagnanasundram reviewed gene: IGBP1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005117; Phenotypes: corpus callosum agenesis-intellectual disability-coloboma-micrognathia syndrome MONDO:0010333; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | IDS | Sangavi Sivagnanasundram reviewed gene: IDS: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005112; Phenotypes: mucopolysaccharidosis type 2 MONDO:0010674; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | HPRT1 | Sangavi Sivagnanasundram reviewed gene: HPRT1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005082; Phenotypes: Lesch-Nyhan syndrome MONDO:0010298; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | HOXA1 | Sangavi Sivagnanasundram reviewed gene: HOXA1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005077; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | HNRNPK | Sangavi Sivagnanasundram reviewed gene: HNRNPK: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005073; Phenotypes: neurodevelopmental disorder-craniofacial dysmorphism-cardiac defect-hip dysplasia syndrome (Au-Kline syndrome) MONDO:0018681; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | HIST1H1E | Sangavi Sivagnanasundram commented on gene: HIST1H1E | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | GPC3 | Sangavi Sivagnanasundram reviewed gene: GPC3: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004990; Phenotypes: Simpson-Golabi-Behmel syndrome MONDO:0010731; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | GDI1 | Sangavi Sivagnanasundram reviewed gene: GDI1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004941; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | FTSJ1 | Sangavi Sivagnanasundram reviewed gene: FTSJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004892; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | FMR1 | Sangavi Sivagnanasundram reviewed gene: FMR1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004870; Phenotypes: fragile X syndrome MONDO:0010383; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SPR | Zornitza Stark Marked gene: SPR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SPR | Zornitza Stark Gene: spr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5821 | SPR | Zornitza Stark Phenotypes for gene: SPR were changed from to Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5820 | SPR | Zornitza Stark Publications for gene: SPR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5819 | SPR | Zornitza Stark Mode of inheritance for gene: SPR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5818 | SPR | Zornitza Stark reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5818 | MAST3 | Zornitza Stark Publications for gene: MAST3 were set to 34185323 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5817 | AGTR2 | Zornitza Stark Phenotypes for gene: AGTR2 were changed from to X-linked complex neurodevelopmental disorder MONDO:0100148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5816 | AGTR2 | Zornitza Stark Mode of inheritance for gene: AGTR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5815 | AGTR2 | Zornitza Stark Tag disputed tag was added to gene: AGTR2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5815 | AVPR1A | Zornitza Stark Tag disputed tag was added to gene: AVPR1A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5815 | BAZ2B | Zornitza Stark Classified gene: BAZ2B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5815 | BAZ2B | Zornitza Stark Gene: baz2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5814 | BCORL1 | Zornitza Stark Classified gene: BCORL1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5814 | BCORL1 | Zornitza Stark Gene: bcorl1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5813 | CASK | Zornitza Stark Publications for gene: CASK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5812 | CASK | Zornitza Stark Marked gene: CASK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5812 | CASK |
Zornitza Stark Added comment: Comment when marking as ready: Microcephaly with pontine and cerebellar hypoplasia (MICPCH), generally associated with pathogenic loss-of-function variants in CASK X-linked intellectual disability (XLID) with or without nystagmus, generally associated with hypomorphic CASK pathogenic variants |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5812 | CASK | Zornitza Stark Gene: cask has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5812 | CASK | Zornitza Stark Phenotypes for gene: CASK were changed from to FG syndrome 4 MIM#300422; Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749; Intellectual disability, with or without nystagmus MIM#300422 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5811 | CASK | Zornitza Stark Mode of inheritance for gene: CASK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5810 | CLIC2 | Zornitza Stark Phenotypes for gene: CLIC2 were changed from Mental retardation, X-linked, syndromic 32, 300886 to Intellectual disability, X-linked, syndromic 32, 300886 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5809 | CLIC2 | Zornitza Stark Tag disputed tag was added to gene: CLIC2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5809 | CNTN6 | Zornitza Stark Tag disputed tag was added to gene: CNTN6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5809 | DHCR7 | Zornitza Stark Marked gene: DHCR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5809 | DHCR7 | Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5809 | DHCR7 | Zornitza Stark Publications for gene: DHCR7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5808 | DHCR7 | Zornitza Stark Phenotypes for gene: DHCR7 were changed from to Smith-Lemli-Opitz syndrome MONDO:0010035 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5807 | DHCR7 | Zornitza Stark Mode of inheritance for gene: DHCR7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal |