Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Intellectual disability syndromic and non-syndromic v1.496 HNRNPU Chirag Patel Deleted their review
Intellectual disability syndromic and non-syndromic v1.496 HNRNPU Chirag Patel Deleted their comment
Intellectual disability syndromic and non-syndromic v1.496 HNRNPU Chirag Patel reviewed gene: HNRNPU: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.496 PRMT9 Lucy Spencer Phenotypes for gene: PRMT9 were changed from Neurodevelopmental disorder, MONDO:0100500, PRMT9-related to Neurodevelopmental disorder, MONDO:0700092, PRMT9-related
Intellectual disability syndromic and non-syndromic v1.495 PRMT9 Lucy Spencer Publications for gene: PRMT9 were set to PMID: 38561334
Intellectual disability syndromic and non-syndromic v1.495 PRMT9 Lucy Spencer Classified gene: PRMT9 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.495 PRMT9 Lucy Spencer Gene: prmt9 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.494 Lucy Spencer Added reviews for gene PRMT9 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.493 SLC39A8 Zornitza Stark Phenotypes for gene: SLC39A8 were changed from Congenital disorder of glycosylation, type IIn , MIM#16721 to Congenital disorder of glycosylation, type IIn , MIM#616721
Intellectual disability syndromic and non-syndromic v1.492 SLC39A8 Zornitza Stark edited their review of gene: SLC39A8: Changed phenotypes: Congenital disorder of glycosylation, type IIn , MIM#616721
Intellectual disability syndromic and non-syndromic v1.492 RSPRY1 Zornitza Stark Phenotypes for gene: RSPRY1 were changed from Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, 616585 to Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, MIM# 616723
Intellectual disability syndromic and non-syndromic v1.491 RSPRY1 Zornitza Stark edited their review of gene: RSPRY1: Changed phenotypes: Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, MIM# 616723
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.; to: Additional cases:
PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel - first case). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases.
PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form.
PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available.
Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity.
Intellectual disability syndromic and non-syndromic v1.491 CTNND2 Monica Petica reviewed gene: CTNND2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38604781, PMID: 25473103, PMID: 31814264,; Phenotypes: Neurodevelopmental disorders (NDDs), intellectual disability (ID), autism, behavioural issues; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.491 ESRRG Zornitza Stark Marked gene: ESRRG as ready
Intellectual disability syndromic and non-syndromic v1.491 ESRRG Zornitza Stark Gene: esrrg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.491 Zornitza Stark Copied gene ESRRG from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.491 ESRRG Zornitza Stark gene: ESRRG was added
gene: ESRRG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: ESRRG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ESRRG were set to 41265451
Phenotypes for gene: ESRRG were set to Movement disorder, MONDO:0005395, ESRRG-related
Intellectual disability syndromic and non-syndromic v1.490 ELMSAN1 Zornitza Stark Marked gene: ELMSAN1 as ready
Intellectual disability syndromic and non-syndromic v1.490 ELMSAN1 Zornitza Stark Gene: elmsan1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.490 Zornitza Stark Copied gene ELMSAN1 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.490 ELMSAN1 Zornitza Stark gene: ELMSAN1 was added
gene: ELMSAN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
new gene name tags were added to gene: ELMSAN1.
Mode of inheritance for gene: ELMSAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ELMSAN1 were set to Neurodevelopmental disorder, MONDO:0700092, ELMSAN1-related
Intellectual disability syndromic and non-syndromic v1.489 SUCO Zornitza Stark Marked gene: SUCO as ready
Intellectual disability syndromic and non-syndromic v1.489 SUCO Zornitza Stark Gene: suco has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.489 Zornitza Stark Copied gene SUCO from panel Osteogenesis Imperfecta and Osteoporosis
Intellectual disability syndromic and non-syndromic v1.489 SUCO Zornitza Stark gene: SUCO was added
gene: SUCO was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000; 41282771
Phenotypes for gene: SUCO were set to Syndromic disease (MONDO:0002254), SUCO-related
Intellectual disability syndromic and non-syndromic v1.488 GTF2H4 Zornitza Stark Marked gene: GTF2H4 as ready
Intellectual disability syndromic and non-syndromic v1.488 GTF2H4 Zornitza Stark Gene: gtf2h4 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.488 Zornitza Stark Copied gene GTF2H4 from panel Photosensitivity Syndromes
Intellectual disability syndromic and non-syndromic v1.488 GTF2H4 Zornitza Stark gene: GTF2H4 was added
gene: GTF2H4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: GTF2H4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF2H4 were set to 40924495; 40924475
Phenotypes for gene: GTF2H4 were set to Xeroderma pigmentosum, complementation group J, MIM# 621435
Intellectual disability syndromic and non-syndromic v1.487 Zornitza Stark Added reviews for gene PPM1K from panel Aminoacidopathy
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37390-Loss Zornitza Stark Marked Region: ISCA-37390-Loss as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37390-Loss Zornitza Stark Region: isca-37390-loss has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37392-Gain Zornitza Stark Marked Region: ISCA-37392-Gain as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37392-Gain Zornitza Stark Region: isca-37392-gain has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37392-Loss Zornitza Stark Marked Region: ISCA-37392-Loss as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37392-Loss Zornitza Stark Region: isca-37392-loss has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37393-Gain Zornitza Stark Marked Region: ISCA-37393-Gain as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37393-Gain Zornitza Stark Region: isca-37393-gain has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37394-Loss Zornitza Stark Marked Region: ISCA-37394-Loss as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37394-Loss Zornitza Stark Region: isca-37394-loss has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37396-Loss Zornitza Stark Marked Region: ISCA-37396-Loss as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37396-Loss Zornitza Stark Region: isca-37396-loss has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37397-Gain Zornitza Stark Marked Region: ISCA-37397-Gain as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37397-Gain Zornitza Stark Region: isca-37397-gain has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37397-Loss Zornitza Stark Marked Region: ISCA-37397-Loss as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37397-Loss Zornitza Stark Region: isca-37397-loss has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37400-Gain Zornitza Stark Marked Region: ISCA-37400-Gain as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37400-Gain Zornitza Stark Region: isca-37400-gain has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37400-Loss Zornitza Stark Marked Region: ISCA-37400-Loss as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37400-Loss Zornitza Stark Region: isca-37400-loss has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37404-Gain Zornitza Stark Marked Region: ISCA-37404-Gain as ready
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37404-Gain Zornitza Stark Region: isca-37404-gain has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.486 Sarah Milton Copied Region ISCA-37404-Gain from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37404-Gain Sarah Milton Region: ISCA-37404-Gain was added
Region: ISCA-37404-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37404-Gain.
Mode of inheritance for Region: ISCA-37404-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37404-Gain were set to 24239951; 24075935
Phenotypes for Region: ISCA-37404-Gain were set to Chromosome 15q11q13 duplication syndrome; {Autism susceptibility 4} 608636; intellectual disability; seizures; ataxia
Intellectual disability syndromic and non-syndromic v1.485 Sarah Milton Copied Region ISCA-37400-Loss from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.485 ISCA-37400-Loss Sarah Milton Region: ISCA-37400-Loss was added
Region: ISCA-37400-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37400-Loss.
Mode of inheritance for Region: ISCA-37400-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37400-Loss were set to Chromosome 16p11.2 deletion syndrome, proximal, MIM# 611913; autism; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.484 Sarah Milton Copied Region ISCA-37400-Gain from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.484 ISCA-37400-Gain Sarah Milton Region: ISCA-37400-Gain was added
Region: ISCA-37400-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37400-Gain.
Mode of inheritance for Region: ISCA-37400-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37400-Gain were set to 21841781; 18184952; 21731881
Phenotypes for Region: ISCA-37400-Gain were set to Chromosome 16p11.2 duplication syndrome, MIM# 614671; intellectual disability; autism
Intellectual disability syndromic and non-syndromic v1.484 Sarah Milton Copied Region ISCA-37397-Loss from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.484 ISCA-37397-Loss Sarah Milton Region: ISCA-37397-Loss was added
Region: ISCA-37397-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37397-Loss.
Mode of inheritance for Region: ISCA-37397-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37397-Loss were set to 21671380; 23765049; 18179902
Phenotypes for Region: ISCA-37397-Loss were set to Chromosome 22q11.2 deletion syndrome, distal, MIM#611867; intellectual disability; seizures; growth retardation; multiple congenital anomalies
Intellectual disability syndromic and non-syndromic v1.483 Sarah Milton Copied Region ISCA-37397-Gain from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.483 ISCA-37397-Gain Sarah Milton Region: ISCA-37397-Gain was added
Region: ISCA-37397-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37397-Gain.
Mode of inheritance for Region: ISCA-37397-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37397-Gain were set to 21671380; 31479204
Phenotypes for Region: ISCA-37397-Gain were set to Chromosome 22q11.2 microduplication syndrome, MIM#608363, distal; intellectual disability; dysmorphic features; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.482 Sarah Milton Copied Region ISCA-37396-Loss from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.482 ISCA-37396-Loss Sarah Milton Region: ISCA-37396-Loss was added
Region: ISCA-37396-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37396-Loss.
Mode of inheritance for Region: ISCA-37396-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37396-Loss were set to 22180641; 19557438; 19233321; 22359776
Phenotypes for Region: ISCA-37396-Loss were set to Chromosome 15q24 deletion syndrome, MIM#613406; intellectual disability; facial dysmorphisms; congenital malformations of the hands and feet, eye, and genitalia; joint laxity; and growth retardation and failure to thrive
Intellectual disability syndromic and non-syndromic v1.481 Sarah Milton Copied Region ISCA-37394-Loss from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.481 ISCA-37394-Loss Sarah Milton Region: ISCA-37394-Loss was added
Region: ISCA-37394-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37394-Loss.
Mode of inheritance for Region: ISCA-37394-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37394-Loss were set to 20691407
Phenotypes for Region: ISCA-37394-Loss were set to Chromosome 2q37 deletion syndrome, MIM# 600430; brachydactyly; intellectual disability
Intellectual disability syndromic and non-syndromic v1.480 Sarah Milton Copied Region ISCA-37393-Gain from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.480 ISCA-37393-Gain Sarah Milton Region: ISCA-37393-Gain was added
Region: ISCA-37393-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37393-Gain.
Mode of inheritance for Region: ISCA-37393-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37393-Gain were set to Cat eye syndrome, MIM# 115470; coloboma; anal atresia; heart and renal malformations
Intellectual disability syndromic and non-syndromic v1.479 Sarah Milton Copied Region ISCA-37392-Loss from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.479 ISCA-37392-Loss Sarah Milton Region: ISCA-37392-Loss was added
Region: ISCA-37392-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37392-Loss.
Mode of inheritance for Region: ISCA-37392-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37392-Loss were set to 20301427
Phenotypes for Region: ISCA-37392-Loss were set to Williams-Beuren syndrome, MIM# 194050; intellectual disability; growth retardation; cardiovascular disease
Intellectual disability syndromic and non-syndromic v1.478 Sarah Milton Copied Region ISCA-37392-Gain from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.478 ISCA-37392-Gain Sarah Milton Region: ISCA-37392-Gain was added
Region: ISCA-37392-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37392-Gain.
Mode of inheritance for Region: ISCA-37392-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37392-Gain were set to 33187326; 27615053; 26610320
Phenotypes for Region: ISCA-37392-Gain were set to Chromosome 7q11.23 duplication syndrome, MIM# 609757; intellectual disability; hypotonia; macrocephaly; seizures; aortic dilatation
Intellectual disability syndromic and non-syndromic v1.478 Sarah Milton Copied Region ISCA-37390-Loss from panel Common deletion and duplication syndromes
Intellectual disability syndromic and non-syndromic v1.478 ISCA-37390-Loss Sarah Milton Region: ISCA-37390-Loss was added
Region: ISCA-37390-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37390-Loss.
Mode of inheritance for Region: ISCA-37390-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37390-Loss were set to 16953888
Phenotypes for Region: ISCA-37390-Loss were set to Cri-du-chat syndrome MIM#123450; intellectual disability; microcephaly
Intellectual disability syndromic and non-syndromic v1.477 MT-ND4 Zornitza Stark Marked gene: MT-ND4 as ready
Intellectual disability syndromic and non-syndromic v1.477 MT-ND4 Zornitza Stark Gene: mt-nd4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.477 Zornitza Stark Copied gene MT-ND4 from panel Mitochondrial disease
Intellectual disability syndromic and non-syndromic v1.477 MT-ND4 Zornitza Stark gene: MT-ND4 was added
gene: MT-ND4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-ND4.
Mode of inheritance for gene gene: MT-ND4 was set to MITOCHONDRIAL
Publications for gene: MT-ND4 were set to 12707444; 16120329; 15576045; 20502985; 27761019; 32445240; 32659360; 3201231
Phenotypes for gene: MT-ND4 were set to Mitochondrial disease (MONDO:0044970), MT-ND4-related
Intellectual disability syndromic and non-syndromic v1.476 MT-CO2 Zornitza Stark Marked gene: MT-CO2 as ready
Intellectual disability syndromic and non-syndromic v1.476 MT-CO2 Zornitza Stark Gene: mt-co2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.476 Zornitza Stark Copied gene MT-CO2 from panel Mitochondrial disease
Intellectual disability syndromic and non-syndromic v1.476 MT-CO2 Zornitza Stark gene: MT-CO2 was added
gene: MT-CO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-CO2.
Mode of inheritance for gene gene: MT-CO2 was set to MITOCHONDRIAL
Publications for gene: MT-CO2 were set to 34325999; 30315213; 28521807; 10205264; 10486321; 11558799; 18245391; 23616164; 31167410; 23965802; 30030519
Phenotypes for gene: MT-CO2 were set to Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related
Intellectual disability syndromic and non-syndromic v1.475 MT-ATP6 Zornitza Stark Marked gene: MT-ATP6 as ready
Intellectual disability syndromic and non-syndromic v1.475 MT-ATP6 Zornitza Stark Gene: mt-atp6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.475 Zornitza Stark Copied gene MT-ATP6 from panel Mitochondrial disease
Intellectual disability syndromic and non-syndromic v1.475 MT-ATP6 Zornitza Stark gene: MT-ATP6 was added
gene: MT-ATP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-ATP6.
Mode of inheritance for gene gene: MT-ATP6 was set to MITOCHONDRIAL
Publications for gene: MT-ATP6 were set to 40112238
Phenotypes for gene: MT-ATP6 were set to Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related
Intellectual disability syndromic and non-syndromic v1.474 FASTKD5 Zornitza Stark Phenotypes for gene: FASTKD5 were changed from Leigh syndrome MONDO:0009723, FASTKD5-related to Mitochondrial complex IV deficiency, nuclear type 24, MIM# 621431
Intellectual disability syndromic and non-syndromic v1.473 FASTKD5 Zornitza Stark reviewed gene: FASTKD5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 24, MIM# 621431; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.473 MED16 Lucy Spencer Phenotypes for gene: MED16 were changed from Neurodevelopmental disorder, MONDO:0700092, MED16-related to Guillouet-Gordon syndrome MIM#621220
Intellectual disability syndromic and non-syndromic v1.472 CSNK1G1 Zornitza Stark Marked gene: CSNK1G1 as ready
Intellectual disability syndromic and non-syndromic v1.472 CSNK1G1 Zornitza Stark Added comment: Comment when marking as ready: Gene-disease relationship reviewed again. No new literature in last 5 years. Only one LP assertion in ClinVar by 3billion. LoF variants in population. Downgrade to Amber.
Intellectual disability syndromic and non-syndromic v1.472 CSNK1G1 Zornitza Stark Gene: csnk1g1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.472 CSNK1G1 Zornitza Stark Classified gene: CSNK1G1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.472 CSNK1G1 Zornitza Stark Gene: csnk1g1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.471 ABI2 Zornitza Stark Marked gene: ABI2 as ready
Intellectual disability syndromic and non-syndromic v1.471 ABI2 Zornitza Stark Gene: abi2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.471 ABI2 Zornitza Stark Classified gene: ABI2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.471 ABI2 Zornitza Stark Gene: abi2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.470 ABI2 Zornitza Stark changed review comment from: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.
Sources: Literature; to: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.

Amber as still a preprint. Additional individual with recurrent variant identified internally.

Sources: Literature
Intellectual disability syndromic and non-syndromic v1.470 ABI2 Zornitza Stark gene: ABI2 was added
gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ABI2 were set to 40475134
Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related
Review for gene: ABI2 was set to AMBER
Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.469 NUDT2 Zornitza Stark Phenotypes for gene: NUDT2 were changed from Muscular hypotonia; Global developmental delay; Intellectual disability; Polyneuropathy to Intellectual developmental disorder with or without peripheral neuropathy MIM#619844
Intellectual disability syndromic and non-syndromic v1.468 NUDT2 Zornitza Stark edited their review of gene: NUDT2: Added comment: PMID 38141063 reports 18 individuals from 10 unrelated families with biallelic loss‑of‑function NUDT2 variants presenting with early‑onset neurodevelopmental disorder characterized by hypotonia, motor delay, gait disturbance, mild intellectual disability, peripheral neuropathy, corpus callosum abnormalities and progressive basal ganglia signal abnormalities.; Changed publications: 27431290, 30059600, 33058507, 38141063
Intellectual disability syndromic and non-syndromic v1.468 NUDT2 Zornitza Stark edited their review of gene: NUDT2: Changed phenotypes: Intellectual developmental disorder with or without peripheral neuropathy MIM#619844
Intellectual disability syndromic and non-syndromic v1.468 KARS Zornitza Stark changed review comment from: Sources: Expert list; to: Infantile-onset progressive leukoencephalopathy with or without deafness (LEPID) is a complex neurodegenerative disorder with onset of symptoms in infancy or early childhood. Most individuals present with sensorineural deafness or hypoacousia and global developmental delay. Affected individuals show episodic regression with progressive motor deterioration resulting in spastic tetraplegia and loss of ambulation, as well as impaired intellectual development with poor or absent speech. Additional more variable features may include poor overall growth with microcephaly, seizures, visual loss, microcytic anaemia, and hepatic enlargement or abnormal liver enzymes.

Brain imaging shows deep white matter abnormalities consistent with a progressive leukoencephalopathy.

Calcifications of the brain and spinal cord are a feature.
Intellectual disability syndromic and non-syndromic v1.468 HNRNPD Lucy Spencer Phenotypes for gene: HNRNPD were changed from Neurodevelopmental disorder to Complex neurodevelopmental disorder MONDO:0100038, HNRNPD-related
Intellectual disability syndromic and non-syndromic v1.467 HID1 Lucy Spencer Phenotypes for gene: HID1 were changed from Syndromic infantile encephalopathy; Hypopituitarism to Developmental and epileptic encephalopathy 105 with hypopituitarism MIM#619983
Intellectual disability syndromic and non-syndromic v1.466 HEATR5B Lucy Spencer Phenotypes for gene: HEATR5B were changed from pontocerebellar hypoplasia; intellectual disability; seizures to Pontocerebellar hypoplasia MONDO:0020135, HEATR5B-related
Intellectual disability syndromic and non-syndromic v1.465 HDAC4 Lucy Spencer Phenotypes for gene: HDAC4 were changed from Brachydactyly mental retardation syndrome; Brachydactyly without intellectual disability to Neurodevelopmental disorder with central hypotonia and dysmorphic facies MIM#619797; Brachydactyly mental retardation syndrome; Brachydactyly without intellectual disability
Intellectual disability syndromic and non-syndromic v1.464 H3F3B Lucy Spencer Phenotypes for gene: H3F3B were changed from Intellectual disability; regression; seizures to Bryant-Li-Bhoj neurodevelopmental syndrome 2 MIM#619721
Intellectual disability syndromic and non-syndromic v1.463 H3F3A Lucy Spencer Phenotypes for gene: H3F3A were changed from Intellectual disability; regression; seizures to Bryant-Li-Bhoj neurodevelopmental syndrome 1 MIM#619720
Intellectual disability syndromic and non-syndromic v1.462 GSPT2 Lucy Spencer Phenotypes for gene: GSPT2 were changed from Intellectual disability MONDO:0001071, GSPT2-related to Intellectual disability MONDO:0001071, GSPT2-related
Intellectual disability syndromic and non-syndromic v1.461 GSPT2 Lucy Spencer Mode of inheritance for gene: GSPT2 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.460 GSPT2 Lucy Spencer Phenotypes for gene: GSPT2 were changed from to Intellectual disability MONDO:0001071, GSPT2-related
Intellectual disability syndromic and non-syndromic v1.460 GSPT2 Lucy Spencer Mode of inheritance for gene: GSPT2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.459 GRIN2B Lucy Spencer Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to GRIN2B-related complex neurodevelopmental disorder MONDO:0700350; Developmental and epileptic encephalopathy 27 MIM#616139; Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM#613970
Intellectual disability syndromic and non-syndromic v1.458 GRIK2 Lucy Spencer Phenotypes for gene: GRIK2 were changed from Mental retardation, autosomal recessive, 6 MIM# 611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures, MIM# 619580 to Intellectual developmental disorder, autosomal recessive 6 MIM#611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures MIM#619580
Intellectual disability syndromic and non-syndromic v1.457 GNB5 Lucy Spencer Phenotypes for gene: GNB5 were changed from Intellectual developmental disorder with cardiac arrhythmia, 617173; Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia, 617182; Early infantile epileptic encephalopathy (EIEE) to gnb5-related intellectual disability-cardiac arrhythmia syndrome MONDO:0014953; Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173); Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182)
Intellectual disability syndromic and non-syndromic v1.456 TRA2B Zornitza Stark Phenotypes for gene: TRA2B were changed from Neurodevelopmental disorder, TRA2B-related, MONDO# 0700092 to Ramond-Elliott neurodevelopmental syndrome, MIM# 621421
Intellectual disability syndromic and non-syndromic v1.455 TRA2B Zornitza Stark reviewed gene: TRA2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ramond-Elliott neurodevelopmental syndrome, MIM# 621421; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.455 LAMC3 Chirag Patel Classified gene: LAMC3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.455 LAMC3 Chirag Patel Gene: lamc3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.455 LAMC3 Chirag Patel Classified gene: LAMC3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.455 LAMC3 Chirag Patel Gene: lamc3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.454 MET Chirag Patel Phenotypes for gene: MET were changed from ?Deafness, autosomal recessive 97, OMIM #616705; {Osteofibrous dysplasia, susceptibility to}, OMIM #607278 to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.454 MET Chirag Patel Mode of inheritance for gene: MET was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.453 MET Chirag Patel Tag disputed tag was added to gene: MET.
Intellectual disability syndromic and non-syndromic v1.453 MET Chirag Patel edited their review of gene: MET: Added comment: ClinGen DISPUTED - Jan 2021; Changed phenotypes: complex neurodevelopmental disorder, MONDO:0100038; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.453 Chirag Patel Added reviews for gene FAAH2 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.452 EN2 Chirag Patel Marked gene: EN2 as ready
Intellectual disability syndromic and non-syndromic v1.452 EN2 Chirag Patel Gene: en2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.452 EN2 Chirag Patel gene: EN2 was added
gene: EN2 was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
disputed tags were added to gene: EN2.
Mode of inheritance for gene: EN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EN2 were set to Complex neurodevelopmental disorder, MONDO:0100038
Review for gene: EN2 was set to RED
Added comment: ClinGen DISPUTED - Feb 2021

https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_91eb2fc6-864c-4a4a-9b2d-0b2bdd695999-2021-02-16T170000.000Z?page=1&size=25&search=
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.451 KATNAL2 Chirag Patel Tag disputed tag was added to gene: KATNAL2.
Intellectual disability syndromic and non-syndromic v1.451 KIRREL3 Chirag Patel Tag refuted was removed from gene: KIRREL3.
Tag disputed tag was added to gene: KIRREL3.
Intellectual disability syndromic and non-syndromic v1.451 CNTN4 Chirag Patel Phenotypes for gene: CNTN4 were changed from complex neurodevelopmental disorder, MONDO:0100038 to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.451 CNTN4 Chirag Patel Phenotypes for gene: CNTN4 were changed from complex neurodevelopmental disorder, MONDO:0100038 to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.451 CNTN4 Chirag Patel Phenotypes for gene: CNTN4 were changed from complex neurodevelopmental disorder, MONDO:0100038 to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.451 CNTN4 Chirag Patel Phenotypes for gene: CNTN4 were changed from complex neurodevelopmental disorder, MONDO:0100038 to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.451 CNTN4 Chirag Patel Phenotypes for gene: CNTN4 were changed from Intellectual disability; SCA to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.450 CNTN4 Chirag Patel Tag disputed tag was added to gene: CNTN4.
Intellectual disability syndromic and non-syndromic v1.450 CNTN4 Chirag Patel reviewed gene: CNTN4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.450 CNTNAP5 Chirag Patel Tag disputed tag was added to gene: CNTNAP5.
Intellectual disability syndromic and non-syndromic v1.450 CNTNAP5 Chirag Patel reviewed gene: CNTNAP5: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.450 TMLHE Chirag Patel Tag disputed tag was added to gene: TMLHE.
Intellectual disability syndromic and non-syndromic v1.450 SLC9A9 Chirag Patel Source Genetic Health Queensland was removed from SLC9A9.
Source ClinGen was added to SLC9A9.
Mode of inheritance for gene SLC9A9 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Tag disputed tag was added to SLC9A9.
Intellectual disability syndromic and non-syndromic v1.449 SLC9A9 Chirag Patel reviewed gene: SLC9A9: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.449 AVPR1A Chirag Patel Mode of inheritance for gene: AVPR1A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.449 AVPR1A Chirag Patel Mode of inheritance for gene: AVPR1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.449 AVPR1A Chirag Patel Phenotypes for gene: AVPR1A were changed from to autism spectrum disorder MONDO:0005258
Intellectual disability syndromic and non-syndromic v1.448 Chirag Patel Added reviews for gene AVPR1A from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.447 COX4I1 Zornitza Stark Marked gene: COX4I1 as ready
Intellectual disability syndromic and non-syndromic v1.447 COX4I1 Zornitza Stark Gene: cox4i1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.447 COX4I1 Zornitza Stark Classified gene: COX4I1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.447 COX4I1 Zornitza Stark Gene: cox4i1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.446 Lucy Spencer Copied gene COX4I1 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.446 COX4I1 Lucy Spencer gene: COX4I1 was added
gene: COX4I1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list
Mode of inheritance for gene: COX4I1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COX4I1 were set to 28766551; 22592081; 31290619; 40095452; 41203052
Phenotypes for gene: COX4I1 were set to Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060
Intellectual disability syndromic and non-syndromic v1.445 COQ5 Zornitza Stark Phenotypes for gene: COQ5 were changed from Coenzyme Q10 deficiency, primary 9, MIM#619028; Cerebellar ataxia; encephalopathy; generalized tonic-clonic seizures; intellectual disability to Coenzyme Q10 deficiency, primary, 9 MIM#619028
Intellectual disability syndromic and non-syndromic v1.444 COQ5 Zornitza Stark Publications for gene: COQ5 were set to 29044765
Intellectual disability syndromic and non-syndromic v1.443 COQ5 Zornitza Stark Classified gene: COQ5 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.443 COQ5 Zornitza Stark Gene: coq5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.442 Lucy Spencer Added reviews for gene COQ5 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.441 CUL1 Zornitza Stark Marked gene: CUL1 as ready
Intellectual disability syndromic and non-syndromic v1.441 CUL1 Zornitza Stark Gene: cul1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.441 Zornitza Stark Copied gene CUL1 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.441 CUL1 Zornitza Stark gene: CUL1 was added
gene: CUL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CUL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CUL1 were set to PMID: 41189326
Phenotypes for gene: CUL1 were set to Neurodevelopmental disorder, MONDO:0700092, CUL1-related
Intellectual disability syndromic and non-syndromic v1.440 SEC31A Zornitza Stark Phenotypes for gene: SEC31A were changed from ?Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, OMIM #618651 to Halperin-Birk syndrome, MIM# 618651
Intellectual disability syndromic and non-syndromic v1.439 SEC31A Zornitza Stark Publications for gene: SEC31A were set to 30464055
Intellectual disability syndromic and non-syndromic v1.438 Zornitza Stark Added reviews for gene SEC31A from panel Arthrogryposis
Intellectual disability syndromic and non-syndromic v1.437 RNU6ATAC Zornitza Stark Marked gene: RNU6ATAC as ready
Intellectual disability syndromic and non-syndromic v1.437 RNU6ATAC Zornitza Stark Gene: rnu6atac has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.437 RNU6ATAC Zornitza Stark Classified gene: RNU6ATAC as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.437 RNU6ATAC Zornitza Stark Gene: rnu6atac has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.436 SUFU Lucy Spencer Phenotypes for gene: SUFU were changed from Joubert syndrome 32, MIM#617757; SUFU-related neurodevelopmental syndrome to Joubert syndrome 32, MIM#617757; Neurodevelopmental disorder, MONDO:0700092, SUFU-related
Intellectual disability syndromic and non-syndromic v1.435 Zornitza Stark Added reviews for gene GLS from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.434 GAD1 Zornitza Stark Phenotypes for gene: GAD1 were changed from Cerebral palsy, spastic quadriplegic, 1, MIM#603513; Developmental and epileptic encephalopathy 89, MIM# 619124 to Developmental and epileptic encephalopathy 89, MIM# 619124
Intellectual disability syndromic and non-syndromic v1.433 CACNA1A Zornitza Stark Publications for gene: CACNA1A were set to 27476654; 33985586
Intellectual disability syndromic and non-syndromic v1.432 CACNA1A Zornitza Stark Mode of inheritance for gene: CACNA1A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.431 Zornitza Stark Added reviews for gene CACNA1A from panel Genetic Epilepsy
Intellectual disability syndromic and non-syndromic v1.430 EXOSC10 Zornitza Stark Marked gene: EXOSC10 as ready
Intellectual disability syndromic and non-syndromic v1.430 EXOSC10 Zornitza Stark Gene: exosc10 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.430 Zornitza Stark Copied gene EXOSC10 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.430 EXOSC10 Zornitza Stark gene: EXOSC10 was added
gene: EXOSC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: EXOSC10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EXOSC10 were set to 41132091
Phenotypes for gene: EXOSC10 were set to Microcephaly, MONDO:0001149, EXOSC10-related
Intellectual disability syndromic and non-syndromic v1.429 TUBA8 Chirag Patel Tag disputed tag was added to gene: TUBA8.
Intellectual disability syndromic and non-syndromic v1.429 TUBA8 Chirag Patel reviewed gene: TUBA8: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.429 IGBP1 Chirag Patel Deleted their review
Intellectual disability syndromic and non-syndromic v1.429 IGBP1 Chirag Patel Deleted their comment
Intellectual disability syndromic and non-syndromic v1.429 IGBP1 Chirag Patel Tag disputed tag was added to gene: IGBP1.
Intellectual disability syndromic and non-syndromic v1.429 IGBP1 Chirag Patel reviewed gene: IGBP1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.429 ARHGEF6 Chirag Patel Tag disputed tag was added to gene: ARHGEF6.
Intellectual disability syndromic and non-syndromic v1.429 ARHGEF6 Chirag Patel reviewed gene: ARHGEF6: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Non-syndromic X-linked intellectual disability, MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.429 PRICKLE1 Chirag Patel Tag disputed tag was added to gene: PRICKLE1.
Intellectual disability syndromic and non-syndromic v1.429 SRPX2 Chirag Patel Tag refuted tag was added to gene: SRPX2.
Intellectual disability syndromic and non-syndromic v1.429 SRPX2 Chirag Patel reviewed gene: SRPX2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.429 RAB40AL Chirag Patel Tag refuted tag was added to gene: RAB40AL.
Intellectual disability syndromic and non-syndromic v1.429 CPA6 Chirag Patel Tag refuted tag was added to gene: CPA6.
Intellectual disability syndromic and non-syndromic v1.429 ADRA2B Chirag Patel Tag refuted tag was added to gene: ADRA2B.
Intellectual disability syndromic and non-syndromic v1.429 RPS6KC1 Zornitza Stark Marked gene: RPS6KC1 as ready
Intellectual disability syndromic and non-syndromic v1.429 RPS6KC1 Zornitza Stark Gene: rps6kc1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.429 Rylee Peters Copied gene RPS6KC1 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.429 RPS6KC1 Rylee Peters gene: RPS6KC1 was added
gene: RPS6KC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: RPS6KC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RPS6KC1 were set to 41130203
Phenotypes for gene: RPS6KC1 were set to Complex neurodevelopmental disorder, MONDO:0100038, RPS6KC1-related
Intellectual disability syndromic and non-syndromic v1.428 DOCK4 Zornitza Stark Phenotypes for gene: DOCK4 were changed from DOCK4-related neurodevelopmental disorder (MONDO:0060490) to Neurodevelopmental disorder, MONDO:0700092, DOCK4-related
Intellectual disability syndromic and non-syndromic v1.427 DOCK4 Zornitza Stark edited their review of gene: DOCK4: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, DOCK4-related
Intellectual disability syndromic and non-syndromic v1.427 LRRC7 Zornitza Stark Phenotypes for gene: LRRC7 were changed from neurodevelopmental disorder (MONDO:0700092), LRRC7-related to Intellectual developmental disorder, autosomal dominant 77, MIM# 621415
Intellectual disability syndromic and non-syndromic v1.426 LRRC7 Zornitza Stark edited their review of gene: LRRC7: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 77, MIM# 621415
Intellectual disability syndromic and non-syndromic v1.426 KLHL13 Krithika Murali Classified gene: KLHL13 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.426 KLHL13 Krithika Murali Gene: klhl13 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.425 KLHL13 Krithika Murali Marked gene: KLHL13 as ready
Intellectual disability syndromic and non-syndromic v1.425 KLHL13 Krithika Murali Gene: klhl13 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.425 KLHL13 Krithika Murali gene: KLHL13 was added
gene: KLHL13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KLHL13 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: KLHL13 were set to PMID: 41159445
Phenotypes for gene: KLHL13 were set to Neurodevelopmental disorder, MONDO:0700092, KLHL13-related
Review for gene: KLHL13 was set to GREEN
Added comment: PMID: 41159445 Akhther et al 2025 (pre-print) report 8 affected individuals from 4 unrelated famlies with hemizygous/heterozygous KLHL13 variants and an X-linked neurodevelopmental disorder with the following phenotypic features including mild-severe ID, developmental delay, macrocephaly, hypotonia, unsteady gait, facial dysmrophism and behavioural issues. Functional studies support LoF disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.424 QSER1 Zornitza Stark Source Literature was added to QSER1.
Rating Changed from No List (delete) to Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.423 QSER1 Zornitza Stark All sources for gene: QSER1 were removed
Intellectual disability syndromic and non-syndromic v1.422 QSER1 Zornitza Stark All sources for gene: QSER1 were removed
Intellectual disability syndromic and non-syndromic v1.421 BAIAP2 Bryony Thompson Marked gene: BAIAP2 as ready
Intellectual disability syndromic and non-syndromic v1.421 BAIAP2 Bryony Thompson Gene: baiap2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.421 Bryony Thompson Added reviews for gene BAIAP2 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.420 Bryony Thompson Copied gene BAIAP2 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.420 BAIAP2 Bryony Thompson gene: BAIAP2 was added
gene: BAIAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: BAIAP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BAIAP2 were set to 41133935; 38149472
Phenotypes for gene: BAIAP2 were set to BAIAP2-related complex neurodevelopmental disorder MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.419 Chirag Patel Added reviews for gene AP1B1 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.418 QSER1 Zornitza Stark Marked gene: QSER1 as ready
Intellectual disability syndromic and non-syndromic v1.418 QSER1 Zornitza Stark Gene: qser1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.418 Zornitza Stark Copied gene QSER1 from panel Fetal anomalies
Intellectual disability syndromic and non-syndromic v1.418 QSER1 Zornitza Stark gene: QSER1 was added
gene: QSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature
Mode of inheritance for gene: QSER1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: QSER1 were set to PMID: 41139957
Phenotypes for gene: QSER1 were set to Neurodevelopmental disorder, MONDO:0700092, QSER1-related
Intellectual disability syndromic and non-syndromic v1.417 CCNK Sangavi Sivagnanasundram Marked gene: CCNK as ready
Intellectual disability syndromic and non-syndromic v1.417 CCNK Sangavi Sivagnanasundram Gene: ccnk has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.417 CCNK Sangavi Sivagnanasundram Classified gene: CCNK as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.417 CCNK Sangavi Sivagnanasundram Gene: ccnk has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.416 CCNK Sangavi Sivagnanasundram changed review comment from: CCNK encodes a regulatory subunit of cyclin-dependent kinases that mediates activation of target kinases.
Reported affected individuals presented with a syndromic neurodevelopmental disorder (i.e. DD, ID, language impairment and various dysmorphic features)
7 unrelated families with different de novo variants (missense and CNV, deletion). All variants were either rare for AD gene or absent in gnomAD v4.1.
Supportive functional studies (knockdown zebrafish and mouse model) showed recapitulation of human phenotype and was supportive of LoF as the mechanism of disease
Sources: Literature; to: CCNK encodes a regulatory subunit of cyclin-dependent kinases that mediates activation of target kinases.
Reported affected individuals presented with a syndromic neurodevelopmental disorder (i.e. DD, ID, language impairment and various dysmorphic features)
7 unrelated families with different de novo variants (missense and CNV, deletion). All variants were absent in gnomAD v4.1.
Supportive functional studies (knockdown zebrafish and mouse model) showed recapitulation of human phenotype and was supportive of LoF as the mechanism of disease
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.416 Sangavi Sivagnanasundram Copied gene CCNK from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.416 CCNK Sangavi Sivagnanasundram gene: CCNK was added
gene: CCNK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCNK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCNK were set to 41101726; 37597256; 30122539
Phenotypes for gene: CCNK were set to CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome MONDO:0035775
Intellectual disability syndromic and non-syndromic v1.415 SRRM1 Zornitza Stark Marked gene: SRRM1 as ready
Intellectual disability syndromic and non-syndromic v1.415 SRRM1 Zornitza Stark Gene: srrm1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.415 SRRM1 Zornitza Stark Classified gene: SRRM1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.415 SRRM1 Zornitza Stark Gene: srrm1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.414 SRRM1 Zornitza Stark gene: SRRM1 was added
gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRRM1 were set to 41145827
Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related
Review for gene: SRRM1 was set to GREEN
Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism.

Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.413 SGSM3 Zornitza Stark Phenotypes for gene: SGSM3 were changed from Neurodevelopmental disorder (MONDO:0700092), SGSM3-related to Intellectual developmental disorder, autosomal recessive 84, MIM# 620401
Intellectual disability syndromic and non-syndromic v1.412 SGSM3 Zornitza Stark reviewed gene: SGSM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 84, MIM# 620401; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.412 CARS Zornitza Stark Marked gene: CARS as ready
Intellectual disability syndromic and non-syndromic v1.412 CARS Zornitza Stark Added comment: Comment when marking as ready: New gene name is CARS1.
Intellectual disability syndromic and non-syndromic v1.412 CARS Zornitza Stark Gene: cars has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.412 CARS Zornitza Stark Tag new gene name tag was added to gene: CARS.
Intellectual disability syndromic and non-syndromic v1.412 PAN2 Zornitza Stark Phenotypes for gene: PAN2 were changed from Syndromic disease MONDO:0002254 to Developmental delay with variable cardiac and renal congenital anomalies and dysmoprhic facies, MIM# 621384
Intellectual disability syndromic and non-syndromic v1.411 PAN2 Zornitza Stark reviewed gene: PAN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay with variable cardiac and renal congenital anomalies and dysmoprhic facies, MIM# 621384; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.411 TAF2 Zornitza Stark Phenotypes for gene: TAF2 were changed from Mental retardation, autosomal recessive 40, MIM# 615599 to Intellectual development disorder, autosomal recessive 40, MIM# 615599
Intellectual disability syndromic and non-syndromic v1.410 TAF2 Zornitza Stark edited their review of gene: TAF2: Changed phenotypes: Intellectual development disorder, autosomal recessive 40, MIM# 615599
Intellectual disability syndromic and non-syndromic v1.410 CXorf56 Zornitza Stark Marked gene: CXorf56 as ready
Intellectual disability syndromic and non-syndromic v1.410 CXorf56 Zornitza Stark Added comment: Comment when marking as ready: New HGNC approved name is STEEP1
Intellectual disability syndromic and non-syndromic v1.410 CXorf56 Zornitza Stark Gene: cxorf56 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.410 CXorf56 Zornitza Stark Phenotypes for gene: CXorf56 were changed from Mental retardation, X-linked 107, MIM# 301013 to Intellectual developmental disorder, X-linked 107, MIM# 301013
Intellectual disability syndromic and non-syndromic v1.409 CXorf56 Zornitza Stark Tag new gene name tag was added to gene: CXorf56.
Intellectual disability syndromic and non-syndromic v1.409 CXorf56 Zornitza Stark edited their review of gene: CXorf56: Changed phenotypes: Intellectual developmental disorder, X-linked 107, MIM# 301013
Intellectual disability syndromic and non-syndromic v1.409 SKOR2 Zornitza Stark Phenotypes for gene: SKOR2 were changed from complex neurodevelopmental disorder with motor features MONDO:0100516 to Valence-Farazi cerebellar ataxia syndrome, MIM# 621386
Intellectual disability syndromic and non-syndromic v1.408 SKOR2 Zornitza Stark edited their review of gene: SKOR2: Changed phenotypes: Valence-Farazi cerebellar ataxia syndrome, MIM# 621386
Intellectual disability syndromic and non-syndromic v1.408 SLC27A3 Zornitza Stark Marked gene: SLC27A3 as ready
Intellectual disability syndromic and non-syndromic v1.408 SLC27A3 Zornitza Stark Gene: slc27a3 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.408 OTUD7A Zornitza Stark Publications for gene: OTUD7A were set to 31997314; 29395075; 29395074; 33381903
Intellectual disability syndromic and non-syndromic v1.407 OTUD7A Zornitza Stark Classified gene: OTUD7A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.407 OTUD7A Zornitza Stark Gene: otud7a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.406 OTUD7A Zornitza Stark Tag SV/CNV tag was added to gene: OTUD7A.
Intellectual disability syndromic and non-syndromic v1.406 AUTS2 Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318; 39953909
Intellectual disability syndromic and non-syndromic v1.405 AUTS2 Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318
Intellectual disability syndromic and non-syndromic v1.404 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.403 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.403 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.402 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171
Intellectual disability syndromic and non-syndromic v1.401 SLC31A1 Zornitza Stark Classified gene: SLC31A1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.401 SLC31A1 Zornitza Stark Gene: slc31a1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.400 SLC31A1 Zornitza Stark Classified gene: SLC31A1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.400 SLC31A1 Zornitza Stark Gene: slc31a1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.399 Sarah Milton Copied gene SLC27A3 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.399 SLC27A3 Sarah Milton gene: SLC27A3 was added
gene: SLC27A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC27A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC27A3 were set to PMID: 41054338
Phenotypes for gene: SLC27A3 were set to Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related
Intellectual disability syndromic and non-syndromic v1.398 OTUD7A Rylee Peters reviewed gene: OTUD7A: Rating: GREEN; Mode of pathogenicity: None; Publications: 29395075, 31997314, 33381903, 36180924, 41028987; Phenotypes: Neurodevelopmental disorder with hypotonia and seizures (MIM#620790), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.398 AUTS2 Fahaz Nazer reviewed gene: AUTS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 39953909; Phenotypes: Intellectual developmental disorder, autosomal dominant 26, MIM# 615834; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.398 SLC31A1 Rylee Peters reviewed gene: SLC31A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 41040850; Phenotypes: Neurodegeneration and seizures due to copper transport defect MIM#620306; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.398 DIP2B_FRA12A_CGG Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128
Intellectual disability syndromic and non-syndromic v1.397 DIP2B_FRA12A_CGG Bryony Thompson edited their review of STR: DIP2B_FRA12A_CGG: Added comment: Unsure about the expansions association with disease due to variable phenotypes and possible incomplete penetrance PMID 17236128, 39854091, and 41028987 report 23 unrelated families with heterozygous CGG repeat expansions in the 5′UTR of DIP2B. Sixteen families present with intellectual disability associated with the FRA12A fragile site, while seven families (including two siblings, five ataxia probands, and one dystonia case) exhibit neurodevelopmental disability with progressive movement disorders (chorea, dystonia, ataxia). Functional studies demonstrate reduced DIP2B expression via promoter hypermethylation. Segregation analysis shows segregation from unaffected parents (possibly reduced penetrance) and de novo events. DIP2B expansion OR 2.8 (p=0.04) in ataxia cohort (5/788) vs gnomAD.; Changed publications: 17236128, 33510257, 39854091, 41028987; Changed phenotypes: intellectual disability, FRA12A type MONDO:0007634
Intellectual disability syndromic and non-syndromic v1.397 SSPO Zornitza Stark Classified gene: SSPO as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.397 SSPO Zornitza Stark Gene: sspo has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.397 SSPO Zornitza Stark Marked gene: SSPO as ready
Intellectual disability syndromic and non-syndromic v1.397 SSPO Zornitza Stark Gene: sspo has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.397 SSPO Zornitza Stark Classified gene: SSPO as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.397 SSPO Zornitza Stark Gene: sspo has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.396 Sarah Milton Copied gene SSPO from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.396 SSPO Sarah Milton gene: SSPO was added
gene: SSPO was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: SSPO.
Mode of inheritance for gene: SSPO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SSPO were set to PMID: 41077560
Phenotypes for gene: SSPO were set to Neurodevelopmental disorder, MONDO:0700092, SSPOP-related
Intellectual disability syndromic and non-syndromic v1.395 PPFIA2 Zornitza Stark Marked gene: PPFIA2 as ready
Intellectual disability syndromic and non-syndromic v1.395 PPFIA2 Zornitza Stark Gene: ppfia2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.395 Zornitza Stark Copied gene PPFIA2 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.395 PPFIA2 Zornitza Stark gene: PPFIA2 was added
gene: PPFIA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PPFIA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPFIA2 were set to 41044885
Phenotypes for gene: PPFIA2 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA2 related
Intellectual disability syndromic and non-syndromic v1.394 EIPR1 Zornitza Stark Marked gene: EIPR1 as ready
Intellectual disability syndromic and non-syndromic v1.394 EIPR1 Zornitza Stark Gene: eipr1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.394 Zornitza Stark Copied gene EIPR1 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.394 EIPR1 Zornitza Stark gene: EIPR1 was added
gene: EIPR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: EIPR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIPR1 were set to 41058046
Phenotypes for gene: EIPR1 were set to Mendelian neurodevelopmental disorder MONDO:0100500, EIPR1-related
Penetrance for gene: EIPR1 were set to unknown
Intellectual disability syndromic and non-syndromic v1.393 BRSK1 Zornitza Stark Marked gene: BRSK1 as ready
Intellectual disability syndromic and non-syndromic v1.393 BRSK1 Zornitza Stark Gene: brsk1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.393 Zornitza Stark Copied gene BRSK1 from panel Mendeliome
Intellectual disability syndromic and non-syndromic v1.393 BRSK1 Zornitza Stark gene: BRSK1 was added
gene: BRSK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: BRSK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BRSK1 were set to 41035394
Phenotypes for gene: BRSK1 were set to Neurodevelopmental disorder, MONDO:0700092, BRSK1-related
Intellectual disability syndromic and non-syndromic v1.392 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.391 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder (MONDO:0700092), KLHL20-related to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.390 KLHL20 Zornitza Stark reviewed gene: KLHL20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.390 SNAPIN Zornitza Stark Phenotypes for gene: SNAPIN were changed from Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393 to Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393
Intellectual disability syndromic and non-syndromic v1.389 SNAPIN Zornitza Stark Phenotypes for gene: SNAPIN were changed from Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related to Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393
Intellectual disability syndromic and non-syndromic v1.388 SNAPIN Zornitza Stark reviewed gene: SNAPIN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.388 MOCS3 Zornitza Stark Phenotypes for gene: MOCS3 were changed from Molybdenum cofactor deficiency, type B2, MIM# 621373 to Molybdenum cofactor deficiency, type B2, MIM# 621373
Intellectual disability syndromic and non-syndromic v1.387 CDKL1 Zornitza Stark Classified gene: CDKL1 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.387 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark edited their review of gene: CDKL1: Changed rating: RED
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark Deleted their comment
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark Mode of pathogenicity for gene: CDKL1 was changed from None to None
Intellectual disability syndromic and non-syndromic v1.386 CDKL1 Zornitza Stark Mode of pathogenicity for gene: CDKL1 was changed from Other to None
Intellectual disability syndromic and non-syndromic v1.385 CDKL1 Zornitza Stark Classified gene: CDKL1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.385 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.384 CDKL1 Zornitza Stark edited their review of gene: CDKL1: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.384 CDKL1 Zornitza Stark commented on gene: CDKL1: PMID 40088891 reports two unrelated individuals with de novo heterozygous CDKL1 missense variants (p.Val115Ala, p.Arg169Cys) presenting with childhood‑onset neurodevelopmental disorder, developmental delay and seizures; Drosophila rescue assays show dominant‑negative activity of the variants. However, note that the variants are present at low frequency in gnomAD v4, p.Val115Ala: 2 individuals, p.Arg169Cys: 13 individuals. Some supportive functional data presented. Upgrade to Amber but not Green due to pop counts.
Intellectual disability syndromic and non-syndromic v1.384 MOCS3 Zornitza Stark Phenotypes for gene: MOCS3 were changed from Molybdenum cofactor deficiency, type B2, MIM# 621373 to Molybdenum cofactor deficiency, type B2, MIM# 621373
Intellectual disability syndromic and non-syndromic v1.383 MOCS3 Zornitza Stark Phenotypes for gene: MOCS3 were changed from Molybdenum cofactor deficiency MONDO:0020480 to Molybdenum cofactor deficiency, type B2, MIM# 621373
Intellectual disability syndromic and non-syndromic v1.382 MOCS3 Zornitza Stark edited their review of gene: MOCS3: Changed phenotypes: Molybdenum cofactor deficiency, type B2, MIM# 621373
Intellectual disability syndromic and non-syndromic v1.382 TBCB Zornitza Stark Phenotypes for gene: TBCB were changed from Neurodevelopmental disorder, MONDO:0700092, TBCB-related to Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382
Intellectual disability syndromic and non-syndromic v1.381 TBCB Zornitza Stark reviewed gene: TBCB: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.381 KMT2B Zornitza Stark commented on gene: KMT2B: Note ClinGen have lumped the dystonia and ID phenotypes as these overlap in the same families. Association considered DEFINITIVE.
Intellectual disability syndromic and non-syndromic v1.381 TBX2 Krithika Murali Classified gene: TBX2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.381 TBX2 Krithika Murali Gene: tbx2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.380 TBX2 Krithika Murali Marked gene: TBX2 as ready
Intellectual disability syndromic and non-syndromic v1.380 TBX2 Krithika Murali Gene: tbx2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.380 TBX2 Krithika Murali gene: TBX2 was added
gene: TBX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TBX2 were set to PMID: 36733940
Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction - MIM#618223
Review for gene: TBX2 was set to AMBER
Added comment: PMID: 36733940 Rafeeq et al 2022 report a novel de novo nonsense variant (c.529A>T; p.Lys177*; NM_005994.4) in a child with chondrodysplasia. Skeletal features included spinal deformities, short limbs, metaphyseal and epiphyseal dysplasia, and bilateral developmental dislocation of the hip (DDH).

Global developmental delay was also noted in this child.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.379 EIF3B Zornitza Stark Marked gene: EIF3B as ready
Intellectual disability syndromic and non-syndromic v1.379 EIF3B Zornitza Stark Gene: eif3b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.379 EIF3B Zornitza Stark Classified gene: EIF3B as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.379 EIF3B Zornitza Stark Gene: eif3b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.378 EIF3B Zornitza Stark gene: EIF3B was added
gene: EIF3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3B were set to 41033306
Phenotypes for gene: EIF3B were set to Syndromic disease (MONDO:0002254), EIF3B-related
Review for gene: EIF3B was set to GREEN
Added comment: Fourteen individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.377 EIF3A Zornitza Stark Marked gene: EIF3A as ready
Intellectual disability syndromic and non-syndromic v1.377 EIF3A Zornitza Stark Gene: eif3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.377 EIF3A Zornitza Stark Classified gene: EIF3A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.377 EIF3A Zornitza Stark Gene: eif3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark changed review comment from: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature; to: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark edited their review of gene: EIF3A: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark gene: EIF3A was added
gene: EIF3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3A were set to 41033306
Phenotypes for gene: EIF3A were set to Syndromic disease (MONDO:0002254), EIF3A-related
Added comment: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.375 SF1 Zornitza Stark Marked gene: SF1 as ready
Intellectual disability syndromic and non-syndromic v1.375 SF1 Zornitza Stark Gene: sf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.375 SF1 Zornitza Stark Classified gene: SF1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.375 SF1 Zornitza Stark Gene: sf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.374 MDGA2 Zornitza Stark Marked gene: MDGA2 as ready
Intellectual disability syndromic and non-syndromic v1.374 MDGA2 Zornitza Stark Gene: mdga2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.374 MDGA2 Zornitza Stark Classified gene: MDGA2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.374 MDGA2 Zornitza Stark Gene: mdga2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.373 MDGA2 Zornitza Stark gene: MDGA2 was added
gene: MDGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MDGA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MDGA2 were set to https://doi.org/10.1101/2025.08.28.25330873; 40168357; 27608760
Phenotypes for gene: MDGA2 were set to MDGA2-related neurodevelopmental disorder MONDO:0700092
Review for gene: MDGA2 was set to GREEN
Added comment: Affected individuals present with a broad neurodevelopmental impairment-like phenotype.

Pre-print - https://doi.org/10.1101/2025.08.28.25330873
Individuals with developmental and epileptic encephalopathy (DEE)
8 individuals from 6 consanguineous families exhibiting infantile hypotonia, severe neurodevelopmental delay, intractable seizures, progressive brain atrophy, and consistent dysmorphic features.
7 different biallelic LoF variants were identified
p.Tyr913Ter, p.Arg404Ter, p.Leu920Ter, c.421-1G>A, p.Lys391SerfsTer7 and c.421-96_595+99del - all variants are rare or absent in gnomAD v4.1
In vitro functional studies of three nonsense variants in mammalian expression systems and hippocampal cultured neurons that resulted in impaired MDGA2 membrane trafficking are supportive of a loss-of-function mechanism.

PMID: 40168357, 27608760
A knockout mouse model showed that MGAD2-deficient mice presented with autism-like behaviours (social deficits, repetitive behaviour, and cognitive impairment).
The mice also showed abnormalities in excitatory synapses.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.372 PTBP1 Zornitza Stark Marked gene: PTBP1 as ready
Intellectual disability syndromic and non-syndromic v1.372 PTBP1 Zornitza Stark Gene: ptbp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.372 PTBP1 Zornitza Stark Classified gene: PTBP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.372 PTBP1 Zornitza Stark Gene: ptbp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.371 DBX1 Zornitza Stark Marked gene: DBX1 as ready
Intellectual disability syndromic and non-syndromic v1.371 DBX1 Zornitza Stark Gene: dbx1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.371 DBX1 Zornitza Stark gene: DBX1 was added
gene: DBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DBX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DBX1 were set to 40995053
Phenotypes for gene: DBX1 were set to central hypoventilation syndrome, congenital MONDO:0800031
Review for gene: DBX1 was set to RED
Added comment: Single individual reported with congenital central hypoventilation syndrome (atypical CCHS) with central hypotonia, global developmental delay, seizures, autoaggressive behaviour. Consanguineous parents, hmz frameshift variant c.340_341delGC, absent from gnomAD.
Mouse Dbx1 knockout is lethal indicating essential role in respiration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.370 NFXL1 Zornitza Stark Marked gene: NFXL1 as ready
Intellectual disability syndromic and non-syndromic v1.370 NFXL1 Zornitza Stark Gene: nfxl1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.370 NFXL1 Zornitza Stark Classified gene: NFXL1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.370 NFXL1 Zornitza Stark Gene: nfxl1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.369 NFXL1 Zornitza Stark gene: NFXL1 was added
gene: NFXL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NFXL1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NFXL1 were set to 40430072; 41024252
Phenotypes for gene: NFXL1 were set to Syndromic disease (MONDO:0002254), NFXL1-related
Review for gene: NFXL1 was set to AMBER
Added comment: PMID: 40430072 2 siblings with psychosis and schizophrenia, homozygous for Cys441Tyr. Some modelling suggested a deleterious affect but no functional studies performed.

PMID: 41024252 8 patients from 7 families with joint hyperlaxity, with or without short stature and renal disease. 6 families were homozygous for p.(Cys539Trpfs*64) while the other two were homozygous for p.(Lys681*). Paper described both as founder variants but they are rare/absent in gnomad.

Joint hyperlaxity (7), chronic kidney disease/FSGS (2) small echogenic kidneys (3), acute kidney injury (1), dysmorphic features (6), short stature (6), speech delay (3).

One patient also had epilepsy, developmental delay and spasticity however c.728+1G>A in WDR45 explained this part of her phenotype. Other patients also had more severe outlying symptoms with no other explanation mentioned: 1 with developmental delay, hearing loss, brain malformations, skeletal abnormalities, and another a 3 year old who passed away following a complex medical course including blue sclera, proximal tibial fracture, severe respiratory distress due to a chest infection, and acute kidney injury.

Amber given the variable phenotype findings of the reported patients and only 2 homozygous variants identified so far.

Extent of associated DD/ID currently unclear but adding on this panel as it is often ordered in children with multi-system features suggestive of an underlying syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.368 PTBP2 Zornitza Stark Marked gene: PTBP2 as ready
Intellectual disability syndromic and non-syndromic v1.368 PTBP2 Zornitza Stark Gene: ptbp2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.368 PTBP2 Zornitza Stark Classified gene: PTBP2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.368 PTBP2 Zornitza Stark Gene: ptbp2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.367 CDK9 Zornitza Stark Marked gene: CDK9 as ready
Intellectual disability syndromic and non-syndromic v1.367 CDK9 Zornitza Stark Gene: cdk9 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.367 CDK9 Zornitza Stark Classified gene: CDK9 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.367 CDK9 Zornitza Stark Gene: cdk9 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.366 CDK9 Zornitza Stark gene: CDK9 was added
gene: CDK9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDK9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDK9 were set to 33640901; 30237576; 26633546
Phenotypes for gene: CDK9 were set to multiple congenital anomalies/dysmorphic syndrome-variable intellectual disability syndrome MONDO:0015160; CHARGE-like syndrome with retinal dystrophy
Review for gene: CDK9 was set to AMBER
Added comment: Two independent reports:
1) A boy with a phenotype resembling CHARGE syndrome (multiple anomalies involving the eyes, ears, cleft lip, and palate, and intellectual disability) with retinal dystrophy (p.A288T/p.R303C),
2) 4 consanguineous families homozygous for p.R225C, including a set of cousins.
CDK9 variants demonstrated decreased kinase activity. One of the studies suggested the extent the kinase activity is reduced may account for the absence/presence of the CHARGE-like phenotype with retinal dystrophy

One additional family with retinal dystrophy only.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.365 AGTPBP1 Chirag Patel Phenotypes for gene: AGTPBP1 were changed from Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy; Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 to Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650
Publications for gene AGTPBP1 were changed from 30420557, 28600779, 30976113, 38153683, 28325758 to 30420557, 28600779, 30976113, 38153683, 28325758
Intellectual disability syndromic and non-syndromic v1.364 ATP1A3 Chirag Patel Source Genetic Health Queensland was removed from ATP1A3.
Source Expert list was added to ATP1A3.
Phenotypes for gene: ATP1A3 were changed from Alternating hemiplegia of childhood 2, MIM#614820; Developmental and epileptic encephalopathy, polymicrogyria to ATP1A3-associated neurological disorder, MONDO:0700002
Publications for gene ATP1A3 were changed from 33880529, 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 to 33880529, 15260953, 22842232, 24468074, 33762331, 29861155, 31425744
Intellectual disability syndromic and non-syndromic v1.363 ALS2 Chirag Patel Source Genetic Health Queensland was removed from ALS2.
Source ClinGen was added to ALS2.
Phenotypes for gene: ALS2 were changed from Spastic paralysis, infantile onset ascending, MIM#607225 to ALS2-related motor neuron disease, MONDO:0100227
Intellectual disability syndromic and non-syndromic v1.362 ALG14 Chirag Patel Source Genetic Health Queensland was removed from ALG14.
Source Expert list was added to ALG14.
Publications for gene ALG14 were changed from 30221345, 23404334, 28733338, 33751823, 34971077 to 30221345, 23404334, 28733338, 33751823, 34971077
Intellectual disability syndromic and non-syndromic v1.361 DHCR24 Chirag Patel Source Genetic Health Queensland was removed from DHCR24.
Source ClinGen was added to DHCR24.
Phenotypes for gene: DHCR24 were changed from Desmosterolosis, MIM# 602398 to Desmosterolosis, MONDO:0011217
Publications for gene DHCR24 were changed from 11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936 to 11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936
Intellectual disability syndromic and non-syndromic v1.360 DDX11 Chirag Patel Source Genetic Health Queensland was removed from DDX11.
Source ClinGen was added to DDX11.
Phenotypes for gene: DDX11 were changed from Warsaw breakage syndrome, MIM# 613398; MONDO:0013252 to Warsaw breakage syndrome, MONDO:0013252
Publications for gene DDX11 were changed from 20137776, 23033317, 30216658, 30924321, 32855419, 36703504, 26089203 to 20137776, 23033317, 30216658, 30924321, 32855419, 36703504, 26089203
Intellectual disability syndromic and non-syndromic v1.359 UGGT1 Zornitza Stark Phenotypes for gene: UGGT1 were changed from Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG to Congenital disorder of glycosylation, type IICC, MIM# 621381
Intellectual disability syndromic and non-syndromic v1.358 UGGT1 Zornitza Stark reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type IICC, MIM# 621381; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.358 NAA20 Chern Lim reviewed gene: NAA20: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37191084; Phenotypes: Intellectual developmental disorder, autosomal recessive 73, MIM# 619717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.358 ATP5O Bryony Thompson Tag new gene name tag was added to gene: ATP5O.
Intellectual disability syndromic and non-syndromic v1.358 DDOST Bryony Thompson Phenotypes for gene: DDOST were changed from Congenital disorder of glycosylation, type Ir, MIM# 614507 to DDOST-congenital disorder of glycosylation MONDO:0013789
Intellectual disability syndromic and non-syndromic v1.357 DDOST Bryony Thompson Publications for gene: DDOST were set to 22305527
Intellectual disability syndromic and non-syndromic v1.356 DDOST Bryony Thompson Classified gene: DDOST as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.356 DDOST Bryony Thompson Gene: ddost has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.355 DDOST Bryony Thompson Classified gene: DDOST as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.355 DDOST Bryony Thompson Gene: ddost has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.354 DDOST Bryony Thompson edited their review of gene: DDOST: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.354 DDOST Bryony Thompson reviewed gene: DDOST: Rating: ; Mode of pathogenicity: None; Publications: 22305527, 34462534, 36214423, 37848450, 33413482, 36631682; Phenotypes: DDOST-congenital disorder of glycosylation MONDO:0013789; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.354 TM2D3 Zornitza Stark Phenotypes for gene: TM2D3 were changed from Neurodevelopmental disorder, MONDO:0700092, TM2D3-related to Neurocardiorenal malformation syndrome, MIM# 621379
Intellectual disability syndromic and non-syndromic v1.353 TM2D3 Zornitza Stark edited their review of gene: TM2D3: Changed phenotypes: Neurocardiorenal malformation syndrome, MIM# 621379
Intellectual disability syndromic and non-syndromic v1.353 ATXN7L3 Zornitza Stark Phenotypes for gene: ATXN7L3 were changed from Neurodevelopmental disorder, MONDO_0100500, ATXN7L3-related to Harel-Tora neurodevelopmental syndrome, MIM# 621377
Intellectual disability syndromic and non-syndromic v1.352 ATXN7L3 Zornitza Stark reviewed gene: ATXN7L3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Harel-Tora neurodevelopmental syndrome, MIM# 621377; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.352 HYPK Zornitza Stark Publications for gene: HYPK were set to Clinical Genetics Early View
Intellectual disability syndromic and non-syndromic v1.351 BCAT1 Zornitza Stark Marked gene: BCAT1 as ready
Intellectual disability syndromic and non-syndromic v1.351 BCAT1 Zornitza Stark Gene: bcat1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.351 BCAT1 Zornitza Stark Classified gene: BCAT1 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.351 BCAT1 Zornitza Stark Gene: bcat1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.350 BCAT1 Lucy Spencer gene: BCAT1 was added
gene: BCAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BCAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BCAT1 were set to 41029903
Phenotypes for gene: BCAT1 were set to Neurodevelopmental disorder (MONDO:0700092), BCAT1-related
Review for gene: BCAT1 was set to RED
Added comment: PMID: 41029903 One patient with a suspected neurometabolic disorder; congenital blindness and suspected Leber Congenital Amaurosis, microcephaly, failure to thrive, profound global developmental delay and extensive delayed myelination on MRI. AT 10 he was non-verbal and non-ambulatory with regression of motor skills and -3SD for height and weight. Compound heterozygous for Phe264Leu (539 hets but no homs in gnomad v4) and Glu348Lys (over 8000 hets and 24 homs in gnomad v4).

in compound heterozygous iPSCs a severe 75% reduction in BCAT1 protein levels was seen, but mRNA levels were normal suggesting the variants affect protein stability or increased degradation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 HYPK Sangavi Sivagnanasundram reviewed gene: HYPK: Rating: ; Mode of pathogenicity: None; Publications: 40986405; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, HYPK-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.350 RNU6ATAC Lucy Spencer gene: RNU6ATAC was added
gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNU6ATAC were set to 40975062
Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related
Review for gene: RNU6ATAC was set to RED
Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP1 Lucy Spencer gene: PTBP1 was added
gene: PTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP1 were set to 40965981
Phenotypes for gene: PTBP1 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP1-related
Review for gene: PTBP1 was set to GREEN
Added comment: PMID: 40965981 27 individuals with abnormal prenatal ultrasound in thirteen (48%) including short femora, IUGR, hydramnios, increased nuchal translucency, asymmetry of heart cavities, and bilateral hydronephrosis. Skeletal anomalies were seen in 24 (89%), short stature/limbs in 63%, facial dysmorphism 25 (93%), developmental delay in 78%, behavioral problems in 30% and ID in 26% generally mild/moderate, 43% had variable brain MRI abnormalities. additional features included skin, nail, and hair anomalies (52%), dental anomalies (37%), ophthalmological findings (44%), and cardiovascular defects (22%).

Variants a mix of missense and startloss, and were confirmed de novo in 23/17 cases.

Various functional studies showed reduced nuclear localization and enhanced cytoplasmic retention, with start-loss variants also leading to increased protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP2 Lucy Spencer gene: PTBP2 was added
gene: PTBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP2 were set to 40965981
Phenotypes for gene: PTBP2 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP2-related
Review for gene: PTBP2 was set to AMBER
Added comment: PMID: 40965981 2 males with developmental delay, ID, autistic features. 1 had some dysmorphic features and tonic-clonic seizures. both probands had a de novo variant in PTBP2 NM_021190.4:c.2T>C (p.Met1?) and NM_021190.4:c.41G>C (p.Arg14Thr), absent from gnomad. Transfection of the variants in transfection in NIH-3T3 cells showed the missense had cytoplasmic retention and colocalization with processing bodies, and that there were 2 alternative downstream start sites Met32 and Met35 that may be used instead.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 ITGAV Zornitza Stark Phenotypes for gene: ITGAV were changed from Syndromic disease, MONDO:0002254, ITGAV-related to Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372
Intellectual disability syndromic and non-syndromic v1.349 ITGAV Zornitza Stark Classified gene: ITGAV as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.349 ITGAV Zornitza Stark Gene: itgav has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.348 ITGAV Zornitza Stark edited their review of gene: ITGAV: Changed rating: GREEN; Changed phenotypes: Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372
Intellectual disability syndromic and non-syndromic v1.348 UBR5 Zornitza Stark Phenotypes for gene: UBR5 were changed from Neurodevelopmental disorder MONDO:0700092, UBR5-related to Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372
Intellectual disability syndromic and non-syndromic v1.347 UBR5 Zornitza Stark reviewed gene: UBR5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.347 DNM1L Chirag Patel Source Genetic Health Queensland was removed from DNM1L.
Source ClinGen was added to DNM1L.
Source Literature was added to DNM1L.
Mode of pathogenicity for gene DNM1L was changed from to Other
Phenotypes for gene: DNM1L were changed from Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388 to Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726
Publications for gene DNM1L were changed from 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748 to 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748
Intellectual disability syndromic and non-syndromic v1.346 SF1 Sarah Milton changed review comment from: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
Variant types included missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature; to: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
12 confirmed to have de novo variants including missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.346 SF1 Sarah Milton gene: SF1 was added
gene: SF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SF1 were set to PMID: 40987292
Phenotypes for gene: SF1 were set to Neurodevelopmental disorder, MONDO:0700092, SF1-related
Review for gene: SF1 was set to GREEN
Added comment: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
Variant types included missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.346 DHDDS Chirag Patel Publications for gene DHDDS were changed from 29100083, 36628425, 34382076 to 29100083, 36628425, 34382076
Intellectual disability syndromic and non-syndromic v1.345 DHDDS Chirag Patel Publications for gene DHDDS were changed from 29100083, 36628425 to 29100083, 36628425
Intellectual disability syndromic and non-syndromic v1.344 DIAPH1 Chirag Patel Source Genetic Health Queensland was removed from DIAPH1.
Source Literature was added to DIAPH1.
Phenotypes for gene: DIAPH1 were changed from progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714 to Progressive microcephaly-seizures-cortical blindness-developmental delay syndrome, MONDO:0014714
Publications for gene DIAPH1 were changed from 24781755, 26463574, 33662367, 36212620, 39076976, 39120629 to 24781755, 26463574, 33662367, 36212620, 39076976, 39120629
Intellectual disability syndromic and non-syndromic v1.343 LEO1 Chirag Patel Classified gene: LEO1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.343 LEO1 Chirag Patel Gene: leo1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.342 LEO1 Chirag Patel reviewed gene: LEO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 40993282, 33004838, 31785789, 40671880, 29674594; Phenotypes: Neurodevelopmental disorder MONDO:0700092, LEO-1 related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.342 SYNE2 Zornitza Stark Marked gene: SYNE2 as ready
Intellectual disability syndromic and non-syndromic v1.342 SYNE2 Zornitza Stark Gene: syne2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.342 SYNE2 Chirag Patel gene: SYNE2 was added
gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SYNE2 were set to 34573277
Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related
Review for gene: SYNE2 was set to RED
Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells.

SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.341 INTS6 Zornitza Stark Marked gene: INTS6 as ready
Intellectual disability syndromic and non-syndromic v1.341 INTS6 Zornitza Stark Gene: ints6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.341 INTS6 Zornitza Stark Classified gene: INTS6 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.341 INTS6 Zornitza Stark Gene: ints6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton gene: INTS6 was added
gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: INTS6 were set to PMID: 40966122
Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related
Review for gene: INTS6 was set to GREEN
Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to 40210679; 40442284
Intellectual disability syndromic and non-syndromic v1.339 RNU2-2P Zornitza Stark Mode of inheritance for gene: RNU2-2P was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.338 RNU2-2P Zornitza Stark edited their review of gene: RNU2-2P: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.338 RNU2-2P Zornitza Stark edited their review of gene: RNU2-2P: Added comment: PMID 40950445: reports bi-allelic cases in a cohort of over 100 individuals. One variant frequently de novo in trans with inherited variant.; Changed publications: 40210679, 40442284, 40950445
Intellectual disability syndromic and non-syndromic v1.338 CRNKL1 Zornitza Stark Publications for gene: CRNKL1 were set to
Intellectual disability syndromic and non-syndromic v1.337 CRNKL1 Boris Keren reviewed gene: CRNKL1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 40857589; Phenotypes: microcephaly, intellectual disability, simplified gyration, epilepsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.337 MRPS36 Krithika Murali Classified gene: MRPS36 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.337 MRPS36 Krithika Murali Gene: mrps36 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.336 MRPS36 Krithika Murali Marked gene: MRPS36 as ready
Intellectual disability syndromic and non-syndromic v1.336 MRPS36 Krithika Murali Gene: mrps36 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.336 MRPS36 Krithika Murali Classified gene: MRPS36 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.336 MRPS36 Krithika Murali Gene: mrps36 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.335 MRPS36 Krithika Murali gene: MRPS36 was added
gene: MRPS36 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRPS36 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPS36 were set to PMID: 41018056; 38685873
Phenotypes for gene: MRPS36 were set to Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related
Review for gene: MRPS36 was set to AMBER
Added comment: 3 individuals from 2 unrelated families reported with biallelic MRPS36 variants (current HGNC is KGD4). Gene encodes E4 subunit of OGDHC complex. Individuals present with a phenotype consistent with Leigh syndrome including seizures, hypotonia, dystonia, brain imaging anomalies, persistent lactic acidosis. GDD, ID and cardiomyopathy also reported.

Patient-derived fibroblast studies demonstrates reduced OGDHC enzymatic activity, however, this functional evidence is not gene or variant-specific.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.334 GTF2I Zornitza Stark Phenotypes for gene: GTF2I were changed from to Neurodevelopmental disorder MONDO:0700092, GTF2I-related
Intellectual disability syndromic and non-syndromic v1.333 GTF2I Zornitza Stark Publications for gene: GTF2I were set to
Intellectual disability syndromic and non-syndromic v1.332 GTF2I Zornitza Stark Mode of inheritance for gene: GTF2I was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.331 GTF2I Zornitza Stark Classified gene: GTF2I as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.331 GTF2I Zornitza Stark Gene: gtf2i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.330 GTF2I Zornitza Stark edited their review of gene: GTF2I: Added comment: 7 individuals reported with de novo variants in this gene and a neurodevelopmental disorder. All but one of the variants are absent from gnomAD v4 (one het present for the indel variant).; Changed rating: GREEN; Changed publications: 40962490; Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF2I-relatedder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.330 BBOX1 Zornitza Stark Marked gene: BBOX1 as ready
Intellectual disability syndromic and non-syndromic v1.330 BBOX1 Zornitza Stark Gene: bbox1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.330 BBOX1 Zornitza Stark Classified gene: BBOX1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.330 BBOX1 Zornitza Stark Gene: bbox1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.329 BBOX1 Zornitza Stark gene: BBOX1 was added
gene: BBOX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BBOX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BBOX1 were set to 41022783
Phenotypes for gene: BBOX1 were set to Carnitine deficiency, MONDO:0017716, BBOX1-related
Review for gene: BBOX1 was set to AMBER
Added comment: Three individuals from two unrelated families reported, presenting with myopathy, neurodevelopmental delay, and later-onset psychiatric manifestations. C. elegans knockout and patient-variant models show embryonic lethality rescued by L‑carnitine supplementation
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.328 INPP4A Zornitza Stark Phenotypes for gene: INPP4A were changed from Intellectual disability to Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354
Intellectual disability syndromic and non-syndromic v1.327 INPP4A Zornitza Stark Publications for gene: INPP4A were set to 31978615; 31938306; 25338135; 20011524
Intellectual disability syndromic and non-syndromic v1.326 INPP4A Zornitza Stark edited their review of gene: INPP4A: Changed phenotypes: Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354
Intellectual disability syndromic and non-syndromic v1.326 B9D1 Zornitza Stark Phenotypes for gene: B9D1 were changed from Joubert syndrome 27, MIM#617120; Meckel syndrome 9, MIM#614209 to Ciliopathy, MONDO:0005308, B9D1-related
Intellectual disability syndromic and non-syndromic v1.325 B9D1 Zornitza Stark Publications for gene: B9D1 were set to 24886560; 21493627
Intellectual disability syndromic and non-syndromic v1.324 B9D1 Zornitza Stark Classified gene: B9D1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.324 B9D1 Zornitza Stark Gene: b9d1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.323 B9D1 Zornitza Stark edited their review of gene: B9D1: Added comment: Lumped by ClinGen. Additional individuals reported, promote to Green.; Changed publications: 24886560, 21493627, 40565534, 40933483; Changed phenotypes: Ciliopathy, MONDO:0005308, B9D1-related
Intellectual disability syndromic and non-syndromic v1.323 DNM1 Chirag Patel Source Genetic Health Queensland was removed from DNM1.
Source Literature was added to DNM1.
Publications for gene DNM1 were changed from 25262651; 27066543; 33372033; 34172529; 36553519; 37900685 to 25262651; 27066543; 33372033; 34172529; 36553519; 37900685
Intellectual disability syndromic and non-syndromic v1.322 RALGAPA1 Zornitza Stark Phenotypes for gene: RALGAPA1 were changed from Intellectual disability; hypotonia; infantile spasms. to Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797
Intellectual disability syndromic and non-syndromic v1.321 RALGAPA1 Zornitza Stark edited their review of gene: RALGAPA1: Changed phenotypes: Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797
Intellectual disability syndromic and non-syndromic v1.321 DDB1 Chirag Patel Source Research was removed from DDB1.
Source Literature was added to DDB1.
Phenotypes for gene: DDB1 were changed from White-Kernohan syndrome, MIM# 619426; Syndromic intellectual disability to White-Kernohan syndrome, MIM# 619426
Intellectual disability syndromic and non-syndromic v1.320 RAC1 Zornitza Stark Phenotypes for gene: RAC1 were changed from Mental retardation, autosomal dominant 48, MIM# 617751 to Intellectual developmental disorder, autosomal dominant 48 MIM#617751
Intellectual disability syndromic and non-syndromic v1.319 RAC1 Zornitza Stark edited their review of gene: RAC1: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 48 MIM#617751
Intellectual disability syndromic and non-syndromic v1.319 RAB14 Zornitza Stark Phenotypes for gene: RAB14 were changed from Developmental disorders to Neurodevelopmental disorder MONDO:0700092, RAB14-related
Intellectual disability syndromic and non-syndromic v1.318 RAB14 Zornitza Stark edited their review of gene: RAB14: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, RAB14-related
Intellectual disability syndromic and non-syndromic v1.318 PJA1 Zornitza Stark Phenotypes for gene: PJA1 were changed from Intellectual disability; trigonocephaly to X-linked complex neurodevelopmental disorder, PJA1-related, MONDO:0100148
Intellectual disability syndromic and non-syndromic v1.317 PJA1 Zornitza Stark edited their review of gene: PJA1: Changed phenotypes: X-linked complex neurodevelopmental disorder, PJA1-related, MONDO:0100148
Intellectual disability syndromic and non-syndromic v1.317 NDE1 Zornitza Stark Phenotypes for gene: NDE1 were changed from Lissencephaly 4 (with microcephaly), MIM# 614019; MONDO:0013527; Microhydranencephaly, MIM# 605013; MONDO:0011504 to Microcephaly with lissencephaly and/or hydranencephaly, MONDO:0700116
Intellectual disability syndromic and non-syndromic v1.316 NDE1 Zornitza Stark edited their review of gene: NDE1: Changed phenotypes: Microcephaly with lissencephaly and/or hydranencephaly, MONDO:0700116
Intellectual disability syndromic and non-syndromic v1.316 DNAJA1 Chirag Patel Phenotypes for gene: DNAJA1 were changed from Intellectual disability; seizures to Neurodevelopmental disorder, MONDO:0700092, DNAJA1-related
Intellectual disability syndromic and non-syndromic v1.315 ALG2 Chirag Patel Classified gene: ALG2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.315 ALG2 Chirag Patel Gene: alg2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.315 ALG2 Chirag Patel Classified gene: ALG2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.315 ALG2 Chirag Patel Gene: alg2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.314 ALG2 Chirag Patel reviewed gene: ALG2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 12684507, 34980536, 23404334, 30397276, 33644825; Phenotypes: Congenital disorder of glycosylation, type Ii, MIM# 607906; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.314 AP2S1 Zornitza Stark Phenotypes for gene: AP2S1 were changed from Developmental disorder to Neurodevelopmental disorder, MONDO:0700092, AP2S1-related
Intellectual disability syndromic and non-syndromic v1.313 AP2S1 Zornitza Stark Publications for gene: AP2S1 were set to 33057194
Intellectual disability syndromic and non-syndromic v1.312 AP2S1 Zornitza Stark Classified gene: AP2S1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.312 AP2S1 Zornitza Stark Gene: ap2s1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.311 AP2S1 Boris Keren reviewed gene: AP2S1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 31981491, 33057194, 35982160, 35982159; Phenotypes: intellectual disability, epilepsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.311 GPHN Bryony Thompson Classified gene: GPHN as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.311 GPHN Bryony Thompson Gene: gphn has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.310 GPHN Bryony Thompson reviewed gene: GPHN: Rating: GREEN; Mode of pathogenicity: None; Publications: 22040219, 11095995, 9812897, 34617111; Phenotypes: sulfite oxidase deficiency due to molybdenum cofactor deficiency type C MONDO:0014212; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.310 BRSK2 Zornitza Stark Phenotypes for gene: BRSK2 were changed from Intellectual disability; autism to Neurodevelopmental disorder, MONDO:0700092, BRSK2-related
Intellectual disability syndromic and non-syndromic v1.309 BRSK2 Sarah Milton reviewed gene: BRSK2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, BRSK2-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.309 UPF1 Zornitza Stark Phenotypes for gene: UPF1 were changed from Developmental disorders to neurodevelopmental disorder, MONDO:0700092, UPF1-related
Intellectual disability syndromic and non-syndromic v1.308 GNAI2 Zornitza Stark Phenotypes for gene: GNAI2 were changed from Syndromic intellectual disability to Syndromic disease MONDO:0002254, GNAI2-related
Intellectual disability syndromic and non-syndromic v1.307 GNAI2 Zornitza Stark Publications for gene: GNAI2 were set to 31036916
Intellectual disability syndromic and non-syndromic v1.306 GNAI2 Zornitza Stark Classified gene: GNAI2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.306 GNAI2 Zornitza Stark Gene: gnai2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.305 TRPC5 Zornitza Stark Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890
Intellectual disability syndromic and non-syndromic v1.304 GNAI2 Rylee Peters reviewed gene: GNAI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 40926810, 39298586; Phenotypes: Syndromic disease MONDO:0002254, GNAI2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.304 TRPC5 Rylee Peters reviewed gene: TRPC5: Rating: AMBER; Mode of pathogenicity: None; Publications: 40907672; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TRPC5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.304 TMEM167A Zornitza Stark Marked gene: TMEM167A as ready
Intellectual disability syndromic and non-syndromic v1.304 TMEM167A Zornitza Stark Gene: tmem167a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.304 KDM5A Rylee Peters reviewed gene: KDM5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 33350388; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), KDM5A-related, AD; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.304 COL4A3BP Elena Savva Phenotypes for gene: COL4A3BP were changed from Intellectual developmental disorder 34 (MIM#616351) to Neurodevelopmental disorder with hypotonia, speech delay, and dysmorphic facies (MIM#616351)
Intellectual disability syndromic and non-syndromic v1.303 TMEM167A Chirag Patel Classified gene: TMEM167A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.303 TMEM167A Chirag Patel Gene: tmem167a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.302 TMEM167A Chirag Patel gene: TMEM167A was added
gene: TMEM167A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM167A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM167A were set to PMID: 40924476
Phenotypes for gene: TMEM167A were set to Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related
Review for gene: TMEM167A was set to GREEN
Added comment: 6 individuals from 6 unrelated families (4/6 consanguineous) presenting with neonatal diabetes onset <4mths (6/6), severe microcephaly (6/6), epilepsy (5/6), and developmental delay (4/6).

Whole genome sequencing identified biallelic variants in TMEM167A gene. Variants were homozygous in 5/6 families, and variant types were missense (4), frameshift (1), and splice (1), and all variants were rare/unreported in gnomAD. Segregation studies not reported in paper.

Microcephaly, epilepsy and diabetes syndrome has 2 known associated genes (IER3IP1 and YIPF5) which encode proteins involved in endoplasmic reticulum to Golgi trafficking. TMEM167A is highly expressed in developing and adult human pancreas and brain. Both TMEM167A depletion in EndoC-βH1 cells and knock‑in of p.Val59Glu variant in iPSC-derived β cells sensitized β cells to ER stress. The p.Val59Glu variant impaired proinsulin trafficking to the Golgi and induced iPSC-β cell dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.301 RAB11A Zornitza Stark Publications for gene: RAB11A were set to 29100083
Intellectual disability syndromic and non-syndromic v1.300 RAB11A Zornitza Stark Phenotypes for gene: RAB11A were changed from Intellectual disability; seizures to Neurodevelopmental disorder MONDO:0700092, RAB11A-related
Intellectual disability syndromic and non-syndromic v1.299 RAB11A Zornitza Stark edited their review of gene: RAB11A: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, RAB11A-related
Intellectual disability syndromic and non-syndromic v1.299 ZNF865 Zornitza Stark Marked gene: ZNF865 as ready
Intellectual disability syndromic and non-syndromic v1.299 ZNF865 Zornitza Stark Gene: znf865 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.299 ZNF865 Zornitza Stark Classified gene: ZNF865 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.299 ZNF865 Zornitza Stark Gene: znf865 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.298 ZNF865 Zornitza Stark reviewed gene: ZNF865: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ZNF865‑associated neurodevelopmental disorder MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.298 PSMC1 Zornitza Stark Phenotypes for gene: PSMC1 were changed from Neurodevelopmental disorder with poor growth, spastic tetraplegia, and hearing loss , MIM# 620071 to Birk-Aharoni syndrome MIM# 620071
Intellectual disability syndromic and non-syndromic v1.297 PSMC1 Zornitza Stark edited their review of gene: PSMC1: Changed phenotypes: Birk-Aharoni syndrome MIM# 620071
Intellectual disability syndromic and non-syndromic v1.297 SNAPIN Zornitza Stark Marked gene: SNAPIN as ready
Intellectual disability syndromic and non-syndromic v1.297 SNAPIN Zornitza Stark Gene: snapin has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.297 SNAPIN Zornitza Stark Classified gene: SNAPIN as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.297 SNAPIN Zornitza Stark Gene: snapin has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.296 ZNF865 Sangavi Sivagnanasundram gene: ZNF865 was added
gene: ZNF865 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF865 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF865 were set to 40936200
Phenotypes for gene: ZNF865 were set to ZNF865‑associated neurodevelopmental disorder MONDO:0700092
Review for gene: ZNF865 was set to AMBER
Added comment: PMID: 40936200
18 patients reported with DD, hypotonia and six individuals were reported with some dysmorphic features (frontal bossing, a broad nasal bridge, hypertelorism, and low-set ears)
All 18 individuals were reported with de novo truncating variants in ZNF865. All variants were rare/absent in gnomAD v4.1.

The mechanism of disease for this gene is unknown. No pathogenic SNVs have been reported in ClinVar at this stage however there are reports of VUS’s and pathogenic CNVs.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.296 SNAPIN Lucy Spencer gene: SNAPIN was added
gene: SNAPIN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNAPIN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNAPIN were set to 40930097; 26539891
Phenotypes for gene: SNAPIN were set to Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related
Review for gene: SNAPIN was set to GREEN
Added comment: PMID: 40930097 6 patients from 5 families with neuroanatomical, craniofacial, and skeletal anomalies on prenatal ultrasound/MRI, all homozygous for variants in SNAPIN. 2 stopgain, 1 canonical splice, 5 missense. common phenotypes: ventriculomegaly 5/6, cerebellar hypoplasia/atrophy 5/6, clubfeet 4/6, corpus callosum agenesis 4/6, flexion contractures 4/6, microcephaly 3/6, micrognathia/retrognathia 4/6. The patients with the nonsense or splice variants did not survive the perinatal period, while those with missense survived into early childhood.

This paper also mentions a 7th patient reported in PMID: 26539891, who has ID, microcephaly, cortical atrophy, bulbar and cerebellar hypoplasia, sensorineural polyneuropathy, and hypotonia. They are homozygous for a missense variant Asn55Tyr. Of note, the other paper report this as Arg55Trp and one of their patients also has this variant, based off the transcript information provided in both papers Arg55Trp is correct.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.296 SKOR2 Zornitza Stark Marked gene: SKOR2 as ready
Intellectual disability syndromic and non-syndromic v1.296 SKOR2 Zornitza Stark Gene: skor2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.296 SKOR2 Zornitza Stark Classified gene: SKOR2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.296 SKOR2 Zornitza Stark Gene: skor2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.295 SKOR2 Zornitza Stark gene: SKOR2 was added
gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600
Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516
Review for gene: SKOR2 was set to GREEN
Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model:
PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous).

PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant.

PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.294 PSMB1 Zornitza Stark Phenotypes for gene: PSMB1 were changed from Intellectual disability; microcephaly to Neurodevelopmental disorder MONDO:0700092, PSMB1-related
Intellectual disability syndromic and non-syndromic v1.293 PSMB1 Zornitza Stark edited their review of gene: PSMB1: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, PSMB1-related
Intellectual disability syndromic and non-syndromic v1.293 GBX1 Zornitza Stark Marked gene: GBX1 as ready
Intellectual disability syndromic and non-syndromic v1.293 GBX1 Zornitza Stark Gene: gbx1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.293 GBX1 Zornitza Stark gene: GBX1 was added
gene: GBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GBX1 were set to 40519143
Phenotypes for gene: GBX1 were set to Neurodevelopmental disorder, MONDO:0700092, GBX1-related
Review for gene: GBX1 was set to RED
Added comment: Single individual with de novo LoF variant with DD and focal epilepsy. Zebrafish model had abnormal morphology of the interocular area. Furthermore, the zebrafish larvae exhibited an increased susceptibility to neurophysiological abnormalities associated with epileptiform activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.292 MTERF3 Zornitza Stark Marked gene: MTERF3 as ready
Intellectual disability syndromic and non-syndromic v1.292 MTERF3 Zornitza Stark Gene: mterf3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.292 MTERF3 Zornitza Stark Classified gene: MTERF3 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.292 MTERF3 Zornitza Stark Gene: mterf3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.291 MTERF3 Zornitza Stark gene: MTERF3 was added
gene: MTERF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTERF3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MTERF3 were set to 40543543
Phenotypes for gene: MTERF3 were set to Mitochondrial disease (MONDO:0044970), MTERF3-related
Review for gene: MTERF3 was set to AMBER
Added comment: Two individuals reported from unrelated families, presenting with DD/ID, intermittent hypoglycaemia and metabolic acidosis. Genetic testing identified compound heterozygous variants c.635dup p.(Asn212Lysfs*7) and c.1055C > T p.(Pro352Leu) in Patient 1, and a homozygous variant c.943A > Gp.(Met315Val) in Patient 2. Patient's fibroblasts and MTERF3 knockdown cells showed impaired mitochondrial respiration and reduced levels of OXPHOS complexes I, III, and IV. Transcription of MT-ND5, ND6, COII, and COIII was reduced, while other mitochondrial genes were upregulated. Wild-type MTERF3 expression restored these defects, but the variant Pro352Leu from patient failed to rescue mitochondrial dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.290 ATP5A1 Zornitza Stark Tag new gene name tag was added to gene: ATP5A1.
Intellectual disability syndromic and non-syndromic v1.290 ATP5A1 Zornitza Stark Marked gene: ATP5A1 as ready
Intellectual disability syndromic and non-syndromic v1.290 ATP5A1 Zornitza Stark Gene: atp5a1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.290 ATP5A1 Zornitza Stark Classified gene: ATP5A1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.290 ATP5A1 Zornitza Stark Gene: atp5a1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.289 ATP5A1 Zornitza Stark gene: ATP5A1 was added
gene: ATP5A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP5A1 were set to 34483339; 34954817; 40859057
Phenotypes for gene: ATP5A1 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD
Review for gene: ATP5A1 was set to GREEN
Added comment: At least 12 individuals reported with de novo missense variants in this gene, several recurrent.

PMIDs: 34483339, 34954817: 6xde novo patients 4 with Arg207His, 1 Arg182Gln 1 Ser346Phe. All Arg207His patients were neonates with failure to thrive, hyperammonemia, lactic acidosis, and respiratory defects in fibroblasts, major symptoms remitted with treatment by late infancy, and at age 14mo to 3yrs growth and development were normal. Other 2 patients are 17yo with ID, ataxia, spastic paraparesis and dystonia, and a 12yo with psychomotor retardation, spastic tetraparesis, generalised dystonia, absent speech, swallowing problems, and increased blood lactate concentrations.

And an internal VCGS patient Arg182Gln (variant also seen in a different patient above) with ID, muscular hypotonia, clinodactyly of the 5th finger, and dysmorphic facial features, proteomics showed decreased ATP5F1A and a complex V deficiency. There is also an alternative change at this residue in the DECIPHER cohort Arg182Pro de novo in an individual with a neurodevelopmental disorder.

PMID: 40672495: 6x de novo individuals - 4 variants p.Arg182Gln, p.Ser346Phe, p.Pro331Leu, and p.Leu109Ser - with complex but overlapping neurological phenotypes including developmental delays, intellectual disability, pyramidal tract dysfunction, and dystonia.

In vivo functional studies in C. elegans were performed for three of the variants, showing growth defects and disruption of mitochondrial function (measured by mitochondrial stress). Authors suggest a dominant negative mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.288 XPO1 Zornitza Stark Marked gene: XPO1 as ready
Intellectual disability syndromic and non-syndromic v1.288 XPO1 Zornitza Stark Gene: xpo1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.288 XPO1 Zornitza Stark Classified gene: XPO1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.288 XPO1 Zornitza Stark Gene: xpo1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.287 SCN3B Zornitza Stark Marked gene: SCN3B as ready
Intellectual disability syndromic and non-syndromic v1.287 SCN3B Zornitza Stark Gene: scn3b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.287 SCN3B Zornitza Stark Classified gene: SCN3B as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.287 SCN3B Zornitza Stark Gene: scn3b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.286 UPF1 Zornitza Stark Classified gene: UPF1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.286 UPF1 Zornitza Stark Gene: upf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.285 UPF1 Zornitza Stark edited their review of gene: UPF1: Added comment: Additional reports identified:

PMID:28135719 (2017) reported four unrelated patients with de novo heterozygous missense variants in UPF1 gene from the Deciphering Developmental Disorders Study cohort, for which no detailed phenotypic information was available in the publication. Three patients were reported with global developmental delay (mild in one) and the fourth patient was reported with neurodevelopmental delay as one of the presenting phenotypes in the Decipher database (https://www.deciphergenomics.org/gene/UPF1/patient-overlap/snvs)

PMID:28539120 (2017) reported a patient with significant intellectual disability (ID) and gross motor delay and with a heterozygous likely pathogenic variant in UPF1 gene (c.1576_1577delinsAA/ p.Ala526Asn). However, this patient also harboured a heterozygous likely pathogenic variant in SQSTM1 gene. As reviewed below by Ivone Leong, the authors suggested that it is plausible that the haploinsufficiency of SQSTM1 may have caused neurofunctional defects, which the haploinsufficiency of UPF1 may have exacerbated.

PMID:39571789 (2024) reported two unrelated paediatric patients with intellectual disabilities, frontal bossing, hypertelorism, high frontal hairline, and thin upper lip. They both had language and motor delays and were identified with de novo heterozygous variants in UPF1 gene (c.949_951del/ p.Asp317del & c.1984G>A/ p.Asp662Asn). The p.Asp662Asn variant has also been previously reported in a patient from PMID:28135719.

PMID:39993774 (2025) reported a 17‐year‐old male patient with moderate intellectual disability, atypical autism, ADHD, and aggressivity. He was identified with a de novo missense variant in UPF1 gene - c.1576G>A/ p.Ala526Thr.; Changed rating: GREEN; Changed publications: 33057194, 28135719, 28539120, 39571789, 39993774; Changed phenotypes: neurodevelopmental disorder, MONDO:0700092, UPF1-related
Intellectual disability syndromic and non-syndromic v1.285 COMMD9 Krithika Murali Marked gene: COMMD9 as ready
Intellectual disability syndromic and non-syndromic v1.285 COMMD9 Krithika Murali Gene: commd9 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.285 COMMD9 Krithika Murali gene: COMMD9 was added
gene: COMMD9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD9 were set to PMID: 40601774
Phenotypes for gene: COMMD9 were set to Neurodevelopmental disorder, MONDO:0700092, COMMD9-related
Review for gene: COMMD9 was set to RED
Added comment: PMID: 40601774 report a cohort ascertained through GeneMatcher with phenotypic features overlapping with Ritscher-Schinzel syndrome.

Homozygous fs variant in COMMD9 [NM_014186.3:c.208_209del, p.Leu70Glyfs*5] identified in a 4 yo M with dev delay, dysmorphism, skeletal changes including brachydactyly and radioulnar dysostosis, hypotonia, MRI-B anomalies - dysgyria, dilated
lateral ventricles, deep white matter periventricular demyelination, thin corpus callosum, cerebellar vermis hypoplasia and malrotation.

Consanguineous parents confirmed to be heterozygous carriers. No information provided regarding segregation of these variants in unaffected siblings.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.284 TBCB Krithika Murali Marked gene: TBCB as ready
Intellectual disability syndromic and non-syndromic v1.284 TBCB Krithika Murali Gene: tbcb has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.284 TBCB Krithika Murali Classified gene: TBCB as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.284 TBCB Krithika Murali Gene: tbcb has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.283 TBCB Krithika Murali gene: TBCB was added
gene: TBCB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBCB were set to PMID: 40856104
Phenotypes for gene: TBCB were set to Neurodevelopmental disorder, MONDO:0700092, TBCB-related
Review for gene: TBCB was set to AMBER
Added comment: PMID: 40856104 Bratman, S. et al 2025 (Genetics in Medicine) report 10 individuals from 8 unrelated families of Ashkenazi Jewish descent with a homozygous missense founder variant in TBCB (c.589T>A, p.Tyr197Asn) identified through exome sequencing. This variant is present at 1.3% carrier frequency in the AJ population in gnomAD v4 with 0 homozygotes. Variant is reasonably well-conserved, REVEL 0.9 and in the Cap-Gly domain. No other homozygous missense variants in this region in gnomAD v4 and homozygous variants rare, overall.

Phenotypic features included:
- Motor/speech delays in infancy (almost all)
- ASD (8/10)
- ADHD (5/10)
- Mild ID - formal cognitive evaluation (5/8).
- Spastic paraparesis in late childhood (9-12y) with slowly progressive gait difficulties and lower limb spasticity. Urinary abnormalities were not reported.
- Brain MRI was performed on five individuals - three displayed a thin corpus callosum,
and two had decreased white matter.

No prenatal features reported.

Supportive Drosophilia models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.282 COMMD4 Zornitza Stark Marked gene: COMMD4 as ready
Intellectual disability syndromic and non-syndromic v1.282 COMMD4 Zornitza Stark Gene: commd4 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.282 COMMD4 Zornitza Stark Classified gene: COMMD4 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.282 COMMD4 Zornitza Stark Gene: commd4 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.281 COMMD4 Lucy Spencer gene: COMMD4 was added
gene: COMMD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD4 were set to 40601774
Phenotypes for gene: COMMD4 were set to Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related
Review for gene: COMMD4 was set to RED
Added comment: PMID: 40601774 3 siblings with Ritscher-Schinzel syndrome and a homozygous missense in COMMD4 NM_017828.5:c.122T>G; p.Leu41Arg. All three individuals died in infancy and the authors suggest there could be a dual diagnosis to explain the severity.

This variant was expressed in a H4 neuroglioma cell line with COMMD4 knocked out, and showed an enhanced degradative turnover compared to WT when treated with cyclohexamide. Western blot in HEK293T cells showed a decrease in the steady-state abundance of COMMD4.

Knock out of COMMD4 protein leads to destabilization of the Commander complex.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.281 TMEM184B Zornitza Stark Marked gene: TMEM184B as ready
Intellectual disability syndromic and non-syndromic v1.281 TMEM184B Zornitza Stark Gene: tmem184b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.281 TMEM184B Zornitza Stark Classified gene: TMEM184B as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.281 TMEM184B Zornitza Stark Gene: tmem184b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.280 TMEM184B Lucy Spencer gene: TMEM184B was added
gene: TMEM184B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM184B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TMEM184B were set to 39006436
Phenotypes for gene: TMEM184B were set to Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related
Review for gene: TMEM184B was set to GREEN
Added comment: A cohort of 6 patients with developmental delay (5/6), corpus callosum hypoplasia (4/6), microcephaly (1/6), seizures (3/6), and ID (2/6). 2 patients also had gastrointestinal motility disruption. All 6 have de novo variants in TMEM184B, 5 missense 1 canonical splice. 1 of the missense variants has 35 hets in gnomad but the rest are absent. The authors also say they are aware of a 7th patient with overlapping features by personal communication.

A knockout zebrafish model showed a dose dependent reduction in head size and body length in larvae. Knock-in of 2 of the missense variants also showed head size and body length reduction, but the other missense did not. However the other three missense failed to rescue the phenotype of a knockout zebrafish while WT and a negative control did. The authors suggest the first 2 variants are dominant negative while the latter three and loss of function.

The splice variant was shown to cause exon 7 skipping which is out of frame.

Transfection of the missense and splice variants in HEK293T cells showed that all but 1 had reduced TMEM184B protein levels.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.280 POLR3D Zornitza Stark Marked gene: POLR3D as ready
Intellectual disability syndromic and non-syndromic v1.280 POLR3D Zornitza Stark Gene: polr3d has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.280 POLR3D Zornitza Stark gene: POLR3D was added
gene: POLR3D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR3D was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3D were set to 37915380
Phenotypes for gene: POLR3D were set to Leukodystrophy, MONDO:0019046, POLR3D-related
Review for gene: POLR3D was set to RED
Added comment: PMID 37915380: single individual with compound het variants in POLR3D and childhood onset leukodystrophy manifesting as DD/ID.

Additional neurological features included cerebellar signs (e.g., dysarthria, ataxia, and intention tremor) and dysphagia, while non-neurological features included hypodontia, hypogonadotropic hypogonadism, and dysmorphic facial features. Her MRI was notable for diffuse hypomyelination with myelin preservation of early myelinating structures, characteristic of POLR3-related leukodystrophy. Exome sequencing revealed the biallelic variants in POLR3D, a missense variant (c.541C > T, p.P181S) and an intronic splice site variant (c.656-6G > A, p.?). Functional studies of the patient's fibroblasts demonstrated significantly decreased RNA-level expression of POLR3D, along with reduced expression of other Pol III subunit genes. Notably, Pol III transcription was also shown to be aberrant, with a significant decrease in 7SK RNA and several distinct tRNA genes analyzed. Affinity purification coupled to mass spectrometry of the POLR3D p.P181S variant showed normal assembly of Pol III subunits yet altered interaction of Pol III with the PAQosome chaperone complex, indicating the missense variant is likely to alter complex maturation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.279 HS6ST2 Bryony Thompson Marked gene: HS6ST2 as ready
Intellectual disability syndromic and non-syndromic v1.279 HS6ST2 Bryony Thompson Gene: hs6st2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.279 HS6ST2 Bryony Thompson Classified gene: HS6ST2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.279 HS6ST2 Bryony Thompson Gene: hs6st2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.278 HS6ST2 Bryony Thompson gene: HS6ST2 was added
gene: HS6ST2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HS6ST2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: HS6ST2 were set to 40686562; 30471091; 36993824; 38015989
Phenotypes for gene: HS6ST2 were set to X-linked syndromic intellectual disability MONDO:0020119
Review for gene: HS6ST2 was set to GREEN
Added comment: 4 males with a neurodevelopmental phenotype from 3 families (1 set monozygotic twins) hemizygous for rare missense variants and a supporting mouse model.
PMID: 40686562 - a Chinese male child with a syndromic neurodevelopmental phenotype hemizygous c.764C>A (p.Pro255Glu) and in vitro assays showing the variant alters function. Parents were unaffected and variant was maternally inherited.

PMID: 38015989 - knockout mouse model impairs dendritic spines of hippocampal neurons, and affects memory.

PMID: 36993824 - an Iranian male child with a syndromic neurodevelopmental phenotype hemizygouc.979C>T p.Pro327Ser.

PMID: 30471091 - Italian monozygotic male twins with a syndromic neurodevelopmental phenotype hemizygous c.916G>C (p.G306R - inherited from unaffected mother) and functional assay showing altered enzyme activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.277 CSMD2 Zornitza Stark Deleted their review
Intellectual disability syndromic and non-syndromic v1.277 CSMD2 Zornitza Stark reviewed gene: CSMD2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Focal epilepsy - MONDO:0005384, CSMD2-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.277 TTC1 Zornitza Stark Marked gene: TTC1 as ready
Intellectual disability syndromic and non-syndromic v1.277 TTC1 Zornitza Stark Gene: ttc1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.277 FSCN1 Zornitza Stark Marked gene: FSCN1 as ready
Intellectual disability syndromic and non-syndromic v1.277 FSCN1 Zornitza Stark Gene: fscn1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.277 FSCN1 Zornitza Stark gene: FSCN1 was added
gene: FSCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FSCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FSCN1 were set to 40874942
Phenotypes for gene: FSCN1 were set to Neurodevelopmental disorder, MONDO:0700092, FSCN1-related
Review for gene: FSCN1 was set to RED
Added comment: Two individuals reported from an Iranian cohort with same missense variant, c.665C>A; p.Ala222Asp plus other circumstantial data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.276 TTC1 Zornitza Stark gene: TTC1 was added
gene: TTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TTC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC1 were set to 40879651
Phenotypes for gene: TTC1 were set to Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related
Review for gene: TTC1 was set to RED
Added comment: Four individuals from two families reported with the same homozygous missense variant, NM_003314.3: c.784 T > G, p.Phe262Val. No other supporting data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.275 MAEA Zornitza Stark changed review comment from: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands.
Sources: Literature; to: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands. Amber rating as scant detail on the affected individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.275 MAEA Zornitza Stark Marked gene: MAEA as ready
Intellectual disability syndromic and non-syndromic v1.275 MAEA Zornitza Stark Gene: maea has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.275 MAEA Zornitza Stark Classified gene: MAEA as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.275 MAEA Zornitza Stark Gene: maea has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.274 MAEA Zornitza Stark gene: MAEA was added
gene: MAEA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAEA were set to 40880485
Phenotypes for gene: MAEA were set to Neurodevelopmental disorder, MONDO:0700092, MAEA-related
Review for gene: MAEA was set to AMBER
Added comment: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.273 CSMD2 Krithika Murali Marked gene: CSMD2 as ready
Intellectual disability syndromic and non-syndromic v1.273 CSMD2 Krithika Murali Gene: csmd2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.273 CSMD2 Krithika Murali changed review comment from: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature; to: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. In addition, no information about unaffected/affected siblings and segregation testing has been provided

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.273 CDK6 Zornitza Stark Publications for gene: CDK6 were set to 23918663
Intellectual disability syndromic and non-syndromic v1.272 CDK6 Zornitza Stark edited their review of gene: CDK6: Added comment: Second family reported, but same homozygous missense variant, likely founder.; Changed publications: 23918663, 40801391
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.271 NSF Zornitza Stark Classified gene: NSF as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.271 NSF Zornitza Stark Gene: nsf has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.270 NSF Zornitza Stark edited their review of gene: NSF: Added comment: Personal communication of additional cases with de novo variants and epilepsy; internal case at VCGS.; Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v1.270 HIRA Zornitza Stark Phenotypes for gene: HIRA were changed from Neurodevelopmental disorder to Neurodevelopmental disorder, MONDO:0700092, HIRA-related
Intellectual disability syndromic and non-syndromic v1.269 RNF2 Zornitza Stark Classified gene: RNF2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.269 RNF2 Zornitza Stark Gene: rnf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.268 RNF2 Zornitza Stark edited their review of gene: RNF2: Added comment: PMID 40831499 is a preprint which identifies additional individuals with de novo variants. p.S82R is recurrent. Functional data to support gene-disease association.; Changed rating: GREEN; Changed publications: 33864376, 40831499
Intellectual disability syndromic and non-syndromic v1.268 CCDC93 Zornitza Stark Marked gene: CCDC93 as ready
Intellectual disability syndromic and non-syndromic v1.268 CCDC93 Zornitza Stark Gene: ccdc93 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.268 CCDC93 Zornitza Stark Classified gene: CCDC93 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.268 CCDC93 Zornitza Stark Gene: ccdc93 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.267 CCDC93 Zornitza Stark reviewed gene: CCDC93: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.267 WDR18 Krithika Murali Marked gene: WDR18 as ready
Intellectual disability syndromic and non-syndromic v1.267 WDR18 Krithika Murali Gene: wdr18 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.267 WDR18 Krithika Murali gene: WDR18 was added
gene: WDR18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR18 were set to PMID: 40677927
Phenotypes for gene: WDR18 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: WDR18 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.266 MIS18BP1 Krithika Murali Marked gene: MIS18BP1 as ready
Intellectual disability syndromic and non-syndromic v1.266 MIS18BP1 Krithika Murali Gene: mis18bp1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.266 MIS18BP1 Krithika Murali gene: MIS18BP1 was added
gene: MIS18BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MIS18BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MIS18BP1 were set to PMID: 40677927
Phenotypes for gene: MIS18BP1 were set to Cornelia de Lange syndrome (MONDO:0016033)
Review for gene: MIS18BP1 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.265 HYPK Zornitza Stark Marked gene: HYPK as ready
Intellectual disability syndromic and non-syndromic v1.265 HYPK Zornitza Stark Gene: hypk has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.265 HYPK Zornitza Stark gene: HYPK was added
gene: HYPK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HYPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HYPK were set to Clinical Genetics Early View
Phenotypes for gene: HYPK were set to Neurodevelopmental disorder, MONDO:0700092, HYPK-related
Review for gene: HYPK was set to RED
Added comment: Single case report - Patel, R. et al 2025 Clinical Genetics Early View

Male proband with developmental delay, autism and facial dysmorphism with a de novo missense HYPK variant (p. R70I). Variant-specific biochemical analyses demonstrates enhanced inhibitory activity of HYPK on NatA-mediated N-terminal protein acetylation.

GestaltMatcher analysis indicates that the proband's facial phenotype closely resembles Ogden syndrome (NAA10) and some resemblance to NAA15-NDS - both associated genes are also involved in the N-terminal acetylation pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.264 DDX39A Zornitza Stark Marked gene: DDX39A as ready
Intellectual disability syndromic and non-syndromic v1.264 DDX39A Zornitza Stark Gene: ddx39a has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.264 DDX39A Zornitza Stark gene: DDX39A was added
gene: DDX39A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX39A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX39A were set to 40726340
Phenotypes for gene: DDX39A were set to Neurodevelopmental disorder, MONDO:0700092, DDX39A-related
Review for gene: DDX39A was set to RED
Added comment: PMID: 40726340 Ahmed et al 2025 (Clinical Genetics) report a 7 month old F with GDD, seizures, microcephaly, hypotonia, corpus callosum thinning and homozygous missense variant (p.Lys137Gln) in DDX39A on trio WES with both non-consanguineous parents confirmed to be heterozygous carriers. DDX39A is involved in mRNA splicing and export. Patient-derived fibroblast studies showed that mutant protein resulted in aberrant nuclear clumping and failure to interact with the TREX complex.

Of note, closely-related paralogue DDX39B is also a component of the TREX complex and has a definitive monoallelic association with neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.263 ARID3A Zornitza Stark Marked gene: ARID3A as ready
Intellectual disability syndromic and non-syndromic v1.263 ARID3A Zornitza Stark Gene: arid3a has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.263 ARID3A Zornitza Stark gene: ARID3A was added
gene: ARID3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARID3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARID3A were set to 40677927
Phenotypes for gene: ARID3A were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: ARID3A was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.262 PIK3C3 Zornitza Stark Marked gene: PIK3C3 as ready
Intellectual disability syndromic and non-syndromic v1.262 PIK3C3 Zornitza Stark Gene: pik3c3 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.262 PIK3C3 Zornitza Stark gene: PIK3C3 was added
gene: PIK3C3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIK3C3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PIK3C3 were set to 40677927
Phenotypes for gene: PIK3C3 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: PIK3C3 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.261 MED29 Zornitza Stark Marked gene: MED29 as ready
Intellectual disability syndromic and non-syndromic v1.261 MED29 Zornitza Stark Gene: med29 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.261 MED29 Zornitza Stark Classified gene: MED29 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.261 MED29 Zornitza Stark Gene: med29 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark Marked gene: GLYAT as ready
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark Gene: glyat has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark changed review comment from: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature; to: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of oedema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark gene: GLYAT was added
gene: GLYAT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GLYAT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLYAT were set to 40747359
Phenotypes for gene: GLYAT were set to Neurodevelopmental disorder, MONDO:0700092, GLYAT-related
Review for gene: GLYAT was set to RED
Added comment: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.259 C1orf109 Zornitza Stark Marked gene: C1orf109 as ready
Intellectual disability syndromic and non-syndromic v1.259 C1orf109 Zornitza Stark Gene: c1orf109 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.259 C1orf109 Zornitza Stark Classified gene: C1orf109 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.259 C1orf109 Zornitza Stark Gene: c1orf109 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.258 C1orf109 Zornitza Stark gene: C1orf109 was added
gene: C1orf109 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C1orf109 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C1orf109 were set to 40760247
Phenotypes for gene: C1orf109 were set to Neurodevelopmental disorder, MONDO:0700092, C1orf109-related
Review for gene: C1orf109 was set to GREEN
Added comment: Cohort of 11 unrelated families, encompassing 18 individuals with bi-allelic variants in C1orf109, 17 liveborn. Affected individuals presented with moderate-to-severe or severe global developmental delay/intellectual disability (17 of 17) and never achieved developmental milestones. Microcephaly and seizures were other common features.

Reduced ribosome activity demonstrated during early brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.257 ASAP2 Zornitza Stark Marked gene: ASAP2 as ready
Intellectual disability syndromic and non-syndromic v1.257 ASAP2 Zornitza Stark Gene: asap2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.257 ASAP2 Zornitza Stark Classified gene: ASAP2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.257 ASAP2 Zornitza Stark Gene: asap2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.256 ASAP2 Zornitza Stark gene: ASAP2 was added
gene: ASAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ASAP2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ASAP2 were set to 40770811; 28191890; 33057194; 35982160
Phenotypes for gene: ASAP2 were set to Neurodevelopmental disorder, MONDO:0700092, ASAP2-related
Review for gene: ASAP2 was set to AMBER
Added comment: One individual reported with compound het missense variants. Identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811. Another individual with biallelic variants identified in the DDD cohort. Several others found with de novo variants through retrospective literature review of large cohort studies reporting multiple gene candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of ASAP2 in brain development. Rated AMBER as only two families with bi-allelic variants and minimal information on the cases with mono-allelic variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.255 RTF1 Zornitza Stark changed review comment from: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data.
Sources: Literature; to: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of RTF1 in brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.255 RTF1 Zornitza Stark Marked gene: RTF1 as ready
Intellectual disability syndromic and non-syndromic v1.255 RTF1 Zornitza Stark Gene: rtf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.255 RTF1 Zornitza Stark Classified gene: RTF1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.255 RTF1 Zornitza Stark Gene: rtf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.254 RTF1 Zornitza Stark gene: RTF1 was added
gene: RTF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RTF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RTF1 were set to 40770811; 33057194; 35982160; 31038196
Phenotypes for gene: RTF1 were set to Neurodevelopmental disorder, MONDO:0700092, RTF1-related
Review for gene: RTF1 was set to GREEN
Added comment: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 MED29 Sarah Milton gene: MED29 was added
gene: MED29 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED29 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED29 were set to PMID: 40745490
Phenotypes for gene: MED29 were set to Pontocerebellar hypoplasia, MONDO:0020135, MED29-related
Review for gene: MED29 was set to AMBER
Added comment: MED29 encodes part of the mediator (MED) complex which has role in RNA polymerase II (Poll II) gene transcription.

PMID: 40745490 describes 2 siblings from one consanguineous family affected with pontocerebellar hypoplasia, profound GDD, severe microcephaly, cataracts and variable seizures.
Both shared the same homozygous missense variant with presumed LOF mechanism.

No homozygous LOF variants in gnomAD v4.

Extensive functional studies performed with morpholino knockdown of MED29 having marked reduction of GABAergic neurons and abnormal touch response.
Studies of hippocampal neurons from mice with knockdown MED29 showed impaired development.
Mouse embryos that had knockdown of MED29 during development demonstrated abnormal neuronal migration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 CCDC93 Sarah Milton gene: CCDC93 was added
gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC93 were set to PMID: 40601774
Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related
Review for gene: CCDC93 was set to AMBER
Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins.

PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts.
Variants were missense and nonsense.

No homozygous LOF variants in gnomAD v4.

Some supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 TRIM74 Zornitza Stark Marked gene: TRIM74 as ready
Intellectual disability syndromic and non-syndromic v1.253 TRIM74 Zornitza Stark Gene: trim74 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.253 TRIM74 Zornitza Stark Classified gene: TRIM74 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.253 TRIM74 Zornitza Stark Gene: trim74 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.252 ZNF496 Zornitza Stark Marked gene: ZNF496 as ready
Intellectual disability syndromic and non-syndromic v1.252 ZNF496 Zornitza Stark Gene: znf496 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.252 SCN3B Sarah Milton gene: SCN3B was added
gene: SCN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SCN3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCN3B were set to PMID: 40879121
Phenotypes for gene: SCN3B were set to Neurodevelopmental disorder, MONDO:0700092, SCN3B-related
Review for gene: SCN3B was set to AMBER
Added comment: SCN3B Encodes b3 auxiliary subunit of the sodium channel.

4 affected individuals from 2 consanguineous families reported in PMID: 40879121 with biallelic variants in this gene with neurodevelopmental phenotypes. Presentation included GDD, ID of variable severity, autism, seizures.
One variant was nonsense, one canonical splice site in the penultimate exon.

No homozygous LOF variants in gnomAD v4.

Some functional studies performed with loss of function of channel demonstrated for one variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 XPO1 Sangavi Sivagnanasundram gene: XPO1 was added
gene: XPO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: XPO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: XPO1 were set to 40819229
Phenotypes for gene: XPO1 were set to Neurodevelopmental disorder, XPO1-related, MONDO:0700092
Review for gene: XPO1 was set to GREEN
Added comment: Established gene-disease association
22 probands with de novo XPO1 variants presenting with phenotypes associated with NDD (DD, ID, motor delay, behavioral problems, facial dysmorphisms, microcephaly and organ anomalies) along with supportive Drosophila knockdown model reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 ZNF496 Zornitza Stark gene: ZNF496 was added
gene: ZNF496 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF496 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF496 were set to 40806714
Phenotypes for gene: ZNF496 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF496-related
Review for gene: ZNF496 was set to RED
Added comment: Single individual with NDD and de novo LoF variant, no other supportive data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.251 TRIM74 Sangavi Sivagnanasundram gene: TRIM74 was added
gene: TRIM74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRIM74 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRIM74 were set to 40735933
Phenotypes for gene: TRIM74 were set to Neurodevelopmental disorder, TRIM74-related, MONDO:0700092
Review for gene: TRIM74 was set to RED
Added comment: Only one reported case with DD.

PMID: 40735933
5yr M presenting from non consanguineous parents with global developmental delay, hypotonia, seizures, and diffuse cerebral atrophy with mega cisterna magna. Parents of the proband were found to be carriers of the variant.
Homozygous variant c.562C > T (p.Pro121Leu) - NFE AF 0.0188% - rare enough for AR

Supportive functional analysis on human fibroblast showed protein function disruption leading to protein aggregation, proteostasis collapse, and cell death.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.251 BAZ2B Zornitza Stark Phenotypes for gene: BAZ2B were changed from Intellectual disability; autism to Neurodevelopmental disorder, MONDO:0700092, BAZ2B-related
Intellectual disability syndromic and non-syndromic v1.250 BAZ2B Zornitza Stark edited their review of gene: BAZ2B: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, BAZ2B-related
Intellectual disability syndromic and non-syndromic v1.250 TP63 Zornitza Stark Phenotypes for gene: TP63 were changed from ADULT syndrome, OMIM #103285; Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome 3, OMIM #604292; Hay-Wells syndrome, OMIM #106260; Limb-mammary syndrome, OMIM #603543; Orofacial cleft 8, OMIM #618149; Rapp-Hodgkin syndrome, OMIM #129400; Split-hand/foot malformation 4, OMIM #605289 to TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001
Intellectual disability syndromic and non-syndromic v1.249 TP63 Zornitza Stark reviewed gene: TP63: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.249 ARNTL Zornitza Stark Marked gene: ARNTL as ready
Intellectual disability syndromic and non-syndromic v1.249 ARNTL Zornitza Stark Gene: arntl has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.249 ARNTL Zornitza Stark Classified gene: ARNTL as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.249 ARNTL Zornitza Stark Gene: arntl has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.248 ARNTL Zornitza Stark Tag new gene name tag was added to gene: ARNTL.
Intellectual disability syndromic and non-syndromic v1.248 TMPRSS7 Zornitza Stark gene: TMPRSS7 was added
gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMPRSS7 were set to 40796295
Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related
Review for gene: TMPRSS7 was set to RED
Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.247 PPP1R2 Zornitza Stark Marked gene: PPP1R2 as ready
Intellectual disability syndromic and non-syndromic v1.247 PPP1R2 Zornitza Stark Gene: ppp1r2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.247 PPP1R2 Zornitza Stark gene: PPP1R2 was added
gene: PPP1R2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP1R2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPP1R2 were set to 40597352; 26558779
Phenotypes for gene: PPP1R2 were set to Neurodevelopmental disorder, PPP1R2-related
Review for gene: PPP1R2 was set to RED
Added comment: Single individual reported with homozygous splicing variant c.403 + 3 A >T. Abnormal splicing demonstrated but leaky. Clinical features included pre and postnatal growth restriction, ventricular septal defect, dysmorphic features (proptosis, long eye lashes, thick eyebrows, low-set ears), microcephaly, sensorineural hearing loss, cortical cataracts, retinal defects, intellectual disability with limited speech, and autism spectrum disorder. Note mouse model is embryonically lethal, leading the authors to speculate survival may be due to fraction of normally spliced transcripts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.246 BORCS5 Zornitza Stark Marked gene: BORCS5 as ready
Intellectual disability syndromic and non-syndromic v1.246 BORCS5 Zornitza Stark Gene: borcs5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.246 BORCS5 Zornitza Stark Classified gene: BORCS5 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.246 BORCS5 Zornitza Stark Gene: borcs5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.245 BORCS5 Zornitza Stark gene: BORCS5 was added
gene: BORCS5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BORCS5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BORCS5 were set to 40385417
Phenotypes for gene: BORCS5 were set to Lysosomal storage disease, MONDO:0002561, BORCS5-related
Review for gene: BORCS5 was set to GREEN
Added comment: preprint PMID 40385417, describing 12 individuals from 7 families with a spectrum of abnormalities (osteopetrosis not mentioned), suggestive of lysosomal disorder.

Homozygous loss-of-function variants presented with prenatally lethal arthrogryposis multiplex congenita, brain malformations, and neuropathological evidence of diffuse neuroaxonal dystrophy. Individuals with missense variants presented differently, with microcephaly, developmental epileptic encephalopathy, intellectual disability, optic atrophy, spasticity, and progressive movement disorders. In this group, brain MRI showed diffuse hypomyelination and progressive global cerebral atrophy, consistent with neurodegeneration. Borcs5 knockout in zebrafish exhibited microcephaly, motor deficits, and seizures, mirroring the patients' clinical presentation. At the cellular level, BORCS5 loss-of-function but not missense variants, resulted in lower protein expression and impaired BORC assembly, paralleled by perinuclear lysosomal clustering. However, both loss-of-function and missense BORCS5 variants were associated with reduced total lysosomal proteolysis, reduced activity of the lysosomal hydrolases glucocerebrosidase and cathepsin B, and presence of multilamellar bodies, indicating lysosomal dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.244 ARNTL Sarah Milton gene: ARNTL was added
gene: ARNTL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARNTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARNTL were set to PMID: 40720646
Phenotypes for gene: ARNTL were set to Neurodevelopmental disorder, MONDO:0700092, BMAL1-related
Review for gene: ARNTL was set to GREEN
Added comment: Note has new HGNC approved name - BMAL1

BMAL1 encodes a transcription factor that plays a role in the mammalian molecular clock, binds to promoter of PER and CRY family genes to promote transcription. Other circardian genes have sleep phase disorder assoc but not neurodevelopmental phenotype.

10 affected individuals described in PMID: 40455867 with variable developmental delay/ID from average IQ to severe ID, seizures in 50%, autism, some had sleep disturbance and marfanoid habitus.
Variants were LOF & missense and very rare or absent in gnomAD v4.
5 confirmed de novo, 2 confirmed inherited (one from apparently unaffected mother).

Functional studies using luciferase reporter assay of downstream target PER showed reduced luminescence for most variants with presumed LOF mechanism. One variant p.(Ile201Thr) led to increased luminescence with author's postulating GOF mechanism for this variant. Drosophilia studies for 2 of the variants demonstrated altered circadian rhythm. ?needs more studies to further define mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.244 MAN2A2 Zornitza Stark Publications for gene: MAN2A2 were set to 36357165
Intellectual disability syndromic and non-syndromic v1.243 MAN2A2 Zornitza Stark Classified gene: MAN2A2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.243 MAN2A2 Zornitza Stark Gene: man2a2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.242 MAN2A2 Zornitza Stark edited their review of gene: MAN2A2: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.242 MAN2A2 Zornitza Stark edited their review of gene: MAN2A2: Added comment: PMID 40628855: second unrelated individual reported, presenting with ID/autism and with bi-allelic variants, one missense and the other LoF. Abnormal glycosylation patterns observed consistent with CDG.; Changed publications: 36357165, 40628855
Intellectual disability syndromic and non-syndromic v1.242 CCDC186 Zornitza Stark Marked gene: CCDC186 as ready
Intellectual disability syndromic and non-syndromic v1.242 CCDC186 Zornitza Stark Gene: ccdc186 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.242 CCDC186 Zornitza Stark Classified gene: CCDC186 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.242 CCDC186 Zornitza Stark Gene: ccdc186 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.241 CCDC186 Zornitza Stark gene: CCDC186 was added
gene: CCDC186 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC186 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC186 were set to 33259146; 37569695; 40633195
Phenotypes for gene: CCDC186 were set to Neurodevelopmental disorder, MONDO:0700092, CCDC186-related
Review for gene: CCDC186 was set to GREEN
Added comment: At least 3 unrelated families reported with bi-allelic LoF variants and a neurodevelopmental phenotype comprising ID and seizures, plus other more variable features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.240 PCLO Zornitza Stark Publications for gene: PCLO were set to 25832664
Intellectual disability syndromic and non-syndromic v1.239 PCLO Zornitza Stark Classified gene: PCLO as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.239 PCLO Zornitza Stark Gene: pclo has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.238 PCLO Zornitza Stark edited their review of gene: PCLO: Added comment: PMID 40661989: additional case report of a Thai patient with PCH and compound het LoF variants in this gene. PMID 32122952: rat model consistent with human phenotype. PMID 30287594: additional family with 5 affected sibs, compound het for LoF variants and PCH. Upgrade to GREEN.; Changed rating: GREEN; Changed publications: 25832664, 40661989, 32122952, 30287594
Intellectual disability syndromic and non-syndromic v1.238 TAF13 Zornitza Stark Phenotypes for gene: TAF13 were changed from Mental retardation, autosomal recessive 60, MIM# 617432 to Intellectual developmental disorder, autosomal recessive 60, MIM# 617432
Intellectual disability syndromic and non-syndromic v1.237 TAF13 Zornitza Stark Publications for gene: TAF13 were set to 28257693
Intellectual disability syndromic and non-syndromic v1.236 TAF13 Zornitza Stark edited their review of gene: TAF13: Changed publications: 28257693, 40679298; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 60, MIM# 617432
Intellectual disability syndromic and non-syndromic v1.236 FAAH2 Zornitza Stark Phenotypes for gene: FAAH2 were changed from Neuropsychiatric disorder to Neurodevelopmental disorder, MONDO:0700092, FAAH2-related
Intellectual disability syndromic and non-syndromic v1.235 FAAH2 Zornitza Stark Publications for gene: FAAH2 were set to 25885783
Intellectual disability syndromic and non-syndromic v1.234 FAAH2 Zornitza Stark edited their review of gene: FAAH2: Added comment: Further case report of novel missense variant in an individual with a neurodevelopmental disorder, no supportive evidence.; Changed publications: 25885783, 40744325; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, FAAH2-related
Intellectual disability syndromic and non-syndromic v1.234 NDC1 Zornitza Stark Phenotypes for gene: NDC1 were changed from triple-A syndrome MONDO:0009279 to Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328
Intellectual disability syndromic and non-syndromic v1.233 NDC1 Zornitza Stark reviewed gene: NDC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.233 SEPHS1 Zornitza Stark Phenotypes for gene: SEPHS1 were changed from Neurodevelopmental disorder, MONDO:0700092, SEPHS1-related to Ververi-Brady syndrome 2, MIM# 621325
Intellectual disability syndromic and non-syndromic v1.232 SEPHS1 Zornitza Stark edited their review of gene: SEPHS1: Changed phenotypes: Ververi-Brady syndrome 2, MIM# 621325
Intellectual disability syndromic and non-syndromic v1.232 TDGF1 Zornitza Stark Phenotypes for gene: TDGF1 were changed from to Congenital nervous system disorder, MONDO:0002320, TDGF1-related
Intellectual disability syndromic and non-syndromic v1.231 TDGF1 Zornitza Stark edited their review of gene: TDGF1: Changed rating: RED; Changed phenotypes: Congenital nervous system disorder, MONDO:0002320, TDGF1-related
Intellectual disability syndromic and non-syndromic v1.231 TCF7L2 Zornitza Stark Phenotypes for gene: TCF7L2 were changed from Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Myopia; Abnormality of skeletal system to Neurodevelopmental disorder, MONDO:0700092, TCF7L2-related
Intellectual disability syndromic and non-syndromic v1.230 TCF7L2 Zornitza Stark edited their review of gene: TCF7L2: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, TCF7L2-related
Intellectual disability syndromic and non-syndromic v1.230 SYP Zornitza Stark Phenotypes for gene: SYP were changed from Mental retardation, X-linked 96 MIM#300802 to Intellectual developmental disorder, X-linked 96, MIM# 300802
Intellectual disability syndromic and non-syndromic v1.229 SYP Zornitza Stark edited their review of gene: SYP: Changed phenotypes: Intellectual developmental disorder, X-linked 96, MIM# 300802
Intellectual disability syndromic and non-syndromic v1.229 SPOP Zornitza Stark Phenotypes for gene: SPOP were changed from Intellectual disability; dysmorphism; microcephaly; macrocephaly to Nabais Sa-de Vries syndrome, type 1 MIM#618828; Nabais Sa-de Vries syndrome, type 2, MIM#618829
Intellectual disability syndromic and non-syndromic v1.228 SPOP Zornitza Stark edited their review of gene: SPOP: Changed phenotypes: Nabais Sa-de Vries syndrome, type 1 MIM#618828, Nabais Sa-de Vries syndrome, type 2, MIM#618829
Intellectual disability syndromic and non-syndromic v1.228 SPOP Zornitza Stark edited their review of gene: SPOP: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, SPOP-related
Intellectual disability syndromic and non-syndromic v1.228 SOBP Zornitza Stark Phenotypes for gene: SOBP were changed from Mental retardation, anterior maxillary protrusion, and strabismus, MIM# 613671 to Impaired intellectual development, anterior maxillary protrusion, and strabismus, MIM# 613671
Intellectual disability syndromic and non-syndromic v1.227 SOBP Zornitza Stark edited their review of gene: SOBP: Changed phenotypes: Impaired intellectual development, anterior maxillary protrusion, and strabismus, MIM# 613671
Intellectual disability syndromic and non-syndromic v1.227 SNX27 Zornitza Stark Phenotypes for gene: SNX27 were changed from intellectual disability; seizures to Neurodevelopmental disorder MONDO:0700092, SNX27-related
Intellectual disability syndromic and non-syndromic v1.226 SNX27 Zornitza Stark edited their review of gene: SNX27: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, SNX27-related
Intellectual disability syndromic and non-syndromic v1.226 SMARCD1 Zornitza Stark Phenotypes for gene: SMARCD1 were changed from no OMIM number yet to Neurodevelopmental disorder MONDO:0700092, SMARCD1-related
Intellectual disability syndromic and non-syndromic v1.225 SMARCD1 Zornitza Stark reviewed gene: SMARCD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder MONDO:0700092, SMARCD1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.225 SMARCA5 Zornitza Stark Phenotypes for gene: SMARCA5 were changed from Neurodevelopmental disorder; microcephaly; dysmorphic features to Neurodevelopmental disorder MONDO:0700092, SMARCA5-related
Intellectual disability syndromic and non-syndromic v1.224 SMARCA5 Zornitza Stark edited their review of gene: SMARCA5: Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, SMARCA5-related
Intellectual disability syndromic and non-syndromic v1.224 SLC6A17 Zornitza Stark Phenotypes for gene: SLC6A17 were changed from Mental retardation, autosomal recessive 48, MIM# 616269 to Intellectual developmental disorder, autosomal recessive 48, MIM# 616269
Intellectual disability syndromic and non-syndromic v1.223 SLC6A17 Zornitza Stark edited their review of gene: SLC6A17: Changed phenotypes: Intellectual developmental disorder, autosomal recessive 48, MIM# 616269
Intellectual disability syndromic and non-syndromic v1.223 YWHAZ Zornitza Stark Phenotypes for gene: YWHAZ were changed from Intellectual disability, MONDO:0001071 to Neurodevelopmental disorder, MONDO:0700092, YWHAZ-related
Intellectual disability syndromic and non-syndromic v1.222 YWHAZ Zornitza Stark Classified gene: YWHAZ as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.222 YWHAZ Zornitza Stark Gene: ywhaz has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.221 YWHAZ Zornitza Stark reviewed gene: YWHAZ: Rating: AMBER; Mode of pathogenicity: None; Publications: 31024343, 35143101, 35501409, 22124272, 26207352; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, YWHAZ-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.221 THRA Zornitza Stark reviewed gene: THRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypothyroidism congenital nongoitrous 6 (MIM 614450); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.221 TBC1D32 Zornitza Stark Marked gene: TBC1D32 as ready
Intellectual disability syndromic and non-syndromic v1.221 TBC1D32 Zornitza Stark Gene: tbc1d32 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.221 TBC1D32 Zornitza Stark Classified gene: TBC1D32 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.221 TBC1D32 Zornitza Stark Gene: tbc1d32 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.220 TBC1D32 Zornitza Stark gene: TBC1D32 was added
gene: TBC1D32 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: TBC1D32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBC1D32 were set to 24285566; 32573025; 32060556; 31130284; 36826837; 40319332
Phenotypes for gene: TBC1D32 were set to Orofacial digital syndrome type IX, MIM#258865
Review for gene: TBC1D32 was set to GREEN
Added comment: Multiple affected individuals reported from unrelated families. Midline brain abnormalities are a feature and DD/ID is variable.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.219 RNU5B-1 Zornitza Stark Phenotypes for gene: RNU5B-1 were changed from Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related to Neurodevelopmental disorder with seizures and joint laxity, MIM# 621302
Intellectual disability syndromic and non-syndromic v1.218 RNU5B-1 Zornitza Stark Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1
Intellectual disability syndromic and non-syndromic v1.217 RNU5B-1 Zornitza Stark edited their review of gene: RNU5B-1: Changed publications: 40442284; Changed phenotypes: Neurodevelopmental disorder with seizures and joint laxity, MIM# 621302
Intellectual disability syndromic and non-syndromic v1.217 RNU2-2P Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related to Developmental and epileptic encephalopathy 119, MIM# 621304
Intellectual disability syndromic and non-syndromic v1.216 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to 40210679
Intellectual disability syndromic and non-syndromic v1.215 RNU2-2P Zornitza Stark edited their review of gene: RNU2-2P: Changed publications: 40210679, 40442284; Changed phenotypes: Developmental and epileptic encephalopathy 119, MIM# 621304
Intellectual disability syndromic and non-syndromic v1.215 ST5 Zornitza Stark Marked gene: ST5 as ready
Intellectual disability syndromic and non-syndromic v1.215 ST5 Zornitza Stark Gene: st5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.215 ST5 Zornitza Stark Classified gene: ST5 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.215 ST5 Zornitza Stark Gene: st5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.214 ST5 Zornitza Stark Tag new gene name tag was added to gene: ST5.
Intellectual disability syndromic and non-syndromic v1.214 FRYL Zornitza Stark Classified gene: FRYL as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.214 FRYL Zornitza Stark Gene: fryl has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.213 FRYL Zornitza Stark edited their review of gene: FRYL: Added comment: Published literature re-reviewed:
A number of variants reported in currently published gene discovery paper were not absent in gnomAD v4.

Loss of function is the proposed mechanism of disease however too many NMD predicted variants throughout the gene in gnomAD v4 to be consistent with rare disease.

Functional studies performed in drosophila using FRY orthologue, however, humans have two paralogous genes - FRY and FRYL. As such, difficult to translate this model to implications in human disease or even judge to what extent it recapitulates the human phenotype.

Note multiple isoforms for FRYL however no clear paucity of NMD predicted variants in the population within one region of the gene.

Requires further literature to establish gene disease association.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.213 ST5 Rylee Peters gene: ST5 was added
gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ST5 were set to 40717498
Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related
Review for gene: ST5 was set to GREEN
Added comment: HGNC: DENND2B
Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10.

Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment).

In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.213 BLOC1S1 Rylee Peters changed review comment from: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy (in some cases), and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.; to: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy, and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.
Intellectual disability syndromic and non-syndromic v1.213 BLOC1S1 Rylee Peters reviewed gene: BLOC1S1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://www.medrxiv.org/content/10.1101/2025.07.17.25331211v1; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.213 CHTF18 Zornitza Stark Marked gene: CHTF18 as ready
Intellectual disability syndromic and non-syndromic v1.213 CHTF18 Zornitza Stark Gene: chtf18 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.213 CHTF18 Zornitza Stark Phenotypes for gene: CHTF18 were changed from complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465 to Neurodevelopmental disorder MONDO#0700092, CHTF18-related
Intellectual disability syndromic and non-syndromic v1.212 CHTF18 Zornitza Stark Classified gene: CHTF18 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.212 CHTF18 Zornitza Stark Gene: chtf18 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.211 CHTF18 Zornitza Stark edited their review of gene: CHTF18: Changed phenotypes: Neurodevelopmental disorder MONDO#0700092, CHTF18-related
Intellectual disability syndromic and non-syndromic v1.211 CHTF18 Zornitza Stark reviewed gene: CHTF18: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.211 KDM2B Zornitza Stark Publications for gene: KDM2B were set to 36322151
Intellectual disability syndromic and non-syndromic v1.210 KDM2B Zornitza Stark reviewed gene: KDM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 40420380; Phenotypes: neurodevelopmental disorder MONDO#0700092, KDM2B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.210 SNW1 Zornitza Stark Marked gene: SNW1 as ready
Intellectual disability syndromic and non-syndromic v1.210 SNW1 Zornitza Stark Gene: snw1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.210 SNW1 Zornitza Stark Classified gene: SNW1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.210 SNW1 Zornitza Stark Gene: snw1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.209 SNW1 Lucy Spencer gene: SNW1 was added
gene: SNW1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNW1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SNW1 were set to 40608414
Phenotypes for gene: SNW1 were set to Neurodevelopmental disorder (MONDO:0700092), SNW1-related
Review for gene: SNW1 was set to GREEN
Added comment: cohort of 9 patients with moderate to profound ID, microcephaly, seizures (7/9), facial dysmorphism, and brain malformations (6/9 - corpus callosum hypoplasia, Dandy-Walker malformation).

3 splice, 1 frameshift, 2 missense, 3 in frame deletions, 1 start loss. all but 1 de novo (the last parents not available).

SNW1 is a core component of the spliceosome and facilitates the conformational changes of the spliceosome. Expression of variants in HEK293 cells showed some decreased SNW1 expression while others increased it (including the frameshift), and only the frameshift variant was mislocalised/in the cytoplasm instead of the nucleus. Several of the variants caused loss of binding to PPIL1 or other proteins which SNW1 usually recruits to the spliceosome. All variants in this study were found to either affect protein expression or localization or influence interactions with other proteins in the spliceosome complex suggesting loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.209 PDCD6IP Zornitza Stark Classified gene: PDCD6IP as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.209 PDCD6IP Zornitza Stark Gene: pdcd6ip has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.208 PDCD6IP Zornitza Stark edited their review of gene: PDCD6IP: Added comment: Additional individual with homozygous truncating variant, mild ID, microcephaly and mild thrombocytopenia.
p.Arg322* - present in gnomAD (NFE AF - 0.0006%).; Changed rating: GREEN; Changed publications: https://doi.org/10.1111/cge.70025
Intellectual disability syndromic and non-syndromic v1.208 CHTF18 Sangavi Sivagnanasundram gene: CHTF18 was added
gene: CHTF18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHTF18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHTF18 were set to 40717333
Phenotypes for gene: CHTF18 were set to complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465
Review for gene: CHTF18 was set to AMBER
Added comment: Only two individuals reported with ID/DD:
1 - 9M with DD, autism and seizures. De novo variant identified - p.Leu355Val
2 - 23month F with congenital bilateral ventriculomegaly status post ventriculoperitoneal shunt placement, epilepsy, right eye optic nerve hypoplasia, hypotonic cerebral palsy complicated by left hip subluxation, and G-tube dependence. De novo variant identified - p.His645Pro
3 - 3F presenting with global DD, hypotonia, seizure and abnormal brain MRI. De novo variant identified - p.Leu676Arg
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.208 SV2A Zornitza Stark Publications for gene: SV2A were set to PMID: 37985816
Intellectual disability syndromic and non-syndromic v1.207 SV2A Ava Stevenson reviewed gene: SV2A: Rating: AMBER; Mode of pathogenicity: None; Publications: 36350923, 37861890; Phenotypes: Developmental and epileptic encephalopathy 113 (MIM#620772), AR, Neurodevelopmental disorder, MONDO:0700092, SV2A-related, AD; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.207 RNU5A-1 Zornitza Stark Marked gene: RNU5A-1 as ready
Intellectual disability syndromic and non-syndromic v1.207 RNU5A-1 Zornitza Stark Gene: rnu5a-1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.207 RNU5A-1 Zornitza Stark Classified gene: RNU5A-1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.207 RNU5A-1 Zornitza Stark Gene: rnu5a-1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.206 RNU5A-1 Zornitza Stark gene: RNU5A-1 was added
gene: RNU5A-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU5A-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU5A-1 were set to 40379786
Phenotypes for gene: RNU5A-1 were set to Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related
Review for gene: RNU5A-1 was set to AMBER
Added comment: PMID: 40379786 (2025) - three unrelated individuals with de novo variants in the RNU5A-1 gene (classified as VUS) and a neurodevelopmental disorder. Six individuals with rare de novo variants were identified in total but clinical details were only available for 3/6. Of these three individuals, two harboured the same variant (n.40_41insA) on the maternal allele, while the third individual harboured a different variant (n.39del) but also on the 5′ loop I domain of RNU5A-1. Clinical data showed neurodevelopmental abnormalities (mild ID (2), severe ID (1), epilepsy (2), brain MRI abnormalities (1)) with variable congenital malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.205 BSN Zornitza Stark Marked gene: BSN as ready
Intellectual disability syndromic and non-syndromic v1.205 BSN Zornitza Stark Gene: bsn has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.205 BSN Zornitza Stark Classified gene: BSN as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.205 BSN Zornitza Stark Gene: bsn has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.204 BSN Zornitza Stark gene: BSN was added
gene: BSN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: BSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BSN were set to 40393460
Phenotypes for gene: BSN were set to Neurodevelopmental disorder (MONDO:0700092), BSN-related
Review for gene: BSN was set to GREEN
Added comment: Guzman et al 2025: Described 12 additional patients with missense (3/12) and premature termination variants (9/12) which included de novo and inherited variants, suggesting incomplete penetrance.

They assessed all reported patients (n=29) which revealed common clinical characteristics including epilepsy(13/29), febrile seizures (7/29), generalised tonic-clonic seizures (5/29), and focal-onset seizures (3/29). Behavioural phenotypes were present in almost half of all individuals (14/29), which included ADHD (7/29) and autistic behaviour (5/29). Additional common features included developmental delay (11/29), obesity (10/29), and delayed speech (8/29). In adults with BSN PTVs, milder features were common, suggesting phenotypic variability, including a range of individuals without obvious neurodevelopmental features (7/29).
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.203 SMAD6 Zornitza Stark Marked gene: SMAD6 as ready
Intellectual disability syndromic and non-syndromic v1.203 SMAD6 Zornitza Stark Gene: smad6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.203 SMAD6 Zornitza Stark Classified gene: SMAD6 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.203 SMAD6 Zornitza Stark Gene: smad6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.202 CRBN Elena Savva Phenotypes for gene: CRBN were changed from Intellectual developmental disorder, autosomal recessive 2, MIM# 607417 to Intellectual developmental disorder, autosomal recessive 2, MIM# 607417
Intellectual disability syndromic and non-syndromic v1.202 CRBN Elena Savva Phenotypes for gene: CRBN were changed from Mental retardation, autosomal recessive 2, MIM# 607417 to Intellectual developmental disorder, autosomal recessive 2, MIM# 607417
Intellectual disability syndromic and non-syndromic v1.201 CRBN Elena Savva Mode of inheritance for gene: CRBN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.200 MARK2 Zornitza Stark Phenotypes for gene: MARK2 were changed from Neurodevelopmental disorder MONDO:0700092 to Intellectual developmental disorder, autosomal dominant 76, MIM# 621285
Intellectual disability syndromic and non-syndromic v1.199 MARK2 Zornitza Stark reviewed gene: MARK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 76, MIM# 621285; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.199 PDE1B Zornitza Stark Marked gene: PDE1B as ready
Intellectual disability syndromic and non-syndromic v1.199 PDE1B Zornitza Stark Gene: pde1b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.199 PDE1B Zornitza Stark Classified gene: PDE1B as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.199 PDE1B Zornitza Stark Gene: pde1b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.198 PDE1B Zornitza Stark gene: PDE1B was added
gene: PDE1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PDE1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE1B were set to 40492975
Phenotypes for gene: PDE1B were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related
Review for gene: PDE1B was set to GREEN
Added comment: PMID:40492975 reported seven individuals from five unrelated families identified with biallelic PDE1B variants. Three truncating (p.Gln45Ter, p.Gln86Ter, p.Ser298Alafs*6) and three splicing variants (c.594 + 2 T>G, c.735 + 5G>A, c.837-1G>C) were identified from these patients in total. They presented with an early-onset movement disorder characterised by hypotonia in infancy, progressing to ataxia and dystonia in early childhood, with motor and speech delay, and intellectual disability. Functional evidence is also available for these variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.197 FASTKD5 Zornitza Stark Marked gene: FASTKD5 as ready
Intellectual disability syndromic and non-syndromic v1.197 FASTKD5 Zornitza Stark Gene: fastkd5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.197 FASTKD5 Zornitza Stark Phenotypes for gene: FASTKD5 were changed from Leigh syndrome MONDO:0009723 to Leigh syndrome MONDO:0009723, FASTKD5-related
Intellectual disability syndromic and non-syndromic v1.196 FASTKD5 Chirag Patel Classified gene: FASTKD5 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.196 FASTKD5 Chirag Patel Gene: fastkd5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.195 FASTKD5 Chirag Patel gene: FASTKD5 was added
gene: FASTKD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FASTKD5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FASTKD5 were set to PMID: 40499538
Phenotypes for gene: FASTKD5 were set to Leigh syndrome MONDO:0009723
Review for gene: FASTKD5 was set to GREEN
Added comment: 3 unrelated individuals with Leigh syndrome (1 x severe/early-onset/fatal, 1 x milder/childhood-onset, 1 x adult-onset). WES identified compound heterozygous variants in FASTKD5 gene (3 x missense variants, 2 x frameshift variants leading to a premature stop codon). The FASTKD5 gene codes for a mitochondrial protein essential for processing mRNAs at non-canonical cleavage sites in the primary mitochondrial transcript.

Analysis of fibroblasts from two subjects showed reduced steady-state levels of FASTKD5 protein by immunoblot, reduced translation of the cytochrome c oxidase subunit 1, impaired assembly of complex IV, and a consequent decrease in cytochrome c oxidase enzymatic activity. The extent of these deficiencies appeared to correlate with the severity of the clinical phenotype. Expression of a wild-type FASTKD5 cDNA, but not cDNAs expressing the missense variants, rescued all the molecular defects in the subjects' fibroblasts, demonstrating that the alleles are pathogenic. 2/3 missense variants resulted in near complete loss of function, while one was hypomorphic, resulting from impaired protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.194 NDUFA4 Zornitza Stark Marked gene: NDUFA4 as ready
Intellectual disability syndromic and non-syndromic v1.194 NDUFA4 Zornitza Stark Gene: ndufa4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.194 NDUFA4 Zornitza Stark Classified gene: NDUFA4 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.194 NDUFA4 Zornitza Stark Gene: ndufa4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.193 NDUFA4 Sarah Milton gene: NDUFA4 was added
gene: NDUFA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDUFA4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA4 were set to PMID: 39967265
Phenotypes for gene: NDUFA4 were set to Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065
Review for gene: NDUFA4 was set to GREEN
Added comment: HGNC symbol now COXFA4

Around 10 patients reported in literature thus far with most having developmental delay. Association with hypertrophic cardiomyopathy reported in 3 siblings from a family in PMID: 39967265
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.193 FEM1B Zornitza Stark Phenotypes for gene: FEM1B were changed from Syndromic disease MONDO:0002254, FEM1B-related to Neurodevelopmental disorder with behavioral, ear, and skeletal abnormalities, MIM# 621263
Intellectual disability syndromic and non-syndromic v1.192 FEM1B Zornitza Stark edited their review of gene: FEM1B: Changed phenotypes: Neurodevelopmental disorder with behavioral, ear, and skeletal abnormalities, MIM# 621263
Intellectual disability syndromic and non-syndromic v1.192 DOT1L Zornitza Stark Phenotypes for gene: DOT1L were changed from Neurodevelopmental disorder, MONDO:0700092, DOT1L-related to Nil-Deshwan neurodevelopmental syndrome, MIM# 621265
Intellectual disability syndromic and non-syndromic v1.191 DOT1L Zornitza Stark edited their review of gene: DOT1L: Changed phenotypes: Nil-Deshwan neurodevelopmental syndrome, MIM# 621265
Intellectual disability syndromic and non-syndromic v1.191 LONP1 Zornitza Stark Phenotypes for gene: LONP1 were changed from CODAS syndrome, MIM#600373; Mitochondrial cytopathy to CODAS syndrome, MIM#600373; mitochondrial disease (MONDO:0044970), LONP1-related
Intellectual disability syndromic and non-syndromic v1.190 LONP1 Zornitza Stark Publications for gene: LONP1 were set to 31636596
Intellectual disability syndromic and non-syndromic v1.189 LONP1 Zornitza Stark Mode of inheritance for gene: LONP1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.188 LONP1 Zornitza Stark edited their review of gene: LONP1: Added comment: New reports of autosomal dominant mitochondrial disease due to missense variants at p.Arg301.

- PMID: 36353900; Hartley 2023: 1x heterozygous de novo individual with p.(Arg301Gln), with dystonia, hearing loss, seizures.
p.(Arg301Gln) has been reported as de novo in a heterozygous individual with dystonia, delayed speech and language development (VCGS/MCRI internal case)

- PMID: 31923470; Besse 2020: 1x heterozygous de novo individual with p.(Arg301Trp) with seizures, encephalopathy, pachygyria and microcephaly.
- p.(Arg301Trp) has also been reported in a heterozygous individual with recurrent neonatal seizures, suspected mitochondrial disorder, elevated lactate, microcephaly, EEG showing significantly increased seizure susceptibility which was de novo but parentage not tested (ClinVar, personal communication).
- p.(Arg301Trp) has also been identified in a heterozygous individual with neonatal intractable epileptic encephalopathy and lactic acidosis. MRI changes in keeping with mitochondrial disorder, a combined Complex I and complex IV defect identified in muscle (but not liver) by RCE (VCGS/MCRI internal case)

- p.(Arg301Gly) has been reported de novo in a heterozygous individual with epileptic encephalopathy, microcephaly and dyskinesia (ClinVar, personal communication)

LONP1 functions as both a chaperone and an ATP-dependent protease. Functional evidence in Besse shows p.(Arg301Trp) results in loss of chaperone activity but retains proteolytic activity. Expression of WT LONP1 in patient fibroblast cells did not rescue dysfunction (measured via levels of MRPL44, RPL11, PDHE1a, TFAM, PINK1, complex 1 and complex IV) - indicating NOT LoF effect. Overexpression of LONP1 in control fibroblast cells leads to dysfunction (decrease in NDUFB8, COXIV, MRPL44 and TFAM), however, MRPL11, PDHE1a and PINK1 proteins were unchanged compared to controls. Variant p.R721G associated with AR disease showed decreased homo-oligomerisation whilst p.R301W showed increased WT-Mut and WT-WT oligomers. GoF was suggested but no dose-dependent studies so DN cannot be excluded.; Changed publications: 31636596, 36353900 31923470; Changed phenotypes: CODAS syndrome, MIM#600373, mitochondrial disease (MONDO:0044970), LONP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.188 PIGU Zornitza Stark Classified gene: PIGU as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.188 PIGU Zornitza Stark Gene: pigu has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.187 PIGU Zornitza Stark reviewed gene: PIGU: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 21, OMIM #618590; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.187 FAAH2 Zornitza Stark commented on gene: FAAH2: DISPUTED by ClinGen
Intellectual disability syndromic and non-syndromic v1.187 FAAH2 Zornitza Stark Tag disputed tag was added to gene: FAAH2.
Intellectual disability syndromic and non-syndromic v1.187 TMEM63B Zornitza Stark Phenotypes for gene: TMEM63B were changed from developmental and epileptic encephalopathy, MONDO:0100062, TMEM63B-related to Developmental and epileptic encephalopathy 118, MIM# 621250
Intellectual disability syndromic and non-syndromic v1.186 TMEM63B Zornitza Stark edited their review of gene: TMEM63B: Changed phenotypes: Developmental and epileptic encephalopathy 118, MIM# 621250
Intellectual disability syndromic and non-syndromic v1.186 LGI1 Krithika Murali Classified gene: LGI1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.186 LGI1 Krithika Murali Gene: lgi1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.185 LGI1 Krithika Murali Marked gene: LGI1 as ready
Intellectual disability syndromic and non-syndromic v1.185 LGI1 Krithika Murali Gene: lgi1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.185 LGI1 Krithika Murali gene: LGI1 was added
gene: LGI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LGI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LGI1 were set to PMID:40455867
Phenotypes for gene: LGI1 were set to Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related
Review for gene: LGI1 was set to GREEN
Added comment: PMID: 40455867 report patients with biallelic variants in 6 individuals from 4 consanguineous families with a more severe DEE phenotype. All indivduals had seizures, global dev delay/ID and generalised hypotonia. Four out of five exhibited spasticity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.184 WDR91 Bryony Thompson Marked gene: WDR91 as ready
Intellectual disability syndromic and non-syndromic v1.184 WDR91 Bryony Thompson Gene: wdr91 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.184 WDR91 Bryony Thompson Classified gene: WDR91 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.184 WDR91 Bryony Thompson Gene: wdr91 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.183 WDR91 Bryony Thompson gene: WDR91 was added
gene: WDR91 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR91 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR91 were set to 32732226; 38041506; 34791078; 40550703; 28860274; 34028500; ClinVar: SCV000965687.1
Phenotypes for gene: WDR91 were set to Complex neurodevelopmental disorder MONDO:0100038
Review for gene: WDR91 was set to GREEN
Added comment: Homozygous LoF variants were identified in at least 5 families with a mainly neurodevelopmental disorder phenotype. Also, supporting mouse models
1. Brain malformation
2. Severe developmental delay, microcephaly, severe microlissencephaly, agenesis of corpus callosum, epilepsy, spastic tetraparesis, laryngomalacia, bicuspid aortic valve, congenital hip dislocation, growth retardation, dysmorphisms
3. Severe microcephaly, dysmorphic features, and organomegaly, along with early onset psychomotor delay, hypotonia, sensorineural hearing impairment, and visual impairment
4. Hygroma, macrocephaly, abnormal ears, unilateral simian crease, hydrocephaly, cerebellar hypoplasia, interventricular
communication
5. Neurodevelopmental disorder with brain malformations and multiple congenital anomalies
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.182 ADD1 Zornitza Stark Classified gene: ADD1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.182 ADD1 Zornitza Stark Gene: add1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.181 ADAM23 Zornitza Stark Marked gene: ADAM23 as ready
Intellectual disability syndromic and non-syndromic v1.181 ADAM23 Zornitza Stark Gene: adam23 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.181 ADAM23 Zornitza Stark Classified gene: ADAM23 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.181 ADAM23 Zornitza Stark Gene: adam23 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.180 SREK1 Zornitza Stark Marked gene: SREK1 as ready
Intellectual disability syndromic and non-syndromic v1.180 SREK1 Zornitza Stark Gene: srek1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.180 SREK1 Zornitza Stark Classified gene: SREK1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.180 SREK1 Zornitza Stark Gene: srek1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.179 NSUN3 Zornitza Stark Marked gene: NSUN3 as ready
Intellectual disability syndromic and non-syndromic v1.179 NSUN3 Zornitza Stark Gene: nsun3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.179 NSUN3 Zornitza Stark Classified gene: NSUN3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.179 NSUN3 Zornitza Stark Gene: nsun3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.178 NSUN3 Zornitza Stark gene: NSUN3 was added
gene: NSUN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSUN3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSUN3 were set to 27356879; 32488845; 40465263
Phenotypes for gene: NSUN3 were set to Combined oxidative phosphorylation deficiency 48, MIM# 619012
Review for gene: NSUN3 was set to GREEN
Added comment: Six families reported. DD/ID can be part of the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.177 SREK1 Sangavi Sivagnanasundram gene: SREK1 was added
gene: SREK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SREK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SREK1 were set to 40549565
Phenotypes for gene: SREK1 were set to Prader-Willi-like syndrome, SREK1-related MONDO:0008300
Review for gene: SREK1 was set to AMBER
Added comment: Three Pakistani probands from three consanguineous families identified with biallelic variants in SREK1. Affected individuals presented with hyperphagic obesity and neurodevelopmental delay. They also presented with psychological and behavioural issues and were phenotypically similar to Prader-Willi affected individuals. ID/DD is a feature in the affected individuals.

Further testing was conducted using human induced pluripotent stem cell (iPSC) -derived neurons followed by RNA sequencing conducted on the neurons.
The results of the assay was suggestive that variants located in the RNA recognition domain (residues 19–96 and 173–256) of SREK1 downregulation of SNORD115 and SNORD116 leading to Prader-Willi-like phenotype however proper validation and controls weren't used.

No relevant mouse models were identified on IMPC (international mouse phenotype consortium) to further support gene-disease association there gene reviewed as Amber.

Variants identified in SREK1 - AF's from gnomADv4.1
P95L - absent in gnomAD v4.1
T194M - EAS PopMax AF - 0.03787% (47 hets)
E601K - SAS PopMax AF - 0.01319% (12 hets)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.177 SMARCC1 Lilian Downie Marked gene: SMARCC1 as ready
Intellectual disability syndromic and non-syndromic v1.177 SMARCC1 Lilian Downie Added comment: Comment when marking as ready: 6/13 developmental delay
many inherited variants - known reduced penetrance
Intellectual disability syndromic and non-syndromic v1.177 SMARCC1 Lilian Downie Gene: smarcc1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.177 SMARCC1 Lilian Downie Classified gene: SMARCC1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.177 SMARCC1 Lilian Downie Gene: smarcc1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.176 ADAM23 Sarah Milton gene: ADAM23 was added
gene: ADAM23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADAM23 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAM23 were set to PMID: 40455867
Phenotypes for gene: ADAM23 were set to Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related
Review for gene: ADAM23 was set to AMBER
Added comment: ADAM23 encodes a transmembrane protein receptor which is a receptor for LGI1. LGI1/ADAM22/ADAM23 form a complex that regulates excitatory synaptic transmission and neuronal excitability in the brain.

1 affected individual described in PMID: 40455867 with severe neonatal seizures, joint contractures, absent reflexes. Noted to have a homozygous NMD predicted variant in ADAM23.
Also had a de novo missense variant in PRKD1.

Knockout ADAM23 mice show early lethal epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 ADD1 Ava Stevenson reviewed gene: ADD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 34906466; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.176 SMARCC1 Gemma Edwards gene: SMARCC1 was added
gene: SMARCC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCC1 were set to 29983323; 37285932
Phenotypes for gene: SMARCC1 were set to SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123)
Review for gene: SMARCC1 was set to GREEN
Added comment: Phenotype expansion since original literature. ClinGen - "SMARCC1-associated developmental dysgenesis syndrome is characterized by developmental delay, cerebral ventriculomegaly, aqueductal stenosis, and other associated structural brain and cardiac defects". See cases in PMIDs 29983323, 37285932.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 IKZF2 Zornitza Stark Marked gene: IKZF2 as ready
Intellectual disability syndromic and non-syndromic v1.176 IKZF2 Zornitza Stark Gene: ikzf2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.176 IKZF2 Zornitza Stark Classified gene: IKZF2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.176 IKZF2 Zornitza Stark Gene: ikzf2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.175 IKZF2 Zornitza Stark gene: IKZF2 was added
gene: IKZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IKZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: IKZF2 were set to 37316189
Phenotypes for gene: IKZF2 were set to Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234
Review for gene: IKZF2 was set to AMBER
Added comment: PMID 37316189: two individuals with de novo variants and syndromic immunodysregulation, including craniofacial anomalies, hearing impairment, athelia, and developmental delay.

Note that variants in this gene are also associated with non-syndromic immune dysregulation and non-syndromic HL. Genotype-phenotype correlation unclear.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.174 ANKS1B Zornitza Stark Classified gene: ANKS1B as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.174 ANKS1B Zornitza Stark Gene: anks1b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.173 ANKS1B Lilian Downie Marked gene: ANKS1B as ready
Intellectual disability syndromic and non-syndromic v1.173 ANKS1B Lilian Downie Gene: anks1b has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.173 ANKS1B Lilian Downie gene: ANKS1B was added
gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: ANKS1B.
Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKS1B were set to PMID: 31388001; 38129387
Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related
Review for gene: ANKS1B was set to GREEN
Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model.

Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.172 KCNA6 Zornitza Stark Marked gene: KCNA6 as ready
Intellectual disability syndromic and non-syndromic v1.172 KCNA6 Zornitza Stark Gene: kcna6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.172 KCNA6 Zornitza Stark Classified gene: KCNA6 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.172 KCNA6 Zornitza Stark Gene: kcna6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.171 KCNA6 Zornitza Stark gene: KCNA6 was added
gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNA6 were set to 36318112; 40472070
Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related
Review for gene: KCNA6 was set to GREEN
Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.170 PIP5K1C Zornitza Stark Phenotypes for gene: PIP5K1C were changed from Neurodevelopmental disorder and microcephaly, MONDO:0700092, PIP5K1C-related to Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related
Intellectual disability syndromic and non-syndromic v1.169 PIP5K1C Zornitza Stark reviewed gene: PIP5K1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 37451268; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.169 ZBTB7B Zornitza Stark Marked gene: ZBTB7B as ready
Intellectual disability syndromic and non-syndromic v1.169 ZBTB7B Zornitza Stark Gene: zbtb7b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.169 ZBTB7B Zornitza Stark Classified gene: ZBTB7B as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.169 ZBTB7B Zornitza Stark Gene: zbtb7b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.168 ZBTB7B Zornitza Stark gene: ZBTB7B was added
gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZBTB7B were set to 40392549
Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related
Review for gene: ZBTB7B was set to AMBER
Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure.

K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.167 TOP2B Zornitza Stark Phenotypes for gene: TOP2B were changed from Intellectual disability to Intellectual disability (MONDO:0001071), TOP2B-related; B-cell immunodeficiency, distal limb anomalies, and urogenital malformations MIM#609296
Intellectual disability syndromic and non-syndromic v1.166 TOP2B Zornitza Stark Classified gene: TOP2B as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.166 TOP2B Zornitza Stark Gene: top2b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.165 PTPN1 Zornitza Stark Marked gene: PTPN1 as ready
Intellectual disability syndromic and non-syndromic v1.165 PTPN1 Zornitza Stark Gene: ptpn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.165 PTPN1 Zornitza Stark Classified gene: PTPN1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.165 PTPN1 Zornitza Stark Gene: ptpn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.164 PTPN1 Zornitza Stark gene: PTPN1 was added
gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTPN1 were set to 39986310
Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related
Review for gene: PTPN1 was set to GREEN
Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.163 WSB2 Krithika Murali Classified gene: WSB2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.163 WSB2 Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.164 WSB2 Krithika Murali Classified gene: WSB2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.164 WSB2 Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.163 WSB2 Krithika Murali Classified gene: WSB2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.163 WSB2 Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.163 WSB2 Krithika Murali Classified gene: WSB2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.163 WSB2 Krithika Murali Gene: wsb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.162 WSB2 Krithika Murali Marked gene: WSB2 as ready
Intellectual disability syndromic and non-syndromic v1.162 WSB2 Krithika Murali Gene: wsb2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.162 WSB2 Krithika Murali gene: WSB2 was added
gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WSB2 were set to PMID:40374945
Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related
Review for gene: WSB2 was set to GREEN
Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include:
- Dev delay (all)
- Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia)
- Dysmorphic feature
- IUGR/oligohydramnios (3/5)
- Hypotonia (all)
- Microcephaly (3/5)
- Seizures (3/5)

Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense.

Supportive mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.161 NKAP Zornitza Stark Mode of inheritance for gene: NKAP was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.160 PRR12 Zornitza Stark Publications for gene: PRR12 were set to 29556724
Intellectual disability syndromic and non-syndromic v1.159 RREB1 Zornitza Stark Publications for gene: RREB1 were set to 32938917; 38332451
Intellectual disability syndromic and non-syndromic v1.158 TAF1C Zornitza Stark Publications for gene: TAF1C were set to 32779182
Intellectual disability syndromic and non-syndromic v1.157 TAF1C Zornitza Stark Classified gene: TAF1C as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.157 TAF1C Zornitza Stark Gene: taf1c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.156 TAF1C Zornitza Stark edited their review of gene: TAF1C: Changed phenotypes: Neurodevelopmental disorder (MONDO#0700092), TAF1C-related
Intellectual disability syndromic and non-syndromic v1.156 TAF1C Zornitza Stark reviewed gene: TAF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 40371665; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.156 TM2D3 Zornitza Stark Marked gene: TM2D3 as ready
Intellectual disability syndromic and non-syndromic v1.156 TM2D3 Zornitza Stark Gene: tm2d3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.156 TM2D3 Zornitza Stark Classified gene: TM2D3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.156 TM2D3 Zornitza Stark Gene: tm2d3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.155 TM2D3 Zornitza Stark gene: TM2D3 was added
gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TM2D3 were set to 40449487
Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related
Review for gene: TM2D3 was set to GREEN
Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.154 SLK Zornitza Stark Marked gene: SLK as ready
Intellectual disability syndromic and non-syndromic v1.154 SLK Zornitza Stark Gene: slk has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.154 SLK Zornitza Stark Classified gene: SLK as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.154 SLK Zornitza Stark Gene: slk has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.153 SLK Zornitza Stark gene: SLK was added
gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLK were set to 40347834
Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related
Review for gene: SLK was set to GREEN
Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.152 RREB1 Chirag Patel Classified gene: RREB1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.152 RREB1 Chirag Patel Gene: rreb1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.152 RREB1 Chirag Patel Classified gene: RREB1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.152 RREB1 Chirag Patel Gene: rreb1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.151 RREB1 Chirag Patel reviewed gene: RREB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40418122; Phenotypes: Rasopathy, MONDO:0021060, RREB1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.151 GON4L Zornitza Stark Phenotypes for gene: GON4L were changed from complex neurodevelopmental disorder MONDO:0100038 to Li-Takada-Miyake syndrome, MIM# 621212
Intellectual disability syndromic and non-syndromic v1.150 GON4L Zornitza Stark reviewed gene: GON4L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Li-Takada-Miyake syndrome, MIM# 621212; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.150 PRR12 Boris Keren reviewed gene: PRR12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33824499; Phenotypes: intellectual disability, ocular anomalies, heart defects, growth failure, kidney anomalies; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v1.150 NKAP Elena Savva Phenotypes for gene: NKAP were changed from Intellectual disability to intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039
Intellectual disability syndromic and non-syndromic v1.149 MYCBP2 Zornitza Stark Classified gene: MYCBP2 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.149 MYCBP2 Zornitza Stark Gene: mycbp2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.148 MYCBP2 Zornitza Stark edited their review of gene: MYCBP2: Added comment: Concerns about LoF variants in population datasets as well as in individuals undergoing diagnostic testing for a wide variety of unrelated phenotypes: downgrade to RED.; Changed rating: RED
Intellectual disability syndromic and non-syndromic v1.148 TOP2B Chris Ciotta reviewed gene: TOP2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33459963, 31953910, 28343847; Phenotypes: Intellectual disability (MONDO:0001071), TOP2B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.148 PIP5K1C Sarah Pantaleo reviewed gene: PIP5K1C: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v1.148 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985
Intellectual disability syndromic and non-syndromic v1.147 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.147 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.146 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported.; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Intellectual disability syndromic and non-syndromic v1.146 FAM177A1 Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177a1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152
Intellectual disability syndromic and non-syndromic v1.145 FAM177A1 Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.145 GTF3C3 Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Intellectual disability syndromic and non-syndromic v1.144 GTF3C3 Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Intellectual disability syndromic and non-syndromic v1.144 PTPMT1 Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199
Intellectual disability syndromic and non-syndromic v1.143 PTPMT1 Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.143 PPP2R5C Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185
Intellectual disability syndromic and non-syndromic v1.142 PPP2R5C Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.142 MRPL49 Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195
Intellectual disability syndromic and non-syndromic v1.141 MRPL49 Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195
Intellectual disability syndromic and non-syndromic v1.141 SMAD6 Boris Keren changed review comment from: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606).
Sources: Literature; to: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606) and 11/15 had neurodevelopmental delay in Timberlake et al. (PMID: 27606499)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.141 SMAD6 Boris Keren gene: SMAD6 was added
gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMAD6 were set to PMID: 32499606
Penetrance for gene: SMAD6 were set to Incomplete
Review for gene: SMAD6 was set to GREEN
Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.141 LSM1 Zornitza Stark Phenotypes for gene: LSM1 were changed from Neurodevelopmental disorder, MONDO:0700092, LSM1-related to FICUS syndrome, MIM# 621193
Intellectual disability syndromic and non-syndromic v1.140 LSM1 Zornitza Stark reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: FICUS syndrome, MIM# 621193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.140 ZNF674 Zornitza Stark Phenotypes for gene: ZNF674 were changed from to X-linked intellectual disability MONDO:0100284
Intellectual disability syndromic and non-syndromic v1.139 PLK1 Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.138 PLK1 Zornitza Stark edited their review of gene: PLK1: Changed phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.138 PLXNA2 Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.137 RFX3 Zornitza Stark Phenotypes for gene: RFX3 were changed from ID, ASD, ADHD to RFX3-related neurodevelopmental disorder MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.136 RFX4 Zornitza Stark Phenotypes for gene: RFX4 were changed from ID, ASD, ADHD to RFX4-related neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.135 AMOTL1 Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192
Intellectual disability syndromic and non-syndromic v1.134 AMOTL1 Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.134 NAV3 Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Intellectual disability syndromic and non-syndromic v1.133 NAV3 Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Marked gene: FBXO22 as ready
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Classified gene: FBXO22 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.132 FBXO22 Sarah Milton gene: FBXO22 was added
gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO22 were set to PMID: 40215970
Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related
Review for gene: FBXO22 was set to GREEN
Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases.

14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4).

Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies.

Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark Marked gene: GAP43 as ready
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark Gene: gap43 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark gene: GAP43 was added
gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GAP43 were set to 39738362
Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related
Review for gene: GAP43 was set to RED
Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities.

The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.131 LSM1 Zornitza Stark Phenotypes for gene: LSM1 were changed from no OMIM number yet to Neurodevelopmental disorder, MONDO:0700092, LSM1-related
Intellectual disability syndromic and non-syndromic v1.130 LSM1 Zornitza Stark Publications for gene: LSM1 were set to PMID: 31010896
Intellectual disability syndromic and non-syndromic v1.129 LSM1 Zornitza Stark Classified gene: LSM1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.129 LSM1 Zornitza Stark Gene: lsm1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.128 RNU2-2P Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related
Intellectual disability syndromic and non-syndromic v1.127 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P.
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Previously referred to as RNU2-2P
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Marked gene: BRF2 as ready
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Classified gene: BRF2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.125 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant.

Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID.

Supportive functional data, including animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Marked gene: EIF3K as ready
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Classified gene: EIF3K as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Marked gene: PCNA as ready
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Marked gene: RAB3A as ready
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Classified gene: RAB3A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.121 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene.

3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes.

The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments.

RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene.

3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes.

The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments.

RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals.
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton edited their review of gene: LSM1: Changed publications: (PMID: 31010896, PMID: 36100156, PMID: 40204357)
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: (PMID: 31010896, 36100156, 40204357); Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.120 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram edited their review of gene: EIF3K: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram gene: EIF3K was added
gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3K were set to 40219605
Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092
Review for gene: EIF3K was set to RED
Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Other
Intellectual disability syndromic and non-syndromic v1.120 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.120 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants.

Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.118 DLG3 Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850
Intellectual disability syndromic and non-syndromic v1.117 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.115 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.113 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Marked STR: FMR1_FXS_CGG as ready
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Classified STR: FMR1_FXS_CGG as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.111 FMR1_FXS_CGG Bryony Thompson STR: FMR1_FXS_CGG was added
STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184
Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624
Review for STR: FMR1_FXS_CGG was set to GREEN
STR: FMR1_FXS_CGG was marked as clinically relevant
STR: FMR1_FXS_CGG was marked as current diagnostic
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.108 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.106 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.104 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.103 AFF2_FRAXE_GCC Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC
Intellectual disability syndromic and non-syndromic v1.102 EEF1D Bryony Thompson Classified gene: EEF1D as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.102 EEF1D Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.101 EEF1D Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321
Intellectual disability syndromic and non-syndromic v1.100 EEF1D Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.100 SPOUT1 Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154
Intellectual disability syndromic and non-syndromic v1.99 SPOUT1 Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.99 DISP1 Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly (MONDO:0016296), DISP1-related to Holoprosencephaly 10, MIM# 621143
Intellectual disability syndromic and non-syndromic v1.98 DISP1 Zornitza Stark edited their review of gene: DISP1: Changed phenotypes: Holoprosencephaly 10, MIM# 621143
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Marked gene: CDKL2 as ready
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Classified gene: CDKL2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.97 CDKL2 Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Marked gene: CDKL1 as ready
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Classified gene: CDKL1 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Sarah Milton gene: CDKL1 was added
gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL1 were set to PMID: 40088891
Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related
Mode of pathogenicity for gene: CDKL1 was set to Other
Review for gene: CDKL1 was set to AMBER
Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4).

Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 CDKL2 Sarah Milton gene: CDKL2 was added
gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL2 were set to PMID: 40088891
Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related
Penetrance for gene: CDKL2 were set to Complete
Mode of pathogenicity for gene: CDKL2 was set to Other
Review for gene: CDKL2 was set to AMBER
Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion.
2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging.

Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5)

Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 MED16 Zornitza Stark Phenotypes for gene: MED16 were changed from complex neurodevelopmental disorder MONDO:0100038 to Neurodevelopmental disorder, MONDO:0700092, MED16-related
Intellectual disability syndromic and non-syndromic v1.95 MED16 Zornitza Stark Publications for gene: MED16 were set to
Intellectual disability syndromic and non-syndromic v1.94 MED16 Zornitza Stark reviewed gene: MED16: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081376; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, MED16-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Marked gene: CELF4 as ready
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Classified gene: CELF4 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.93 CELF4 Zornitza Stark gene: CELF4 was added
gene: CELF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF4 were set to 40108438
Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related
Review for gene: CELF4 was set to GREEN
Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.92 SVBP Zornitza Stark Phenotypes for gene: SVBP were changed from Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569 to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569; Spastic paraplegia 94, autosomal recessive, MIM# 621150
Intellectual disability syndromic and non-syndromic v1.91 SVBP Zornitza Stark Publications for gene: SVBP were set to PMID: 31363758; 30607023
Intellectual disability syndromic and non-syndromic v1.90 SVBP Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Marked gene: CRMP1 as ready
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Classified gene: CRMP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.89 CRMP1 Zornitza Stark gene: CRMP1 was added
gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CRMP1 were set to 36511780; 39758889
Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related
Review for gene: CRMP1 was set to GREEN
Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants.

PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID.

Four individuals with neurodevelopmental disorders and de novo variants in this gene.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.88 MACROD2 Zornitza Stark Phenotypes for gene: MACROD2 were changed from Syndromic disease, MONDO:0002254, MACROD2-related to Syndromic disease, MONDO:0002254, MACROD2-related
Intellectual disability syndromic and non-syndromic v1.88 MACROD2 Zornitza Stark Phenotypes for gene: MACROD2 were changed from no OMIM number yet to Syndromic disease, MONDO:0002254, MACROD2-related
Intellectual disability syndromic and non-syndromic v1.87 SLC35F1 Zornitza Stark Phenotypes for gene: SLC35F1 were changed from Neruodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome to Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome
Intellectual disability syndromic and non-syndromic v1.86 SLC35F1 Zornitza Stark edited their review of gene: SLC35F1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated, Rett-like syndrome
Intellectual disability syndromic and non-syndromic v1.86 EXOSC2 Zornitza Stark Publications for gene: EXOSC2 were set to 26843489; 31628467
Intellectual disability syndromic and non-syndromic v1.85 EXOSC2 Zornitza Stark edited their review of gene: EXOSC2: Added comment: LIMITED by ClinGen. Two additional patients reported but again, predominantly missense variants.; Changed rating: AMBER; Changed publications: 26843489, 31628467, 36344539, 36069504
Intellectual disability syndromic and non-syndromic v1.85 KMT2C Zornitza Stark Phenotypes for gene: KMT2C were changed from Kleefstra syndrome 2, MIM#617768 to Kleefstra syndrome 2, MIM#617768; Neurodevelopmental disorder, MONDO:0700092, KMT2C-related
Intellectual disability syndromic and non-syndromic v1.84 KMT2C Zornitza Stark Publications for gene: KMT2C were set to
Intellectual disability syndromic and non-syndromic v1.83 KMT2C Zornitza Stark edited their review of gene: KMT2C: Added comment: Additional report of >80 individuals suggesting condition is distinct from Kleefstra syndrome and needs to be renamed.; Changed publications: 39013459; Changed phenotypes: Kleefstra syndrome 2, MIM#617768, Neurodevelopmental disorder, MONDO:0700092, KMT2C-related
Intellectual disability syndromic and non-syndromic v1.83 LINC01578 Zornitza Stark Tag non-coding gene tag was added to gene: LINC01578.
Intellectual disability syndromic and non-syndromic v1.83 MIR17HG Zornitza Stark Tag non-coding gene tag was added to gene: MIR17HG.
Intellectual disability syndromic and non-syndromic v1.83 RMRP Zornitza Stark Tag non-coding gene tag was added to gene: RMRP.
Intellectual disability syndromic and non-syndromic v1.83 RNU2-2P Zornitza Stark Tag non-coding gene tag was added to gene: RNU2-2P.
Intellectual disability syndromic and non-syndromic v1.83 SNORD118 Zornitza Stark Tag non-coding gene tag was added to gene: SNORD118.
Intellectual disability syndromic and non-syndromic v1.83 RNU7-1 Zornitza Stark Tag non-coding gene tag was added to gene: RNU7-1.
Intellectual disability syndromic and non-syndromic v1.83 RNU4ATAC Zornitza Stark Tag non-coding gene tag was added to gene: RNU4ATAC.
Intellectual disability syndromic and non-syndromic v1.83 RNU4-2 Zornitza Stark Tag non-coding gene tag was added to gene: RNU4-2.
Intellectual disability syndromic and non-syndromic v1.83 DROSHA Zornitza Stark Tag non-coding gene tag was added to gene: DROSHA.
Intellectual disability syndromic and non-syndromic v1.83 MEG3 Zornitza Stark Marked gene: MEG3 as ready
Intellectual disability syndromic and non-syndromic v1.83 MEG3 Zornitza Stark Gene: meg3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.83 MEG3 Zornitza Stark Classified gene: MEG3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.83 MEG3 Zornitza Stark Gene: meg3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.82 MEG3 Zornitza Stark gene: MEG3 was added
gene: MEG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MEG3 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Publications for gene: MEG3 were set to 33010492; 33746039; 33067531; 38212313
Phenotypes for gene: MEG3 were set to Kagami-Ogata syndrome, MIM# 608149
Review for gene: MEG3 was set to GREEN
Added comment: Small deletions of MAG3 reported in multiple patients as one of the mechanisms of disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.81 H19 Zornitza Stark Tag non-coding gene tag was added to gene: H19.
Intellectual disability syndromic and non-syndromic v1.81 PPFIA3 Zornitza Stark Phenotypes for gene: PPFIA3 were changed from Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related to Paul-Chao neurodevelopmental syndrome, MIM# 621122
Intellectual disability syndromic and non-syndromic v1.80 PPFIA3 Zornitza Stark edited their review of gene: PPFIA3: Changed phenotypes: Paul-Chao neurodevelopmental syndrome, MIM# 621122
Intellectual disability syndromic and non-syndromic v1.80 PIGW Zornitza Stark Classified gene: PIGW as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.80 PIGW Zornitza Stark Gene: pigw has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.79 PIGW Zornitza Stark edited their review of gene: PIGW: Added comment: Downgraded to AMBER, assessed as LIMITED by ClinGen.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.79 PPP2R5E Chirag Patel gene: PPP2R5E was added
gene: PPP2R5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP2R5E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5E were set to PMID: 39284558
Phenotypes for gene: PPP2R5E were set to Mendelian neurodevelopmental disorder MONDO:0100500
Review for gene: PPP2R5E was set to RED
Added comment: One 20yrs old individual with learning issues, motor coordination disorders, hypotonia (myopathy on EMG), and behavioural issues (mood and emotional dysregulation). WES testing identified a de novo heterozygous missense variant (Glu191Lys) in PPP2R5E gene. The variant was not found in the 4 healthy brothers of the individual. The variant is located within a conserved LFDSEDPRER motif common to all PPP2R5 B-subunits. Biochemical assays demonstrated a decreased interaction with the PP2A A and C subunits, leading to disturbances in holoenzyme formation.

Protein phosphatase 2A (PP2A) is a family of multifunctional enzymatic complexes crucial for cellular signalling, playing a pivotal role in brain function and development. Mutations in specific genes encoding PP2A complexes have been associated with neurodevelopmental disorders with hypotonia and high risk of seizures (e.g. PP2AR-1A, 2B, 3C, 5C, 5D).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.78 DDX39B Zornitza Stark Marked gene: DDX39B as ready
Intellectual disability syndromic and non-syndromic v1.78 DDX39B Zornitza Stark Gene: ddx39b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.78 DDX39B Zornitza Stark Classified gene: DDX39B as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.78 DDX39B Zornitza Stark Gene: ddx39b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.77 CDO1 Zornitza Stark Marked gene: CDO1 as ready
Intellectual disability syndromic and non-syndromic v1.77 CDO1 Zornitza Stark Gene: cdo1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.77 CDO1 Zornitza Stark Classified gene: CDO1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.77 CDO1 Zornitza Stark Gene: cdo1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.76 CDO1 Zornitza Stark gene: CDO1 was added
gene: CDO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDO1 were set to 39949058
Phenotypes for gene: CDO1 were set to Syndromic disease, MONDO:0002254, CDO1-related
Review for gene: CDO1 was set to AMBER
Added comment: Three children with overlapping features including severe microcephaly and DD/ID. Three missense de novo variants were identified and were clustered around exon 3 and exon 4. The three missense variants identified p.(His147Arg, Ala131Val, Glu143Lys) are all absent from gnomAD v4.1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.75 PHACTR4 Zornitza Stark Marked gene: PHACTR4 as ready
Intellectual disability syndromic and non-syndromic v1.75 PHACTR4 Zornitza Stark Gene: phactr4 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.75 PHACTR4 Zornitza Stark Classified gene: PHACTR4 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.75 PHACTR4 Zornitza Stark Gene: phactr4 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.74 PHACTR4 Zornitza Stark gene: PHACTR4 was added
gene: PHACTR4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PHACTR4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHACTR4 were set to 40012205
Phenotypes for gene: PHACTR4 were set to Syndromic disease, MONDO:0002254, PHACTR4-related
Review for gene: PHACTR4 was set to AMBER
Added comment: Two individuals with syndromic disease and de novo missense variants reported together with aggregate information on additional individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.73 C14orf80 Zornitza Stark Marked gene: C14orf80 as ready
Intellectual disability syndromic and non-syndromic v1.73 C14orf80 Zornitza Stark Gene: c14orf80 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.73 C14orf80 Zornitza Stark Classified gene: C14orf80 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.73 C14orf80 Zornitza Stark Gene: c14orf80 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.72 C14orf80 Zornitza Stark gene: C14orf80 was added
gene: C14orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: C14orf80.
Mode of inheritance for gene: C14orf80 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C14orf80 were set to 39979680; 38252227
Phenotypes for gene: C14orf80 were set to Primary microcephaly, MONDO:0016660
Review for gene: C14orf80 was set to AMBER
Added comment: New HGNC approved Gene Name: TEDC1
Only two families reported with biallelic variants in this gene - Reports of a supportive functional assay however rated as Amber given that one of the reported families are consanguineous with hmz missense.

PMID: 39979680 - Male sibs from non-consanguineous parents presenting with a range of phenotypes including growth development abnormalities, microcephaly, DD, ID and endocrine insufficiency. The brothers were found to carry chet variants identified in trans [NM_001134877.1 c.[104-5C>G];[787delG] p.[?];[(Ala263LeufsTer29)].
Homozygous zebrafish model recapitulated the human phenotype and is supportive of the loss of function mechanism of disease.

PMID: 38252227 - Iranian consanguineous families identified with a rare biallelic missense variant (Gln269Arg). The affected brothers presented with a range of developmental phenotypes including cognitive impairment and microcephaly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.71 SPOUT1 Bryony Thompson Marked gene: SPOUT1 as ready
Intellectual disability syndromic and non-syndromic v1.71 SPOUT1 Bryony Thompson Gene: spout1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.71 SPOUT1 Bryony Thompson Classified gene: SPOUT1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.71 SPOUT1 Bryony Thompson Gene: spout1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.70 SPOUT1 Bryony Thompson gene: SPOUT1 was added
gene: SPOUT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPOUT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPOUT1 were set to 39962046
Phenotypes for gene: SPOUT1 were set to complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related
Review for gene: SPOUT1 was set to GREEN
Added comment: Biallelic SPOUT1 variants were identified in 28 individuals with a complex neurodevelopmental disorder from 21 unrelated families. Common phenotypes include microcephaly (18/21), seizures (20/28), intellectual disability (14/14), and varying degrees of developmental delays (28/28). Also, supporting zebrafish model. The suggested name of the disorder is SpADMiSS (SPOUT1 Associated Development delay Microcephaly Seizures Short stature).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.69 SIN3B Zornitza Stark Phenotypes for gene: SIN3B were changed from Syndromic intellectual disability/autism spectrum disorder to Neurodevelopmental disorder, MONDO:0700092, SIN3B-related
Intellectual disability syndromic and non-syndromic v1.68 SIN3B Zornitza Stark reviewed gene: SIN3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SIN3B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.68 DDX39B Sangavi Sivagnanasundram gene: DDX39B was added
gene: DDX39B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX39B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DDX39B were set to 39918047
Phenotypes for gene: DDX39B were set to neurodevelopmental disorder MONDO:0700092, DDX39B-related
Review for gene: DDX39B was set to GREEN
Added comment: Established gene-disease association - ID/DD is a prominent feature in affected individuals.

6 individuals from 5 families with variable neurological and developmental phenotypes including hypotonia, DD, ID and epilepsy.
4 de novo missense variants and 1 inherited splice variant were identified. All variants are absent from gnomAD v4.1.
In vivo functional assay using Drosophila transgenic flies was supportive of a loss of function phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.68 SMARCA1 Zornitza Stark Marked gene: SMARCA1 as ready
Intellectual disability syndromic and non-syndromic v1.68 SMARCA1 Zornitza Stark Gene: smarca1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.68 SMARCA1 Zornitza Stark Classified gene: SMARCA1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.68 SMARCA1 Zornitza Stark Gene: smarca1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.67 SMARCA1 Zornitza Stark gene: SMARCA1 was added
gene: SMARCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: SMARCA1 were set to 37841849
Phenotypes for gene: SMARCA1 were set to Neurodevelopmental disorder, MONDO:0700092, SMARCA1-related
Review for gene: SMARCA1 was set to GREEN
Added comment: 40 individuals from 30 families with NDD and variants in this gene reported in this preprint, publication imminent
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.66 C12orf66 Zornitza Stark Phenotypes for gene: C12orf66 were changed from complex neurodevelopmental disorder MONDO:0100038 to Intellectual developmental disorder, autosomal recessive 83, MIM# 621100
Intellectual disability syndromic and non-syndromic v1.65 C12orf66 Zornitza Stark Publications for gene: C12orf66 were set to
Intellectual disability syndromic and non-syndromic v1.64 C12orf66 Zornitza Stark edited their review of gene: C12orf66: Changed rating: GREEN; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 83, MIM# 621100; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.64 EEFSEC Zornitza Stark Phenotypes for gene: EEFSEC were changed from Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related to Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102
Intellectual disability syndromic and non-syndromic v1.63 EEFSEC Zornitza Stark edited their review of gene: EEFSEC: Changed phenotypes: Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102
Intellectual disability syndromic and non-syndromic v1.63 HECTD1 Zornitza Stark Marked gene: HECTD1 as ready
Intellectual disability syndromic and non-syndromic v1.63 HECTD1 Zornitza Stark Gene: hectd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.63 ARHGEF40 Zornitza Stark Marked gene: ARHGEF40 as ready
Intellectual disability syndromic and non-syndromic v1.63 ARHGEF40 Zornitza Stark Gene: arhgef40 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.63 ARHGEF40 Zornitza Stark Classified gene: ARHGEF40 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.63 ARHGEF40 Zornitza Stark Gene: arhgef40 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.62 ARHGEF40 Zornitza Stark reviewed gene: ARHGEF40: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.62 C12orf66 Zornitza Stark Marked gene: C12orf66 as ready
Intellectual disability syndromic and non-syndromic v1.62 C12orf66 Zornitza Stark Added comment: Comment when marking as ready: New HGNC approved gene name is KICS2
Intellectual disability syndromic and non-syndromic v1.62 C12orf66 Zornitza Stark Gene: c12orf66 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.62 C12orf66 Zornitza Stark Tag new gene name tag was added to gene: C12orf66.
Intellectual disability syndromic and non-syndromic v1.62 C12orf66 Chirag Patel reviewed gene: C12orf66: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39824192; Phenotypes: Neurodevelopmental disorder MONDO:0700092; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.62 ARHGEF40 Chirag Patel gene: ARHGEF40 was added
gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARHGEF40 were set to PMID: 39838643
Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: ARHGEF40 was set to RED
Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of
the importance of this residue.

The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.61 HECTD1 Chirag Patel Classified gene: HECTD1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.61 HECTD1 Chirag Patel Gene: hectd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.60 HECTD1 Chirag Patel Classified gene: HECTD1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.60 HECTD1 Chirag Patel Gene: hectd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.60 HECTD1 Chirag Patel Classified gene: HECTD1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.60 HECTD1 Chirag Patel Gene: hectd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.59 HECTD1 Chirag Patel gene: HECTD1 was added
gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HECTD1 were set to PMID: 39879987
Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: HECTD1 was set to GREEN
Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy.

The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype.

Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease.

HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.58 PTPMT1 Bryony Thompson Marked gene: PTPMT1 as ready
Intellectual disability syndromic and non-syndromic v1.58 PTPMT1 Bryony Thompson Gene: ptpmt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.58 PTPMT1 Bryony Thompson Classified gene: PTPMT1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.58 PTPMT1 Bryony Thompson Gene: ptpmt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.57 PTPMT1 Bryony Thompson gene: PTPMT1 was added
gene: PTPMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPMT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTPMT1 were set to 39279645; 37672386
Phenotypes for gene: PTPMT1 were set to inborn mitochondrial metabolism disorder MONDO:0004069
Review for gene: PTPMT1 was set to GREEN
Added comment: 6 cases from 3 independent families with biallelic variants in PTPMT1 (a mitochondrial tyrosine phosphatase required for de novo cardiolipin biosynthesis). All cases presented with a complex, neonatal/infantile onset neurological and neurodevelopmental syndrome including developmental delay, microcephaly, facial dysmorphism, epilepsy, spasticity, cerebellar ataxia and nystagmus, sensorineural hearing loss, optic atrophy and bulbar dysfunction. Supporting knockout zebrafish and mouse models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Marked gene: ITGAV as ready
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Classified gene: ITGAV as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Marked gene: ITGAV as ready
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Classified gene: ITGAV as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.56 ITGAV Zornitza Stark Gene: itgav has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.55 ITGAV Zornitza Stark gene: ITGAV was added
gene: ITGAV was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ITGAV was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ITGAV were set to 39526957
Phenotypes for gene: ITGAV were set to Syndromic disease, MONDO:0002254, ITGAV-related
Review for gene: ITGAV was set to AMBER
Added comment: Three unrelated families reported: two with affected children (one hmz missense; other compound het LoF with missense) and one family with four affected fetuses. Clinical features included brain and eye anomalies and IBD/immune dysregulation. TGF-beta signalling pathway affected. The deletion of itgav in zebrafish recapitulated patient phenotypes including retinal and brain defects and the loss of microglia in early development as well as colitis in juvenile zebrafish with reduced SMAD3 expression and transcriptional regulation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.54 RYBP Zornitza Stark Classified gene: RYBP as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.54 RYBP Zornitza Stark Gene: rybp has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.53 RYBP Zornitza Stark Marked gene: RYBP as ready
Intellectual disability syndromic and non-syndromic v1.53 RYBP Zornitza Stark Gene: rybp has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.53 RYBP Zornitza Stark Classified gene: RYBP as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.53 RYBP Zornitza Stark Gene: rybp has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.52 RYBP Zornitza Stark gene: RYBP was added
gene: RYBP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RYBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RYBP were set to 39891528
Phenotypes for gene: RYBP were set to Neurodevelopmental disorder, MONDO:0700092, RYBP-related
Review for gene: RYBP was set to GREEN
Added comment: Seven individuals with heterozygous de novo variants in RYBP reported. Clinical findings include severe developmental delay, dysmorphisms and multiple congenital anomalies. All the single nucleotide variants in RYBP localized to the N-terminal domain of the gene, which encodes the zinc finger domain and ubiquitin binding moiety. Further supportive in vitro and Drosophila functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.51 SEL1L Zornitza Stark Phenotypes for gene: SEL1L were changed from Neurodevelopmental disorder, MONDO:0700092, SEL1L-related to Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068; Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067
Intellectual disability syndromic and non-syndromic v1.50 SEL1L Zornitza Stark reviewed gene: SEL1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068, Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.50 MGA Zornitza Stark Classified gene: MGA as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.50 MGA Zornitza Stark Gene: mga has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.49 MGA Zornitza Stark edited their review of gene: MGA: Added comment: Note LoF variants now also associated with POF, supportive mouse model. Downgrade to Amber until further delineation of phenotypes and mechanisms.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.49 TRPM7 Zornitza Stark Marked gene: TRPM7 as ready
Intellectual disability syndromic and non-syndromic v1.49 TRPM7 Zornitza Stark Gene: trpm7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.49 TRPM7 Zornitza Stark Phenotypes for gene: TRPM7 were changed from Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related to Familial primary hypomagnesaemia, MONDO:0018100, TRPM7-related
Intellectual disability syndromic and non-syndromic v1.48 TRPM7 Zornitza Stark Classified gene: TRPM7 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.48 TRPM7 Zornitza Stark Gene: trpm7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.47 TRPM7 Zornitza Stark gene: TRPM7 was added
gene: TRPM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRPM7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPM7 were set to 35561741; 35712613; 39099563
Phenotypes for gene: TRPM7 were set to Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related
Review for gene: TRPM7 was set to GREEN
Added comment: Protein expressed in the distal tubule, related to TRPM6. Postulated link with hypoMg with secondary hypoCa.
PMID 35561741: two families reported with dominant inheritance. F1: three affected individuals with splicing variant; some supportive functional data. F2: single affected individual, de novo missense variant.
PMID 35712613: de novo missense variant in an individual with hypoMg.
PMID 39099563: three affected individuals with missense variants, all de novo. Probands had DD, two had seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.46 TAOK2 Zornitza Stark Marked gene: TAOK2 as ready
Intellectual disability syndromic and non-syndromic v1.46 TAOK2 Zornitza Stark Gene: taok2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.46 TAOK2 Zornitza Stark Classified gene: TAOK2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.46 TAOK2 Zornitza Stark Gene: taok2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.45 TAOK2 Zornitza Stark gene: TAOK2 was added
gene: TAOK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAOK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAOK2 were set to 39737487
Phenotypes for gene: TAOK2 were set to neurodevelopmental disorder, MONDO:0700092, TAOK2-related
Review for gene: TAOK2 was set to GREEN
Added comment: PMID:39737487 reported 10 individuals with monoallelic TAOK2 variants and with a neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.44 GTF3C3 Chirag Patel reviewed gene: GTF3C3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39636576; Phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF3C3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.44 INPP4A Chirag Patel Classified gene: INPP4A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.44 INPP4A Chirag Patel Gene: inpp4a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.43 INPP4A Chirag Patel reviewed gene: INPP4A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39315527; Phenotypes: INPP4A-related neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.43 LRRC45 Zornitza Stark Marked gene: LRRC45 as ready
Intellectual disability syndromic and non-syndromic v1.43 LRRC45 Zornitza Stark Gene: lrrc45 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.43 LRRC45 Zornitza Stark Classified gene: LRRC45 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.43 LRRC45 Zornitza Stark Gene: lrrc45 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.42 LRRC45 Zornitza Stark gene: LRRC45 was added
gene: LRRC45 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC45 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LRRC45 were set to 39638757
Phenotypes for gene: LRRC45 were set to Neurodevelopmental disorder MONDO:0700092, LRRC45-related
Review for gene: LRRC45 was set to AMBER
Added comment: Three individuals from two families reported with two homozygous variants, one splice site and the other missense. Features of a neurological ciliopathy with some supportive experimental evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.41 WASHC3 Zornitza Stark Marked gene: WASHC3 as ready
Intellectual disability syndromic and non-syndromic v1.41 WASHC3 Zornitza Stark Gene: washc3 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.41 WASHC3 Zornitza Stark gene: WASHC3 was added
gene: WASHC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WASHC3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915
Phenotypes for gene: WASHC3 were set to neurodevelopmental disorder MONDO:0700092, WASHC3 related
Review for gene: WASHC3 was set to RED
Added comment: One family with de novo missense. Two families with homozygous start loss variant. The functional evidence provided does not directly link to the human phenotype. Given two variants and two different MOIs, RED rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.40 NAV3 Zornitza Stark Marked gene: NAV3 as ready
Intellectual disability syndromic and non-syndromic v1.40 NAV3 Zornitza Stark Gene: nav3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.40 NAV3 Zornitza Stark Classified gene: NAV3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.40 NAV3 Zornitza Stark Gene: nav3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.39 NAV3 Zornitza Stark gene: NAV3 was added
gene: NAV3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAV3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAV3 were set to 39708122; 38977784
Phenotypes for gene: NAV3 were set to Neurodevelopmental disorder, MONDO:0700092, NAV3-related
Review for gene: NAV3 was set to GREEN
Added comment: 17 individuals from 11 families reported with bi-allelic variants and neurodevelopmental phenotypes, including DD/ID and behavioural abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.38 EEFSEC Zornitza Stark Marked gene: EEFSEC as ready
Intellectual disability syndromic and non-syndromic v1.38 EEFSEC Zornitza Stark Gene: eefsec has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.38 EEFSEC Zornitza Stark Classified gene: EEFSEC as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.38 EEFSEC Zornitza Stark Gene: eefsec has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.37 EEFSEC Zornitza Stark gene: EEFSEC was added
gene: EEFSEC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EEFSEC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EEFSEC were set to 39753114
Phenotypes for gene: EEFSEC were set to Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related
Review for gene: EEFSEC was set to GREEN
Added comment: Nine individuals from 8 unrelated families reported with bi-allelic variants in this gene and progressive neurodevelopmental disorder manifesting with global developmental delay, progressive spasticity, ataxia, and seizures. Cerebral MRI primarily demonstrated a cerebellar pathology, including hypoplasia and progressive atrophy. In line with the clinical phenotype, an eEFSec-RNAi Drosophila model displays progressive impairment of motor function, which is reflected in the synaptic defects in this model organisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.36 LRRC8C Zornitza Stark Marked gene: LRRC8C as ready
Intellectual disability syndromic and non-syndromic v1.36 LRRC8C Zornitza Stark Gene: lrrc8c has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.36 LRRC8C Zornitza Stark Classified gene: LRRC8C as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.36 LRRC8C Zornitza Stark Gene: lrrc8c has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.35 CCT3 Zornitza Stark reviewed gene: CCT3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with speech or visual impairment and brain hypomyelination, MIM# 621034; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.35 TCP1 Zornitza Stark Phenotypes for gene: TCP1 were changed from neurodevelopmental disorder MONDO:0700092, TCP1-related to Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021
Intellectual disability syndromic and non-syndromic v1.34 TCP1 Zornitza Stark reviewed gene: TCP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.34 EP400 Bryony Thompson Marked gene: EP400 as ready
Intellectual disability syndromic and non-syndromic v1.34 EP400 Bryony Thompson Gene: ep400 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.34 EP400 Bryony Thompson Classified gene: EP400 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.34 EP400 Bryony Thompson Gene: ep400 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.33 EP400 Sangavi Sivagnanasundram gene: EP400 was added
gene: EP400 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EP400 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EP400 were set to 39708813
Phenotypes for gene: EP400 were set to neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930
Review for gene: EP400 was set to GREEN
Added comment: 6 unrelated probands presenting with epilepsy with NDD (including ID and DD) had compound heterozygous variants in EP400. They were confirmed in trans and inherited from their asymptomatic parents.

Knockdown of EP400 ortholog in Drosophila showed an increase in seizure-like susceptibility and abnormal neurological behaviour.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.33 LRRC8C Sangavi Sivagnanasundram gene: LRRC8C was added
gene: LRRC8C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC8C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: LRRC8C were set to 39623139
Phenotypes for gene: LRRC8C were set to TIMES syndrome MIM#621056
Mode of pathogenicity for gene: LRRC8C was set to Other
Review for gene: LRRC8C was set to AMBER
Added comment: TIMES syndrome is a multisystem disorder characterised by considerable phenotypic variability, but overlapping features include telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature. Patients exhibit striking cutis marmorata in infancy.

Two individuals from unrelated families presenting with similar features consistent with TIMES syndrome.
Leu400IlefsTer8 and Val390Leu variants were identified however the proposed mechanism of disease is GoF.
Supporting in vitro functional assay was conducted however further evidence is required to upgrade the gene classification.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.33 RICTOR Bryony Thompson Marked gene: RICTOR as ready
Intellectual disability syndromic and non-syndromic v1.33 RICTOR Bryony Thompson Gene: rictor has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.33 RICTOR Bryony Thompson Classified gene: RICTOR as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.33 RICTOR Bryony Thompson Gene: rictor has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.32 RICTOR Bryony Thompson gene: RICTOR was added
gene: RICTOR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RICTOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RICTOR were set to 39738822
Phenotypes for gene: RICTOR were set to Neurodevelopmental disorder MONDO:0700092, RICTOR-related
Review for gene: RICTOR was set to GREEN
Added comment: 8 unrelated cases presenting with ID and/or developmental delay with de novo or heterozygous variants inherited from one affected parent, including three missense variants, four loss-of-function variants and one 3 kb deletion encompassing RICTOR. Possible gain of function and loss of function mechanism of disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.31 UBR5 Bryony Thompson Marked gene: UBR5 as ready
Intellectual disability syndromic and non-syndromic v1.31 UBR5 Bryony Thompson Gene: ubr5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.31 UBR5 Bryony Thompson Classified gene: UBR5 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.31 UBR5 Bryony Thompson Gene: ubr5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.30 UBR5 Bryony Thompson gene: UBR5 was added
gene: UBR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBR5 were set to 39721588
Phenotypes for gene: UBR5 were set to Neurodevelopmental disorder MONDO:0700092, UBR5-related
Review for gene: UBR5 was set to GREEN
Added comment: 29 individuals with a neurodevelopment syndrome (24 de novo variants) with a core phenotype characterised by developmental delay (26/28), autism (16/26), and intellectual disability (56%). Additionally, some individuals presented with epilepsy/seizures (11/27), movement disorders, and/or genital anomalies (35%). Loss of function is the expected mechanism of disease with functional experiments in C. elegans and in vitro ubiquitination assays.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.29 ZNF711 Zornitza Stark Phenotypes for gene: ZNF711 were changed from Mental retardation, X-linked 97; OMIM #300803 to Intellectual developmental disorder, X-linked 97, MIM# 300803
Intellectual disability syndromic and non-syndromic v1.28 ZNF711 Zornitza Stark reviewed gene: ZNF711: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 97, MIM# 300803; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.28 FRYL Zornitza Stark Phenotypes for gene: FRYL were changed from neurodevelopmental disorder MONDO:0700092, FRYL-related to Pan-Chung-Bellen syndrome, MIM# 621049
Intellectual disability syndromic and non-syndromic v1.27 FRYL Zornitza Stark reviewed gene: FRYL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pan-Chung-Bellen syndrome, MIM# 621049; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.27 PIGG Ain Roesley Phenotypes for gene: PIGG were changed from Mental retardation, autosomal recessive 53, MIM#616917 to Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy MIM#616917
Intellectual disability syndromic and non-syndromic v1.26 RUNX1T1 Zornitza Stark Marked gene: RUNX1T1 as ready
Intellectual disability syndromic and non-syndromic v1.26 RUNX1T1 Zornitza Stark Gene: runx1t1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.26 RUNX1T1 Zornitza Stark Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340
Intellectual disability syndromic and non-syndromic v1.25 RUNX1T1 Zornitza Stark Phenotypes for gene: RUNX1T1 were changed from Neurodevelopmental disorder MONDO:0700092 to Neurodevelopmental disorder MONDO:0700092, RUNX1T1-related
Intellectual disability syndromic and non-syndromic v1.24 RUNX1T1 Chirag Patel Classified gene: RUNX1T1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.24 RUNX1T1 Chirag Patel Gene: runx1t1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.23 RUNX1T1 Chirag Patel gene: RUNX1T1 was added
gene: RUNX1T1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RUNX1T1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340
Phenotypes for gene: RUNX1T1 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: RUNX1T1 was set to GREEN
Added comment: RUNX1T1 encodes a transcription regulator for hematopoietic genes and is well-known for its involvement in hematologic malignancies. Germline RUNX1T1 variants may also play a role in human congenital neurodevelopmental disorders.

PMID: 39568205
3 unrelated individuals with developmental delay, learning disability, ASD, ADHD, and dysmorphism (1 x heart defects). Trio WES identified de novo variants in RUNX1T1 gene (1 x nonsense variant in 5' region [p.Gln36Ter], 2 x missense variants in C-terminus [p.Gly412Arg and p.His521Tyr]).

PMID: 19172993
1 individual with mild-moderate ID and congenital heart disease, and chromosome t(5;8)(q32;q21.3) translocation. Molecular characterization revealed that one of the break points was within the RUNX1T1 gene. Analysis of RUNX1T1 expression in human embryonic and fetal tissues suggests a role of RUNX1T1 in brain and heart development.

PMID: 22644616
1 individual with mild ID and dysmorphism, and de novo deletion exons 3-7 in RUNX1T1.

PMID: 31223340
1 individual with ID, anaemia, atrial septal defect, dysmorphism, and seizures. Found to have a 2.1 Mb deletion at 8q21.3q22.1 involving entire RUNX1T1 gene (and 2 adjacent genes - SLC26A7 and TRIQK), and a benign familial 4.3 Mb duplication at 1p22.1p21.3 (present in unaffected healthy brother).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.22 CAPZA2 Zornitza Stark Phenotypes for gene: CAPZA2 were changed from Intellectual disability to Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related
Intellectual disability syndromic and non-syndromic v1.21 CAPZA2 Zornitza Stark Publications for gene: CAPZA2 were set to 32338762
Intellectual disability syndromic and non-syndromic v1.20 CAPZA2 Zornitza Stark Classified gene: CAPZA2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.20 CAPZA2 Zornitza Stark Gene: capza2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.19 CAPZA2 Chris Ciotta reviewed gene: CAPZA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32338762, 38374166, 35856264; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v1.19 CCT6A Ain Roesley Classified gene: CCT6A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.19 CCT6A Ain Roesley Gene: cct6a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.18 CCT6A Ain Roesley Marked gene: CCT6A as ready
Intellectual disability syndromic and non-syndromic v1.18 CCT6A Ain Roesley Gene: cct6a has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.18 CCT6A Ain Roesley gene: CCT6A was added
gene: CCT6A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCT6A were set to 39480921
Phenotypes for gene: CCT6A were set to neurodevelopmental disorder MONDO:0700092, CCT6A-related
Penetrance for gene: CCT6A were set to Complete
Review for gene: CCT6A was set to GREEN
gene: CCT6A was marked as current diagnostic
Added comment: previously known as CCT6

5x individuals including 4x de novo
3x PTCS + 1x +5C>G + 1x missense

4/5 DD/ID
2/5 visual impairment
2/5 seizures
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.17 TCP1 Ain Roesley Marked gene: TCP1 as ready
Intellectual disability syndromic and non-syndromic v1.17 TCP1 Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.17 TCP1 Ain Roesley Classified gene: TCP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.17 TCP1 Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.17 TCP1 Ain Roesley Classified gene: TCP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.17 TCP1 Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.16 TCP1 Ain Roesley gene: TCP1 was added
gene: TCP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TCP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TCP1 were set to 39480921
Phenotypes for gene: TCP1 were set to neurodevelopmental disorder MONDO:0700092, TCP1-related
Penetrance for gene: TCP1 were set to Complete
Review for gene: TCP1 was set to GREEN
gene: TCP1 was marked as current diagnostic
Added comment: previously known as CCT1

8x individuals including 5x de novo
6x PTCs + 2x missense

6/8 DD/ID
2/8 visual impairment
6/8 seizures
6/8 polymicrogyria + 1x Ventriculomegaly, white matter hyperintensities
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.15 CCT3 Ain Roesley Classified gene: CCT3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.15 CCT3 Ain Roesley Gene: cct3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.15 CCT3 Ain Roesley Marked gene: CCT3 as ready
Intellectual disability syndromic and non-syndromic v1.15 CCT3 Ain Roesley Gene: cct3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.15 CCT3 Ain Roesley Classified gene: CCT3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.15 CCT3 Ain Roesley Gene: cct3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.14 CCT3 Ain Roesley gene: CCT3 was added
gene: CCT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCT3 were set to 39480921
Phenotypes for gene: CCT3 were set to neurodevelopmental disorder MONDO:0700092, CCT3-related
Penetrance for gene: CCT3 were set to Complete
Review for gene: CCT3 was set to GREEN
gene: CCT3 was marked as current diagnostic
Added comment: 4x de novo - 3x PTCs and 1x missense

overlapping phenotypes:
4/4 ID/DD
3/4 visual impairment
2/4 seizures
4/4 Hypomyelination of white matter
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.13 CLASP1 Ain Roesley Marked gene: CLASP1 as ready
Intellectual disability syndromic and non-syndromic v1.13 CLASP1 Ain Roesley Gene: clasp1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.13 CLASP1 Ain Roesley gene: CLASP1 was added
gene: CLASP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLASP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CLASP1 were set to 39040917
Phenotypes for gene: CLASP1 were set to neurodevelopmental disorder MONDO:0700092, CLASP1-related
Review for gene: CLASP1 was set to RED
gene: CLASP1 was marked as current diagnostic
Added comment: 3 siblings from a consanguineous family, homozygous for p.(Arg1481His)
at birth, all had low weight and microcephaly (< 3-4SD), profound dev delay, spasticity, seizures and lissencephaly

Arg1481His - 3 hets 0 Homs in v4
codon is highly conserved with a high REVEL score 0.83
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.12 GPATCH11 Zornitza Stark Publications for gene: GPATCH11 were set to
Intellectual disability syndromic and non-syndromic v1.11 GPATCH11 Zornitza Stark reviewed gene: GPATCH11: Rating: GREEN; Mode of pathogenicity: None; Publications: 39572588; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.11 MGA Zornitza Stark Marked gene: MGA as ready
Intellectual disability syndromic and non-syndromic v1.11 MGA Zornitza Stark Gene: mga has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.11 MGA Zornitza Stark Classified gene: MGA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.11 MGA Zornitza Stark Gene: mga has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.10 MGA Zornitza Stark gene: MGA was added
gene: MGA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MGA were set to 39600096; 20044811
Phenotypes for gene: MGA were set to Syndromic disease, MONDO:0002254, MGA-related
Review for gene: MGA was set to GREEN
Added comment: Three individuals with de novo LoF variants reported in individuals with ID and congenital anomalies. Zebrafish model supports role of this transcription factor in organogenesis. Note there are previous, less clear reports of association with NDD/CHD. Gene is constrained for LoF variants in gnomad v4; however, note there are ~30 individuals with LoF variants present. Borderline Green/Amber.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.9 PPP2R2B Bryony Thompson Marked gene: PPP2R2B as ready
Intellectual disability syndromic and non-syndromic v1.9 PPP2R2B Bryony Thompson Gene: ppp2r2b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.9 PPP2R2B Bryony Thompson Classified gene: PPP2R2B as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.9 PPP2R2B Bryony Thompson Gene: ppp2r2b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.8 PPP2R2B Bryony Thompson Classified gene: PPP2R2B as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.8 PPP2R2B Bryony Thompson Gene: ppp2r2b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.7 PPP2R2B Bryony Thompson gene: PPP2R2B was added
gene: PPP2R2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP2R2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R2B were set to 25356899; 39565297
Phenotypes for gene: PPP2R2B were set to Neurodevelopmental disorder MONDO:0700092, PPP2R2B-related
Review for gene: PPP2R2B was set to AMBER
Added comment: 5 cases with NDD and heterozygous missense (4/5 confirmed de novo): p.Thr246Lys (unknown inheritance), p.Asn310Lys (confirmed de novo), p.Glu37Lys (confirmed de novo, also had RNU4-2 path de novo Path variant), p.Ile427Thr (confirmed de novo, also had TAOK1 inherited Path variant), p.Arg149Pro (confirmed de novo). 5/5 with intellectual disability and developmental delay, 4/5 with seizures, 2/5 with hearing loss/auditory neuropathy. Study includes in vitro functional assays supporting a possible loss of function mechanism of disease. The 2 missense with additional diagnoses (E37K & I427T) demonstrated a partial reduction in PP2A holoenzyme assembly. Only 3 cases with a possible diagnosis that could be attributed to the PPP2R2B only, and only 2 were confirmed de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.6 WDR47 Bryony Thompson Marked gene: WDR47 as ready
Intellectual disability syndromic and non-syndromic v1.6 WDR47 Bryony Thompson Gene: wdr47 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.6 WDR47 Bryony Thompson Classified gene: WDR47 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.6 WDR47 Bryony Thompson Gene: wdr47 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.5 WDR47 Bryony Thompson gene: WDR47 was added
gene: WDR47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR47 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR47 were set to 39609633
Phenotypes for gene: WDR47 were set to Complex neurodevelopmental disorder MONDO:0100038, WDR47-related
Review for gene: WDR47 was set to GREEN
Added comment: 7 cases from 5 unrelated families with biallelic variants and a complex neurodevelopmental syndrome. The most frequent phenotypes were corpus callosum dysgenesis (7/7), microcephaly (7/7), mild to severe intellectual disability (7/7), epilepsy (7/7). Additionally, mouse models recapitulate the human phenotype. Loss of function is the mechanism of disease. Heterozygous parents had no phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.4 PPP5C Bryony Thompson Marked gene: PPP5C as ready
Intellectual disability syndromic and non-syndromic v1.4 PPP5C Bryony Thompson Gene: ppp5c has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.4 PPP5C Bryony Thompson Classified gene: PPP5C as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.4 PPP5C Bryony Thompson Gene: ppp5c has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.3 PPP5C Lucy Spencer gene: PPP5C was added
gene: PPP5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP5C were set to 35361529; 25363768; 33057194
Phenotypes for gene: PPP5C were set to Neurodevelopmental disorder, MONDO:0700092, PPP5C-related
Review for gene: PPP5C was set to AMBER
Added comment: PMID: 35361529 - reported a de novo missense in a proband with microcephaly, developmental delay and epilepsy. However, after personal communication with the undiagnosed disease network this proband has since been found to have a different diagnosis with a nonsense and a missense in VARS1 identified, so unclear if the PPP5C variant is contributing to their phenotype.

3 more probands with de novo missense variants have been published in large autism or developmental disorder cohort with limited information (PMIDs: 25363768, 33057194)

An internal VCGS proband with intellectual disability and failure to thrive was also found to have a de novo missense variant in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.3 WDR83OS Zornitza Stark Phenotypes for gene: WDR83OS were changed from complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia to Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016
Intellectual disability syndromic and non-syndromic v1.2 WDR83OS Zornitza Stark reviewed gene: WDR83OS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.2 SLC35F1 Zornitza Stark Classified gene: SLC35F1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.2 SLC35F1 Zornitza Stark Gene: slc35f1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.1 SLC35F1 Zornitza Stark edited their review of gene: SLC35F1: Added comment: Likely second individual identified internally at VCGS, AS/Rett-like phenotype and de novo Gly226Arg variant.; Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.1 LINC01578 Zornitza Stark Phenotypes for gene: LINC01578 were changed from Neurodevelopmental disorder, MONDO:0700092, CHASERR-related to Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012
Intellectual disability syndromic and non-syndromic v1.0 LINC01578 Zornitza Stark edited their review of gene: LINC01578: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012
Intellectual disability syndromic and non-syndromic v1.0 Zornitza Stark promoted panel to version 1.0
Intellectual disability syndromic and non-syndromic v0.6911 FMR1 Zornitza Stark Marked gene: FMR1 as ready
Intellectual disability syndromic and non-syndromic v0.6911 FMR1 Zornitza Stark Gene: fmr1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6911 FMR1 Zornitza Stark Phenotypes for gene: FMR1 were changed from to fragile X syndrome MONDO:0010383
Intellectual disability syndromic and non-syndromic v0.6910 FMR1 Zornitza Stark Publications for gene: FMR1 were set to
Intellectual disability syndromic and non-syndromic v0.6909 FMR1 Zornitza Stark Mode of inheritance for gene: FMR1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6908 FRAXE Zornitza Stark Marked STR: FRAXE as ready
Intellectual disability syndromic and non-syndromic v0.6908 FRAXE Zornitza Stark Str: fraxe has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6908 FRAXE Zornitza Stark Tag STR tag was added to STR: FRAXE.
Intellectual disability syndromic and non-syndromic v0.6908 HADHA Zornitza Stark Marked gene: HADHA as ready
Intellectual disability syndromic and non-syndromic v0.6908 HADHA Zornitza Stark Gene: hadha has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6908 HADHA Zornitza Stark Phenotypes for gene: HADHA were changed from to long chain 3-hydroxyacyl-CoA dehydrogenase deficiency MONDO:0012173
Intellectual disability syndromic and non-syndromic v0.6907 HADHA Zornitza Stark Publications for gene: HADHA were set to
Intellectual disability syndromic and non-syndromic v0.6906 HADHA Zornitza Stark Mode of inheritance for gene: HADHA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6905 PEX14 Zornitza Stark Marked gene: PEX14 as ready
Intellectual disability syndromic and non-syndromic v0.6905 PEX14 Zornitza Stark Gene: pex14 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6905 AHSG Zornitza Stark Marked gene: AHSG as ready
Intellectual disability syndromic and non-syndromic v0.6905 AHSG Zornitza Stark Gene: ahsg has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.6905 STN1 Zornitza Stark Marked gene: STN1 as ready
Intellectual disability syndromic and non-syndromic v0.6905 STN1 Zornitza Stark Gene: stn1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6905 STN1 Zornitza Stark Phenotypes for gene: STN1 were changed from cerebral calcification; premature ageing; bone marrow failure; retinal telangiactasia; hepatic fibrosis to Cerebroretinal microangiopathy with calcification and cysts 2, MIM#617341
Intellectual disability syndromic and non-syndromic v0.6904 PCNT Zornitza Stark Marked gene: PCNT as ready
Intellectual disability syndromic and non-syndromic v0.6904 PCNT Zornitza Stark Gene: pcnt has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6904 PCNT Zornitza Stark Phenotypes for gene: PCNT were changed from to Microcephalic osteodysplastic primordial dwarfism, type II MIM#210720
Intellectual disability syndromic and non-syndromic v0.6903 PCNT Zornitza Stark Publications for gene: PCNT were set to
Intellectual disability syndromic and non-syndromic v0.6902 PCNT Zornitza Stark Mode of inheritance for gene: PCNT was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6901 PCNT Zornitza Stark Mode of inheritance for gene: PCNT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6901 PCNT Zornitza Stark Classified gene: PCNT as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6901 PCNT Zornitza Stark Gene: pcnt has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6900 PCNT Zornitza Stark Classified gene: PCNT as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6900 PCNT Zornitza Stark Gene: pcnt has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6899 PC Zornitza Stark Marked gene: PC as ready
Intellectual disability syndromic and non-syndromic v0.6899 PC Zornitza Stark Gene: pc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6899 PC Zornitza Stark Phenotypes for gene: PC were changed from to Pyruvate carboxylase deficiency - MIM#266150
Intellectual disability syndromic and non-syndromic v0.6898 PC Zornitza Stark Publications for gene: PC were set to
Intellectual disability syndromic and non-syndromic v0.6897 PC Zornitza Stark Mode of inheritance for gene: PC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6896 PAX8 Zornitza Stark Marked gene: PAX8 as ready
Intellectual disability syndromic and non-syndromic v0.6896 PAX8 Zornitza Stark Gene: pax8 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6896 PAX8 Zornitza Stark Phenotypes for gene: PAX8 were changed from to Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700
Intellectual disability syndromic and non-syndromic v0.6895 PAX8 Zornitza Stark Publications for gene: PAX8 were set to
Intellectual disability syndromic and non-syndromic v0.6894 PAX8 Zornitza Stark Mode of inheritance for gene: PAX8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6893 PAX6 Zornitza Stark Marked gene: PAX6 as ready
Intellectual disability syndromic and non-syndromic v0.6893 PAX6 Zornitza Stark Gene: pax6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6893 PAX6 Zornitza Stark Phenotypes for gene: PAX6 were changed from Microphthalmia/coloboma 12, OMIM #120200 to Microphthalmia/coloboma 12, OMIM #120200
Intellectual disability syndromic and non-syndromic v0.6892 PAX6 Zornitza Stark Phenotypes for gene: PAX6 were changed from to Microphthalmia/coloboma 12, OMIM #120200
Intellectual disability syndromic and non-syndromic v0.6891 PAX6 Zornitza Stark Publications for gene: PAX6 were set to
Intellectual disability syndromic and non-syndromic v0.6890 PAX6 Zornitza Stark Mode of inheritance for gene: PAX6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6889 PARN Zornitza Stark Marked gene: PARN as ready
Intellectual disability syndromic and non-syndromic v0.6889 PARN Zornitza Stark Gene: parn has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6889 PARN Zornitza Stark Phenotypes for gene: PARN were changed from to Dyskeratosis congenita, autosomal recessive 6, MIM# 616353
Intellectual disability syndromic and non-syndromic v0.6888 PARN Zornitza Stark Publications for gene: PARN were set to
Intellectual disability syndromic and non-syndromic v0.6887 PARN Zornitza Stark Mode of inheritance for gene: PARN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6886 OTX2 Zornitza Stark Marked gene: OTX2 as ready
Intellectual disability syndromic and non-syndromic v0.6886 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6886 OTX2 Zornitza Stark Phenotypes for gene: OTX2 were changed from to Microphthalmia, syndromic 5, MIM# 610125; Pituitary hormone deficiency, combined, 6, MIM# 613986; Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125; Otocephaly-dysgnathia complex
Intellectual disability syndromic and non-syndromic v0.6885 OTX2 Zornitza Stark Publications for gene: OTX2 were set to
Intellectual disability syndromic and non-syndromic v0.6884 OTX2 Zornitza Stark Mode of inheritance for gene: OTX2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6883 OPA3 Zornitza Stark Marked gene: OPA3 as ready
Intellectual disability syndromic and non-syndromic v0.6883 OPA3 Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6883 OPA3 Zornitza Stark Phenotypes for gene: OPA3 were changed from to 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR; Optic atrophy 3 with cataract (MIM#165300), AD
Intellectual disability syndromic and non-syndromic v0.6882 OPA3 Zornitza Stark Publications for gene: OPA3 were set to 25159689; 31119193; 31928268
Intellectual disability syndromic and non-syndromic v0.6881 OPA3 Zornitza Stark Publications for gene: OPA3 were set to
Intellectual disability syndromic and non-syndromic v0.6880 OPA3 Zornitza Stark Mode of inheritance for gene: OPA3 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6879 OPA3 Zornitza Stark Mode of inheritance for gene: OPA3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6878 OCLN Zornitza Stark Marked gene: OCLN as ready
Intellectual disability syndromic and non-syndromic v0.6878 OCLN Zornitza Stark Gene: ocln has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6878 OCLN Zornitza Stark Phenotypes for gene: OCLN were changed from to Pseudo-TORCH syndrome 1, MIM#251290
Intellectual disability syndromic and non-syndromic v0.6877 OCLN Zornitza Stark Publications for gene: OCLN were set to
Intellectual disability syndromic and non-syndromic v0.6876 OCLN Zornitza Stark Mode of inheritance for gene: OCLN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6875 NRAS Zornitza Stark Marked gene: NRAS as ready
Intellectual disability syndromic and non-syndromic v0.6875 NRAS Zornitza Stark Gene: nras has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6875 NRAS Zornitza Stark Phenotypes for gene: NRAS were changed from to Noonan syndrome 6, MIM# 613224
Intellectual disability syndromic and non-syndromic v0.6874 NRAS Zornitza Stark Publications for gene: NRAS were set to
Intellectual disability syndromic and non-syndromic v0.6873 NRAS Zornitza Stark Mode of pathogenicity for gene: NRAS was changed from Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6872 NRAS Zornitza Stark Mode of pathogenicity for gene: NRAS was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6871 NRAS Zornitza Stark Mode of inheritance for gene: NRAS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6870 NPHP1 Zornitza Stark Marked gene: NPHP1 as ready
Intellectual disability syndromic and non-syndromic v0.6870 NPHP1 Zornitza Stark Gene: nphp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6870 NPHP1 Zornitza Stark Phenotypes for gene: NPHP1 were changed from to Joubert syndrome 4, MIM# 609583; Nephronophthisis 1, juvenile, MIM# 256100; Senior-Loken syndrome-1, MIM# 266900
Intellectual disability syndromic and non-syndromic v0.6869 NPHP1 Zornitza Stark Publications for gene: NPHP1 were set to 15138899; 32139166; 28347285; 8852662; 9856524
Intellectual disability syndromic and non-syndromic v0.6868 NPHP1 Zornitza Stark Publications for gene: NPHP1 were set to
Intellectual disability syndromic and non-syndromic v0.6867 NPHP1 Zornitza Stark Mode of inheritance for gene: NPHP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6866 NF1 Zornitza Stark Marked gene: NF1 as ready
Intellectual disability syndromic and non-syndromic v0.6866 NF1 Zornitza Stark Gene: nf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6866 NF1 Zornitza Stark Phenotypes for gene: NF1 were changed from to Neurofibromatosis, type 1 (MIM#162200)
Intellectual disability syndromic and non-syndromic v0.6865 NF1 Zornitza Stark Publications for gene: NF1 were set to 23931823; 10762507
Intellectual disability syndromic and non-syndromic v0.6864 NF1 Zornitza Stark Publications for gene: NF1 were set to
Intellectual disability syndromic and non-syndromic v0.6863 NF1 Zornitza Stark Mode of inheritance for gene: NF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6862 NDUFS8 Zornitza Stark Marked gene: NDUFS8 as ready
Intellectual disability syndromic and non-syndromic v0.6862 NDUFS8 Zornitza Stark Gene: ndufs8 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6862 NDUFS8 Zornitza Stark Phenotypes for gene: NDUFS8 were changed from Mitochondrial complex I deficiency, nuclear type 2 MIM#618222 to Mitochondrial complex I deficiency, nuclear type 2 MIM#618222
Intellectual disability syndromic and non-syndromic v0.6861 NDUFS8 Zornitza Stark Phenotypes for gene: NDUFS8 were changed from to Mitochondrial complex I deficiency, nuclear type 2 MIM#618222
Intellectual disability syndromic and non-syndromic v0.6861 NDUFS8 Zornitza Stark Publications for gene: NDUFS8 were set to 23430795; 9837812; 15159508; 22499348; 20818383; 20819849
Intellectual disability syndromic and non-syndromic v0.6860 NDUFS8 Zornitza Stark Publications for gene: NDUFS8 were set to 23430795; 9837812; 15159508; 22499348; 20818383; 20819849
Intellectual disability syndromic and non-syndromic v0.6859 NDUFS8 Zornitza Stark Publications for gene: NDUFS8 were set to
Intellectual disability syndromic and non-syndromic v0.6858 NDUFS8 Zornitza Stark Mode of inheritance for gene: NDUFS8 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6857 NDUFS8 Zornitza Stark Mode of inheritance for gene: NDUFS8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6856 NDUFS4 Zornitza Stark Phenotypes for gene: NDUFS4 were changed from Mitochondrial complex I deficiency, nuclear type 1, 252010; Leigh syndrome, MIM#252010 to Mitochondrial complex I deficiency, nuclear type 1, 252010; Leigh syndrome, MIM#252010
Intellectual disability syndromic and non-syndromic v0.6856 NDUFS4 Zornitza Stark Marked gene: NDUFS4 as ready
Intellectual disability syndromic and non-syndromic v0.6856 NDUFS4 Zornitza Stark Gene: ndufs4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6856 NDUFS4 Zornitza Stark Phenotypes for gene: NDUFS4 were changed from to Mitochondrial complex I deficiency, nuclear type 1, 252010; Leigh syndrome, MIM#252010
Intellectual disability syndromic and non-syndromic v0.6855 NDUFS4 Zornitza Stark Publications for gene: NDUFS4 were set to
Intellectual disability syndromic and non-syndromic v0.6854 NDUFS4 Zornitza Stark Mode of inheritance for gene: NDUFS4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6853 NDUFS4 Zornitza Stark Mode of inheritance for gene: NDUFS4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6852 NACC1 Zornitza Stark Marked gene: NACC1 as ready
Intellectual disability syndromic and non-syndromic v0.6852 NACC1 Zornitza Stark Gene: nacc1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6852 MYCN Zornitza Stark Marked gene: MYCN as ready
Intellectual disability syndromic and non-syndromic v0.6852 MYCN Zornitza Stark Gene: mycn has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6852 MYCN Zornitza Stark Phenotypes for gene: MYCN were changed from to Feingold syndrome 1 MIM#164280; Megalencephaly-polydactyly syndrome, MIM# 620748
Intellectual disability syndromic and non-syndromic v0.6851 MYCN Zornitza Stark reviewed gene: MYCN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Feingold syndrome 1 MIM#164280; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6851 MYCN Zornitza Stark Publications for gene: MYCN were set to
Intellectual disability syndromic and non-syndromic v0.6850 MYCN Zornitza Stark Mode of inheritance for gene: MYCN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6849 MED12L Zornitza Stark Marked gene: MED12L as ready
Intellectual disability syndromic and non-syndromic v0.6849 MED12L Zornitza Stark Gene: med12l has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6849 MED12L Zornitza Stark Phenotypes for gene: MED12L were changed from Intellectual disability; Seizures; Autism to Neurodevelopmental disorder, MONDO:0700092, MED12L-related; Intellectual disability; Seizures; Autism
Intellectual disability syndromic and non-syndromic v0.6848 LARS2 Zornitza Stark Marked gene: LARS2 as ready
Intellectual disability syndromic and non-syndromic v0.6848 LARS2 Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6848 LARS2 Zornitza Stark Phenotypes for gene: LARS2 were changed from to Perrault syndrome 4, MIM# 615300; Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021
Intellectual disability syndromic and non-syndromic v0.6847 LARS2 Zornitza Stark Publications for gene: LARS2 were set to
Intellectual disability syndromic and non-syndromic v0.6846 LARS2 Zornitza Stark Mode of inheritance for gene: LARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6845 LARGE1 Zornitza Stark Marked gene: LARGE1 as ready
Intellectual disability syndromic and non-syndromic v0.6845 LARGE1 Zornitza Stark Gene: large1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6845 LARGE1 Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840
Intellectual disability syndromic and non-syndromic v0.6844 LARGE1 Zornitza Stark Publications for gene: LARGE1 were set to
Intellectual disability syndromic and non-syndromic v0.6843 LARGE1 Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6842 LAMP2 Zornitza Stark Marked gene: LAMP2 as ready
Intellectual disability syndromic and non-syndromic v0.6842 LAMP2 Zornitza Stark Gene: lamp2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6842 LAMP2 Zornitza Stark Phenotypes for gene: LAMP2 were changed from Danon disease, MIM# 300257; MONDO:0010281 to Danon disease, MIM# 300257; MONDO:0010281
Intellectual disability syndromic and non-syndromic v0.6841 LAMP2 Zornitza Stark Phenotypes for gene: LAMP2 were changed from to Danon disease, MIM# 300257; MONDO:0010281
Intellectual disability syndromic and non-syndromic v0.6840 LAMP2 Zornitza Stark Publications for gene: LAMP2 were set to
Intellectual disability syndromic and non-syndromic v0.6839 LAMP2 Zornitza Stark Mode of inheritance for gene: LAMP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6838 KRAS Zornitza Stark Marked gene: KRAS as ready
Intellectual disability syndromic and non-syndromic v0.6838 KRAS Zornitza Stark Gene: kras has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6838 KRAS Zornitza Stark Phenotypes for gene: KRAS were changed from to Noonan syndrome 3, MIM# 609942; Cardiofaciocutaneous syndrome 2, MIM# 615278
Intellectual disability syndromic and non-syndromic v0.6837 KRAS Zornitza Stark Publications for gene: KRAS were set to
Intellectual disability syndromic and non-syndromic v0.6836 KRAS Zornitza Stark Mode of pathogenicity for gene: KRAS was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6835 KRAS Zornitza Stark Mode of inheritance for gene: KRAS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6834 KMT2E Zornitza Stark Marked gene: KMT2E as ready
Intellectual disability syndromic and non-syndromic v0.6834 KMT2E Zornitza Stark Gene: kmt2e has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6834 KMT2E Zornitza Stark Phenotypes for gene: KMT2E were changed from to O'Donnell-Luria-Rodan syndrome, MIM# 618512; Intellectual disability; Autism; Seizures
Intellectual disability syndromic and non-syndromic v0.6833 KMT2E Zornitza Stark Publications for gene: KMT2E were set to
Intellectual disability syndromic and non-syndromic v0.6832 KMT2E Zornitza Stark Mode of inheritance for gene: KMT2E was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6831 KAT6B Zornitza Stark Marked gene: KAT6B as ready
Intellectual disability syndromic and non-syndromic v0.6831 KAT6B Zornitza Stark Gene: kat6b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6831 KAT6B Zornitza Stark Phenotypes for gene: KAT6B were changed from KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 to KAT6B-related multiple congenital anomalies syndrome MONDO:0036042
Intellectual disability syndromic and non-syndromic v0.6830 KAT6B Zornitza Stark Phenotypes for gene: KAT6B were changed from to KAT6B-related multiple congenital anomalies syndrome MONDO:0036042
Intellectual disability syndromic and non-syndromic v0.6829 KAT6B Zornitza Stark Publications for gene: KAT6B were set to
Intellectual disability syndromic and non-syndromic v0.6828 KAT6B Zornitza Stark Mode of inheritance for gene: KAT6B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6827 KAT6A Zornitza Stark Marked gene: KAT6A as ready
Intellectual disability syndromic and non-syndromic v0.6827 KAT6A Zornitza Stark Gene: kat6a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6827 KAT6A Zornitza Stark Phenotypes for gene: KAT6A were changed from to syndromic intellectual disability MONDO:0000508
Intellectual disability syndromic and non-syndromic v0.6826 KAT6A Zornitza Stark Publications for gene: KAT6A were set to
Intellectual disability syndromic and non-syndromic v0.6825 KAT6A Zornitza Stark Mode of inheritance for gene: KAT6A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6824 INPP5K Zornitza Stark Marked gene: INPP5K as ready
Intellectual disability syndromic and non-syndromic v0.6824 INPP5K Zornitza Stark Gene: inpp5k has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6824 INPP5K Zornitza Stark Phenotypes for gene: INPP5K were changed from to congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607
Intellectual disability syndromic and non-syndromic v0.6823 INPP5K Zornitza Stark Publications for gene: INPP5K were set to
Intellectual disability syndromic and non-syndromic v0.6822 INPP5K Zornitza Stark Mode of inheritance for gene: INPP5K was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6821 IKBKG Zornitza Stark Marked gene: IKBKG as ready
Intellectual disability syndromic and non-syndromic v0.6821 IKBKG Zornitza Stark Gene: ikbkg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6821 IKBKG Zornitza Stark Phenotypes for gene: IKBKG were changed from to Incontinentia pigmenti MONDO:0010631
Intellectual disability syndromic and non-syndromic v0.6820 IKBKG Zornitza Stark Publications for gene: IKBKG were set to
Intellectual disability syndromic and non-syndromic v0.6819 IKBKG Zornitza Stark Mode of inheritance for gene: IKBKG was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6818 DHRSX Zornitza Stark Phenotypes for gene: DHRSX were changed from congenital disorder of glycosylation, MONDO:0015286, DHRSX-related to Congenital disorder of glycosylation, type 1DD, MIM# 301133
Intellectual disability syndromic and non-syndromic v0.6817 DHRSX Zornitza Stark edited their review of gene: DHRSX: Changed phenotypes: Congenital disorder of glycosylation, type 1DD, MIM# 301133
Intellectual disability syndromic and non-syndromic v0.6817 IFT172 Zornitza Stark Marked gene: IFT172 as ready
Intellectual disability syndromic and non-syndromic v0.6817 IFT172 Zornitza Stark Gene: ift172 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6817 IFT172 Zornitza Stark Phenotypes for gene: IFT172 were changed from to Bardet-Biedl syndrome MONDO:0015229
Intellectual disability syndromic and non-syndromic v0.6816 IFT172 Zornitza Stark Publications for gene: IFT172 were set to
Intellectual disability syndromic and non-syndromic v0.6815 IFT172 Zornitza Stark Mode of inheritance for gene: IFT172 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6814 IFIH1 Zornitza Stark Marked gene: IFIH1 as ready
Intellectual disability syndromic and non-syndromic v0.6814 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6814 IFIH1 Zornitza Stark Phenotypes for gene: IFIH1 were changed from to IFIH1-related type 1 interferonopathy MONDO:0700262
Intellectual disability syndromic and non-syndromic v0.6813 IFIH1 Zornitza Stark Publications for gene: IFIH1 were set to
Intellectual disability syndromic and non-syndromic v0.6812 IFIH1 Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6811 IDUA Zornitza Stark Marked gene: IDUA as ready
Intellectual disability syndromic and non-syndromic v0.6811 IDUA Zornitza Stark Gene: idua has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6811 IDUA Zornitza Stark Phenotypes for gene: IDUA were changed from to mucopolysaccharidosis type 1 MONDO:0001586
Intellectual disability syndromic and non-syndromic v0.6810 IDUA Zornitza Stark Publications for gene: IDUA were set to 20301341
Intellectual disability syndromic and non-syndromic v0.6809 IDUA Zornitza Stark Publications for gene: IDUA were set to
Intellectual disability syndromic and non-syndromic v0.6808 IDUA Zornitza Stark Mode of inheritance for gene: IDUA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6807 IDS Zornitza Stark Marked gene: IDS as ready
Intellectual disability syndromic and non-syndromic v0.6807 IDS Zornitza Stark Gene: ids has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6807 IDS Zornitza Stark Phenotypes for gene: IDS were changed from to mucopolysaccharidosis type 2 MONDO:0010674
Intellectual disability syndromic and non-syndromic v0.6806 IDS Zornitza Stark Publications for gene: IDS were set to
Intellectual disability syndromic and non-syndromic v0.6805 IDS Zornitza Stark Mode of inheritance for gene: IDS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6804 IDH2 Zornitza Stark Marked gene: IDH2 as ready
Intellectual disability syndromic and non-syndromic v0.6804 IDH2 Zornitza Stark Gene: idh2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6804 IDH2 Zornitza Stark Phenotypes for gene: IDH2 were changed from to mitochondrial disease MONDO:0044970
Intellectual disability syndromic and non-syndromic v0.6803 IDH2 Zornitza Stark Publications for gene: IDH2 were set to
Intellectual disability syndromic and non-syndromic v0.6802 IDH2 Zornitza Stark Mode of inheritance for gene: IDH2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6801 HTRA2 Zornitza Stark Marked gene: HTRA2 as ready
Intellectual disability syndromic and non-syndromic v0.6801 HTRA2 Zornitza Stark Gene: htra2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6801 HTRA2 Zornitza Stark Phenotypes for gene: HTRA2 were changed from to 3-methylglutaconic aciduria type 8 MONDO:0044723
Intellectual disability syndromic and non-syndromic v0.6800 HTRA2 Zornitza Stark Publications for gene: HTRA2 were set to
Intellectual disability syndromic and non-syndromic v0.6799 HTRA2 Zornitza Stark Mode of inheritance for gene: HTRA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6798 HSPD1 Zornitza Stark Marked gene: HSPD1 as ready
Intellectual disability syndromic and non-syndromic v0.6798 HSPD1 Zornitza Stark Gene: hspd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6798 HSPD1 Zornitza Stark Phenotypes for gene: HSPD1 were changed from Leukodystrophy, hypomyelinating, 4, MIM# 612233 to Leukodystrophy, hypomyelinating, 4, MIM# 612233
Intellectual disability syndromic and non-syndromic v0.6797 HSPD1 Zornitza Stark Phenotypes for gene: HSPD1 were changed from Leukodystrophy, hypomyelinating, 4, MIM# 612233 to Leukodystrophy, hypomyelinating, 4, MIM# 612233
Intellectual disability syndromic and non-syndromic v0.6796 HSPD1 Zornitza Stark Phenotypes for gene: HSPD1 were changed from to Leukodystrophy, hypomyelinating, 4, MIM# 612233
Intellectual disability syndromic and non-syndromic v0.6795 HSPD1 Zornitza Stark Publications for gene: HSPD1 were set to
Intellectual disability syndromic and non-syndromic v0.6794 HSPD1 Zornitza Stark Mode of inheritance for gene: HSPD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6793 HSPD1 Zornitza Stark reviewed gene: HSPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571143, 27405012, 32532876, 28377887, 27405012, 11898127, 17420924; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM# 612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6793 HSD17B10 Zornitza Stark Phenotypes for gene: HSD17B10 were changed from HSD10 mitochondrial disease MONDO:0010327 to HSD10 mitochondrial disease MONDO:0010327
Intellectual disability syndromic and non-syndromic v0.6792 HSD17B10 Zornitza Stark Marked gene: HSD17B10 as ready
Intellectual disability syndromic and non-syndromic v0.6792 HSD17B10 Zornitza Stark Gene: hsd17b10 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6792 HSD17B10 Zornitza Stark Phenotypes for gene: HSD17B10 were changed from to HSD10 mitochondrial disease MONDO:0010327
Intellectual disability syndromic and non-syndromic v0.6791 HSD17B10 Zornitza Stark Publications for gene: HSD17B10 were set to
Intellectual disability syndromic and non-syndromic v0.6790 HSD17B10 Zornitza Stark Mode of inheritance for gene: HSD17B10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6789 HPRT1 Zornitza Stark Marked gene: HPRT1 as ready
Intellectual disability syndromic and non-syndromic v0.6789 HPRT1 Zornitza Stark Gene: hprt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6789 HPRT1 Zornitza Stark Phenotypes for gene: HPRT1 were changed from to Lesch-Nyhan syndrome MONDO:0010298
Intellectual disability syndromic and non-syndromic v0.6788 HPRT1 Zornitza Stark Publications for gene: HPRT1 were set to
Intellectual disability syndromic and non-syndromic v0.6787 HPRT1 Zornitza Stark Mode of inheritance for gene: HPRT1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6786 HPD Zornitza Stark Marked gene: HPD as ready
Intellectual disability syndromic and non-syndromic v0.6786 HPD Zornitza Stark Gene: hpd has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6786 HPD Zornitza Stark Phenotypes for gene: HPD were changed from to tyrosinemia type III MONDO:0010162
Intellectual disability syndromic and non-syndromic v0.6785 HPD Zornitza Stark Publications for gene: HPD were set to
Intellectual disability syndromic and non-syndromic v0.6784 HPD Zornitza Stark Mode of inheritance for gene: HPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6783 HPD Zornitza Stark reviewed gene: HPD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6783 HOXA1 Zornitza Stark Marked gene: HOXA1 as ready
Intellectual disability syndromic and non-syndromic v0.6783 HOXA1 Zornitza Stark Gene: hoxa1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6783 HOXA1 Zornitza Stark Mode of inheritance for gene: HOXA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6782 HOXA1 Zornitza Stark Publications for gene: HOXA1 were set to
Intellectual disability syndromic and non-syndromic v0.6781 HOXA1 Zornitza Stark Phenotypes for gene: HOXA1 were changed from to Bosley-Salih-Alorainy syndrome, MIM#601536 and Athabaskan brainstem dysgenesis syndrome, MIM#601536
Intellectual disability syndromic and non-syndromic v0.6780 HNRNPK Zornitza Stark Marked gene: HNRNPK as ready
Intellectual disability syndromic and non-syndromic v0.6780 HNRNPK Zornitza Stark Gene: hnrnpk has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6780 HNRNPK Zornitza Stark Phenotypes for gene: HNRNPK were changed from to neurodevelopmental disorder-craniofacial dysmorphism-cardiac defect-hip dysplasia syndrome (Au-Kline syndrome) MONDO:0018681
Intellectual disability syndromic and non-syndromic v0.6779 HNRNPK Zornitza Stark Publications for gene: HNRNPK were set to
Intellectual disability syndromic and non-syndromic v0.6778 HNRNPK Zornitza Stark Mode of inheritance for gene: HNRNPK was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6777 HMGCL Zornitza Stark Marked gene: HMGCL as ready
Intellectual disability syndromic and non-syndromic v0.6777 HMGCL Zornitza Stark Gene: hmgcl has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6777 HMGCL Zornitza Stark Phenotypes for gene: HMGCL were changed from to 3-hydroxy-3-methylglutaric aciduria MONDO:0009520
Intellectual disability syndromic and non-syndromic v0.6776 HMGCL Zornitza Stark Publications for gene: HMGCL were set to
Intellectual disability syndromic and non-syndromic v0.6775 HMGCL Zornitza Stark Mode of inheritance for gene: HMGCL was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6774 HLCS Zornitza Stark Marked gene: HLCS as ready
Intellectual disability syndromic and non-syndromic v0.6774 HLCS Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6774 HLCS Zornitza Stark Phenotypes for gene: HLCS were changed from to holocarboxylase synthetase deficiency MONDO:0009666
Intellectual disability syndromic and non-syndromic v0.6773 HLCS Zornitza Stark Publications for gene: HLCS were set to
Intellectual disability syndromic and non-syndromic v0.6772 HLCS Zornitza Stark Mode of inheritance for gene: HLCS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6771 HLCS Zornitza Stark Mode of inheritance for gene: HLCS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6770 HIBCH Zornitza Stark Marked gene: HIBCH as ready
Intellectual disability syndromic and non-syndromic v0.6770 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6770 HIBCH Zornitza Stark Phenotypes for gene: HIBCH were changed from 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603; Leigh syndrome MONDO:0009723 to 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603; Leigh syndrome MONDO:0009723
Intellectual disability syndromic and non-syndromic v0.6769 HIBCH Zornitza Stark Phenotypes for gene: HIBCH were changed from to 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603; Leigh syndrome MONDO:0009723
Intellectual disability syndromic and non-syndromic v0.6768 HIBCH Zornitza Stark Publications for gene: HIBCH were set to
Intellectual disability syndromic and non-syndromic v0.6767 HIBCH Zornitza Stark Mode of inheritance for gene: HIBCH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6766 HEXB Zornitza Stark Marked gene: HEXB as ready
Intellectual disability syndromic and non-syndromic v0.6766 HEXB Zornitza Stark Gene: hexb has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6766 HEXB Zornitza Stark Phenotypes for gene: HEXB were changed from Sandhoff disease MONDO:0010006 to Sandhoff disease MONDO:0010006
Intellectual disability syndromic and non-syndromic v0.6765 HEXB Zornitza Stark Phenotypes for gene: HEXB were changed from to Sandhoff disease MONDO:0010006
Intellectual disability syndromic and non-syndromic v0.6764 HEXB Zornitza Stark Publications for gene: HEXB were set to 35420740
Intellectual disability syndromic and non-syndromic v0.6764 HEXB Zornitza Stark Publications for gene: HEXB were set to
Intellectual disability syndromic and non-syndromic v0.6763 HEXB Zornitza Stark Mode of inheritance for gene: HEXB was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6762 HEXB Zornitza Stark Mode of inheritance for gene: HEXB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6761 HEXA Zornitza Stark Marked gene: HEXA as ready
Intellectual disability syndromic and non-syndromic v0.6761 HEXA Zornitza Stark Gene: hexa has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6761 HEXA Zornitza Stark Phenotypes for gene: HEXA were changed from to Tay-Sachs disease MONDO:0010100
Intellectual disability syndromic and non-syndromic v0.6760 HEXA Zornitza Stark Publications for gene: HEXA were set to
Intellectual disability syndromic and non-syndromic v0.6759 HEXA Zornitza Stark Mode of inheritance for gene: HEXA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6758 HESX1 Zornitza Stark Phenotypes for gene: HESX1 were changed from septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099 to septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099
Intellectual disability syndromic and non-syndromic v0.6758 HESX1 Zornitza Stark Marked gene: HESX1 as ready
Intellectual disability syndromic and non-syndromic v0.6758 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6758 HESX1 Zornitza Stark Phenotypes for gene: HESX1 were changed from to septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099
Intellectual disability syndromic and non-syndromic v0.6757 HESX1 Zornitza Stark Publications for gene: HESX1 were set to
Intellectual disability syndromic and non-syndromic v0.6756 HESX1 Zornitza Stark Mode of inheritance for gene: HESX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6755 HESX1 Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6755 HEPACAM Zornitza Stark Marked gene: HEPACAM as ready
Intellectual disability syndromic and non-syndromic v0.6755 HEPACAM Zornitza Stark Gene: hepacam has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6755 HEPACAM Zornitza Stark Phenotypes for gene: HEPACAM were changed from to Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490; Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491
Intellectual disability syndromic and non-syndromic v0.6754 HEPACAM Zornitza Stark Publications for gene: HEPACAM were set to
Intellectual disability syndromic and non-syndromic v0.6753 HEPACAM Zornitza Stark Mode of inheritance for gene: HEPACAM was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6752 HCCS Zornitza Stark Marked gene: HCCS as ready
Intellectual disability syndromic and non-syndromic v0.6752 HCCS Zornitza Stark Gene: hccs has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6752 HCCS Zornitza Stark Phenotypes for gene: HCCS were changed from to linear skin defects with multiple congenital anomalies 1 (MONDO:0024552)
Intellectual disability syndromic and non-syndromic v0.6751 HCCS Zornitza Stark Publications for gene: HCCS were set to
Intellectual disability syndromic and non-syndromic v0.6750 HCCS Zornitza Stark Mode of inheritance for gene: HCCS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6749 HCCS Zornitza Stark reviewed gene: HCCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6749 GTF2H5 Zornitza Stark Marked gene: GTF2H5 as ready
Intellectual disability syndromic and non-syndromic v0.6749 GTF2H5 Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6749 GTF2H5 Zornitza Stark Phenotypes for gene: GTF2H5 were changed from to Trichothiodystrophy 3, photosensitive MIM#616395
Intellectual disability syndromic and non-syndromic v0.6748 GTF2H5 Zornitza Stark Publications for gene: GTF2H5 were set to
Intellectual disability syndromic and non-syndromic v0.6747 GTF2H5 Zornitza Stark Mode of inheritance for gene: GTF2H5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6746 GTF2H5 Zornitza Stark reviewed gene: GTF2H5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6746 GRM1 Zornitza Stark Marked gene: GRM1 as ready
Intellectual disability syndromic and non-syndromic v0.6746 GRM1 Zornitza Stark Gene: grm1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6746 GRM1 Zornitza Stark Phenotypes for gene: GRM1 were changed from to autosomal recessive spinocerebellar ataxia 13 MONDO:0013905
Intellectual disability syndromic and non-syndromic v0.6745 GRM1 Zornitza Stark Publications for gene: GRM1 were set to
Intellectual disability syndromic and non-syndromic v0.6744 GRM1 Zornitza Stark Mode of inheritance for gene: GRM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6743 GRM1 Zornitza Stark reviewed gene: GRM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6743 GPC3 Zornitza Stark Marked gene: GPC3 as ready
Intellectual disability syndromic and non-syndromic v0.6743 GPC3 Zornitza Stark Gene: gpc3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6743 GPC3 Zornitza Stark Phenotypes for gene: GPC3 were changed from to Simpson-Golabi-Behmel syndrome MONDO:0010731
Intellectual disability syndromic and non-syndromic v0.6742 GPC3 Zornitza Stark Publications for gene: GPC3 were set to
Intellectual disability syndromic and non-syndromic v0.6741 GPC3 Zornitza Stark Mode of inheritance for gene: GPC3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6740 GNS Zornitza Stark Marked gene: GNS as ready
Intellectual disability syndromic and non-syndromic v0.6740 GNS Zornitza Stark Gene: gns has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6740 GNS Zornitza Stark Phenotypes for gene: GNS were changed from to mucopolysaccharidosis type 3D MONDO:0009658
Intellectual disability syndromic and non-syndromic v0.6739 GNS Zornitza Stark Publications for gene: GNS were set to
Intellectual disability syndromic and non-syndromic v0.6738 GNS Zornitza Stark Mode of inheritance for gene: GNS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6737 GNPTAB Zornitza Stark Marked gene: GNPTAB as ready
Intellectual disability syndromic and non-syndromic v0.6737 GNPTAB Zornitza Stark Gene: gnptab has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6737 GNPTAB Zornitza Stark Phenotypes for gene: GNPTAB were changed from to GNPTAB-mucolipidosis MONDO:0100122
Intellectual disability syndromic and non-syndromic v0.6736 GNPTAB Zornitza Stark Publications for gene: GNPTAB were set to
Intellectual disability syndromic and non-syndromic v0.6735 GNPTAB Zornitza Stark Mode of inheritance for gene: GNPTAB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6734 GNPAT Zornitza Stark Marked gene: GNPAT as ready
Intellectual disability syndromic and non-syndromic v0.6734 GNPAT Zornitza Stark Gene: gnpat has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6734 GNPAT Zornitza Stark Phenotypes for gene: GNPAT were changed from to glyceronephosphate O-acyltransferase deficiency MONDO:0100273
Intellectual disability syndromic and non-syndromic v0.6733 GNPAT Zornitza Stark Publications for gene: GNPAT were set to
Intellectual disability syndromic and non-syndromic v0.6732 GNPAT Zornitza Stark Mode of inheritance for gene: GNPAT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6731 GMPPB Zornitza Stark Marked gene: GMPPB as ready
Intellectual disability syndromic and non-syndromic v0.6731 GMPPB Zornitza Stark Gene: gmppb has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6731 GMPPB Zornitza Stark Phenotypes for gene: GMPPB were changed from to myopathy caused by variation in GMPPB MONDO:0700084
Intellectual disability syndromic and non-syndromic v0.6730 GMPPB Zornitza Stark Publications for gene: GMPPB were set to
Intellectual disability syndromic and non-syndromic v0.6729 GMPPB Zornitza Stark Mode of inheritance for gene: GMPPB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6728 GMPPA Zornitza Stark Marked gene: GMPPA as ready
Intellectual disability syndromic and non-syndromic v0.6728 GMPPA Zornitza Stark Gene: gmppa has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6728 GMPPA Zornitza Stark Phenotypes for gene: GMPPA were changed from to alacrima, achalasia, and intellectual disability syndrome MONDO:0014219
Intellectual disability syndromic and non-syndromic v0.6727 GMPPA Zornitza Stark Publications for gene: GMPPA were set to
Intellectual disability syndromic and non-syndromic v0.6726 GMPPA Zornitza Stark Mode of inheritance for gene: GMPPA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6725 GM2A Zornitza Stark Marked gene: GM2A as ready
Intellectual disability syndromic and non-syndromic v0.6725 GM2A Zornitza Stark Gene: gm2a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6725 GM2A Zornitza Stark Phenotypes for gene: GM2A were changed from to Tay-Sachs disease AB variant MONDO:0010099
Intellectual disability syndromic and non-syndromic v0.6724 GM2A Zornitza Stark Publications for gene: GM2A were set to
Intellectual disability syndromic and non-syndromic v0.6723 GM2A Zornitza Stark Mode of inheritance for gene: GM2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6722 PSPH Ain Roesley Marked gene: PSPH as ready
Intellectual disability syndromic and non-syndromic v0.6722 PSPH Ain Roesley Gene: psph has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6722 PSPH Ain Roesley Phenotypes for gene: PSPH were changed from Phosphoserine phosphatase deficiency MIM#614023 to Phosphoserine phosphatase deficiency MIM#614023
Intellectual disability syndromic and non-syndromic v0.6722 PSPH Ain Roesley Phenotypes for gene: PSPH were changed from to Phosphoserine phosphatase deficiency MIM#614023
Intellectual disability syndromic and non-syndromic v0.6721 PSPH Ain Roesley Publications for gene: PSPH were set to
Intellectual disability syndromic and non-syndromic v0.6721 PSPH Ain Roesley Mode of inheritance for gene: PSPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6720 PSPH Ain Roesley reviewed gene: PSPH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Phosphoserine phosphatase deficiency MIM#614023; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6720 PRPS1 Ain Roesley Phenotypes for gene: PRPS1 were changed from PRPS1 deficiency disorder MONDO:0100061 to PRPS1 deficiency disorder MONDO:0100061
Intellectual disability syndromic and non-syndromic v0.6720 PRPS1 Ain Roesley Publications for gene: PRPS1 were set to 24961627
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Marked gene: PRPS1 as ready
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Gene: prps1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Phenotypes for gene: PRPS1 were changed from to PRPS1 deficiency disorder MONDO:0100061
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Publications for gene: PRPS1 were set to
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Mode of inheritance for gene: PRPS1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6718 PRPS1 Ain Roesley reviewed gene: PRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24961627; Phenotypes: PRPS1 deficiency disorder MONDO:0100061; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6718 PRODH Ain Roesley Mode of inheritance for gene: PRODH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6718 PRODH Ain Roesley Marked gene: PRODH as ready
Intellectual disability syndromic and non-syndromic v0.6718 PRODH Ain Roesley Gene: prodh has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6718 PRODH Ain Roesley Mode of inheritance for gene: PRODH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6718 PRODH Ain Roesley Publications for gene: PRODH were set to 17412540; 12217952
Intellectual disability syndromic and non-syndromic v0.6717 PRODH Ain Roesley Mode of inheritance for gene: PRODH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6717 PRODH Ain Roesley Publications for gene: PRODH were set to
Intellectual disability syndromic and non-syndromic v0.6717 PRODH Ain Roesley Phenotypes for gene: PRODH were changed from to Hyperprolinemia, type I MIM#239500
Intellectual disability syndromic and non-syndromic v0.6716 PRODH Ain Roesley reviewed gene: PRODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 17412540, 12217952; Phenotypes: Hyperprolinemia, type I MIM#239500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6716 PPT1 Ain Roesley Phenotypes for gene: PPT1 were changed from Ceroid lipofuscinosis, neuronal, 1 MIM#256730 to Ceroid lipofuscinosis, neuronal, 1 MIM#256730
Intellectual disability syndromic and non-syndromic v0.6716 PPT1 Ain Roesley Mode of inheritance for gene: PPT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6715 PPT1 Ain Roesley Marked gene: PPT1 as ready
Intellectual disability syndromic and non-syndromic v0.6715 PPT1 Ain Roesley Gene: ppt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6715 PPT1 Ain Roesley Phenotypes for gene: PPT1 were changed from to Ceroid lipofuscinosis, neuronal, 1 MIM#256730
Intellectual disability syndromic and non-syndromic v0.6715 PPT1 Ain Roesley Mode of inheritance for gene: PPT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6715 PPT1 Ain Roesley Publications for gene: PPT1 were set to
Intellectual disability syndromic and non-syndromic v0.6714 PPT1 Ain Roesley reviewed gene: PPT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7637805, 9425237, 9664077; Phenotypes: Ceroid lipofuscinosis, neuronal, 1 MIM#256730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6714 FTSJ1 Zornitza Stark Marked gene: FTSJ1 as ready
Intellectual disability syndromic and non-syndromic v0.6714 FTSJ1 Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6714 FTSJ1 Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Intellectual developmental disorder, X-linked 9, MIM# 309549 to Intellectual developmental disorder, X-linked 9, MIM# 309549; X-linked complex neurodevelopmental disorder MONDO:0100148
Intellectual disability syndromic and non-syndromic v0.6713 FTSJ1 Zornitza Stark Phenotypes for gene: FTSJ1 were changed from to Intellectual developmental disorder, X-linked 9, MIM# 309549
Intellectual disability syndromic and non-syndromic v0.6712 FTSJ1 Zornitza Stark Publications for gene: FTSJ1 were set to
Intellectual disability syndromic and non-syndromic v0.6711 FTSJ1 Zornitza Stark Mode of inheritance for gene: FTSJ1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6710 PPP3CA Ain Roesley Marked gene: PPP3CA as ready
Intellectual disability syndromic and non-syndromic v0.6710 PPP3CA Ain Roesley Gene: ppp3ca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6710 PPP3CA Ain Roesley Publications for gene: PPP3CA were set to
Intellectual disability syndromic and non-syndromic v0.6710 PPP3CA Ain Roesley Phenotypes for gene: PPP3CA were changed from to Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265; Developmental and epileptic encephalopathy 91 MIM617711
Intellectual disability syndromic and non-syndromic v0.6710 PPP3CA Ain Roesley Mode of inheritance for gene: PPP3CA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6709 PPP3CA Ain Roesley reviewed gene: PPP3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 29432562, 32593294; Phenotypes: Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265, Developmental and epileptic encephalopathy 91 MIM617711; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6709 POMT2 Ain Roesley Marked gene: POMT2 as ready
Intellectual disability syndromic and non-syndromic v0.6709 POMT2 Ain Roesley Gene: pomt2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6709 POMT2 Ain Roesley Phenotypes for gene: POMT2 were changed from myopathy caused by variation in POMT2 MONDO:0700071 to myopathy caused by variation in POMT2 MONDO:0700071
Intellectual disability syndromic and non-syndromic v0.6708 POMT2 Ain Roesley Phenotypes for gene: POMT2 were changed from to myopathy caused by variation in POMT2 MONDO:0700071
Intellectual disability syndromic and non-syndromic v0.6708 POMT2 Ain Roesley Mode of inheritance for gene: POMT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6707 POMT1 Ain Roesley Marked gene: POMT1 as ready
Intellectual disability syndromic and non-syndromic v0.6707 POMT1 Ain Roesley Gene: pomt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6707 POMT2 Ain Roesley reviewed gene: POMT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT2 MONDO:0700071; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6707 POMT1 Ain Roesley Phenotypes for gene: POMT1 were changed from to myopathy caused by variation in POMT1 MONDO:0700070
Intellectual disability syndromic and non-syndromic v0.6707 POMT1 Ain Roesley Mode of inheritance for gene: POMT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6706 POMT1 Ain Roesley reviewed gene: POMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT1 MONDO:0700070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6706 POMGNT2 Ain Roesley Marked gene: POMGNT2 as ready
Intellectual disability syndromic and non-syndromic v0.6706 POMGNT2 Ain Roesley Gene: pomgnt2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6706 POMGNT2 Ain Roesley Phenotypes for gene: POMGNT2 were changed from to myopathy caused by variation in POMGNT2 MONDO:0700069
Intellectual disability syndromic and non-syndromic v0.6706 POMGNT2 Ain Roesley Mode of inheritance for gene: POMGNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6705 POMGNT2 Ain Roesley reviewed gene: POMGNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT2 MONDO:0700069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6705 POMGNT1 Ain Roesley Marked gene: POMGNT1 as ready
Intellectual disability syndromic and non-syndromic v0.6705 POMGNT1 Ain Roesley Gene: pomgnt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6705 POMGNT1 Ain Roesley Phenotypes for gene: POMGNT1 were changed from myopathy caused by variation in POMGNT1 MONDO:0700068 to myopathy caused by variation in POMGNT1 MONDO:0700068
Intellectual disability syndromic and non-syndromic v0.6705 POMGNT1 Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6704 POMGNT1 Ain Roesley Phenotypes for gene: POMGNT1 were changed from myopathy caused by variation in POMGNT1 MONDO:0700068 to myopathy caused by variation in POMGNT1 MONDO:0700068
Intellectual disability syndromic and non-syndromic v0.6704 POMGNT1 Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6704 POMGNT1 Ain Roesley Phenotypes for gene: POMGNT1 were changed from to myopathy caused by variation in POMGNT1 MONDO:0700068
Intellectual disability syndromic and non-syndromic v0.6704 POMGNT1 Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6703 POMGNT1 Ain Roesley changed review comment from: DD/ID is a feature

the following has been lumped by clingen as one entity

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280
Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151
Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157; to: DD/ID is a feature

the following has been lumped by clingen as one entity

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280
Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151
Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157

https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_03bb8479-2ed3-4b15-9e54-378ea0729ab2-2024-08-14T190000.000Z?page=1&size=25&search=
Intellectual disability syndromic and non-syndromic v0.6703 POMGNT1 Ain Roesley reviewed gene: POMGNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT1 MONDO:0700068; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6703 POLR3B Ain Roesley Marked gene: POLR3B as ready
Intellectual disability syndromic and non-syndromic v0.6703 POLR3B Ain Roesley Gene: polr3b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6703 POLR3B Ain Roesley Mode of inheritance for gene: POLR3B was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6702 POLR3B Ain Roesley Mode of inheritance for gene: POLR3B was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6702 POLR3K Ain Roesley Marked gene: POLR3K as ready
Intellectual disability syndromic and non-syndromic v0.6702 POLR3K Ain Roesley Gene: polr3k has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6702 POLR3B Ain Roesley Phenotypes for gene: POLR3B were changed from to POLR3B-related disorder MONDO:0700277; Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742; Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381
Intellectual disability syndromic and non-syndromic v0.6702 POLR3B Ain Roesley Publications for gene: POLR3B were set to
Intellectual disability syndromic and non-syndromic v0.6701 POLR3B Ain Roesley reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33417887; Phenotypes: POLR3B-related disorder MONDO:0700277, Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742, Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6701 POLR3A Ain Roesley Marked gene: POLR3A as ready
Intellectual disability syndromic and non-syndromic v0.6701 POLR3A Ain Roesley Gene: polr3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6701 POLR3A Ain Roesley Phenotypes for gene: POLR3A were changed from POLR3A-related disorder MONDO:0700276 to POLR3A-related disorder MONDO:0700276
Intellectual disability syndromic and non-syndromic v0.6700 POLR3A Ain Roesley Phenotypes for gene: POLR3A were changed from to POLR3A-related disorder MONDO:0700276
Intellectual disability syndromic and non-syndromic v0.6700 POLR3A Ain Roesley Mode of inheritance for gene: POLR3A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6699 POLR3A Ain Roesley reviewed gene: POLR3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: POLR3A-related disorder MONDO:0700276; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6699 POLG Ain Roesley Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640
Intellectual disability syndromic and non-syndromic v0.6699 POLG Ain Roesley Marked gene: POLG as ready
Intellectual disability syndromic and non-syndromic v0.6699 POLG Ain Roesley Gene: polg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6699 POLG Ain Roesley Publications for gene: POLG were set to 20301791
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Publications for gene: POLG were set to 20301791
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Publications for gene: POLG were set to
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Phenotypes for gene: POLG were changed from to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Mode of inheritance for gene: POLG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6697 POLG Ain Roesley reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301791; Phenotypes: Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700, Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662, Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459, Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450, Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6697 PNPLA6 Ain Roesley Publications for gene: PNPLA6 were set to 25299038
Intellectual disability syndromic and non-syndromic v0.6697 PNPLA6 Ain Roesley Phenotypes for gene: PNPLA6 were changed from retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155
Intellectual disability syndromic and non-syndromic v0.6697 PNPLA6 Ain Roesley Phenotypes for gene: PNPLA6 were changed from retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155
Intellectual disability syndromic and non-syndromic v0.6696 PNPLA6 Ain Roesley Mode of inheritance for gene: PNPLA6 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6696 PNPLA6 Ain Roesley Marked gene: PNPLA6 as ready
Intellectual disability syndromic and non-syndromic v0.6696 PNPLA6 Ain Roesley Gene: pnpla6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6696 PNPLA6 Ain Roesley Phenotypes for gene: PNPLA6 were changed from to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155
Intellectual disability syndromic and non-syndromic v0.6696 PNPLA6 Ain Roesley Publications for gene: PNPLA6 were set to
Intellectual disability syndromic and non-syndromic v0.6696 PNPLA6 Ain Roesley Mode of inheritance for gene: PNPLA6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6695 PNPLA6 Ain Roesley reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25299038; Phenotypes: retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Publications for gene: PMM2 were set to 20301289
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Phenotypes for gene: PMM2 were changed from Congenital disorder of glycosylation, type Ia MIM#212065 to Congenital disorder of glycosylation, type Ia MIM#212065
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Phenotypes for gene: PMM2 were changed from Congenital disorder of glycosylation, type Ia MIM#212065 to Congenital disorder of glycosylation, type Ia MIM#212065
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Marked gene: PMM2 as ready
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Gene: pmm2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6694 PMM2 Ain Roesley Mode of inheritance for gene: PMM2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6694 PMM2 Ain Roesley Phenotypes for gene: PMM2 were changed from to Congenital disorder of glycosylation, type Ia MIM#212065
Intellectual disability syndromic and non-syndromic v0.6694 PMM2 Ain Roesley Publications for gene: PMM2 were set to
Intellectual disability syndromic and non-syndromic v0.6693 PLA2G6 Ain Roesley Phenotypes for gene: PLA2G6 were changed from Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217 to Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217
Intellectual disability syndromic and non-syndromic v0.6693 PLA2G6 Ain Roesley Publications for gene: PLA2G6 were set to 20301718
Intellectual disability syndromic and non-syndromic v0.6692 PLA2G6 Ain Roesley Marked gene: PLA2G6 as ready
Intellectual disability syndromic and non-syndromic v0.6692 PLA2G6 Ain Roesley Gene: pla2g6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6692 PLA2G6 Ain Roesley Phenotypes for gene: PLA2G6 were changed from to Infantile neuroaxonal dystrophy 1 MIM#256600; Neurodegeneration with brain iron accumulation 2B MIM#610217
Intellectual disability syndromic and non-syndromic v0.6692 PMM2 Ain Roesley reviewed gene: PMM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301289; Phenotypes: Congenital disorder of glycosylation, type Ia MIM#212065; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6692 PLA2G6 Ain Roesley Publications for gene: PLA2G6 were set to
Intellectual disability syndromic and non-syndromic v0.6692 PLA2G6 Ain Roesley Mode of inheritance for gene: PLA2G6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6691 PLA2G6 Ain Roesley reviewed gene: PLA2G6: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301718; Phenotypes: nfantile neuroaxonal dystrophy 1 MIM#256600, Neurodegeneration with brain iron accumulation 2B MIM#610217; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Marked gene: PIK3CA as ready
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Gene: pik3ca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Phenotypes for gene: PIK3CA were changed from PIK3CA-related overgrowth spectrum MONDO:1040002 to PIK3CA-related overgrowth spectrum MONDO:1040002
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Publications for gene: PIK3CA were set to 23946963
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Phenotypes for gene: PIK3CA were changed from PIK3CA-related overgrowth spectrum MONDO:1040002 to PIK3CA-related overgrowth spectrum MONDO:1040002
Intellectual disability syndromic and non-syndromic v0.6690 PIK3CA Ain Roesley Phenotypes for gene: PIK3CA were changed from to PIK3CA-related overgrowth spectrum MONDO:1040002
Intellectual disability syndromic and non-syndromic v0.6690 PIK3CA Ain Roesley Publications for gene: PIK3CA were set to
Intellectual disability syndromic and non-syndromic v0.6690 PIK3CA Ain Roesley Mode of inheritance for gene: PIK3CA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6689 PIK3CA Ain Roesley reviewed gene: PIK3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 23946963; Phenotypes: PIK3CA-related overgrowth spectrum MONDO:1040002; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6689 PHGDH Ain Roesley Phenotypes for gene: PHGDH were changed from Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815 to Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815
Intellectual disability syndromic and non-syndromic v0.6688 PHGDH Ain Roesley Marked gene: PHGDH as ready
Intellectual disability syndromic and non-syndromic v0.6688 PHGDH Ain Roesley Gene: phgdh has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6689 PHGDH Ain Roesley Publications for gene: PHGDH were set to 37347880
Intellectual disability syndromic and non-syndromic v0.6688 PHGDH Ain Roesley Phenotypes for gene: PHGDH were changed from to Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815
Intellectual disability syndromic and non-syndromic v0.6688 PHGDH Ain Roesley Publications for gene: PHGDH were set to
Intellectual disability syndromic and non-syndromic v0.6688 PHGDH Ain Roesley Mode of inheritance for gene: PHGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6687 PHGDH Ain Roesley reviewed gene: PHGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Neu-Laxova syndrome 1 MIM#256520, Phosphoglycerate dehydrogenase deficiency MIM#601815; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6687 PEX7 Ain Roesley Phenotypes for gene: PEX7 were changed from Peroxisome biogenesis disorder 9B MIM#614879; Rhizomelic chondrodysplasia punctata, type 1 MIM#215100 to Peroxisome biogenesis disorder 9B MIM#614879; Rhizomelic chondrodysplasia punctata, type 1 MIM#215100
Intellectual disability syndromic and non-syndromic v0.6687 PEX7 Ain Roesley Publications for gene: PEX7 were set to 20301447
Intellectual disability syndromic and non-syndromic v0.6686 PEX7 Ain Roesley Marked gene: PEX7 as ready
Intellectual disability syndromic and non-syndromic v0.6686 PEX7 Ain Roesley Gene: pex7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6686 PEX7 Ain Roesley Phenotypes for gene: PEX7 were changed from to Peroxisome biogenesis disorder 9B MIM#614879; Rhizomelic chondrodysplasia punctata, type 1 MIM#215100
Intellectual disability syndromic and non-syndromic v0.6686 PEX7 Ain Roesley Publications for gene: PEX7 were set to
Intellectual disability syndromic and non-syndromic v0.6686 PEX7 Ain Roesley Mode of inheritance for gene: PEX7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6685 PEX7 Ain Roesley reviewed gene: PEX7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301447; Phenotypes: Peroxisome biogenesis disorder 9B MIM#614879, Rhizomelic chondrodysplasia punctata, type 1 MIM#215100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6685 PEX6 Ain Roesley Marked gene: PEX6 as ready
Intellectual disability syndromic and non-syndromic v0.6685 PEX6 Ain Roesley Gene: pex6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6685 PEX6 Ain Roesley Publications for gene: PEX6 were set to
Intellectual disability syndromic and non-syndromic v0.6684 PEX6 Ain Roesley Phenotypes for gene: PEX6 were changed from to Peroxisome biogenesis disorder 4A (Zellweger) MIM#614862; Peroxisome biogenesis disorder 4B MIM#614863
Intellectual disability syndromic and non-syndromic v0.6684 PEX6 Ain Roesley edited their review of gene: PEX6: Changed publications: 29220678, 20301621
Intellectual disability syndromic and non-syndromic v0.6684 PEX6 Ain Roesley Mode of inheritance for gene: PEX6 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6683 PEX6 Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6683 PEX6 Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6683 PEX5 Ain Roesley Phenotypes for gene: PEX5 were changed from Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110; Peroxisome biogenesis disorder 2B MIM#202370 to Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110; Peroxisome biogenesis disorder 2B MIM#202370
Intellectual disability syndromic and non-syndromic v0.6683 PEX5 Ain Roesley Marked gene: PEX5 as ready
Intellectual disability syndromic and non-syndromic v0.6683 PEX5 Ain Roesley Gene: pex5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6683 PEX6 Ain Roesley reviewed gene: PEX6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Peroxisome biogenesis disorder 4A (Zellweger) MIM#614862, Peroxisome biogenesis disorder 4B MIM#614863; Mode of inheritance: None; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6683 PEX5 Ain Roesley Mode of inheritance for gene: PEX5 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6683 PEX5 Ain Roesley Publications for gene: PEX5 were set to 20301621
Intellectual disability syndromic and non-syndromic v0.6682 PEX5 Ain Roesley Publications for gene: PEX5 were set to
Intellectual disability syndromic and non-syndromic v0.6682 PEX5 Ain Roesley Phenotypes for gene: PEX5 were changed from to Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110; Peroxisome biogenesis disorder 2B MIM#202370
Intellectual disability syndromic and non-syndromic v0.6682 PEX5 Ain Roesley Mode of inheritance for gene: PEX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6682 PEX3 Ain Roesley Marked gene: PEX3 as ready
Intellectual disability syndromic and non-syndromic v0.6682 PEX3 Ain Roesley Gene: pex3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6682 PEX3 Ain Roesley Phenotypes for gene: PEX3 were changed from Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882; Peroxisome biogenesis disorder 10B , MIM# 617370 to Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882; Peroxisome biogenesis disorder 10B , MIM# 617370
Intellectual disability syndromic and non-syndromic v0.6681 PEX3 Ain Roesley Phenotypes for gene: PEX3 were changed from to Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882; Peroxisome biogenesis disorder 10B , MIM# 617370
Intellectual disability syndromic and non-syndromic v0.6681 PEX5 Ain Roesley reviewed gene: PEX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110, Peroxisome biogenesis disorder 2B MIM#202370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6681 PEX3 Ain Roesley Publications for gene: PEX3 were set to
Intellectual disability syndromic and non-syndromic v0.6681 PEX3 Ain Roesley Mode of inheritance for gene: PEX3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6680 PEX26 Ain Roesley Marked gene: PEX26 as ready
Intellectual disability syndromic and non-syndromic v0.6680 PEX26 Ain Roesley Gene: pex26 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6680 PEX3 Ain Roesley reviewed gene: PEX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10942428, 10958759, 10968777, 27557811, 33101983, 20301621; Phenotypes: Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882, Peroxisome biogenesis disorder 10B , MIM# 617370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6680 PEX26 Ain Roesley Phenotypes for gene: PEX26 were changed from Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872; Peroxisome biogenesis disorder 7B MIM614873 to Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872; Peroxisome biogenesis disorder 7B MIM614873
Intellectual disability syndromic and non-syndromic v0.6679 PEX26 Ain Roesley Phenotypes for gene: PEX26 were changed from to Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872; Peroxisome biogenesis disorder 7B MIM614873
Intellectual disability syndromic and non-syndromic v0.6679 PEX26 Ain Roesley Mode of inheritance for gene: PEX26 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6679 PEX26 Ain Roesley Publications for gene: PEX26 were set to
Intellectual disability syndromic and non-syndromic v0.6678 PEX2 Ain Roesley Phenotypes for gene: PEX2 were changed from Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866; Peroxisome biogenesis disorder 5B MIM#614867 to Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866; Peroxisome biogenesis disorder 5B MIM#614867
Intellectual disability syndromic and non-syndromic v0.6678 PEX26 Ain Roesley Deleted their comment
Intellectual disability syndromic and non-syndromic v0.6678 PEX2 Ain Roesley Marked gene: PEX2 as ready
Intellectual disability syndromic and non-syndromic v0.6678 PEX2 Ain Roesley Gene: pex2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6678 PEX2 Ain Roesley Publications for gene: PEX2 were set to 20301621
Intellectual disability syndromic and non-syndromic v0.6677 PEX26 Ain Roesley commented on gene: PEX26: ID/DD is part of the Zellweger spectrum
Intellectual disability syndromic and non-syndromic v0.6677 PEX2 Ain Roesley Phenotypes for gene: PEX2 were changed from to Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866; Peroxisome biogenesis disorder 5B MIM#614867
Intellectual disability syndromic and non-syndromic v0.6677 PEX2 Ain Roesley Publications for gene: PEX2 were set to
Intellectual disability syndromic and non-syndromic v0.6677 PEX26 Ain Roesley reviewed gene: PEX26: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872, Peroxisome biogenesis disorder 7B MIM614873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6677 PEX2 Ain Roesley Mode of inheritance for gene: PEX2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6677 PEX2 Ain Roesley Mode of inheritance for gene: PEX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6676 PEX2 Ain Roesley changed review comment from: Few individuals reported with variants in PEX19 however,; to: ID/DD is part of the Zellweger spectrum
Intellectual disability syndromic and non-syndromic v0.6676 PEX2 Ain Roesley commented on gene: PEX2: Few individuals reported with variants in PEX19 however,
Intellectual disability syndromic and non-syndromic v0.6676 PEX2 Ain Roesley reviewed gene: PEX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866, Peroxisome biogenesis disorder 5B MIM#614867; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6676 PEX19 Ain Roesley Marked gene: PEX19 as ready
Intellectual disability syndromic and non-syndromic v0.6676 PEX19 Ain Roesley Gene: pex19 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6676 PEX19 Ain Roesley Phenotypes for gene: PEX19 were changed from Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886 to Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886
Intellectual disability syndromic and non-syndromic v0.6675 PEX19 Ain Roesley Phenotypes for gene: PEX19 were changed from to Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886
Intellectual disability syndromic and non-syndromic v0.6675 PEX19 Ain Roesley Publications for gene: PEX19 were set to
Intellectual disability syndromic and non-syndromic v0.6675 PEX19 Ain Roesley Mode of inheritance for gene: PEX19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6674 PEX19 Ain Roesley reviewed gene: PEX19: Rating: GREEN; Mode of pathogenicity: None; Publications: 10051604, 20683989, 11883941, 28391327; Phenotypes: Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6674 PEX16 Ain Roesley Mode of inheritance for gene: PEX16 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6673 PEX16 Ain Roesley Marked gene: PEX16 as ready
Intellectual disability syndromic and non-syndromic v0.6673 PEX16 Ain Roesley Gene: pex16 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6673 PEX16 Ain Roesley Mode of inheritance for gene: PEX16 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6673 PEX16 Ain Roesley Publications for gene: PEX16 were set to
Intellectual disability syndromic and non-syndromic v0.6673 PEX16 Ain Roesley Phenotypes for gene: PEX16 were changed from to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876; Peroxisome biogenesis disorder 8B MIM#614877
Intellectual disability syndromic and non-syndromic v0.6672 PEX16 Ain Roesley edited their review of gene: PEX16: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.6672 PEX14 Ain Roesley Publications for gene: PEX14 were set to 37493040; 20301621
Intellectual disability syndromic and non-syndromic v0.6672 PEX16 Ain Roesley reviewed gene: PEX16: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876, Peroxisome biogenesis disorder 8B MIM#614877; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6672 PEX14 Ain Roesley Phenotypes for gene: PEX14 were changed from Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887; peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268 to Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887; peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268
Intellectual disability syndromic and non-syndromic v0.6671 PEX14 Ain Roesley Phenotypes for gene: PEX14 were changed from to Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887; peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268
Intellectual disability syndromic and non-syndromic v0.6671 PEX14 Ain Roesley Publications for gene: PEX14 were set to
Intellectual disability syndromic and non-syndromic v0.6671 PEX14 Ain Roesley Mode of inheritance for gene: PEX14 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6670 PEX14 Ain Roesley reviewed gene: PEX14: Rating: GREEN; Mode of pathogenicity: None; Publications: 37493040, 20301621; Phenotypes: Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887, peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6670 PEX13 Ain Roesley Mode of inheritance for gene: PEX13 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6669 PEX13 Ain Roesley Marked gene: PEX13 as ready
Intellectual disability syndromic and non-syndromic v0.6669 PEX13 Ain Roesley Gene: pex13 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6669 PEX13 Ain Roesley Mode of inheritance for gene: PEX13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6669 PEX13 Ain Roesley Publications for gene: PEX13 were set to
Intellectual disability syndromic and non-syndromic v0.6669 PEX13 Ain Roesley Phenotypes for gene: PEX13 were changed from to Peroxisome biogenesis disorder 11A (Zellweger) MIM#614883; Peroxisome biogenesis disorder 11B MIM#614885
Intellectual disability syndromic and non-syndromic v0.6668 PEX13 Ain Roesley reviewed gene: PEX13: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 11A (Zellweger) MIM#614883, Peroxisome biogenesis disorder 11B MIM#614885; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6668 PEX12 Ain Roesley Phenotypes for gene: PEX12 were changed from Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510 to Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510
Intellectual disability syndromic and non-syndromic v0.6668 PEX12 Ain Roesley Marked gene: PEX12 as ready
Intellectual disability syndromic and non-syndromic v0.6668 PEX12 Ain Roesley Gene: pex12 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6668 PEX12 Ain Roesley Phenotypes for gene: PEX12 were changed from Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510 to Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510
Intellectual disability syndromic and non-syndromic v0.6667 PEX12 Ain Roesley Phenotypes for gene: PEX12 were changed from to Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859; Peroxisome biogenesis disorder 3B MIM#266510
Intellectual disability syndromic and non-syndromic v0.6667 PEX12 Ain Roesley Publications for gene: PEX12 were set to
Intellectual disability syndromic and non-syndromic v0.6667 PEX12 Ain Roesley Mode of inheritance for gene: PEX12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6666 PEX12 Ain Roesley reviewed gene: PEX12: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859, Peroxisome biogenesis disorder 3B MIM#266510; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6666 TSHZ3 Bryony Thompson Marked gene: TSHZ3 as ready
Intellectual disability syndromic and non-syndromic v0.6666 TSHZ3 Bryony Thompson Gene: tshz3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6666 TSHZ3 Bryony Thompson Classified gene: TSHZ3 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6666 TSHZ3 Bryony Thompson Gene: tshz3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6666 TSHZ3 Bryony Thompson Classified gene: TSHZ3 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6666 TSHZ3 Bryony Thompson Gene: tshz3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6665 TSHZ3 Bryony Thompson gene: TSHZ3 was added
gene: TSHZ3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TSHZ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TSHZ3 were set to 27668656; 34919690; 36553458; 39420202
Phenotypes for gene: TSHZ3 were set to congenital anomaly of kidney and urinary tract MONDO:0019719
Review for gene: TSHZ3 was set to AMBER
Added comment: More evidence for the gene-disease association is required
PMID: 27668656 - TSHZ3 is included in the region deleted in chromosome 19q13.11 Deletion Syndrome, which includes intellectual disability and behavioural issues, congenital anomalies of the kidney and urinary tract (CAKUT)
PMID: 34919690 - haploinsufficient mouse model leads to kidney defects
PMID: 36553458 - heterozygous frameshift variant c.119_120dup p.Pro41SerfsTer79 in a case with intellectual disability, behavioural issues, pyelocaliceal dilatation, and mild urethral stenosis.
PMID: 39420202 - 12 CAKUT patients from 9/301 (3%) families carried 5 different rare heterozygous TSHZ3 missense variants. However, 1 of the variants (p.Ser58Gly) present in 5 of the families is more common in gnomAD v4.1 than you would expect for a dominant disease including 5 homozygotes (1,408/1,612,114 alleles, 5 hom, AF=0.0008734). The authors state this is not unexpected in a condition, such as CAKUT. However, the different missense variants are inherited from unaffected parents in at least 2/9 families (there was no phenotype information available for an additional 3 parents).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6664 WDR83OS Bryony Thompson Marked gene: WDR83OS as ready
Intellectual disability syndromic and non-syndromic v0.6664 WDR83OS Bryony Thompson Gene: wdr83os has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6664 WDR83OS Bryony Thompson Classified gene: WDR83OS as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6664 WDR83OS Bryony Thompson Gene: wdr83os has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6663 WDR83OS Bryony Thompson gene: WDR83OS was added
gene: WDR83OS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR83OS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR83OS were set to 39471804; 30250217
Phenotypes for gene: WDR83OS were set to complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia
Review for gene: WDR83OS was set to GREEN
Added comment: Now 14 cases from 9 unrelated families with homozygous LoF variants, including the family reported in 2019. Consistent clinical features include NDD (14/14), facial dysmorphism (13/14), intractable itching (9/14), and elevated bile acids (5/6). Also, supporting null zebrafish model that recapitulates the human phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6662 GON4L Bryony Thompson Marked gene: GON4L as ready
Intellectual disability syndromic and non-syndromic v0.6662 GON4L Bryony Thompson Gene: gon4l has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6662 GON4L Bryony Thompson Classified gene: GON4L as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6662 GON4L Bryony Thompson Gene: gon4l has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6661 GON4L Bryony Thompson gene: GON4L was added
gene: GON4L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GON4L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON4L were set to 39500882; 21937992
Phenotypes for gene: GON4L were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: GON4L was set to GREEN
Added comment: 2 LoF variants in 4 cases from 3 unrelated consanguineous families, and supporting null zebrafish model
PMID: 39500882 - 2 homozygous truncating GON4L variants [NM_001282860.2: c.62_63del, p.(Gln21Argfs*12) and c.5517+1G>A] in 3 patients from 2 consanguineous families with prenatal-onset growth impairment, developmental delay, mild intellectual disability, speech impairment, progressive and disproportionate microcephaly, facial asymmetry, congenital heart anomaly, and brain structure abnormalities.
Null zebrafish model had distinct morphological and size abnormalities in the craniofacial cartilage of zebrafish larvae
Heterozygous carriers in biallelic families were unaffected
PMID: 21937992 - a case from Iran from a consanguineous family homozygous for c.5517+1G>A with syndromic ID. No other clinical details provided
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6660 SGSM3 Zornitza Stark Publications for gene: SGSM3 were set to PMID: 37833060
Intellectual disability syndromic and non-syndromic v0.6659 SGSM3 Zornitza Stark Classified gene: SGSM3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6659 SGSM3 Zornitza Stark Gene: sgsm3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6658 UBTF Zornitza Stark Phenotypes for gene: UBTF were changed from Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701 to Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701; Neurodevelopmental disorder, MONDO:0700092, UBTF-related
Intellectual disability syndromic and non-syndromic v0.6657 UBTF Zornitza Stark Publications for gene: UBTF were set to 28777933; 29300972
Intellectual disability syndromic and non-syndromic v0.6656 MARK2 Zornitza Stark Marked gene: MARK2 as ready
Intellectual disability syndromic and non-syndromic v0.6656 MARK2 Zornitza Stark Gene: mark2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6656 BHLHE22 Zornitza Stark Classified gene: BHLHE22 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6656 BHLHE22 Zornitza Stark Gene: bhlhe22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6655 BHLHE22 Zornitza Stark Marked gene: BHLHE22 as ready
Intellectual disability syndromic and non-syndromic v0.6655 BHLHE22 Zornitza Stark Gene: bhlhe22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6655 BHLHE22 Zornitza Stark Classified gene: BHLHE22 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6655 BHLHE22 Zornitza Stark Gene: bhlhe22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6654 BHLHE22 Zornitza Stark gene: BHLHE22 was added
gene: BHLHE22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BHLHE22 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: BHLHE22 were set to 39502664
Phenotypes for gene: BHLHE22 were set to Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related
Review for gene: BHLHE22 was set to GREEN
Added comment: Four individuals with de novo missense variants within the highly conserved helix-loop-helix domain and seven individuals from five unrelated families with a recurrent homozygous frameshift variant, p.(Gly74Alafs*18).

Individuals presented with absent or limited speech, severely impaired motor abilities, intellectual disability (ID), involuntary movements, autistic traits with stereotypies, abnormal muscle tone. The majority of individuals had partial or complete agenesis of the corpus callosum (ACC). Additional symptoms comprised epilepsy, variable dysmorphic features, and eye anomalies. One additional individual had spastic paraplegia without delayed development and ACC, expanding the phenotype to milder and later onset forms.

Mice lacking bhlhe22 show nearly complete loss of three brain comminsure, including the corpus callosum.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6653 MRPL49 Zornitza Stark Marked gene: MRPL49 as ready
Intellectual disability syndromic and non-syndromic v0.6653 MRPL49 Zornitza Stark Gene: mrpl49 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6653 MRPL49 Zornitza Stark Classified gene: MRPL49 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6653 MRPL49 Zornitza Stark Gene: mrpl49 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6652 MRPL49 Zornitza Stark gene: MRPL49 was added
gene: MRPL49 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRPL49 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPL49 were set to 39417135
Phenotypes for gene: MRPL49 were set to Mitochondrial disease, MONDO:0044970, MRPL49-related
Review for gene: MRPL49 was set to GREEN
Added comment: Five unrelated families with presentations ranging from Perrault syndrome (primary ovarian insufficiency and sensorineural hearing loss) to severe childhood onset of leukodystrophy, learning disability, microcephaly and retinal dystrophy and bi-allelic variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6651 SATB1 Sangavi Sivagnanasundram reviewed gene: SATB1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008481; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6651 PEX11B Ain Roesley Marked gene: PEX11B as ready
Intellectual disability syndromic and non-syndromic v0.6651 PEX11B Ain Roesley Gene: pex11b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6651 PEX11B Ain Roesley Publications for gene: PEX11B were set to 28129423; 22581968
Intellectual disability syndromic and non-syndromic v0.6650 PEX11B Ain Roesley Phenotypes for gene: PEX11B were changed from to Peroxisome biogenesis disorder 14B MIM#614920
Intellectual disability syndromic and non-syndromic v0.6649 PEX11B Ain Roesley Publications for gene: PEX11B were set to
Intellectual disability syndromic and non-syndromic v0.6648 PEX11B Ain Roesley Mode of inheritance for gene: PEX11B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6647 PEX11B Ain Roesley reviewed gene: PEX11B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28129423, 22581968; Phenotypes: Peroxisome biogenesis disorder 14B MIM#614920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6647 PEX10 Ain Roesley Marked gene: PEX10 as ready
Intellectual disability syndromic and non-syndromic v0.6647 PEX10 Ain Roesley Gene: pex10 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6647 PEX10 Ain Roesley Publications for gene: PEX10 were set to 20301621
Intellectual disability syndromic and non-syndromic v0.6647 PEX10 Ain Roesley Phenotypes for gene: PEX10 were changed from to Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870; Peroxisome biogenesis disorder 6B MIM#614871
Intellectual disability syndromic and non-syndromic v0.6646 PEX10 Ain Roesley Publications for gene: PEX10 were set to
Intellectual disability syndromic and non-syndromic v0.6646 PEX10 Ain Roesley Mode of inheritance for gene: PEX10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6645 PEX10 Ain Roesley reviewed gene: PEX10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870, Peroxisome biogenesis disorder 6B MIM#614871; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6645 PEX1 Ain Roesley Marked gene: PEX1 as ready
Intellectual disability syndromic and non-syndromic v0.6645 PEX1 Ain Roesley Gene: pex1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6645 PEX1 Ain Roesley Publications for gene: PEX1 were set to
Intellectual disability syndromic and non-syndromic v0.6645 PEX1 Ain Roesley Phenotypes for gene: PEX1 were changed from to Heimler syndrome 1 MIM#234580; Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100; Peroxisome biogenesis disorder 1B (NALD/IRD) MIM#601539
Intellectual disability syndromic and non-syndromic v0.6645 PEX1 Ain Roesley Mode of inheritance for gene: PEX1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6644 PEX1 Ain Roesley edited their review of gene: PEX1: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.6644 PEX1 Ain Roesley reviewed gene: PEX1: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Heimler syndrome 1 MIM#234580, Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100, Peroxisome biogenesis disorder 1B (NALD/IRD) MIM#601539; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6644 PEPD Ain Roesley Publications for gene: PEPD were set to 26110198; 32455636
Intellectual disability syndromic and non-syndromic v0.6644 PEPD Ain Roesley Phenotypes for gene: PEPD were changed from Prolidase deficiency MIM#170100 to Prolidase deficiency MIM#170100
Intellectual disability syndromic and non-syndromic v0.6643 PEPD Ain Roesley Marked gene: PEPD as ready
Intellectual disability syndromic and non-syndromic v0.6643 PEPD Ain Roesley Gene: pepd has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6643 PEPD Ain Roesley Phenotypes for gene: PEPD were changed from to Prolidase deficiency MIM#170100
Intellectual disability syndromic and non-syndromic v0.6643 PEPD Ain Roesley Publications for gene: PEPD were set to
Intellectual disability syndromic and non-syndromic v0.6643 PEPD Ain Roesley Mode of inheritance for gene: PEPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6642 PEPD Ain Roesley reviewed gene: PEPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26110198, 32455636; Phenotypes: Prolidase deficiency MIM#170100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6642 PDSS2 Ain Roesley Phenotypes for gene: PDSS2 were changed from Coenzyme Q10 deficiency, primary, 3 MIM#614652 to Coenzyme Q10 deficiency, primary, 3 MIM#614652
Intellectual disability syndromic and non-syndromic v0.6641 PDSS2 Ain Roesley Marked gene: PDSS2 as ready
Intellectual disability syndromic and non-syndromic v0.6641 PDSS2 Ain Roesley Gene: pdss2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.6641 PDSS2 Ain Roesley Phenotypes for gene: PDSS2 were changed from Coenzyme Q10 deficiency, primary, 3 MIM#614652 to Coenzyme Q10 deficiency, primary, 3 MIM#614652
Intellectual disability syndromic and non-syndromic v0.6640 PDSS2 Ain Roesley Phenotypes for gene: PDSS2 were changed from to Coenzyme Q10 deficiency, primary, 3 MIM#614652
Intellectual disability syndromic and non-syndromic v0.6640 PDSS2 Ain Roesley Publications for gene: PDSS2 were set to
Intellectual disability syndromic and non-syndromic v0.6639 PDSS2 Ain Roesley Mode of inheritance for gene: PDSS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6639 PDSS2 Ain Roesley Classified gene: PDSS2 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.6639 PDSS2 Ain Roesley Gene: pdss2 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.6638 PDSS2 Ain Roesley reviewed gene: PDSS2: Rating: RED; Mode of pathogenicity: None; Publications: 28125198, 29032433, 25349199, 17186472, 21723727, 10972372; Phenotypes: Coenzyme Q10 deficiency, primary, 3 MIM#614652; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6638 PDHX Ain Roesley Phenotypes for gene: PDHX were changed from Lacticacidemia due to PDX1 deficiency MIM#245349 to Lacticacidemia due to PDX1 deficiency MIM#245349
Intellectual disability syndromic and non-syndromic v0.6638 PDHX Ain Roesley Marked gene: PDHX as ready
Intellectual disability syndromic and non-syndromic v0.6638 PDHX Ain Roesley Gene: pdhx has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6638 PDHX Ain Roesley Phenotypes for gene: PDHX were changed from Lacticacidemia due to PDX1 deficiency MIM#245349 to Lacticacidemia due to PDX1 deficiency MIM#245349
Intellectual disability syndromic and non-syndromic v0.6638 PDHX Ain Roesley Phenotypes for gene: PDHX were changed from to Lacticacidemia due to PDX1 deficiency MIM#245349
Intellectual disability syndromic and non-syndromic v0.6637 PDHX Ain Roesley Publications for gene: PDHX were set to
Intellectual disability syndromic and non-syndromic v0.6637 PDHX Ain Roesley Mode of inheritance for gene: PDHX was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6636 PDHX Ain Roesley reviewed gene: PDHX: Rating: GREEN; Mode of pathogenicity: None; Publications: 34138529; Phenotypes: Lacticacidemia due to PDX1 deficiency MIM#245349; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6636 PDHA1 Ain Roesley Publications for gene: PDHA1 were set to 23021068
Intellectual disability syndromic and non-syndromic v0.6636 PDHA1 Ain Roesley Marked gene: PDHA1 as ready
Intellectual disability syndromic and non-syndromic v0.6636 PDHA1 Ain Roesley Gene: pdha1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6636 PDHA1 Ain Roesley Phenotypes for gene: PDHA1 were changed from Pyruvate dehydrogenase E1-alpha deficiency MIM#312170 to Pyruvate dehydrogenase E1-alpha deficiency MIM#312170
Intellectual disability syndromic and non-syndromic v0.6635 PDHA1 Ain Roesley Phenotypes for gene: PDHA1 were changed from to Pyruvate dehydrogenase E1-alpha deficiency MIM#312170
Intellectual disability syndromic and non-syndromic v0.6635 PDHA1 Ain Roesley Publications for gene: PDHA1 were set to
Intellectual disability syndromic and non-syndromic v0.6635 PDHA1 Ain Roesley Mode of inheritance for gene: PDHA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6634 PDHA1 Ain Roesley changed review comment from: In subjects surviving past 6 months, a broad range of intellectual outcomes was observed.; to: ID is a feature of this condition.

PMID:23021068 "In subjects surviving past 6 months, a broad range of intellectual outcomes was observed."
Intellectual disability syndromic and non-syndromic v0.6634 PDHA1 Ain Roesley reviewed gene: PDHA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23021068; Phenotypes: Pyruvate dehydrogenase E1-alpha deficiency MIM#312170; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6634 MED16 Zornitza Stark Marked gene: MED16 as ready
Intellectual disability syndromic and non-syndromic v0.6634 MED16 Zornitza Stark Gene: med16 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6634 PDGFRB Ain Roesley Publications for gene: PDGFRB were set to 31710779; 35221873
Intellectual disability syndromic and non-syndromic v0.6634 PDGFRB Ain Roesley Phenotypes for gene: PDGFRB were changed from Kosaki overgrowth syndrome MIM#616592 to Kosaki overgrowth syndrome MIM#616592
Intellectual disability syndromic and non-syndromic v0.6633 PDGFRB Ain Roesley Publications for gene: PDGFRB were set to
Intellectual disability syndromic and non-syndromic v0.6633 PDGFRB Ain Roesley Phenotypes for gene: PDGFRB were changed from to Kosaki overgrowth syndrome MIM#616592
Intellectual disability syndromic and non-syndromic v0.6633 PDGFRB Ain Roesley Mode of inheritance for gene: PDGFRB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6632 PDGFRB Ain Roesley Marked gene: PDGFRB as ready
Intellectual disability syndromic and non-syndromic v0.6632 PDGFRB Ain Roesley Gene: pdgfrb has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6632 PDGFRB Ain Roesley reviewed gene: PDGFRB: Rating: GREEN; Mode of pathogenicity: None; Publications: 31710779, 35221873; Phenotypes: Kosaki overgrowth syndrome MIM#616592; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6632 PCNT Ain Roesley reviewed gene: PCNT: Rating: AMBER; Mode of pathogenicity: None; Publications: 34978779; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II MIM#210720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6632 PCCA Ain Roesley Mode of inheritance for gene: PCCA was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6631 PCCA Ain Roesley Mode of inheritance for gene: PCCA was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6632 PCCB Ain Roesley Mode of inheritance for gene: PCCB was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6632 PCCB Ain Roesley Publications for gene: PCCB were set to 22593918
Intellectual disability syndromic and non-syndromic v0.6631 PCCB Ain Roesley Publications for gene: PCCB were set to
Intellectual disability syndromic and non-syndromic v0.6631 PCCA Ain Roesley Publications for gene: PCCA were set to 22593918
Intellectual disability syndromic and non-syndromic v0.6631 PCCA Ain Roesley Mode of inheritance for gene: PCCA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6631 PCCB Ain Roesley Phenotypes for gene: PCCB were changed from Propionicacidemia MIM#606054 to Propionicacidemia MIM#606054
Intellectual disability syndromic and non-syndromic v0.6631 PCCB Ain Roesley Phenotypes for gene: PCCB were changed from to Propionicacidemia MIM#606054
Intellectual disability syndromic and non-syndromic v0.6630 PCCB Ain Roesley Mode of inheritance for gene: PCCB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6631 PCDH19 Ain Roesley Publications for gene: PCDH19 were set to 28669061
Intellectual disability syndromic and non-syndromic v0.6630 PCCA Ain Roesley Publications for gene: PCCA were set to
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Marked gene: PCDH19 as ready
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Gene: pcdh19 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6630 PCCA Ain Roesley Phenotypes for gene: PCCA were changed from to Propionicacidemia MIM#606054
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Phenotypes for gene: PCDH19 were changed from to Developmental and epileptic encephalopathy 9 MIM#300088
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Publications for gene: PCDH19 were set to
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Mode of inheritance for gene: PCDH19 was changed from Unknown to Other
Intellectual disability syndromic and non-syndromic v0.6629 PCDH19 Ain Roesley reviewed gene: PCDH19: Rating: GREEN; Mode of pathogenicity: None; Publications: 28669061; Phenotypes: Developmental and epileptic encephalopathy 9 MIM#300088; Mode of inheritance: Other; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6629 PCCB Ain Roesley Marked gene: PCCB as ready
Intellectual disability syndromic and non-syndromic v0.6629 PCCB Ain Roesley Gene: pccb has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6629 PCCB Ain Roesley reviewed gene: PCCB: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6629 MARK2 Chirag Patel Classified gene: MARK2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6629 MARK2 Chirag Patel Gene: mark2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6628 PCCA Ain Roesley Marked gene: PCCA as ready
Intellectual disability syndromic and non-syndromic v0.6628 PCCA Ain Roesley Gene: pcca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6628 PCCA Ain Roesley reviewed gene: PCCA: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6628 MARK2 Chirag Patel gene: MARK2 was added
gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MARK2 were set to PMID: 39419027, 39436150
Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: MARK2 was set to GREEN
Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears).

WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains.

The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6627 UBTF Chirag Patel reviewed gene: UBTF: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 39366741; Phenotypes: Global developmental delay without neuroregression; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6627 SGSM3 Sangavi Sivagnanasundram reviewed gene: SGSM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 39390489; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), SGSM3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6627 LINC01578 Zornitza Stark Tag SV/CNV tag was added to gene: LINC01578.
Intellectual disability syndromic and non-syndromic v0.6627 LINC01578 Zornitza Stark Marked gene: LINC01578 as ready
Intellectual disability syndromic and non-syndromic v0.6627 LINC01578 Zornitza Stark Gene: linc01578 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6627 LINC01578 Zornitza Stark Classified gene: LINC01578 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6627 LINC01578 Zornitza Stark Gene: linc01578 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6626 LINC01578 Zornitza Stark gene: LINC01578 was added
gene: LINC01578 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: LINC01578.
Mode of inheritance for gene: LINC01578 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LINC01578 were set to 39442041
Phenotypes for gene: LINC01578 were set to Neurodevelopmental disorder, MONDO:0700092, CHASERR-related
Review for gene: LINC01578 was set to GREEN
Added comment: CHASERR encodes a human long noncoding RNA (lncRNA) adjacent to CHD2, a coding gene in which de novo loss-of-function variants cause developmental and epileptic encephalopathy. Three unrelated children reported with a syndromic, early-onset neurodevelopmental disorder, each of whom had a de novo deletion in the CHASERR locus. The children had severe encephalopathy, shared facial dysmorphisms, cortical atrophy, and cerebral hypomyelination - a phenotype that is distinct from the phenotypes of patients with CHD2 haploinsufficiency. CHASERR deletion results in increased CHD2 protein abundance in patient-derived cell lines and increased expression of the CHD2 transcript in cis, indicating bidirectional dosage sensitivity in human disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6625 RNU5B-1 Zornitza Stark Marked gene: RNU5B-1 as ready
Intellectual disability syndromic and non-syndromic v0.6625 RNU5B-1 Zornitza Stark Gene: rnu5b-1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6625 RNU5B-1 Zornitza Stark Phenotypes for gene: RNU5B-1 were changed from to Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related
Intellectual disability syndromic and non-syndromic v0.6624 RNU5B-1 Zornitza Stark Classified gene: RNU5B-1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6624 RNU5B-1 Zornitza Stark Gene: rnu5b-1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6623 RNU5B-1 Zornitza Stark edited their review of gene: RNU5B-1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related
Intellectual disability syndromic and non-syndromic v0.6623 RNU5B-1 Zornitza Stark gene: RNU5B-1 was added
gene: RNU5B-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU5B-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1
Review for gene: RNU5B-1 was set to GREEN
Added comment: 20 individuals reported in two preprints with de novo variants in this gene and a neurodevelopmental phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6622 MBOAT7 Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6621 MBOAT7 Zornitza Stark reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6621 SRPK3 Zornitza Stark Phenotypes for gene: SRPK3 were changed from Neurodevelopmental disorder, MONDO:0700092, SRPK3-related to Intellectual developmental disorder, X-linked, 114, MIM#301134
Intellectual disability syndromic and non-syndromic v0.6620 SRPK3 Zornitza Stark edited their review of gene: SRPK3: Changed phenotypes: Intellectual developmental disorder, X-linked, 114, MIM#301134
Intellectual disability syndromic and non-syndromic v0.6620 KCNJ11 Zornitza Stark Phenotypes for gene: KCNJ11 were changed from to {Diabetes mellitus, type 2, susceptibility to} 125853; Diabetes mellitus, transient neonatal, 3 610582; Diabetes, permanent neonatal, with or without neurologic features 606176; Hyperinsulinemic hypoglycemia, familial, 2 601820; Maturity-onset diabetes of the young, type 13 616329 AD
Intellectual disability syndromic and non-syndromic v0.6619 KCNJ11 Zornitza Stark Mode of inheritance for gene: KCNJ11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6618 KCNJ11 Zornitza Stark Marked gene: KCNJ11 as ready
Intellectual disability syndromic and non-syndromic v0.6618 KCNJ11 Zornitza Stark Gene: kcnj11 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.6618 YAP1 Zornitza Stark Marked gene: YAP1 as ready
Intellectual disability syndromic and non-syndromic v0.6618 YAP1 Zornitza Stark Gene: yap1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6618 YAP1 Zornitza Stark Phenotypes for gene: YAP1 were changed from to Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation OMIM #120433
Intellectual disability syndromic and non-syndromic v0.6617 YAP1 Zornitza Stark Publications for gene: YAP1 were set to
Intellectual disability syndromic and non-syndromic v0.6616 YAP1 Zornitza Stark Mode of inheritance for gene: YAP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6615 TGFB1 Zornitza Stark Marked gene: TGFB1 as ready
Intellectual disability syndromic and non-syndromic v0.6615 TGFB1 Zornitza Stark Gene: tgfb1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6615 RSPRY1 Zornitza Stark Marked gene: RSPRY1 as ready
Intellectual disability syndromic and non-syndromic v0.6615 RSPRY1 Zornitza Stark Gene: rspry1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6615 RAB1A Zornitza Stark Marked gene: RAB1A as ready
Intellectual disability syndromic and non-syndromic v0.6615 RAB1A Zornitza Stark Gene: rab1a has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6615 NUP85 Zornitza Stark Marked gene: NUP85 as ready
Intellectual disability syndromic and non-syndromic v0.6615 NUP85 Zornitza Stark Gene: nup85 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6615 CACNB4 Zornitza Stark Marked gene: CACNB4 as ready
Intellectual disability syndromic and non-syndromic v0.6615 CACNB4 Zornitza Stark Gene: cacnb4 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6615 AASS Zornitza Stark Marked gene: AASS as ready
Intellectual disability syndromic and non-syndromic v0.6615 AASS Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6615 SUOX Zornitza Stark Marked gene: SUOX as ready
Intellectual disability syndromic and non-syndromic v0.6615 SUOX Zornitza Stark Gene: suox has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6615 SUOX Zornitza Stark Phenotypes for gene: SUOX were changed from to isolated sulfite oxidase deficiency MONDO:0010089
Intellectual disability syndromic and non-syndromic v0.6614 SUOX Zornitza Stark Publications for gene: SUOX were set to
Intellectual disability syndromic and non-syndromic v0.6613 SUOX Zornitza Stark Mode of inheritance for gene: SUOX was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6612 SPTBN2 Zornitza Stark Marked gene: SPTBN2 as ready
Intellectual disability syndromic and non-syndromic v0.6612 SPTBN2 Zornitza Stark Gene: sptbn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6612 SPTBN2 Zornitza Stark Phenotypes for gene: SPTBN2 were changed from to Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386; Spinocerebellar ataxia 5, MIM# 600224
Intellectual disability syndromic and non-syndromic v0.6611 SPTBN2 Zornitza Stark Publications for gene: SPTBN2 were set to
Intellectual disability syndromic and non-syndromic v0.6610 SLC6A19 Zornitza Stark Marked gene: SLC6A19 as ready
Intellectual disability syndromic and non-syndromic v0.6610 SLC6A19 Zornitza Stark Gene: slc6a19 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6610 SLC6A19 Zornitza Stark Phenotypes for gene: SLC6A19 were changed from to Hartnup disorder, MIM# 234500
Intellectual disability syndromic and non-syndromic v0.6609 SLC6A19 Zornitza Stark Mode of inheritance for gene: SLC6A19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6608 SLC6A19 Zornitza Stark commented on gene: SLC6A19: Well established gene-disease association with several neurological manifestations, including DD.
Intellectual disability syndromic and non-syndromic v0.6608 SLC6A19 Zornitza Stark reviewed gene: SLC6A19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hartnup disorder, MIM# 234500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6608 DHX9 Zornitza Stark Phenotypes for gene: DHX9 were changed from Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 to Intellectual developmental disorder, autosomal dominant 75, MIM# 620988
Intellectual disability syndromic and non-syndromic v0.6607 DHX9 Zornitza Stark Phenotypes for gene: DHX9 were changed from Neurodevelopmental disorder, MONDO:0700092, DHX9-related to Intellectual developmental disorder, autosomal dominant 75, MIM# 620988
Intellectual disability syndromic and non-syndromic v0.6606 DHX9 Zornitza Stark edited their review of gene: DHX9: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 75, MIM# 620988
Intellectual disability syndromic and non-syndromic v0.6606 ANKRD31 Zornitza Stark Marked gene: ANKRD31 as ready
Intellectual disability syndromic and non-syndromic v0.6606 ANKRD31 Zornitza Stark Gene: ankrd31 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.6606 ANKRD31 Zornitza Stark Phenotypes for gene: ANKRD31 were changed from to Neurodevelopmental disorder, MONDO:0700092, ANKRD31-related
Intellectual disability syndromic and non-syndromic v0.6605 ANKRD31 Zornitza Stark Classified gene: ANKRD31 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.6605 ANKRD31 Zornitza Stark Gene: ankrd31 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.6604 ANKRD31 Megan Ball gene: ANKRD31 was added
gene: ANKRD31 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ANKRD31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKRD31 were set to 27541642
Review for gene: ANKRD31 was set to RED
Added comment: 1 individual with Rett-like phenotype. De novo missense. C.196A>T, p.Ile66Phe. Onset of features at 3 years, delayed ambulation, epilepsy, developmental regression, stereotypies, non-verbal. 17 years old at time of publication. A C.elegans model of ANKRD31 with a deletion showed significantly defective locomotion and asymmetric dynamics of axonal and dendritic microtubule defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6604 SLC35A2 Zornitza Stark Marked gene: SLC35A2 as ready
Intellectual disability syndromic and non-syndromic v0.6604 SLC35A2 Zornitza Stark Gene: slc35a2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6604 SLC35A2 Zornitza Stark Phenotypes for gene: SLC35A2 were changed from to Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854; Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE)
Intellectual disability syndromic and non-syndromic v0.6603 SLC35A2 Zornitza Stark Publications for gene: SLC35A2 were set to
Intellectual disability syndromic and non-syndromic v0.6602 SLC35A2 Zornitza Stark Mode of inheritance for gene: SLC35A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6601 SLC35A2 Zornitza Stark Tag somatic tag was added to gene: SLC35A2.
Intellectual disability syndromic and non-syndromic v0.6601 SLC35A2 Zornitza Stark reviewed gene: SLC35A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23561849, 24115232, 27743886, 25778940, 33407896; Phenotypes: Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854, Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6601 SLC33A1 Zornitza Stark Marked gene: SLC33A1 as ready
Intellectual disability syndromic and non-syndromic v0.6601 SLC33A1 Zornitza Stark Gene: slc33a1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6601 SLC33A1 Zornitza Stark Phenotypes for gene: SLC33A1 were changed from to Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482
Intellectual disability syndromic and non-syndromic v0.6601 SLC33A1 Zornitza Stark Publications for gene: SLC33A1 were set to 31194315
Intellectual disability syndromic and non-syndromic v0.6600 SLC33A1 Zornitza Stark Publications for gene: SLC33A1 were set to
Intellectual disability syndromic and non-syndromic v0.6599 SLC33A1 Zornitza Stark Mode of inheritance for gene: SLC33A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6598 SLC33A1 Zornitza Stark reviewed gene: SLC33A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31194315; Phenotypes: Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6598 SLC2A1 Zornitza Stark Marked gene: SLC2A1 as ready
Intellectual disability syndromic and non-syndromic v0.6598 SLC2A1 Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6598 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from to GLUT1-deficiency syndrome, MONDO:0000188; Dystonia 9 601042; GLUT1 deficiency syndrome 1, infantile onset, severe 606777; GLUT1 deficiency syndrome 2, childhood onset 612126; Stomatin-deficient cryohydrocytosis with neurologic defects 608885
Intellectual disability syndromic and non-syndromic v0.6597 SLC2A1 Zornitza Stark Publications for gene: SLC2A1 were set to
Intellectual disability syndromic and non-syndromic v0.6596 SLC2A1 Zornitza Stark Mode of inheritance for gene: SLC2A1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6595 SLC2A1 Zornitza Stark reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32913944; Phenotypes: GLUT1-deficiency syndrome, MONDO:0000188, Dystonia 9 601042, GLUT1 deficiency syndrome 1, infantile onset, severe 606777, GLUT1 deficiency syndrome 2, childhood onset 612126, Stomatin-deficient cryohydrocytosis with neurologic defects 608885; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6595 SLC25A22 Zornitza Stark Marked gene: SLC25A22 as ready
Intellectual disability syndromic and non-syndromic v0.6595 SLC25A22 Zornitza Stark Gene: slc25a22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6595 SLC25A22 Zornitza Stark Phenotypes for gene: SLC25A22 were changed from to Developmental and epileptic encephalopathy 3, MIM# 609304
Intellectual disability syndromic and non-syndromic v0.6594 SLC25A22 Zornitza Stark Publications for gene: SLC25A22 were set to
Intellectual disability syndromic and non-syndromic v0.6593 SLC25A22 Zornitza Stark Mode of inheritance for gene: SLC25A22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6592 SLC25A22 Zornitza Stark reviewed gene: SLC25A22: Rating: GREEN; Mode of pathogenicity: None; Publications: 15592994, 19780765, 24596948, 33821742, 33342683, 31285529; Phenotypes: Developmental and epileptic encephalopathy 3, MIM# 609304; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6592 ZRSR2 Zornitza Stark Phenotypes for gene: ZRSR2 were changed from Orofacialdigital syndrome MONDO:0015375, ZRSR2-related to Orofaciodigital syndrome XXI, MIM# 301132
Intellectual disability syndromic and non-syndromic v0.6591 ZRSR2 Zornitza Stark reviewed gene: ZRSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Orofaciodigital syndrome XXI, MIM# 301132; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6591 SLC25A12 Zornitza Stark Marked gene: SLC25A12 as ready
Intellectual disability syndromic and non-syndromic v0.6591 SLC25A12 Zornitza Stark Gene: slc25a12 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6591 SLC25A12 Zornitza Stark Phenotypes for gene: SLC25A12 were changed from to Developmental and epileptic encephalopathy 39, MIM# 612949
Intellectual disability syndromic and non-syndromic v0.6590 SLC25A12 Zornitza Stark Publications for gene: SLC25A12 were set to
Intellectual disability syndromic and non-syndromic v0.6589 SLC25A12 Zornitza Stark Mode of inheritance for gene: SLC25A12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6588 SLC25A12 Zornitza Stark reviewed gene: SLC25A12: Rating: GREEN; Mode of pathogenicity: None; Publications: 19641205, 24515575, 35008954, 32700846, 31766059, 31514314; Phenotypes: Developmental and epileptic encephalopathy 39, MIM# 612949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6588 SLC17A5 Zornitza Stark Marked gene: SLC17A5 as ready
Intellectual disability syndromic and non-syndromic v0.6588 SLC17A5 Zornitza Stark Gene: slc17a5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6588 SLC17A5 Zornitza Stark Phenotypes for gene: SLC17A5 were changed from to Sialic acid storage disorder, infantile, MIM# 269920
Intellectual disability syndromic and non-syndromic v0.6587 SLC17A5 Zornitza Stark Publications for gene: SLC17A5 were set to
Intellectual disability syndromic and non-syndromic v0.6586 SLC17A5 Zornitza Stark Mode of inheritance for gene: SLC17A5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6585 SLC17A5 Zornitza Stark edited their review of gene: SLC17A5: Changed publications: 10581036, 10947946
Intellectual disability syndromic and non-syndromic v0.6585 SLC17A5 Zornitza Stark commented on gene: SLC17A5: Sialic acid storage diseases are autosomal recessive neurodegenerative disorders that may present as a severe infantile form, including DD/IDD or a slowly progressive adult form, which is prevalent in Finland and referred to as Salla disease. p.Arg39Cys is a founder Finnish variant. Multiple families reported.
Intellectual disability syndromic and non-syndromic v0.6585 SLC17A5 Zornitza Stark reviewed gene: SLC17A5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sialic acid storage disorder, infantile, MIM# 269920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6585 SLC12A6 Zornitza Stark Marked gene: SLC12A6 as ready
Intellectual disability syndromic and non-syndromic v0.6585 SLC12A6 Zornitza Stark Gene: slc12a6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6585 SLC12A6 Zornitza Stark Phenotypes for gene: SLC12A6 were changed from to Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000
Intellectual disability syndromic and non-syndromic v0.6584 SLC12A6 Zornitza Stark Publications for gene: SLC12A6 were set to
Intellectual disability syndromic and non-syndromic v0.6583 SLC12A6 Zornitza Stark Mode of inheritance for gene: SLC12A6 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6582 SLC12A6 Zornitza Stark Mode of inheritance for gene: SLC12A6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6581 SLC12A6 Zornitza Stark reviewed gene: SLC12A6: Rating: GREEN; Mode of pathogenicity: None; Publications: 31439721, 27485015, 16606917, 21628467, 12368912, 17893295; Phenotypes: Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6581 AJAP1 Zornitza Stark Marked gene: AJAP1 as ready
Intellectual disability syndromic and non-syndromic v0.6581 AJAP1 Zornitza Stark Gene: ajap1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6581 AJAP1 Zornitza Stark Classified gene: AJAP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6581 AJAP1 Zornitza Stark Gene: ajap1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6580 AJAP1 Zornitza Stark gene: AJAP1 was added
gene: AJAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AJAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AJAP1 were set to 38985877
Phenotypes for gene: AJAP1 were set to neurodevelopmental disorder, MONDO:0700092, AJAP1-related
Review for gene: AJAP1 was set to GREEN
Added comment: PMID:38985877 reported five unrelated individuals with monoallelic variants or a deletion in AJAP1 gene and they presented with epilepsy, neurodevelopmental problems, or intellectual disability. There is also supporting functional evidence available.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6579 KIF5A Zornitza Stark Marked gene: KIF5A as ready
Intellectual disability syndromic and non-syndromic v0.6579 KIF5A Zornitza Stark Gene: kif5a has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6579 KIF5A Zornitza Stark Phenotypes for gene: KIF5A were changed from Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237 to Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237
Intellectual disability syndromic and non-syndromic v0.6578 KIF5A Zornitza Stark Phenotypes for gene: KIF5A were changed from to Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237
Intellectual disability syndromic and non-syndromic v0.6577 KIF5A Zornitza Stark Publications for gene: KIF5A were set to 18853458
Intellectual disability syndromic and non-syndromic v0.6576 KIF5A Zornitza Stark Publications for gene: KIF5A were set to
Intellectual disability syndromic and non-syndromic v0.6575 KIF5A Zornitza Stark Mode of inheritance for gene: KIF5A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6574 KIF5A Zornitza Stark Classified gene: KIF5A as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6574 KIF5A Zornitza Stark Gene: kif5a has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6573 KIF5A Zornitza Stark Classified gene: KIF5A as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6573 KIF5A Zornitza Stark Gene: kif5a has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6572 KIF7 Zornitza Stark Marked gene: KIF7 as ready
Intellectual disability syndromic and non-syndromic v0.6572 KIF7 Zornitza Stark Gene: kif7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6572 KIF7 Zornitza Stark Phenotypes for gene: KIF7 were changed from acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990 to acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990
Intellectual disability syndromic and non-syndromic v0.6571 KIF7 Zornitza Stark Phenotypes for gene: KIF7 were changed from to acrocallosal syndrome MONDO:0008708; KIF7-related ciliopathy MONDO:0800463; Joubert syndrome 12 MIM#200990
Intellectual disability syndromic and non-syndromic v0.6570 KIF7 Zornitza Stark Publications for gene: KIF7 were set to
Intellectual disability syndromic and non-syndromic v0.6569 KIF7 Zornitza Stark Mode of inheritance for gene: KIF7 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6569 KIF7 Zornitza Stark Mode of inheritance for gene: KIF7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6568 KLHL7 Zornitza Stark Marked gene: KLHL7 as ready
Intellectual disability syndromic and non-syndromic v0.6568 KLHL7 Zornitza Stark Gene: klhl7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6568 KLHL7 Zornitza Stark Phenotypes for gene: KLHL7 were changed from to PERCHING syndrome MONDO:0014890; acrocallosal syndrome MONDO:0008708
Intellectual disability syndromic and non-syndromic v0.6567 KLHL7 Zornitza Stark Publications for gene: KLHL7 were set to 27392078; 30142437; 29074562
Intellectual disability syndromic and non-syndromic v0.6566 KLHL7 Zornitza Stark Publications for gene: KLHL7 were set to
Intellectual disability syndromic and non-syndromic v0.6565 KLHL7 Zornitza Stark Mode of inheritance for gene: KLHL7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6564 L2HGDH Zornitza Stark Marked gene: L2HGDH as ready
Intellectual disability syndromic and non-syndromic v0.6564 L2HGDH Zornitza Stark Gene: l2hgdh has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6564 L2HGDH Zornitza Stark Phenotypes for gene: L2HGDH were changed from to L-2-hydroxyglutaric aciduria, MIM#236792
Intellectual disability syndromic and non-syndromic v0.6563 L2HGDH Zornitza Stark Publications for gene: L2HGDH were set to
Intellectual disability syndromic and non-syndromic v0.6562 L2HGDH Zornitza Stark Mode of inheritance for gene: L2HGDH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6561 L2HGDH Zornitza Stark Mode of inheritance for gene: L2HGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6560 LAMA1 Zornitza Stark Marked gene: LAMA1 as ready
Intellectual disability syndromic and non-syndromic v0.6560 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6560 LAMA1 Zornitza Stark Phenotypes for gene: LAMA1 were changed from to ataxia - intellectual disability - oculomotor apraxia - cerebellar cysts syndrome MONDO:0014419
Intellectual disability syndromic and non-syndromic v0.6559 LAMA1 Zornitza Stark Publications for gene: LAMA1 were set to
Intellectual disability syndromic and non-syndromic v0.6558 LAMA1 Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6557 LAMA1 Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6556 LAMA1 Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6555 LAMA1 Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6554 ISPD Zornitza Stark Marked gene: ISPD as ready
Intellectual disability syndromic and non-syndromic v0.6554 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6554 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643
Intellectual disability syndromic and non-syndromic v0.6553 ISPD Zornitza Stark Publications for gene: ISPD were set to 23288328
Intellectual disability syndromic and non-syndromic v0.6552 ISPD Zornitza Stark Publications for gene: ISPD were set to
Intellectual disability syndromic and non-syndromic v0.6551 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6550 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 ISPD Zornitza Stark Tag new gene name tag was added to gene: ISPD.
Intellectual disability syndromic and non-syndromic v0.6549 ISPD Sangavi Sivagnanasundram reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23288328; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 LAMA1 Sangavi Sivagnanasundram reviewed gene: LAMA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24013853; Phenotypes: ataxia - intellectual disability - oculomotor apraxia - cerebellar cysts syndrome MONDO:0014419; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 L2HGDH Sangavi Sivagnanasundram reviewed gene: L2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37113859; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 KLHL7 Sangavi Sivagnanasundram reviewed gene: KLHL7: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392078, 30142437, 29074562; Phenotypes: PERCHING syndrome MONDO:0014890, acrocallosal syndrome MONDO:0008708; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 KIF7 Sangavi Sivagnanasundram reviewed gene: KIF7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301500; Phenotypes: acrocallosal syndrome MONDO:0008708, KIF7-related ciliopathy MONDO:0800463, Joubert syndrome 12 MIM#200990; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6549 KIF5A Sangavi Sivagnanasundram reviewed gene: KIF5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 18853458; Phenotypes: Spastic paraplegia 10, autosomal dominant, MIM# 604187, inherited neurodegenerative disorder MONDO:0024237; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6549 DHRSX Zornitza Stark Marked gene: DHRSX as ready
Intellectual disability syndromic and non-syndromic v0.6549 DHRSX Zornitza Stark Gene: dhrsx has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6549 DHRSX Zornitza Stark Classified gene: DHRSX as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6549 DHRSX Zornitza Stark Gene: dhrsx has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6548 DHRSX Zornitza Stark edited their review of gene: DHRSX: Changed rating: GREEN
Intellectual disability syndromic and non-syndromic v0.6548 DHRSX Zornitza Stark gene: DHRSX was added
gene: DHRSX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHRSX was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DHRSX were set to 38821050
Phenotypes for gene: DHRSX were set to congenital disorder of glycosylation, MONDO:0015286, DHRSX-related
Added comment: PMID:38821050 reported the identification of biallelic missense variants in DHRSX gene in four patients from three unrelated families with a congenital disorder of glycosylation. They displayed distinct facial features, severe neurological involvement including hypotonia, scoliosis, contractures, profound intellectual disability, epilepsy, and sensorineural hearing loss. These patients also experienced severe failure to thrive (requiring tube feeding); variable respiratory insufficiency; and involvement of the eyes, the gastrointestinal system, and other organs.

Gene located in PAR.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6547 ITPR1 Zornitza Stark Marked gene: ITPR1 as ready
Intellectual disability syndromic and non-syndromic v0.6547 ITPR1 Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6547 ITPR1 Zornitza Stark Phenotypes for gene: ITPR1 were changed from to aniridia-cerebellar ataxia-intellectual disability syndrome MONDO:0008795; spinocerebellar ataxia type 29 MONDO:0007298
Intellectual disability syndromic and non-syndromic v0.6546 ITPR1 Zornitza Stark Publications for gene: ITPR1 were set to 27108797; 27108798; 15623688; 22986007; 28488678
Intellectual disability syndromic and non-syndromic v0.6545 ITPR1 Zornitza Stark Publications for gene: ITPR1 were set to
Intellectual disability syndromic and non-syndromic v0.6544 ITPR1 Zornitza Stark Mode of inheritance for gene: ITPR1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6543 IVD Zornitza Stark Marked gene: IVD as ready
Intellectual disability syndromic and non-syndromic v0.6543 IVD Zornitza Stark Gene: ivd has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6543 IVD Zornitza Stark Phenotypes for gene: IVD were changed from to isovaleric acidaemia MONDO:0009475
Intellectual disability syndromic and non-syndromic v0.6542 IVD Zornitza Stark Publications for gene: IVD were set to
Intellectual disability syndromic and non-syndromic v0.6541 IVD Zornitza Stark Mode of inheritance for gene: IVD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6540 KCNT1 Zornitza Stark Marked gene: KCNT1 as ready
Intellectual disability syndromic and non-syndromic v0.6540 KCNT1 Zornitza Stark Gene: kcnt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6540 KCNT1 Zornitza Stark Phenotypes for gene: KCNT1 were changed from to Developmental and epileptic encephalopathy MIM#614959; childhood-onset epilepsy syndrome MONDO:0020072
Intellectual disability syndromic and non-syndromic v0.6539 KCNT1 Zornitza Stark Publications for gene: KCNT1 were set to
Intellectual disability syndromic and non-syndromic v0.6538 KCNT1 Zornitza Stark Mode of inheritance for gene: KCNT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6537 KCTD7 Zornitza Stark Marked gene: KCTD7 as ready
Intellectual disability syndromic and non-syndromic v0.6537 KCTD7 Zornitza Stark Gene: kctd7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6537 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726); progressive myoclonus epilepsy MONDO:0020074 to progressive myoclonus epilepsy MONDO:0020074; Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726)
Intellectual disability syndromic and non-syndromic v0.6536 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726); progressive myoclonus epilepsy MONDO:0020074
Intellectual disability syndromic and non-syndromic v0.6535 KCTD7 Zornitza Stark Publications for gene: KCTD7 were set to
Intellectual disability syndromic and non-syndromic v0.6534 KCTD7 Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6533 KDM6A Zornitza Stark Marked gene: KDM6A as ready
Intellectual disability syndromic and non-syndromic v0.6533 KDM6A Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6533 KDM6A Zornitza Stark Phenotypes for gene: KDM6A were changed from to Kabuki syndrome 2 MONDO:0010465
Intellectual disability syndromic and non-syndromic v0.6532 KDM6A Zornitza Stark Publications for gene: KDM6A were set to
Intellectual disability syndromic and non-syndromic v0.6531 KDM6A Zornitza Stark Mode of inheritance for gene: KDM6A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Marked gene: KIAA0586 as ready
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Added comment: Comment when marking as ready: HGNC approved name KATNIP
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Gene: kiaa0586 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Marked gene: KIAA0586 as ready
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Gene: kiaa0586 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Publications for gene: KIAA0586 were set to
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Phenotypes for gene: KIAA0586 were changed from Joubert syndrome 23 MIM#616490 to Joubert syndrome 23 MIM#616490
Intellectual disability syndromic and non-syndromic v0.6529 KIAA0586 Zornitza Stark Phenotypes for gene: KIAA0586 were changed from to Joubert syndrome 23 MIM#616490
Intellectual disability syndromic and non-syndromic v0.6529 KIAA0586 Zornitza Stark Mode of inheritance for gene: KIAA0586 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6528 KIAA0586 Zornitza Stark Tag new gene name tag was added to gene: KIAA0586.
Intellectual disability syndromic and non-syndromic v0.6528 KIAA0586 Sangavi Sivagnanasundram reviewed gene: KIAA0586: Rating: GREEN; Mode of pathogenicity: None; Publications: 26096313; Phenotypes: Joubert syndrome 23 MIM#616490; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6528 KDM6A Sangavi Sivagnanasundram reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33674768; Phenotypes: Kabuki syndrome 2 MONDO:0010465; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6528 KCTD7 Sangavi Sivagnanasundram reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 30295347, 31197948; Phenotypes: progressive myoclonus epilepsy MONDO:0020074; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6528 KCNT1 Sangavi Sivagnanasundram reviewed gene: KCNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23086397, 24029078; Phenotypes: childhood-onset epilepsy syndrome MONDO:0020072; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6528 IVD Sangavi Sivagnanasundram reviewed gene: IVD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26018748; Phenotypes: isovaleric acidemia MONDO:0009475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6528 ITPR1 Sangavi Sivagnanasundram reviewed gene: ITPR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108797, 27108798, 15623688, 22986007, 28488678; Phenotypes: aniridia-cerebellar ataxia-intellectual disability syndrome MONDO:0008795, spinocerebellar ataxia type 29 MONDO:0007298; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6528 MSL2 Zornitza Stark Phenotypes for gene: MSL2 were changed from Neurodevelopmental disorder, MONDO:0700092, MSL2-related to Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985
Intellectual disability syndromic and non-syndromic v0.6527 MSL2 Zornitza Stark edited their review of gene: MSL2: Changed phenotypes: Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985
Intellectual disability syndromic and non-syndromic v0.6527 BORCS8 Zornitza Stark Phenotypes for gene: BORCS8 were changed from Neurodevelopmental disorder (MONDO#0700092), BORCS8-related to Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987
Intellectual disability syndromic and non-syndromic v0.6526 BORCS8 Zornitza Stark reviewed gene: BORCS8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6526 GLYCTK Bryony Thompson Marked gene: GLYCTK as ready
Intellectual disability syndromic and non-syndromic v0.6526 GLYCTK Bryony Thompson Gene: glyctk has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6526 GLYCTK Bryony Thompson Phenotypes for gene: GLYCTK were changed from to D-glyceric aciduria MONDO:0009070
Intellectual disability syndromic and non-syndromic v0.6525 GLYCTK Bryony Thompson Publications for gene: GLYCTK were set to
Intellectual disability syndromic and non-syndromic v0.6524 GLYCTK Bryony Thompson Mode of inheritance for gene: GLYCTK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6523 GLYCTK Bryony Thompson Classified gene: GLYCTK as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6523 GLYCTK Bryony Thompson Gene: glyctk has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6522 GLYCTK Bryony Thompson reviewed gene: GLYCTK: Rating: AMBER; Mode of pathogenicity: None; Publications: 20949620, 31837836, 3588091, 30637540, 28462797, 20949620, 28190537; Phenotypes: D-glyceric aciduria MONDO:0009070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6522 GLI3 Bryony Thompson Marked gene: GLI3 as ready
Intellectual disability syndromic and non-syndromic v0.6522 GLI3 Bryony Thompson Gene: gli3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6522 GLI3 Bryony Thompson Phenotypes for gene: GLI3 were changed from to Greig cephalopolysyndactyly syndrome MONDO:0008287
Intellectual disability syndromic and non-syndromic v0.6521 GLI3 Bryony Thompson Publications for gene: GLI3 were set to
Intellectual disability syndromic and non-syndromic v0.6520 GLI3 Bryony Thompson Mode of inheritance for gene: GLI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6519 GLI3 Bryony Thompson reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301619, 20301638; Phenotypes: Greig cephalopolysyndactyly syndrome MONDO:0008287; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6519 GLI2 Bryony Thompson Marked gene: GLI2 as ready
Intellectual disability syndromic and non-syndromic v0.6519 GLI2 Bryony Thompson Gene: gli2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6519 GLI2 Bryony Thompson Phenotypes for gene: GLI2 were changed from to postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369
Intellectual disability syndromic and non-syndromic v0.6518 GLI2 Bryony Thompson Publications for gene: GLI2 were set to
Intellectual disability syndromic and non-syndromic v0.6517 GLI2 Bryony Thompson Mode of inheritance for gene: GLI2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6516 GLI2 Bryony Thompson reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24744436; Phenotypes: postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6516 GLDC Bryony Thompson Marked gene: GLDC as ready
Intellectual disability syndromic and non-syndromic v0.6516 GLDC Bryony Thompson Gene: gldc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6516 GLDC Bryony Thompson Phenotypes for gene: GLDC were changed from to glycine encephalopathy MONDO:0011612
Intellectual disability syndromic and non-syndromic v0.6515 GLDC Bryony Thompson Publications for gene: GLDC were set to
Intellectual disability syndromic and non-syndromic v0.6514 GLDC Bryony Thompson Mode of inheritance for gene: GLDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6513 GLDC Bryony Thompson reviewed gene: GLDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301531; Phenotypes: glycine encephalopathy MONDO:0011612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6513 GLB1 Bryony Thompson Marked gene: GLB1 as ready
Intellectual disability syndromic and non-syndromic v0.6513 GLB1 Bryony Thompson Gene: glb1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6513 GLB1 Bryony Thompson Phenotypes for gene: GLB1 were changed from to GM1 gangliosidosis MONDO:0018149; mucopolysaccharidosis type 4B MONDO:0009660
Intellectual disability syndromic and non-syndromic v0.6512 GLB1 Bryony Thompson Publications for gene: GLB1 were set to
Intellectual disability syndromic and non-syndromic v0.6511 GLB1 Bryony Thompson Mode of inheritance for gene: GLB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6510 GLB1 Bryony Thompson reviewed gene: GLB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24156116; Phenotypes: GM1 gangliosidosis MONDO:0018149, mucopolysaccharidosis type 4B MONDO:0009660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6510 GK Bryony Thompson Marked gene: GK as ready
Intellectual disability syndromic and non-syndromic v0.6510 GK Bryony Thompson Gene: gk has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6510 GK Bryony Thompson Phenotypes for gene: GK were changed from to inborn glycerol kinase deficiency MONDO:0010613; X-linked adrenal hypoplasia congenita MONDO:0010264
Intellectual disability syndromic and non-syndromic v0.6509 GK Bryony Thompson Publications for gene: GK were set to
Intellectual disability syndromic and non-syndromic v0.6508 GK Bryony Thompson Mode of inheritance for gene: GK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6507 GK Bryony Thompson Tag SV/CNV tag was added to gene: GK.
Intellectual disability syndromic and non-syndromic v0.6507 GK Bryony Thompson reviewed gene: GK: Rating: GREEN; Mode of pathogenicity: None; Publications: 37091526, 33212314; Phenotypes: inborn glycerol kinase deficiency MONDO:0010613, X-linked adrenal hypoplasia congenita MONDO:0010264; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6507 MAL Zornitza Stark Phenotypes for gene: MAL were changed from Leukodystrophy MONDO:0019046, MAL-related to Leukodystrophy, hypomyelinating, 28, MIM# 620978
Intellectual disability syndromic and non-syndromic v0.6506 MAL Zornitza Stark edited their review of gene: MAL: Changed phenotypes: Leukodystrophy, hypomyelinating, 28, MIM# 620978
Intellectual disability syndromic and non-syndromic v0.6506 GJC2 Bryony Thompson Marked gene: GJC2 as ready
Intellectual disability syndromic and non-syndromic v0.6506 GJC2 Bryony Thompson Gene: gjc2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6506 GJC2 Bryony Thompson Phenotypes for gene: GJC2 were changed from to hypomyelinating leukodystrophy 2 MONDO:0012125; hereditary spastic paraplegia 44 MONDO:0013179
Intellectual disability syndromic and non-syndromic v0.6505 GJC2 Bryony Thompson reviewed gene: GJC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29276893; Phenotypes: hypomyelinating leukodystrophy 2 MONDO:0012125, hereditary spastic paraplegia 44 MONDO:0013179; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6505 GJC2 Bryony Thompson Publications for gene: GJC2 were set to
Intellectual disability syndromic and non-syndromic v0.6504 GJC2 Bryony Thompson Mode of inheritance for gene: GJC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6503 GFM1 Bryony Thompson Marked gene: GFM1 as ready
Intellectual disability syndromic and non-syndromic v0.6503 GFM1 Bryony Thompson Gene: gfm1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6503 GFM1 Bryony Thompson Phenotypes for gene: GFM1 were changed from to Leigh syndrome MONDO:0009723
Intellectual disability syndromic and non-syndromic v0.6502 GFM1 Bryony Thompson Publications for gene: GFM1 were set to
Intellectual disability syndromic and non-syndromic v0.6501 GFM1 Bryony Thompson Mode of inheritance for gene: GFM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6500 GFM1 Bryony Thompson reviewed gene: GFM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25852744, 31680380, 21986555, 32776492; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6500 SLC12A5 Zornitza Stark Marked gene: SLC12A5 as ready
Intellectual disability syndromic and non-syndromic v0.6500 SLC12A5 Zornitza Stark Gene: slc12a5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6500 SLC12A5 Zornitza Stark Phenotypes for gene: SLC12A5 were changed from to Developmental and epileptic encephalopathy 34, MIM# 616645
Intellectual disability syndromic and non-syndromic v0.6499 SLC12A5 Zornitza Stark Publications for gene: SLC12A5 were set to
Intellectual disability syndromic and non-syndromic v0.6498 SLC12A5 Zornitza Stark Mode of inheritance for gene: SLC12A5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6497 SLC12A5 Zornitza Stark changed review comment from: Note LIMITED by ClinGen. However, note functional evidence including mouse model.

Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship.; to: LIMITED by ClinGen. However, note functional evidence including mouse model and additional family in 38660387, again with supportive functional data.

Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship.
Intellectual disability syndromic and non-syndromic v0.6497 SLC12A5 Zornitza Stark edited their review of gene: SLC12A5: Changed publications: 26333769, 27436767, 31618474, 12000122, 38660387
Intellectual disability syndromic and non-syndromic v0.6497 SLC12A5 Zornitza Stark reviewed gene: SLC12A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26333769, 27436767, 31618474, 12000122; Phenotypes: Developmental and epileptic encephalopathy 34, MIM# 616645; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6497 SC5D Zornitza Stark Marked gene: SC5D as ready
Intellectual disability syndromic and non-syndromic v0.6497 SC5D Zornitza Stark Gene: sc5d has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6497 SC5D Zornitza Stark Phenotypes for gene: SC5D were changed from to Lathosterolosis, MIM#607330
Intellectual disability syndromic and non-syndromic v0.6496 SC5D Zornitza Stark Publications for gene: SC5D were set to
Intellectual disability syndromic and non-syndromic v0.6495 SC5D Zornitza Stark Mode of inheritance for gene: SC5D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6494 SC5D Zornitza Stark changed review comment from: Well established gene-disease association. DD/ID is part of the phenotype.; to: Well established gene-disease association. DD/ID is part of the phenotype. More than 5 families reported.
Intellectual disability syndromic and non-syndromic v0.6494 SC5D Zornitza Stark edited their review of gene: SC5D: Changed publications: 17853487, 12189593, 12812989, 24142275
Intellectual disability syndromic and non-syndromic v0.6494 SC5D Zornitza Stark reviewed gene: SC5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lathosterolosis, MIM#607330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6494 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Intellectual disability syndromic and non-syndromic v0.6494 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6494 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from Dyskeratosis congenita, autosomal recessive 5, MIM#615190 to Dyskeratosis congenita, autosomal recessive 5, MIM#615190
Intellectual disability syndromic and non-syndromic v0.6493 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal recessive 5, MIM#615190
Intellectual disability syndromic and non-syndromic v0.6492 RTEL1 Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6491 RTEL1 Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dyskeratosis congenita, autosomal recessive 5, MIM#615190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6491 RRM2B Zornitza Stark Marked gene: RRM2B as ready
Intellectual disability syndromic and non-syndromic v0.6491 RRM2B Zornitza Stark Gene: rrm2b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6491 RRM2B Zornitza Stark Phenotypes for gene: RRM2B were changed from to Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075; Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075
Intellectual disability syndromic and non-syndromic v0.6490 RRM2B Zornitza Stark Mode of inheritance for gene: RRM2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6489 RRM2B Zornitza Stark reviewed gene: RRM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075, Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6489 UFC1 Zornitza Stark Tag deep intronic tag was added to gene: UFC1.
Intellectual disability syndromic and non-syndromic v0.6489 UFC1 Zornitza Stark reviewed gene: UFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with spasticity and poor growth, OMIM #618076; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6489 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Intellectual disability syndromic and non-syndromic v0.6489 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6489 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from to Coffin-Lowry syndrome MIM# 303600
Intellectual disability syndromic and non-syndromic v0.6488 RPS6KA3 Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6487 RPS6KA3 Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Lowry syndrome MIM# 303600; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6487 RPGRIP1L Zornitza Stark Marked gene: RPGRIP1L as ready
Intellectual disability syndromic and non-syndromic v0.6487 RPGRIP1L Zornitza Stark Gene: rpgrip1l has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6487 RPGRIP1L Zornitza Stark Phenotypes for gene: RPGRIP1L were changed from to Joubert syndrome 7, MIM# 611560; Meckel syndrome 5, MIM# 611561
Intellectual disability syndromic and non-syndromic v0.6486 RPGRIP1L Zornitza Stark Mode of inheritance for gene: RPGRIP1L was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6485 RPGRIP1L Zornitza Stark reviewed gene: RPGRIP1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Joubert syndrome 7, MIM# 611560, Meckel syndrome 5, MIM# 611561; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6485 RNASET2 Zornitza Stark Marked gene: RNASET2 as ready
Intellectual disability syndromic and non-syndromic v0.6485 RNASET2 Zornitza Stark Gene: rnaset2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6485 RNASET2 Zornitza Stark Phenotypes for gene: RNASET2 were changed from to Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951
Intellectual disability syndromic and non-syndromic v0.6484 RNASET2 Zornitza Stark Publications for gene: RNASET2 were set to
Intellectual disability syndromic and non-syndromic v0.6483 RNASET2 Zornitza Stark Mode of inheritance for gene: RNASET2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6482 RNASET2 Zornitza Stark edited their review of gene: RNASET2: Added comment: More than 10 families reported, DD/ID is part of the phenotype.; Changed publications: 31349848, 19525954, 27091087, 29336640, 18545798, 15851732
Intellectual disability syndromic and non-syndromic v0.6482 RNASET2 Zornitza Stark reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6482 RNASEH2C Zornitza Stark Marked gene: RNASEH2C as ready
Intellectual disability syndromic and non-syndromic v0.6482 RNASEH2C Zornitza Stark Gene: rnaseh2c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6482 RNASEH2C Zornitza Stark Phenotypes for gene: RNASEH2C were changed from to Aicardi-Goutieres syndrome 3, MIM# 610329
Intellectual disability syndromic and non-syndromic v0.6481 RNASEH2C Zornitza Stark Mode of inheritance for gene: RNASEH2C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6480 RNASEH2C Zornitza Stark reviewed gene: RNASEH2C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 3, MIM# 610329; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6480 RNASEH2B Zornitza Stark Marked gene: RNASEH2B as ready
Intellectual disability syndromic and non-syndromic v0.6480 RNASEH2B Zornitza Stark Gene: rnaseh2b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6480 RNASEH2B Zornitza Stark Phenotypes for gene: RNASEH2B were changed from to Aicardi-Goutieres syndrome 2, MIM# 610181
Intellectual disability syndromic and non-syndromic v0.6479 RNASEH2B Zornitza Stark Mode of inheritance for gene: RNASEH2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6478 RNASEH2B Zornitza Stark reviewed gene: RNASEH2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 2, MIM# 610181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6478 RNASEH2A Zornitza Stark Marked gene: RNASEH2A as ready
Intellectual disability syndromic and non-syndromic v0.6478 RNASEH2A Zornitza Stark Gene: rnaseh2a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6478 RNASEH2A Zornitza Stark Phenotypes for gene: RNASEH2A were changed from to Aicardi-Goutieres syndrome 4, MIM# 610333
Intellectual disability syndromic and non-syndromic v0.6477 RNASEH2A Zornitza Stark Mode of inheritance for gene: RNASEH2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6476 RNASEH2A Zornitza Stark reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 4, MIM# 610333; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6476 RMND1 Zornitza Stark Marked gene: RMND1 as ready
Intellectual disability syndromic and non-syndromic v0.6476 RMND1 Zornitza Stark Gene: rmnd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6476 RMND1 Zornitza Stark Phenotypes for gene: RMND1 were changed from to Combined oxidative phosphorylation deficiency 11 MIM#614922
Intellectual disability syndromic and non-syndromic v0.6475 RMND1 Zornitza Stark Publications for gene: RMND1 were set to
Intellectual disability syndromic and non-syndromic v0.6474 RMND1 Zornitza Stark Mode of inheritance for gene: RMND1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6473 RMND1 Zornitza Stark reviewed gene: RMND1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 11 MIM#614922; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6473 RIT1 Zornitza Stark Marked gene: RIT1 as ready
Intellectual disability syndromic and non-syndromic v0.6473 RIT1 Zornitza Stark Gene: rit1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6473 RIT1 Zornitza Stark Phenotypes for gene: RIT1 were changed from to Noonan syndrome 8, MIM# 615355
Intellectual disability syndromic and non-syndromic v0.6472 RIT1 Zornitza Stark Publications for gene: RIT1 were set to
Intellectual disability syndromic and non-syndromic v0.6471 RIT1 Zornitza Stark Mode of pathogenicity for gene: RIT1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6470 RIT1 Zornitza Stark Mode of inheritance for gene: RIT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6469 RFC4 Zornitza Stark Marked gene: RFC4 as ready
Intellectual disability syndromic and non-syndromic v0.6469 RFC4 Zornitza Stark Gene: rfc4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6469 RFC4 Zornitza Stark Phenotypes for gene: RFC4 were changed from RFC4-related multisystem disorder to Neurodevelopmental disorder, MONDO:0700092, RFC4-related
Intellectual disability syndromic and non-syndromic v0.6468 RFC4 Zornitza Stark reviewed gene: RFC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RFC4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6468 RARS2 Zornitza Stark Marked gene: RARS2 as ready
Intellectual disability syndromic and non-syndromic v0.6468 RARS2 Zornitza Stark Gene: rars2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6468 RARS2 Zornitza Stark Phenotypes for gene: RARS2 were changed from to Pontocerebellar hypoplasia, type 6, MIM# 611523
Intellectual disability syndromic and non-syndromic v0.6467 RARS2 Zornitza Stark Publications for gene: RARS2 were set to
Intellectual disability syndromic and non-syndromic v0.6466 RARS2 Zornitza Stark Mode of inheritance for gene: RARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6465 RARS2 Zornitza Stark reviewed gene: RARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17847012, 20635367, 25809939; Phenotypes: Pontocerebellar hypoplasia, type 6, MIM# 611523; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6465 IPO8 Zornitza Stark Marked gene: IPO8 as ready
Intellectual disability syndromic and non-syndromic v0.6465 IPO8 Zornitza Stark Gene: ipo8 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6465 IPO8 Zornitza Stark Classified gene: IPO8 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6465 IPO8 Zornitza Stark Gene: ipo8 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6464 IPO8 Zornitza Stark gene: IPO8 was added
gene: IPO8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IPO8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IPO8 were set to 34010604; 33875846; 34010605
Phenotypes for gene: IPO8 were set to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities
Review for gene: IPO8 was set to GREEN
Added comment: There are 35 unrelated cases with a IPO8 variant, 4/35 with mild ID, 1/35 with severe ID and 7 global developmental delay. There is a further case with severe ID, but the patient also has a 1.779Mb deletion in 19q13.4, which could be responsible for the ID (PMID: 34010605).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6463 PRKACB Zornitza Stark Publications for gene: PRKACB were set to 33058759
Intellectual disability syndromic and non-syndromic v0.6462 PRKACB Zornitza Stark Classified gene: PRKACB as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6462 PRKACB Zornitza Stark Gene: prkacb has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6461 PRKACB Zornitza Stark edited their review of gene: PRKACB: Added comment: Additional individual reported with ID and de novo missense variant.; Changed rating: GREEN; Changed publications: 39095811
Intellectual disability syndromic and non-syndromic v0.6461 RAF1 Zornitza Stark Marked gene: RAF1 as ready
Intellectual disability syndromic and non-syndromic v0.6461 RAF1 Zornitza Stark Gene: raf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6461 RAF1 Zornitza Stark Phenotypes for gene: RAF1 were changed from Noonan syndrome 5, MIM# 611553 to Noonan syndrome 5, MIM# 611553
Intellectual disability syndromic and non-syndromic v0.6460 RAF1 Zornitza Stark Phenotypes for gene: RAF1 were changed from to Noonan syndrome 5, MIM# 611553
Intellectual disability syndromic and non-syndromic v0.6459 RAF1 Zornitza Stark Publications for gene: RAF1 were set to
Intellectual disability syndromic and non-syndromic v0.6458 RAF1 Zornitza Stark Mode of pathogenicity for gene: RAF1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6457 RAF1 Zornitza Stark Mode of inheritance for gene: RAF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6456 RAB18 Zornitza Stark changed review comment from: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln; to: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe ID, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln
Intellectual disability syndromic and non-syndromic v0.6456 RAB18 Zornitza Stark Marked gene: RAB18 as ready
Intellectual disability syndromic and non-syndromic v0.6456 RAB18 Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6456 RAB18 Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222
Intellectual disability syndromic and non-syndromic v0.6455 RAB18 Zornitza Stark Publications for gene: RAB18 were set to
Intellectual disability syndromic and non-syndromic v0.6454 RAB18 Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6453 RAB18 Zornitza Stark Tag founder tag was added to gene: RAB18.
Intellectual disability syndromic and non-syndromic v0.6453 RAB18 Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6453 PYCR1 Zornitza Stark Marked gene: PYCR1 as ready
Intellectual disability syndromic and non-syndromic v0.6453 PYCR1 Zornitza Stark Gene: pycr1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6453 PYCR1 Zornitza Stark Phenotypes for gene: PYCR1 were changed from to Cutis laxa, autosomal recessive, type IIB, MIM# 612940; Cutis laxa, autosomal recessive, type IIIB, MIM# 614438
Intellectual disability syndromic and non-syndromic v0.6452 PYCR1 Zornitza Stark Publications for gene: PYCR1 were set to
Intellectual disability syndromic and non-syndromic v0.6451 PYCR1 Zornitza Stark Mode of inheritance for gene: PYCR1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6450 PYCR1 Zornitza Stark reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19648921, 4076251, 22052856, 19576563, 19648921, 9648921, 22052856, 28294978, 27756598; Phenotypes: Cutis laxa, autosomal recessive, type IIB, MIM# 612940, Cutis laxa, autosomal recessive, type IIIB, MIM# 614438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6450 PUS1 Zornitza Stark Marked gene: PUS1 as ready
Intellectual disability syndromic and non-syndromic v0.6450 PUS1 Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6450 PUS1 Zornitza Stark Phenotypes for gene: PUS1 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Intellectual disability syndromic and non-syndromic v0.6449 PUS1 Zornitza Stark Publications for gene: PUS1 were set to
Intellectual disability syndromic and non-syndromic v0.6448 PUS1 Zornitza Stark Mode of inheritance for gene: PUS1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6448 PUS1 Zornitza Stark Mode of inheritance for gene: PUS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6447 PUS1 Zornitza Stark edited their review of gene: PUS1: Changed phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Intellectual disability syndromic and non-syndromic v0.6447 PUS1 Zornitza Stark reviewed gene: PUS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25227147, 17056637, 15108122, 32287105, 31641589, 28832011; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6447 PTS Zornitza Stark Marked gene: PTS as ready
Intellectual disability syndromic and non-syndromic v0.6447 PTS Zornitza Stark Gene: pts has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6447 PTS Zornitza Stark Phenotypes for gene: PTS were changed from Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 to Hyperphenylalaninaemia, BH4-deficient, A, MIM# 261640
Intellectual disability syndromic and non-syndromic v0.6446 PTS Zornitza Stark Phenotypes for gene: PTS were changed from to Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640
Intellectual disability syndromic and non-syndromic v0.6445 PTS Zornitza Stark Mode of inheritance for gene: PTS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6444 PTS Zornitza Stark reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6444 PTPN11 Zornitza Stark Marked gene: PTPN11 as ready
Intellectual disability syndromic and non-syndromic v0.6444 PTPN11 Zornitza Stark Gene: ptpn11 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6444 PTPN11 Zornitza Stark Phenotypes for gene: PTPN11 were changed from to Noonan syndrome 1, MIM#163950 AD; LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines)
Intellectual disability syndromic and non-syndromic v0.6443 PTPN11 Zornitza Stark Publications for gene: PTPN11 were set to
Intellectual disability syndromic and non-syndromic v0.6442 PTPN11 Zornitza Stark Mode of pathogenicity for gene: PTPN11 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6441 PTPN11 Zornitza Stark Mode of inheritance for gene: PTPN11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6440 PTF1A Zornitza Stark Marked gene: PTF1A as ready
Intellectual disability syndromic and non-syndromic v0.6440 PTF1A Zornitza Stark Gene: ptf1a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6440 PTF1A Zornitza Stark Phenotypes for gene: PTF1A were changed from to Pancreatic and cerebellar agenesis, MIM# 609069
Intellectual disability syndromic and non-syndromic v0.6439 PTF1A Zornitza Stark Publications for gene: PTF1A were set to
Intellectual disability syndromic and non-syndromic v0.6438 PTF1A Zornitza Stark Mode of inheritance for gene: PTF1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6437 PTF1A Zornitza Stark reviewed gene: PTF1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 21749365, 10507728, 15543146, 19650412; Phenotypes: Pancreatic and cerebellar agenesis, MIM# 609069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6437 PTDSS1 Zornitza Stark Marked gene: PTDSS1 as ready
Intellectual disability syndromic and non-syndromic v0.6437 PTDSS1 Zornitza Stark Gene: ptdss1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6437 PTDSS1 Zornitza Stark Phenotypes for gene: PTDSS1 were changed from Lenz-Majewski hyperostotic dwarfism MIM#151050 to Lenz-Majewski hyperostotic dwarfism MIM#151050
Intellectual disability syndromic and non-syndromic v0.6436 PTDSS1 Zornitza Stark Phenotypes for gene: PTDSS1 were changed from to Lenz-Majewski hyperostotic dwarfism MIM#151050
Intellectual disability syndromic and non-syndromic v0.6435 PTDSS1 Zornitza Stark Publications for gene: PTDSS1 were set to
Intellectual disability syndromic and non-syndromic v0.6434 PTDSS1 Zornitza Stark Mode of inheritance for gene: PTDSS1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6433 PTDSS1 Zornitza Stark commented on gene: PTDSS1: Lenz-Majewski hyperostotic dwarfism is a rare condition characterized by intellectual disability, sclerosing bone dysplasia, distinct craniofacial and dental anomalies, loose skin, and distal limb anomalies, particularly brachydactyly and symphalangism. Patients have multiple radiographic abnormalities due to progressive generalized hyperostosis that affects the cranium, vertebrae, and diaphyses of tubular bones, leading to severe growth retardation.

Multiple families. Gain-of-function is the established or expected mechanism of disease for these variants.
Intellectual disability syndromic and non-syndromic v0.6433 PTDSS1 Zornitza Stark edited their review of gene: PTDSS1: Changed publications: 24241535, 29341480, 31403251
Intellectual disability syndromic and non-syndromic v0.6433 PTDSS1 Zornitza Stark reviewed gene: PTDSS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lenz-Majewski hyperostotic dwarfism MIM#151050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6433 PTCH1 Zornitza Stark Marked gene: PTCH1 as ready
Intellectual disability syndromic and non-syndromic v0.6433 PTCH1 Zornitza Stark Gene: ptch1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6433 PTCH1 Zornitza Stark Phenotypes for gene: PTCH1 were changed from to Holoprosencephaly 7, MIM# 610828
Intellectual disability syndromic and non-syndromic v0.6432 PTCH1 Zornitza Stark Mode of inheritance for gene: PTCH1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6431 PTCH1 Zornitza Stark Mode of inheritance for gene: PTCH1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6430 PTCH1 Zornitza Stark reviewed gene: PTCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holoprosencephaly 7, MIM# 610828; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6430 KBTBD2 Zornitza Stark Marked gene: KBTBD2 as ready
Intellectual disability syndromic and non-syndromic v0.6430 KBTBD2 Zornitza Stark Gene: kbtbd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6430 KBTBD2 Zornitza Stark Classified gene: KBTBD2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6430 KBTBD2 Zornitza Stark Gene: kbtbd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6429 KBTBD2 Zornitza Stark gene: KBTBD2 was added
gene: KBTBD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KBTBD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KBTBD2 were set to 39313616
Phenotypes for gene: KBTBD2 were set to neurodevelopmental disorder MONDO:0700092, KBTBD2-related
Review for gene: KBTBD2 was set to GREEN
Added comment: 3 families - 2 compound hets and 1 hom

phenotypes include:
Microcephaly, hypotonia, failure to thrive, IUGR, delayed gross motor development, dysmorphism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6428 MAP2K1 Zornitza Stark Marked gene: MAP2K1 as ready
Intellectual disability syndromic and non-syndromic v0.6428 MAP2K1 Zornitza Stark Gene: map2k1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6428 MAP2K1 Zornitza Stark Phenotypes for gene: MAP2K1 were changed from to Cardiofaciocutaneous syndrome 3, MIM# 615279
Intellectual disability syndromic and non-syndromic v0.6427 MAP2K1 Zornitza Stark Publications for gene: MAP2K1 were set to 16439621; 17551924; 18042262; 20301365
Intellectual disability syndromic and non-syndromic v0.6426 MAP2K1 Zornitza Stark Publications for gene: MAP2K1 were set to
Intellectual disability syndromic and non-syndromic v0.6425 MAP2K1 Zornitza Stark Mode of pathogenicity for gene: MAP2K1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6424 MAP2K1 Zornitza Stark Mode of inheritance for gene: MAP2K1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6423 MAP2K1 Zornitza Stark Mode of inheritance for gene: MAP2K1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6422 MAP2K2 Zornitza Stark Marked gene: MAP2K2 as ready
Intellectual disability syndromic and non-syndromic v0.6422 MAP2K2 Zornitza Stark Gene: map2k2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6422 MAP2K2 Zornitza Stark Phenotypes for gene: MAP2K2 were changed from to Cardiofaciocutaneous syndrome 3, MIM# 615279
Intellectual disability syndromic and non-syndromic v0.6421 MAP2K2 Zornitza Stark Mode of pathogenicity for gene: MAP2K2 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.6420 MAP2K2 Zornitza Stark Publications for gene: MAP2K2 were set to
Intellectual disability syndromic and non-syndromic v0.6419 MAP2K2 Zornitza Stark Mode of inheritance for gene: MAP2K2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6418 MAT1A Zornitza Stark Marked gene: MAT1A as ready
Intellectual disability syndromic and non-syndromic v0.6418 MAT1A Zornitza Stark Gene: mat1a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6418 MAT1A Zornitza Stark Phenotypes for gene: MAT1A were changed from to Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850; Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850; Disorders of the metabolism of sulphur amino acids
Intellectual disability syndromic and non-syndromic v0.6417 MAT1A Zornitza Stark Publications for gene: MAT1A were set to
Intellectual disability syndromic and non-syndromic v0.6416 MAT1A Zornitza Stark Mode of inheritance for gene: MAT1A was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6415 MBOAT7 Zornitza Stark Marked gene: MBOAT7 as ready
Intellectual disability syndromic and non-syndromic v0.6415 MBOAT7 Zornitza Stark Gene: mboat7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6415 MBOAT7 Zornitza Stark Phenotypes for gene: MBOAT7 were changed from to Intellectual disability MIM#617188
Intellectual disability syndromic and non-syndromic v0.6414 MBOAT7 Zornitza Stark Publications for gene: MBOAT7 were set to
Intellectual disability syndromic and non-syndromic v0.6413 MBOAT7 Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6412 MKKS Zornitza Stark Marked gene: MKKS as ready
Intellectual disability syndromic and non-syndromic v0.6412 MKKS Zornitza Stark Gene: mkks has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6412 MKKS Zornitza Stark Phenotypes for gene: MKKS were changed from to McKusick-Kaufman syndrome, MIM# 236700; Bardet-Biedl syndrome 6, MIM# 605231; Retinitis pigmentosa
Intellectual disability syndromic and non-syndromic v0.6411 MKKS Zornitza Stark Publications for gene: MKKS were set to
Intellectual disability syndromic and non-syndromic v0.6410 MKKS Zornitza Stark Mode of inheritance for gene: MKKS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6409 MKS1 Zornitza Stark Marked gene: MKS1 as ready
Intellectual disability syndromic and non-syndromic v0.6409 MKS1 Zornitza Stark Gene: mks1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6409 MKS1 Zornitza Stark Phenotypes for gene: MKS1 were changed from to Joubert syndrome 28, MIM# 617121; MONDO:0014928; Meckel syndrome 1, MIM# 249000; MONDO:0009571; Bardet-Biedl syndrome 13, MIM# 615990; MONDO:0014441
Intellectual disability syndromic and non-syndromic v0.6408 MKS1 Zornitza Stark Publications for gene: MKS1 were set to
Intellectual disability syndromic and non-syndromic v0.6407 MKS1 Zornitza Stark Mode of inheritance for gene: MKS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6406 MLC1 Zornitza Stark Marked gene: MLC1 as ready
Intellectual disability syndromic and non-syndromic v0.6406 MLC1 Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6406 MLC1 Zornitza Stark Phenotypes for gene: MLC1 were changed from to Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004)
Intellectual disability syndromic and non-syndromic v0.6405 MLC1 Zornitza Stark Publications for gene: MLC1 were set to
Intellectual disability syndromic and non-syndromic v0.6404 MLC1 Zornitza Stark Mode of inheritance for gene: MLC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6403 MMAA Zornitza Stark Marked gene: MMAA as ready
Intellectual disability syndromic and non-syndromic v0.6403 MMAA Zornitza Stark Gene: mmaa has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6403 MMAA Zornitza Stark Phenotypes for gene: MMAA were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100
Intellectual disability syndromic and non-syndromic v0.6402 MMAA Zornitza Stark Publications for gene: MMAA were set to
Intellectual disability syndromic and non-syndromic v0.6401 MMAA Zornitza Stark Mode of inheritance for gene: MMAA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6400 MMAB Zornitza Stark Marked gene: MMAB as ready
Intellectual disability syndromic and non-syndromic v0.6400 MMAB Zornitza Stark Gene: mmab has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6400 MMAB Zornitza Stark Phenotypes for gene: MMAB were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110
Intellectual disability syndromic and non-syndromic v0.6399 MMAB Zornitza Stark Publications for gene: MMAB were set to
Intellectual disability syndromic and non-syndromic v0.6398 MMAB Zornitza Stark Mode of inheritance for gene: MMAB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6397 MMADHC Zornitza Stark Marked gene: MMADHC as ready
Intellectual disability syndromic and non-syndromic v0.6397 MMADHC Zornitza Stark Gene: mmadhc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6397 MMADHC Zornitza Stark Phenotypes for gene: MMADHC were changed from to Homocystinuria, cblD type, variant 1 MIM#277410; Methylmalonic aciduria and homocystinuria, cblD type MIM#277410; Methylmalonic aciduria, cblD type, variant 2 MIM#277410; Disorders of cobalamin absorption, transport and metabolism
Intellectual disability syndromic and non-syndromic v0.6396 MMADHC Zornitza Stark Publications for gene: MMADHC were set to
Intellectual disability syndromic and non-syndromic v0.6395 MMADHC Zornitza Stark Mode of inheritance for gene: MMADHC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6394 MUT Zornitza Stark Marked gene: MUT as ready
Intellectual disability syndromic and non-syndromic v0.6394 MUT Zornitza Stark Gene: mut has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6394 MUT Zornitza Stark Phenotypes for gene: MUT were changed from to Methylmalonic aciduria, mut(0) type, MIM# 251000
Intellectual disability syndromic and non-syndromic v0.6393 MUT Zornitza Stark Publications for gene: MUT were set to
Intellectual disability syndromic and non-syndromic v0.6392 MUT Zornitza Stark Mode of inheritance for gene: MUT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6391 MOCS2 Zornitza Stark Marked gene: MOCS2 as ready
Intellectual disability syndromic and non-syndromic v0.6391 MOCS2 Zornitza Stark Gene: mocs2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6391 MOCS2 Zornitza Stark Phenotypes for gene: MOCS2 were changed from to Molybdenum cofactor deficiency B MIM#252160; Disorders of molybdenum cofactor metabolism
Intellectual disability syndromic and non-syndromic v0.6390 MOCS2 Zornitza Stark Publications for gene: MOCS2 were set to
Intellectual disability syndromic and non-syndromic v0.6389 MOCS2 Zornitza Stark Mode of inheritance for gene: MOCS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6388 ATAD2B Zornitza Stark Marked gene: ATAD2B as ready
Intellectual disability syndromic and non-syndromic v0.6388 ATAD2B Zornitza Stark Gene: atad2b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6388 ATAD2B Zornitza Stark Classified gene: ATAD2B as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6388 ATAD2B Zornitza Stark Gene: atad2b has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6387 POLR3K Bryony Thompson Classified gene: POLR3K as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6387 POLR3K Bryony Thompson Gene: polr3k has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6386 POLR3K Bryony Thompson gene: POLR3K was added
gene: POLR3K was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3K were set to https://doi.org/10.1155/2024/8807171; 30584594
Phenotypes for gene: POLR3K were set to POLR3-related leukodystrophy MONDO:0700282
Review for gene: POLR3K was set to GREEN
Added comment: 3 apparently unrelated cases (1 compound het & 2 homozygous for the same missense & supporting functional assays) with phenotypes consistent with POLR3-related leukodystrophy which includes ID and DD as part of the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6385 GFAP Bryony Thompson Marked gene: GFAP as ready
Intellectual disability syndromic and non-syndromic v0.6385 GFAP Bryony Thompson Gene: gfap has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6385 GFAP Bryony Thompson Phenotypes for gene: GFAP were changed from to Alexander disease MONDO:0008752
Intellectual disability syndromic and non-syndromic v0.6384 GFAP Bryony Thompson Publications for gene: GFAP were set to
Intellectual disability syndromic and non-syndromic v0.6383 GFAP Bryony Thompson Mode of inheritance for gene: GFAP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6382 GFAP Bryony Thompson reviewed gene: GFAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301351; Phenotypes: Alexander disease MONDO:0008752; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6382 ATAD2B Zornitza Stark gene: ATAD2B was added
gene: ATAD2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATAD2B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATAD2B were set to 39313616
Phenotypes for gene: ATAD2B were set to neurodevelopmental disorder MONDO:0700092, ATAD2B-related
Review for gene: ATAD2B was set to AMBER
Added comment: 3 families including 2 siblings
1 fam is hom for a highly conserved missense

Amber because of the lack of specific phenotypes:
Abnormality of the nervous system and Abnormality of the eye
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6381 MRPS22 Zornitza Stark Marked gene: MRPS22 as ready
Intellectual disability syndromic and non-syndromic v0.6381 MRPS22 Zornitza Stark Gene: mrps22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6381 MRPS22 Zornitza Stark Phenotypes for gene: MRPS22 were changed from to Combined oxidative phosphorylation deficiency 5 MIM#611719
Intellectual disability syndromic and non-syndromic v0.6380 MRPS22 Zornitza Stark Publications for gene: MRPS22 were set to
Intellectual disability syndromic and non-syndromic v0.6379 MRPS22 Zornitza Stark Mode of inheritance for gene: MRPS22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6378 MTFMT Zornitza Stark Marked gene: MTFMT as ready
Intellectual disability syndromic and non-syndromic v0.6378 MTFMT Zornitza Stark Gene: mtfmt has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6378 MTFMT Zornitza Stark Phenotypes for gene: MTFMT were changed from to Combined oxidative phosphorylation deficiency 15, MIM# 614947; Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248
Intellectual disability syndromic and non-syndromic v0.6377 MTFMT Zornitza Stark Publications for gene: MTFMT were set to 21907147; 23499752; 24461907; 22499348
Intellectual disability syndromic and non-syndromic v0.6376 MTFMT Zornitza Stark Publications for gene: MTFMT were set to
Intellectual disability syndromic and non-syndromic v0.6375 MTFMT Zornitza Stark Mode of inheritance for gene: MTFMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6374 MVK Zornitza Stark Marked gene: MVK as ready
Intellectual disability syndromic and non-syndromic v0.6374 MVK Zornitza Stark Gene: mvk has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6374 MVK Zornitza Stark Phenotypes for gene: MVK were changed from to Hyper-IgD syndrome (MIM#260920); Mevalonic aciduria (MIM#610377)
Intellectual disability syndromic and non-syndromic v0.6374 MVK Zornitza Stark Publications for gene: MVK were set to 29047407; 26409462
Intellectual disability syndromic and non-syndromic v0.6373 MVK Zornitza Stark Publications for gene: MVK were set to 29047407; 26409462
Intellectual disability syndromic and non-syndromic v0.6373 MVK Zornitza Stark Publications for gene: MVK were set to
Intellectual disability syndromic and non-syndromic v0.6373 MVK Zornitza Stark Mode of inheritance for gene: MVK was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6372 MVK Zornitza Stark Mode of inheritance for gene: MVK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6371 MYO5A Zornitza Stark Marked gene: MYO5A as ready
Intellectual disability syndromic and non-syndromic v0.6371 MYO5A Zornitza Stark Gene: myo5a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6371 MYO5A Zornitza Stark Phenotypes for gene: MYO5A were changed from to Griscelli syndrome, type 1 MIM#214450
Intellectual disability syndromic and non-syndromic v0.6370 MYO5A Zornitza Stark Publications for gene: MYO5A were set to
Intellectual disability syndromic and non-syndromic v0.6369 MYO5A Zornitza Stark Mode of inheritance for gene: MYO5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6368 MTHFR Zornitza Stark Marked gene: MTHFR as ready
Intellectual disability syndromic and non-syndromic v0.6368 MTHFR Zornitza Stark Gene: mthfr has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6368 MTHFR Zornitza Stark Phenotypes for gene: MTHFR were changed from to Homocystinuria due to MTHFR deficiency MIM#236250; Disorders of folate metabolism and transport
Intellectual disability syndromic and non-syndromic v0.6367 MTHFR Zornitza Stark Publications for gene: MTHFR were set to
Intellectual disability syndromic and non-syndromic v0.6366 MTHFR Zornitza Stark Mode of inheritance for gene: MTHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6365 NPC2 Zornitza Stark Marked gene: NPC2 as ready
Intellectual disability syndromic and non-syndromic v0.6365 NPC2 Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6365 NPC2 Zornitza Stark Phenotypes for gene: NPC2 were changed from to Niemann-pick disease, type C2, MIM# 607625; MONDO:0011873
Intellectual disability syndromic and non-syndromic v0.6364 NPC2 Zornitza Stark Publications for gene: NPC2 were set to 11125141; 17470133
Intellectual disability syndromic and non-syndromic v0.6363 NPC2 Zornitza Stark Publications for gene: NPC2 were set to
Intellectual disability syndromic and non-syndromic v0.6362 NPC2 Zornitza Stark Mode of inheritance for gene: NPC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6361 NPC1 Zornitza Stark Marked gene: NPC1 as ready
Intellectual disability syndromic and non-syndromic v0.6361 NPC1 Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6361 NPC1 Zornitza Stark Phenotypes for gene: NPC1 were changed from to Niemann-Pick disease, type C1 and type D, MIM# 257220; MONDO:0009757
Intellectual disability syndromic and non-syndromic v0.6360 NPC1 Zornitza Stark Publications for gene: NPC1 were set to
Intellectual disability syndromic and non-syndromic v0.6359 NPC1 Zornitza Stark Mode of inheritance for gene: NPC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6358 NKX2-1 Zornitza Stark Marked gene: NKX2-1 as ready
Intellectual disability syndromic and non-syndromic v0.6358 NKX2-1 Zornitza Stark Gene: nkx2-1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6358 NKX2-1 Zornitza Stark Phenotypes for gene: NKX2-1 were changed from Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 to Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978
Intellectual disability syndromic and non-syndromic v0.6357 NKX2-1 Zornitza Stark Phenotypes for gene: NKX2-1 were changed from to Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978
Intellectual disability syndromic and non-syndromic v0.6356 NKX2-1 Zornitza Stark Publications for gene: NKX2-1 were set to 10931427; 27066577; 26839702; 26103969; 23911641; 11854319; 24714694
Intellectual disability syndromic and non-syndromic v0.6355 NKX2-1 Zornitza Stark Publications for gene: NKX2-1 were set to
Intellectual disability syndromic and non-syndromic v0.6354 NKX2-1 Zornitza Stark Mode of inheritance for gene: NKX2-1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6353 NGLY1 Zornitza Stark Marked gene: NGLY1 as ready
Intellectual disability syndromic and non-syndromic v0.6353 NGLY1 Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6353 NGLY1 Zornitza Stark Phenotypes for gene: NGLY1 were changed from to Congenital disorder of deglycosylation (OMIM 615273)
Intellectual disability syndromic and non-syndromic v0.6352 NGLY1 Zornitza Stark reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24651605, 27388694, 32259258; Phenotypes: Congenital disorder of deglycosylation (OMIM 615273); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6352 NGLY1 Zornitza Stark Publications for gene: NGLY1 were set to
Intellectual disability syndromic and non-syndromic v0.6351 NGLY1 Zornitza Stark Mode of inheritance for gene: NGLY1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6350 NFIX Zornitza Stark Marked gene: NFIX as ready
Intellectual disability syndromic and non-syndromic v0.6350 NFIX Zornitza Stark Gene: nfix has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6350 NFIX Zornitza Stark Phenotypes for gene: NFIX were changed from to Sotos syndrome 2 (MIM#614753); Marshall-Smith syndrome, MIM# 602535
Intellectual disability syndromic and non-syndromic v0.6349 NFIX Zornitza Stark Publications for gene: NFIX were set to 33034087; 29897170; 30548146; 25118028
Intellectual disability syndromic and non-syndromic v0.6348 NFIX Zornitza Stark Publications for gene: NFIX were set to
Intellectual disability syndromic and non-syndromic v0.6347 NFIX Zornitza Stark Mode of inheritance for gene: NFIX was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6346 NEU1 Zornitza Stark Marked gene: NEU1 as ready
Intellectual disability syndromic and non-syndromic v0.6346 NEU1 Zornitza Stark Gene: neu1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6346 NEU1 Zornitza Stark Phenotypes for gene: NEU1 were changed from to Sialidosis, type I and type II, MIM# 256550; MONDO:0009738
Intellectual disability syndromic and non-syndromic v0.6345 NEU1 Zornitza Stark Publications for gene: NEU1 were set to
Intellectual disability syndromic and non-syndromic v0.6344 NEU1 Zornitza Stark Mode of inheritance for gene: NEU1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6343 NDUFV1 Zornitza Stark Marked gene: NDUFV1 as ready
Intellectual disability syndromic and non-syndromic v0.6343 NDUFV1 Zornitza Stark Gene: ndufv1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6343 NDUFV1 Zornitza Stark Phenotypes for gene: NDUFV1 were changed from to Mitochondrial complex I deficiency, nuclear type 4 MIM#618225
Intellectual disability syndromic and non-syndromic v0.6342 NDUFV1 Zornitza Stark Publications for gene: NDUFV1 were set to
Intellectual disability syndromic and non-syndromic v0.6341 NDUFV1 Zornitza Stark Mode of inheritance for gene: NDUFV1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6340 NDUFS7 Zornitza Stark Marked gene: NDUFS7 as ready
Intellectual disability syndromic and non-syndromic v0.6340 NDUFS7 Zornitza Stark Gene: ndufs7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6340 NDUFS7 Zornitza Stark Phenotypes for gene: NDUFS7 were changed from to Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224)
Intellectual disability syndromic and non-syndromic v0.6339 NDUFS7 Zornitza Stark Publications for gene: NDUFS7 were set to
Intellectual disability syndromic and non-syndromic v0.6338 NDUFS7 Zornitza Stark Mode of inheritance for gene: NDUFS7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6337 NDUFA1 Zornitza Stark Marked gene: NDUFA1 as ready
Intellectual disability syndromic and non-syndromic v0.6337 NDUFA1 Zornitza Stark Gene: ndufa1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6337 NDUFA1 Zornitza Stark Phenotypes for gene: NDUFA1 were changed from Mitochondrial complex I deficiency, nuclear type 12 MIM#301020 to Mitochondrial complex I deficiency, nuclear type 12 MIM#301020
Intellectual disability syndromic and non-syndromic v0.6336 NDUFA1 Zornitza Stark Phenotypes for gene: NDUFA1 were changed from to Mitochondrial complex I deficiency, nuclear type 12 MIM#301020
Intellectual disability syndromic and non-syndromic v0.6335 NDUFA1 Zornitza Stark Publications for gene: NDUFA1 were set to
Intellectual disability syndromic and non-syndromic v0.6334 NDUFA1 Zornitza Stark Mode of inheritance for gene: NDUFA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6333 NALCN Zornitza Stark Marked gene: NALCN as ready
Intellectual disability syndromic and non-syndromic v0.6333 NALCN Zornitza Stark Gene: nalcn has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6333 NALCN Zornitza Stark Phenotypes for gene: NALCN were changed from to Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266; Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419
Intellectual disability syndromic and non-syndromic v0.6332 NALCN Zornitza Stark Publications for gene: NALCN were set to
Intellectual disability syndromic and non-syndromic v0.6331 NALCN Zornitza Stark Mode of inheritance for gene: NALCN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6330 NAGLU Zornitza Stark Marked gene: NAGLU as ready
Intellectual disability syndromic and non-syndromic v0.6330 NAGLU Zornitza Stark Gene: naglu has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6330 NAGLU Zornitza Stark Phenotypes for gene: NAGLU were changed from to Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920
Intellectual disability syndromic and non-syndromic v0.6329 NAGLU Zornitza Stark Publications for gene: NAGLU were set to
Intellectual disability syndromic and non-syndromic v0.6328 NAGLU Zornitza Stark Mode of inheritance for gene: NAGLU was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6327 NAGA Zornitza Stark Marked gene: NAGA as ready
Intellectual disability syndromic and non-syndromic v0.6327 NAGA Zornitza Stark Gene: naga has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6327 NAGA Zornitza Stark Phenotypes for gene: NAGA were changed from Kanzaki disease, MIM# 609242; Schindler disease, type I and type II 609241; alpha-N-acetylgalactosaminidase deficiency MONDO:0017779 to Kanzaki disease, MIM# 609242; Schindler disease, type I and type II 609241; alpha-N-acetylgalactosaminidase deficiency MONDO:0017779
Intellectual disability syndromic and non-syndromic v0.6327 NAGA Zornitza Stark Phenotypes for gene: NAGA were changed from to Kanzaki disease, MIM# 609242; Schindler disease, type I and type II 609241; alpha-N-acetylgalactosaminidase deficiency MONDO:0017779
Intellectual disability syndromic and non-syndromic v0.6326 NAGA Zornitza Stark Publications for gene: NAGA were set to
Intellectual disability syndromic and non-syndromic v0.6325 NAGA Zornitza Stark Mode of inheritance for gene: NAGA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6324 SCO2 Zornitza Stark Marked gene: SCO2 as ready
Intellectual disability syndromic and non-syndromic v0.6324 SCO2 Zornitza Stark Gene: sco2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6324 SCO2 Zornitza Stark Phenotypes for gene: SCO2 were changed from to Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377
Intellectual disability syndromic and non-syndromic v0.6323 SCO2 Zornitza Stark Publications for gene: SCO2 were set to
Intellectual disability syndromic and non-syndromic v0.6322 SCO2 Zornitza Stark Mode of inheritance for gene: SCO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6321 SKI Zornitza Stark Marked gene: SKI as ready
Intellectual disability syndromic and non-syndromic v0.6321 SKI Zornitza Stark Gene: ski has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6321 SKI Zornitza Stark Phenotypes for gene: SKI were changed from to Shprintzen-Goldberg syndrome, MIM# 182212; Neurodevelopmental disorder, MONDO:0700092, SKI-related
Intellectual disability syndromic and non-syndromic v0.6320 SKI Zornitza Stark Publications for gene: SKI were set to
Intellectual disability syndromic and non-syndromic v0.6319 SKI Zornitza Stark Mode of inheritance for gene: SKI was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6318 SKI Zornitza Stark reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SKI-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6318 SHH Zornitza Stark Marked gene: SHH as ready
Intellectual disability syndromic and non-syndromic v0.6318 SHH Zornitza Stark Gene: shh has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6318 SHH Zornitza Stark Phenotypes for gene: SHH were changed from to Holoprosencephaly 3 (MIM#142945)
Intellectual disability syndromic and non-syndromic v0.6317 SHH Zornitza Stark Publications for gene: SHH were set to
Intellectual disability syndromic and non-syndromic v0.6316 SHH Zornitza Stark Mode of inheritance for gene: SHH was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6315 LRRC7 Zornitza Stark Marked gene: LRRC7 as ready
Intellectual disability syndromic and non-syndromic v0.6315 LRRC7 Zornitza Stark Gene: lrrc7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6315 LRRC7 Zornitza Stark Phenotypes for gene: LRRC7 were changed from neurodevelopmental disorder (MONDO:0700092) to neurodevelopmental disorder (MONDO:0700092), LRRC7-related
Intellectual disability syndromic and non-syndromic v0.6314 LRRC7 Zornitza Stark reviewed gene: LRRC7: Rating: GREEN; Mode of pathogenicity: None; Publications: 39256359; Phenotypes: neurodevelopmental disorder (MONDO:0700092), LRRC7-related; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6314 LRRC7 Zornitza Stark Classified gene: LRRC7 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6314 LRRC7 Zornitza Stark Gene: lrrc7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6313 SECISBP2 Zornitza Stark Phenotypes for gene: SECISBP2 were changed from #609698 THYROID HORMONE METABOLISM, ABNORMAL to Thyroid hormone metabolism, abnormal, 1, MIM# 609698
Intellectual disability syndromic and non-syndromic v0.6312 SECISBP2 Zornitza Stark Publications for gene: SECISBP2 were set to 16228000; 19602558; 21084748; 22247018
Intellectual disability syndromic and non-syndromic v0.6311 SECISBP2 Zornitza Stark Classified gene: SECISBP2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6311 SECISBP2 Zornitza Stark Gene: secisbp2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6310 SECISBP2 Zornitza Stark reviewed gene: SECISBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 39315526; Phenotypes: Thyroid hormone metabolism, abnormal, 1, MIM# 609698; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6310 FLVCR1 Bryony Thompson Phenotypes for gene: FLVCR1 were changed from Ataxia, posterior column, with retinitis pigmentosa, MIM#609033 to neurodevelopmental disorder MONDO:0700092, FLVCR1-related
Intellectual disability syndromic and non-syndromic v0.6309 FLVCR1 Bryony Thompson Publications for gene: FLVCR1 were set to
Intellectual disability syndromic and non-syndromic v0.6308 FLVCR1 Bryony Thompson Classified gene: FLVCR1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6308 FLVCR1 Bryony Thompson Gene: flvcr1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6307 FLVCR1 Bryony Thompson reviewed gene: FLVCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39306721; Phenotypes: neurodevelopmental disorder MONDO:0700092, FLVCR1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6307 LRRC7 Sangavi Sivagnanasundram gene: LRRC7 was added
gene: LRRC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LRRC7 were set to 39256359
Phenotypes for gene: LRRC7 were set to neurodevelopmental disorder (MONDO:0700092)
Review for gene: LRRC7 was set to GREEN
Added comment: Well established gene-disease association.
Neurodevelopmental disorder with a clinical spectrum - symptoms include ID, ADHD, aggression and in many cases, hyperphagia associate obesity.
Heterozygous missense and LoF variants have been reported and functional assays were conducted on missense and truncating variants that support LoF mechanism of disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6307 SHH Chirag Patel reviewed gene: SHH: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22791840, 19057928; Phenotypes: Holoprosencephaly 3 (MIM#142945); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6307 SKI Chirag Patel reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23023332, 23103230, 24736733, 30071989; Phenotypes: Shprintzen-Goldberg syndrome, MIM# 182212; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6307 SCO2 Chirag Patel reviewed gene: SCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10545952, 10749987, 18924171; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6307 NAGA Chirag Patel reviewed gene: NAGA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11313741, 31468281, 15619430, 8782044; Phenotypes: Kanzaki disease, MIM# 609242, Schindler disease, type I and type II 609241, alpha-N-acetylgalactosaminidase deficiency MONDO:0017779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6307 NAGLU Chirag Patel reviewed gene: NAGLU: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8650226; Phenotypes: Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6307 NALCN Chirag Patel reviewed gene: NALCN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25683120, 30167850, 23749988, 24075186; Phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266, Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6307 USP9X Ain Roesley Phenotypes for gene: USP9X were changed from Mental retardation, X-linked 99, XLR (MIM#300919) and XLD (MIM#300968) to Intellectual developmental disorder 99 MIM#300919; syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968
Intellectual disability syndromic and non-syndromic v0.6306 SGPL1 Ain Roesley Phenotypes for gene: SGPL1 were changed from Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575) to Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575)
Intellectual disability syndromic and non-syndromic v0.6305 SGPL1 Ain Roesley Phenotypes for gene: SGPL1 were changed from Sphingosine Phosphate Lyase Insufficiency Syndrome; Nephrotic syndrome, type 14, MIM#617575 to Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575)
Intellectual disability syndromic and non-syndromic v0.6304 NDUFA1 Chirag Patel reviewed gene: NDUFA1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29506883, 19185523, 17262856, 21596602; Phenotypes: Mitochondrial complex I deficiency, nuclear type 12 MIM#301020; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6304 NDUFS7 Chirag Patel reviewed gene: NDUFS7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22644603; Phenotypes: Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NDUFS8 Chirag Patel reviewed gene: NDUFS8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23430795, 9837812, 15159508, 22499348, 20818383, 20819849; Phenotypes: Mitochondrial complex I deficiency, nuclear type 2 MIM#618222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NDUFV1 Chirag Patel reviewed gene: NDUFV1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34807224; Phenotypes: Mitochondrial complex I deficiency, nuclear type 4 MIM#618225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NEU1 Chirag Patel reviewed gene: NEU1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8985184, 9054950, 11063730; Phenotypes: Sialidosis, type I and type II, MIM# 256550, MONDO:0009738; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NFIX Chirag Patel reviewed gene: NFIX: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33034087, 29897170, 30548146, 25118028; Phenotypes: Sotos syndrome 2 (MIM#614753), Marshall-Smith syndrome, MIM# 602535; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6304 NGLY1 Chirag Patel reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: Congenital disorder of deglycosylation (OMIM 615273); Phenotypes: PMID: 24651605, 27388694, 32259258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6304 NKX2-1 Chirag Patel reviewed gene: NKX2-1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10931427, 27066577, 26839702, 26103969, 23911641, 11854319, 24714694; Phenotypes: Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978, Chorea, hereditary benign MIM#118700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6304 PPP2R5D Ain Roesley Phenotypes for gene: PPP2R5D were changed from Mental retardation, autosomal dominant 35, MIM#616355 to Houge-Janssens syndrome 1, MIM#616355
Intellectual disability syndromic and non-syndromic v0.6303 NPC1 Chirag Patel reviewed gene: NPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9211849, 11333381; Phenotypes: Niemann-Pick disease, type C1 and type D, MIM# 257220, MONDO:0009757; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 NPC2 Chirag Patel reviewed gene: NPC2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11125141, 17470133; Phenotypes: Niemann-pick disease, type C2, MIM# 607625, MONDO:0011873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MTHFR Chirag Patel commented on gene: MTHFR: Well-established gene-disease association (see OMIM entry). Homocystinuria due to MTHFR deficiency is classified as a metabolic disorder by NIH GARD (https://rarediseases.info.nih.gov/diseases/diseases-by-category/14/metabolic-disorders) and is an inborn error of folate metabolism. DD/ID can be seen in condition.
Intellectual disability syndromic and non-syndromic v0.6303 MTHFR Chirag Patel reviewed gene: MTHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7920641; Phenotypes: Homocystinuria due to MTHFR deficiency MIM#236250, Disorders of folate metabolism and transport; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MYO5A Chirag Patel reviewed gene: MYO5A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 32275080, 22711375, 25283056; Phenotypes: Griscelli syndrome, type 1 MIM#214450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 RAB27A Chirag Patel reviewed gene: RAB27A: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6303 MVK Chirag Patel reviewed gene: MVK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29047407, 26409462; Phenotypes: Hyper-IgD syndrome (MIM#260920), Mevalonic aciduria (MIM#610377); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MTFMT Chirag Patel reviewed gene: MTFMT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21907147, 23499752, 24461907, 22499348; Phenotypes: Combined oxidative phosphorylation deficiency 15, MIM# 614947, Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MRPS22 Chirag Patel reviewed gene: MRPS22: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29566152,17873122, 25663021, 28752220; Phenotypes: Combined oxidative phosphorylation deficiency 5 MIM#611719, Ovarian dysgenesis 7 MIM#618117; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MOCS2 Chirag Patel reviewed gene: MOCS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 10053004; Phenotypes: Molybdenum cofactor deficiency B MIM#252160, Disorders of molybdenum cofactor metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MUT Chirag Patel reviewed gene: MUT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116, 1977311, 11528502, 12948746; Phenotypes: Methylmalonic aciduria, mut(0) type, MIM# 251000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MMADHC Chirag Patel reviewed gene: MMADHC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116,27604308, 18385497; Phenotypes: Homocystinuria, cblD type, variant 1 MIM#277410, Methylmalonic aciduria and homocystinuria, cblD type MIM#277410, Methylmalonic aciduria, cblD type, variant 2 MIM#277410, Disorders of cobalamin absorption, transport and metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MMAB Chirag Patel reviewed gene: MMAB: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MMAA Chirag Patel reviewed gene: MMAA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MLC1 Chirag Patel reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11254442, 18757878, 16652334; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MKS1 Chirag Patel reviewed gene: MKS1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 17377820, 24886560, 19776033, 33193692, 27570071, 27377014, 18327255, 24608809; Phenotypes: Joubert syndrome 28, MIM# 617121, MONDO:0014928, Meckel syndrome 1, MIM# 249000, MONDO:0009571, Bardet-Biedl syndrome 13, MIM# 615990, MONDO:0014441; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MKKS Chirag Patel reviewed gene: MKKS: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10973251, 10802661, 26900326; Phenotypes: McKusick-Kaufman syndrome, MIM# 236700, Bardet-Biedl syndrome 6, MIM# 605231, Retinitis pigmentosa; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MBOAT7 Chirag Patel reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33335874, 32645526, 32744787, 31852446, 31282596, 30701556; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MAT1A Chirag Patel reviewed gene: MAT1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7560086; Phenotypes: Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850, Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850, Disorders of the metabolism of sulphur amino acids; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6303 MAP2K2 Chirag Patel reviewed gene: MAP2K2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20358587, 16439621, 18042262; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6303 MAP2K1 Chirag Patel reviewed gene: MAP2K1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 16439621, 17551924, 18042262, 20301365; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6303 ZDHHC16 Ain Roesley Classified gene: ZDHHC16 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6303 ZDHHC16 Ain Roesley Gene: zdhhc16 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6303 ZDHHC16 Ain Roesley Marked gene: ZDHHC16 as ready
Intellectual disability syndromic and non-syndromic v0.6303 ZDHHC16 Ain Roesley Gene: zdhhc16 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6303 ZDHHC16 Ain Roesley Classified gene: ZDHHC16 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6303 ZDHHC16 Ain Roesley Gene: zdhhc16 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6302 ZDHHC16 Ain Roesley gene: ZDHHC16 was added
gene: ZDHHC16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZDHHC16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZDHHC16 were set to 39313616
Phenotypes for gene: ZDHHC16 were set to neurodevelopmental disorder MONDO:0700092, ZDHHC16-related
Review for gene: ZDHHC16 was set to AMBER
gene: ZDHHC16 was marked as current diagnostic
Added comment: 6 families including a pair of siblings

Amber because 5 of the families had non specific phenotypes listed
Abnormality of:
the nervous system, metabolism/homeostasis, head/neck, immune system, the integument, the digestive system, the respiratory system, the endocrine system, Growth abnormality the skeletal system, the musculature, the eye

Specific HPOs were provided for one individual (homoyzygous for a canonical splice)

Abnormality of the face; Cerebellar hypoplasia; Developmental regression; Encephalopathy; Hyperreflexia; Hypertonia; Hypotonia; Inguinal hernia; Laryngomalacia; Microcephaly; Motor delay; Optic atrophy; Seizure; Spastic paraparesis; Spasticity; Talipes equinovarus; Umbilical hernia
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6301 EPB41L3 Bryony Thompson Marked gene: EPB41L3 as ready
Intellectual disability syndromic and non-syndromic v0.6301 EPB41L3 Bryony Thompson Gene: epb41l3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6301 EPB41L3 Bryony Thompson Classified gene: EPB41L3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6301 EPB41L3 Bryony Thompson Gene: epb41l3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6300 EPB41L3 Bryony Thompson gene: EPB41L3 was added
gene: EPB41L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EPB41L3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EPB41L3 were set to 39292993
Phenotypes for gene: EPB41L3 were set to neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063
Review for gene: EPB41L3 was set to GREEN
Added comment: 6 cases from 5 unrelated consanguineous families (2nd & 3rd degree) with homozygous LoF variants and a neurodevelopmental condition, including ID and seizures. Epb41l3 shRNA-mediated downregulation in mouse oligodendroglia demonstrated impaired oligodendrocyte function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6299 GCH1 Bryony Thompson Marked gene: GCH1 as ready
Intellectual disability syndromic and non-syndromic v0.6299 GCH1 Bryony Thompson Gene: gch1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6299 GCH1 Bryony Thompson Phenotypes for gene: GCH1 were changed from to GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186
Intellectual disability syndromic and non-syndromic v0.6298 GCH1 Bryony Thompson Publications for gene: GCH1 were set to 22473768; 7869202
Intellectual disability syndromic and non-syndromic v0.6297 GCH1 Bryony Thompson Publications for gene: GCH1 were set to
Intellectual disability syndromic and non-syndromic v0.6296 GCH1 Bryony Thompson Mode of inheritance for gene: GCH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6295 GCH1 Bryony Thompson reviewed gene: GCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22473768, 7869202; Phenotypes: GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6295 GAMT Bryony Thompson Marked gene: GAMT as ready
Intellectual disability syndromic and non-syndromic v0.6295 GAMT Bryony Thompson Gene: gamt has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6295 GAMT Bryony Thompson Phenotypes for gene: GAMT were changed from to guanidinoacetate methyltransferase deficiency MONDO:0012999
Intellectual disability syndromic and non-syndromic v0.6294 GAMT Bryony Thompson Publications for gene: GAMT were set to
Intellectual disability syndromic and non-syndromic v0.6293 GAMT Bryony Thompson Mode of inheritance for gene: GAMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6292 GAMT Bryony Thompson reviewed gene: GAMT: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301745; Phenotypes: guanidinoacetate methyltransferase deficiency MONDO:0012999; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6292 GALE Bryony Thompson Marked gene: GALE as ready
Intellectual disability syndromic and non-syndromic v0.6292 GALE Bryony Thompson Gene: gale has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6292 GALE Bryony Thompson Phenotypes for gene: GALE were changed from to galactose epimerase deficiency MONDO:0009257
Intellectual disability syndromic and non-syndromic v0.6291 GALE Bryony Thompson Publications for gene: GALE were set to
Intellectual disability syndromic and non-syndromic v0.6290 GALE Bryony Thompson Mode of inheritance for gene: GALE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6289 GALE Bryony Thompson reviewed gene: GALE: Rating: GREEN; Mode of pathogenicity: None; Publications: 21290786; Phenotypes: galactose epimerase deficiency MONDO:0009257; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6289 GALC Bryony Thompson Marked gene: GALC as ready
Intellectual disability syndromic and non-syndromic v0.6289 GALC Bryony Thompson Gene: galc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6289 GALC Bryony Thompson Phenotypes for gene: GALC were changed from to Krabbe disease MONDO:000949
Intellectual disability syndromic and non-syndromic v0.6288 GALC Bryony Thompson Publications for gene: GALC were set to
Intellectual disability syndromic and non-syndromic v0.6287 GALC Bryony Thompson Mode of inheritance for gene: GALC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6286 GALC Bryony Thompson reviewed gene: GALC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301416; Phenotypes: Krabbe disease MONDO:000949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6286 GABRB2 Bryony Thompson Marked gene: GABRB2 as ready
Intellectual disability syndromic and non-syndromic v0.6286 GABRB2 Bryony Thompson Gene: gabrb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6286 GABRB2 Bryony Thompson Phenotypes for gene: GABRB2 were changed from to epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631
Intellectual disability syndromic and non-syndromic v0.6285 GABRB2 Bryony Thompson Publications for gene: GABRB2 were set to
Intellectual disability syndromic and non-syndromic v0.6284 GABRB2 Bryony Thompson Mode of inheritance for gene: GABRB2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6283 GABRB2 Bryony Thompson reviewed gene: GABRB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 38996765; Phenotypes: epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6283 FUCA1 Bryony Thompson Marked gene: FUCA1 as ready
Intellectual disability syndromic and non-syndromic v0.6283 FUCA1 Bryony Thompson Gene: fuca1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6283 FUCA1 Bryony Thompson Phenotypes for gene: FUCA1 were changed from to Fucosidosis MONDO:0009254
Intellectual disability syndromic and non-syndromic v0.6282 FUCA1 Bryony Thompson Publications for gene: FUCA1 were set to
Intellectual disability syndromic and non-syndromic v0.6281 FUCA1 Bryony Thompson Mode of inheritance for gene: FUCA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6280 FUCA1 Bryony Thompson reviewed gene: FUCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33266441; Phenotypes: Fucosidosis MONDO:0009254; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6280 FOXRED1 Bryony Thompson Marked gene: FOXRED1 as ready
Intellectual disability syndromic and non-syndromic v0.6280 FOXRED1 Bryony Thompson Gene: foxred1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6280 FOXRED1 Bryony Thompson Phenotypes for gene: FOXRED1 were changed from to Mitochondrial disease MONDO:0044970
Intellectual disability syndromic and non-syndromic v0.6279 FOXRED1 Bryony Thompson Publications for gene: FOXRED1 were set to
Intellectual disability syndromic and non-syndromic v0.6278 FOXRED1 Bryony Thompson Mode of inheritance for gene: FOXRED1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6277 FOXRED1 Bryony Thompson reviewed gene: FOXRED1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31434271, 20818383, 20858599; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6277 FOXG1 Bryony Thompson Marked gene: FOXG1 as ready
Intellectual disability syndromic and non-syndromic v0.6277 FOXG1 Bryony Thompson Gene: foxg1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6277 FOXG1 Bryony Thompson Phenotypes for gene: FOXG1 were changed from to FOXG1 disorder MONDO:0100040
Intellectual disability syndromic and non-syndromic v0.6276 FOXG1 Bryony Thompson Publications for gene: FOXG1 were set to
Intellectual disability syndromic and non-syndromic v0.6275 FOXG1 Bryony Thompson Mode of inheritance for gene: FOXG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6274 FOXG1 Bryony Thompson reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571142, 19578037, 19564653, 28661489; Phenotypes: FOXG1 disorder MONDO:0100040; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6274 FKTN Bryony Thompson Marked gene: FKTN as ready
Intellectual disability syndromic and non-syndromic v0.6274 FKTN Bryony Thompson Gene: fktn has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6274 FKTN Bryony Thompson Phenotypes for gene: FKTN were changed from to Myopathy caused by variation in FKTN MONDO:0700067
Intellectual disability syndromic and non-syndromic v0.6273 FKTN Bryony Thompson Publications for gene: FKTN were set to
Intellectual disability syndromic and non-syndromic v0.6272 FKTN Bryony Thompson Mode of inheritance for gene: FKTN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6271 FKTN Bryony Thompson reviewed gene: FKTN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301385; Phenotypes: Myopathy caused by variation in FKTN MONDO:0700067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6271 FKRP Bryony Thompson Marked gene: FKRP as ready
Intellectual disability syndromic and non-syndromic v0.6271 FKRP Bryony Thompson Gene: fkrp has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6271 FKRP Bryony Thompson Phenotypes for gene: FKRP were changed from myopathy caused by variation in FKRP MONDO:0700066 to myopathy caused by variation in FKRP MONDO:0700066
Intellectual disability syndromic and non-syndromic v0.6270 FKRP Bryony Thompson Phenotypes for gene: FKRP were changed from to myopathy caused by variation in FKRP MONDO:0700066
Intellectual disability syndromic and non-syndromic v0.6269 FKRP Bryony Thompson Publications for gene: FKRP were set to
Intellectual disability syndromic and non-syndromic v0.6268 FKRP Bryony Thompson Mode of inheritance for gene: FKRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6267 FKRP Bryony Thompson reviewed gene: FKRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 33200426, 11053680, 12654965, 14652796, 15121789; Phenotypes: myopathy caused by variation in FKRP MONDO:0700066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6267 FIG4 Bryony Thompson Marked gene: FIG4 as ready
Intellectual disability syndromic and non-syndromic v0.6267 FIG4 Bryony Thompson Gene: fig4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6267 FIG4 Bryony Thompson Phenotypes for gene: FIG4 were changed from to Charcot-Marie-Tooth disease MONDO:0015626
Intellectual disability syndromic and non-syndromic v0.6266 FIG4 Bryony Thompson Publications for gene: FIG4 were set to
Intellectual disability syndromic and non-syndromic v0.6265 FIG4 Bryony Thompson Mode of inheritance for gene: FIG4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6264 FIG4 Bryony Thompson reviewed gene: FIG4: Rating: GREEN; Mode of pathogenicity: None; Publications: 32385905, 34122524, 36529678; Phenotypes: Charcot-Marie-Tooth disease MONDO:0015626; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6264 FBXL4 Bryony Thompson Marked gene: FBXL4 as ready
Intellectual disability syndromic and non-syndromic v0.6264 FBXL4 Bryony Thompson Gene: fbxl4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6264 FBXL4 Bryony Thompson Phenotypes for gene: FBXL4 were changed from to Leigh syndrome MONDO:0009723
Intellectual disability syndromic and non-syndromic v0.6263 FBXL4 Bryony Thompson Publications for gene: FBXL4 were set to
Intellectual disability syndromic and non-syndromic v0.6262 FBXL4 Bryony Thompson reviewed gene: FBXL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 28383868; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6262 FBXL4 Bryony Thompson Mode of inheritance for gene: FBXL4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6261 FAT4 Bryony Thompson Marked gene: FAT4 as ready
Intellectual disability syndromic and non-syndromic v0.6261 FAT4 Bryony Thompson Gene: fat4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6261 FAT4 Bryony Thompson Phenotypes for gene: FAT4 were changed from to Hennekam syndrome MONDO:0016256; van Maldergem syndrome MONDO:0017813
Intellectual disability syndromic and non-syndromic v0.6260 FAT4 Bryony Thompson Publications for gene: FAT4 were set to
Intellectual disability syndromic and non-syndromic v0.6259 FAT4 Bryony Thompson Mode of inheritance for gene: FAT4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6258 FAT4 Bryony Thompson reviewed gene: FAT4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681106; Phenotypes: Hennekam syndrome MONDO:0016256, van Maldergem syndrome MONDO:0017813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6258 FAM20C Bryony Thompson Marked gene: FAM20C as ready
Intellectual disability syndromic and non-syndromic v0.6258 FAM20C Bryony Thompson Gene: fam20c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6258 FAM20C Bryony Thompson Phenotypes for gene: FAM20C were changed from to lethal osteosclerotic bone dysplasia MONDO:0009821
Intellectual disability syndromic and non-syndromic v0.6257 FAM20C Bryony Thompson Publications for gene: FAM20C were set to
Intellectual disability syndromic and non-syndromic v0.6256 FAM20C Bryony Thompson Mode of inheritance for gene: FAM20C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6255 FAM20C Bryony Thompson reviewed gene: FAM20C: Rating: GREEN; Mode of pathogenicity: None; Publications: 34360805; Phenotypes: lethal osteosclerotic bone dysplasia MONDO:0009821; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6255 FAM126A Bryony Thompson Marked gene: FAM126A as ready
Intellectual disability syndromic and non-syndromic v0.6255 FAM126A Bryony Thompson Gene: fam126a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6255 FAM126A Bryony Thompson Phenotypes for gene: FAM126A were changed from to hypomyelinating leukodystrophy 5 MONDO:0012514
Intellectual disability syndromic and non-syndromic v0.6254 FAM126A Bryony Thompson Publications for gene: FAM126A were set to
Intellectual disability syndromic and non-syndromic v0.6253 FAM126A Bryony Thompson Mode of inheritance for gene: FAM126A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6252 FAM126A Bryony Thompson reviewed gene: FAM126A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301737; Phenotypes: hypomyelinating leukodystrophy 5 MONDO:0012514; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6252 ESCO2 Bryony Thompson Marked gene: ESCO2 as ready
Intellectual disability syndromic and non-syndromic v0.6252 ESCO2 Bryony Thompson Gene: esco2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6252 ESCO2 Bryony Thompson Phenotypes for gene: ESCO2 were changed from to Roberts-SC phocomelia syndrome MONDO:0100253
Intellectual disability syndromic and non-syndromic v0.6251 ESCO2 Bryony Thompson Publications for gene: ESCO2 were set to
Intellectual disability syndromic and non-syndromic v0.6250 ESCO2 Bryony Thompson Mode of inheritance for gene: ESCO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6249 ESCO2 Bryony Thompson reviewed gene: ESCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301332; Phenotypes: Roberts-SC phocomelia syndrome MONDO:0100253; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6249 INPP5K Sangavi Sivagnanasundram reviewed gene: INPP5K: Rating: GREEN; Mode of pathogenicity: None; Publications: 28190456, 28190459; Phenotypes: congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6249 IKBKG Sangavi Sivagnanasundram reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301645; Phenotypes: Incontinentia pigmenti MONDO:0010631; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6249 RAF1 Chirag Patel reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 17603483, 17603482, 31145547, 31030682, 29271604; Phenotypes: Noonan syndrome 5, MIM# 611553; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6249 RIT1 Chirag Patel reviewed gene: RIT1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 23791108, 25124994, 24939608, 27101134; Phenotypes: Noonan syndrome 8, MIM# 615355; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6249 RRAS2 Chirag Patel Classified gene: RRAS2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6249 RRAS2 Chirag Patel Gene: rras2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6248 RRAS2 Chirag Patel reviewed gene: RRAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.6248 PTPN11 Chirag Patel reviewed gene: PTPN11: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 11992261,21533187, 24935154; Phenotypes: LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines), Metachondromatosis, 156250 AD, Noonan syndrome 1, 163950 AD, Leukemia, juvenile myelomonocytic, somatic, 607785; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 KRAS Chirag Patel reviewed gene: KRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 21797849, 16474404, 16474405, 16773572, 17056636; Phenotypes: Noonan syndrome 3, MIM# 609942, Cardiofaciocutaneous syndrome 2, MIM# 615278; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 NRAS Chirag Patel reviewed gene: NRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 19966803, 26467218, 28594414; Phenotypes: Noonan syndrome 6, MIM# 613224; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 NPHP1 Chirag Patel reviewed gene: NPHP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15138899, 32139166, 28347285, 8852662, 9856524; Phenotypes: Joubert syndrome 4, MIM# 609583, Nephronophthisis 1, juvenile, MIM# 256100, Senior-Loken syndrome-1, MIM# 266900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.6248 OTX2 Chirag Patel reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24167467, 25589041, 31969185,; Phenotypes: Microphthalmia, syndromic 5, MIM# 610125, Pituitary hormone deficiency, combined, 6, MIM# 613986, Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125, Otocephaly-dysgnathia complex; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6248 OPA3 Chirag Patel reviewed gene: OPA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25159689, 31119193, 31928268; Phenotypes: 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR, Optic atrophy 3 with cataract (MIM#165300), AD; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6248 OCLN Chirag Patel reviewed gene: OCLN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20727516, 32240828, 29192239, 28386946; Phenotypes: Pseudo-TORCH syndrome 1, MIM#251290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6248 ERCC8 Bryony Thompson Marked gene: ERCC8 as ready
Intellectual disability syndromic and non-syndromic v0.6248 ERCC8 Bryony Thompson Gene: ercc8 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6248 ERCC8 Bryony Thompson Phenotypes for gene: ERCC8 were changed from to Cockayne syndrome type 1 MONDO:0019569
Intellectual disability syndromic and non-syndromic v0.6247 ERCC8 Bryony Thompson Publications for gene: ERCC8 were set to
Intellectual disability syndromic and non-syndromic v0.6246 ERCC8 Bryony Thompson Mode of inheritance for gene: ERCC8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6245 ERCC8 Bryony Thompson reviewed gene: ERCC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301516; Phenotypes: Cockayne syndrome type 1 MONDO:0019569; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6245 ERCC6L2 Bryony Thompson Marked gene: ERCC6L2 as ready
Intellectual disability syndromic and non-syndromic v0.6245 ERCC6L2 Bryony Thompson Gene: ercc6l2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6245 ERCC6L2 Bryony Thompson Phenotypes for gene: ERCC6L2 were changed from to pancytopenia-developmental delay syndrome MONDO:0014317
Intellectual disability syndromic and non-syndromic v0.6244 ERCC6L2 Bryony Thompson Publications for gene: ERCC6L2 were set to
Intellectual disability syndromic and non-syndromic v0.6243 ERCC6L2 Bryony Thompson Mode of inheritance for gene: ERCC6L2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6242 ERCC6L2 Bryony Thompson reviewed gene: ERCC6L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36790458; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6242 ERCC6 Bryony Thompson Marked gene: ERCC6 as ready
Intellectual disability syndromic and non-syndromic v0.6242 ERCC6 Bryony Thompson Gene: ercc6 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6242 ERCC6 Bryony Thompson Phenotypes for gene: ERCC6 were changed from to Cockayne spectrum with or without cerebrooculofacioskeletal syndrome MONDO:0100506
Intellectual disability syndromic and non-syndromic v0.6241 ERCC6 Bryony Thompson Publications for gene: ERCC6 were set to
Intellectual disability syndromic and non-syndromic v0.6240 ERCC6 Bryony Thompson Mode of inheritance for gene: ERCC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6239 ERCC3 Bryony Thompson Marked gene: ERCC3 as ready
Intellectual disability syndromic and non-syndromic v0.6239 ERCC3 Bryony Thompson Gene: ercc3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6239 ERCC3 Bryony Thompson Phenotypes for gene: ERCC3 were changed from to xeroderma pigmentosum group B MONDO:0012531
Intellectual disability syndromic and non-syndromic v0.6238 ERCC3 Bryony Thompson Publications for gene: ERCC3 were set to
Intellectual disability syndromic and non-syndromic v0.6237 ERCC3 Bryony Thompson Mode of inheritance for gene: ERCC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6236 ERCC2 Bryony Thompson Phenotypes for gene: ERCC2 were changed from xeroderma pigmentosum group D MONDO:0010212 to xeroderma pigmentosum group D MONDO:0010212; trichothiodystrophy 1, photosensitive MONDO:0011125; cerebrooculofacioskeletal syndrome 2 MONDO:0012553
Intellectual disability syndromic and non-syndromic v0.6235 ERCC2 Bryony Thompson Marked gene: ERCC2 as ready
Intellectual disability syndromic and non-syndromic v0.6235 ERCC2 Bryony Thompson Gene: ercc2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6235 ERCC2 Bryony Thompson Phenotypes for gene: ERCC2 were changed from to xeroderma pigmentosum group D MONDO:0010212
Intellectual disability syndromic and non-syndromic v0.6234 ERCC2 Bryony Thompson Publications for gene: ERCC2 were set to
Intellectual disability syndromic and non-syndromic v0.6233 ERCC2 Bryony Thompson Mode of inheritance for gene: ERCC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6232 EP300 Bryony Thompson Marked gene: EP300 as ready
Intellectual disability syndromic and non-syndromic v0.6232 EP300 Bryony Thompson Gene: ep300 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6232 EP300 Bryony Thompson Phenotypes for gene: EP300 were changed from to Rubinstein-Taybi syndrome MONDO:0019188
Intellectual disability syndromic and non-syndromic v0.6231 EP300 Bryony Thompson Publications for gene: EP300 were set to https://search.clinicalgenome.org/CCID:004751
Intellectual disability syndromic and non-syndromic v0.6230 EP300 Bryony Thompson Publications for gene: EP300 were set to
Intellectual disability syndromic and non-syndromic v0.6229 EP300 Bryony Thompson Mode of inheritance for gene: EP300 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6228 ELOVL4 Bryony Thompson Marked gene: ELOVL4 as ready
Intellectual disability syndromic and non-syndromic v0.6228 ELOVL4 Bryony Thompson Gene: elovl4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6228 ELOVL4 Bryony Thompson Phenotypes for gene: ELOVL4 were changed from to congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760
Intellectual disability syndromic and non-syndromic v0.6227 ELOVL4 Bryony Thompson Publications for gene: ELOVL4 were set to
Intellectual disability syndromic and non-syndromic v0.6226 ELOVL4 Bryony Thompson Mode of inheritance for gene: ELOVL4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6225 EIF2AK3 Bryony Thompson Marked gene: EIF2AK3 as ready
Intellectual disability syndromic and non-syndromic v0.6225 EIF2AK3 Bryony Thompson Gene: eif2ak3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6225 EIF2AK3 Bryony Thompson Mode of inheritance for gene: EIF2AK3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6224 EIF2AK3 Bryony Thompson Publications for gene: EIF2AK3 were set to
Intellectual disability syndromic and non-syndromic v0.6223 DIAPH1 Bryony Thompson Publications for gene: DIAPH1 were set to 24781755; 26463574
Intellectual disability syndromic and non-syndromic v0.6222 DIAPH1 Bryony Thompson reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39076976, 24781755, 26463574, 33662367; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ERCC6L2 Ken Lee Wan reviewed gene: ERCC6L2: Rating: AMBER; Mode of pathogenicity: None; Publications: 24507776, 27185855, 28815563, 29633571; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ERCC3 Ken Lee Wan reviewed gene: ERCC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group B MONDO:0012531; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ERCC2 Ken Lee Wan reviewed gene: ERCC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group D MONDO:0010212, trichothiodystrophy 1, photosensitive MONDO:0011125, cerebrooculofacioskeletal syndrome 2 MONDO:0012553; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 EP300 Ken Lee Wan changed review comment from: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature, and intellectual disability (https://search.clinicalgenome.org/CCID:004751).

Mechanism of disease: loss of function; to: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature and intellectual disability (https://search.clinicalgenome.org/CCID:004751).

Mechanism of disease: loss of function
Intellectual disability syndromic and non-syndromic v0.6222 EP300 Ken Lee Wan reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rubinstein-Taybi syndrome MONDO:0019188; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 ELOVL4 Ken Lee Wan reviewed gene: ELOVL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 37592902; Phenotypes: congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6222 IFT172 Sangavi Sivagnanasundram reviewed gene: IFT172: Rating: AMBER; Mode of pathogenicity: None; Publications: 24290075, 26763875; Phenotypes: Bardet-Biedl syndrome MONDO:0015229; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 IFIH1 Sangavi Sivagnanasundram changed review comment from: ID is a prominent feature of this condition in most cases and those affected will likely have severe intellectual and physical disability.

GoF is the mechanism of disease.; to: ID is a prominent feature of this condition in most cases and those affected will likely have severe intellectual and physical disability.

GoF is the mechanism of disease.

Classified as DEFINITIVE by ClinGen's Leukodystrophy and Leukoencephalopathy GCEP on 23/08/2024 - https://search.clinicalgenome.org/CCID:008354
Intellectual disability syndromic and non-syndromic v0.6222 IFIH1 Sangavi Sivagnanasundram reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 20301648, 25620204; Phenotypes: IFIH1-related type 1 interferonopathy MONDO:0700262; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6222 ERCC6 Mark Cleghorn reviewed gene: ERCC6: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301516; Phenotypes: Cockayne syndrome type B, Cerebrooculofacioskeletal syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 IDUA Sangavi Sivagnanasundram reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301341; Phenotypes: mucopolysaccharidosis type 1 MONDO:0001586; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 IDH2 Sangavi Sivagnanasundram reviewed gene: IDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20847235, 35359529; Phenotypes: mitochondrial disease MONDO:0044970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.6222 HTRA2 Sangavi Sivagnanasundram reviewed gene: HTRA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27208207, 27696117, 30114719, 32445293; Phenotypes: 3-methylglutaconic aciduria type 8 MONDO:0044723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HSPD1 Sangavi Sivagnanasundram reviewed gene: HSPD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 18571143, 27405012; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM #612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HSD17B10 Sangavi Sivagnanasundram reviewed gene: HSD17B10: Rating: GREEN; Mode of pathogenicity: None; Publications: 22132097, 17618155; Phenotypes: HSD10 mitochondrial disease MONDO:0010327; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6222 HPD Sangavi Sivagnanasundram reviewed gene: HPD: Rating: AMBER; Mode of pathogenicity: None; Publications: 31537781; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HMGCL Sangavi Sivagnanasundram reviewed gene: HMGCL: Rating: AMBER; Mode of pathogenicity: None; Publications: 36771238, 35646072; Phenotypes: 3-hydroxy-3-methylglutaric aciduria MONDO:0009520; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HLCS Sangavi Sivagnanasundram reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: 18974016, 18429047, 12124727; Phenotypes: holocarboxylase synthetase deficiency MONDO:0009666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HIBCH Sangavi Sivagnanasundram reviewed gene: HIBCH: Rating: GREEN; Mode of pathogenicity: None; Publications: 24299452, 30847210, 17160907, 26163321, 26026795, 31523596, 32022391, 24299452, 32677093; Phenotypes: 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603, Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HEXB Sangavi Sivagnanasundram reviewed gene: HEXB: Rating: GREEN; Mode of pathogenicity: None; Publications: 35420740; Phenotypes: Sandhoff disease MONDO:0010006; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HEXA Sangavi Sivagnanasundram reviewed gene: HEXA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301397; Phenotypes: Tay-Sachs disease MONDO:0010100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HESX1 Sangavi Sivagnanasundram reviewed gene: HESX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 19623216, 30888394; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HEPACAM Sangavi Sivagnanasundram reviewed gene: HEPACAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 21419380, 24202401, 27389245, 31372844, 21419380, 24202401, 27322623; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490, Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 HCCS Sangavi Sivagnanasundram reviewed gene: HCCS: Rating: AMBER; Mode of pathogenicity: None; Publications: 18950397; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.6222 HADHA Sangavi Sivagnanasundram reviewed gene: HADHA: Rating: AMBER; Mode of pathogenicity: None; Publications: 36063482; Phenotypes: long chain 3-hydroxyacyl-CoA dehydrogenase deficiency MONDO:0012173; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GTF2H5 Sangavi Sivagnanasundram reviewed gene: GTF2H5: Rating: AMBER; Mode of pathogenicity: None; Publications: 30359777, 24986372; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GRM1 Sangavi Sivagnanasundram reviewed gene: GRM1: Rating: AMBER; Mode of pathogenicity: None; Publications: 26308914, 22901947, 31319223, 36675067; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GNS Sangavi Sivagnanasundram reviewed gene: GNS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31536183, 25851924, 17998446, 6450420; Phenotypes: mucopolysaccharidosis type 3D MONDO:0009658; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GNPTAB Sangavi Sivagnanasundram reviewed gene: GNPTAB: Rating: ; Mode of pathogenicity: None; Publications: 20301728; Phenotypes: GNPTAB-mucolipidosis MONDO:0100122; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GNPAT Sangavi Sivagnanasundram reviewed gene: GNPAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843043, 19270340, 21990100; Phenotypes: glyceronephosphate O-acyltransferase deficiency MONDO:0100273; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GMPPB Sangavi Sivagnanasundram reviewed gene: GMPPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23768512, 26133662, 27147698; Phenotypes: myopathy caused by variation in GMPPB MONDO:0700084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GMPPA Sangavi Sivagnanasundram reviewed gene: GMPPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 31898852, 35607266; Phenotypes: alacrima, achalasia, and intellectual disability syndrome MONDO:0014219; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 GM2A Sangavi Sivagnanasundram reviewed gene: GM2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33819415, 20301397; Phenotypes: Tay-Sachs disease AB variant MONDO:0010099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6222 DIAPH1 Zornitza Stark Marked gene: DIAPH1 as ready
Intellectual disability syndromic and non-syndromic v0.6222 DIAPH1 Zornitza Stark Gene: diaph1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6222 DIAPH1 Zornitza Stark Phenotypes for gene: DIAPH1 were changed from to progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714
Intellectual disability syndromic and non-syndromic v0.6221 DIAPH1 Zornitza Stark Publications for gene: DIAPH1 were set to 24781755; 26463574
Intellectual disability syndromic and non-syndromic v0.6220 DIAPH1 Zornitza Stark Publications for gene: DIAPH1 were set to
Intellectual disability syndromic and non-syndromic v0.6220 DIAPH1 Zornitza Stark Mode of inheritance for gene: DIAPH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6219 DIAPH1 Zornitza Stark reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6219 EIF2AK3 Ken Lee Wan reviewed gene: EIF2AK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20202148; Phenotypes: Wolcott-Rallison syndrome MONDO:0009192; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6219 DYNC1H1 Zornitza Stark Marked gene: DYNC1H1 as ready
Intellectual disability syndromic and non-syndromic v0.6219 DYNC1H1 Zornitza Stark Gene: dync1h1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6219 DYNC1H1 Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to dyneinopathy MONDO:1040031
Intellectual disability syndromic and non-syndromic v0.6218 DYNC1H1 Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6217 DYNC1H1 Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism.

Mechanism of disease: gain of function
(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112)
Intellectual disability syndromic and non-syndromic v0.6217 DIS3L2 Zornitza Stark Marked gene: DIS3L2 as ready
Intellectual disability syndromic and non-syndromic v0.6217 DIS3L2 Zornitza Stark Gene: dis3l2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6217 DIS3L2 Zornitza Stark Phenotypes for gene: DIS3L2 were changed from to Perlman syndrome MONDO:0009965
Intellectual disability syndromic and non-syndromic v0.6216 DIS3L2 Zornitza Stark Publications for gene: DIS3L2 were set to
Intellectual disability syndromic and non-syndromic v0.6215 DIAPH1 Ken Lee Wan changed review comment from: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development, and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632).

Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).; to: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632).

Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).
Intellectual disability syndromic and non-syndromic v0.6215 DIS3L2 Zornitza Stark Mode of inheritance for gene: DIS3L2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6214 DNMT3B Ken Lee Wan changed review comment from: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692).

Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860).

Mechanism of disease: loss of function; to: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692).

Immunodeficiency, centromeric instability and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9 and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860).

Mechanism of disease: loss of function
Intellectual disability syndromic and non-syndromic v0.6214 DYNC1H1 Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112)
Intellectual disability syndromic and non-syndromic v0.6214 DYNC1H1 Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM#600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy.

A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations.

DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism.

(https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112)
Intellectual disability syndromic and non-syndromic v0.6214 DYNC1H1 Ken Lee Wan reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: dyneinopathy MONDO:1040031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6214 DIS3L2 Zornitza Stark Mode of inheritance for gene: DIS3L2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6213 DNAJC19 Zornitza Stark Marked gene: DNAJC19 as ready
Intellectual disability syndromic and non-syndromic v0.6213 DNAJC19 Zornitza Stark Gene: dnajc19 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6213 DNAJC19 Zornitza Stark Phenotypes for gene: DNAJC19 were changed from 3-methylglutaconic aciduria type 5 MONDO:0012435 to 3-methylglutaconic aciduria type 5 MONDO:0012435
Intellectual disability syndromic and non-syndromic v0.6212 DNAJC19 Zornitza Stark Phenotypes for gene: DNAJC19 were changed from to 3-methylglutaconic aciduria type 5 MONDO:0012435
Intellectual disability syndromic and non-syndromic v0.6211 DNAJC19 Zornitza Stark Mode of inheritance for gene: DNAJC19 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6210 DNAJC19 Zornitza Stark Mode of inheritance for gene: DNAJC19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6209 DNMT3B Zornitza Stark Marked gene: DNMT3B as ready
Intellectual disability syndromic and non-syndromic v0.6209 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6209 DNMT3B Zornitza Stark Phenotypes for gene: DNMT3B were changed from to immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454
Intellectual disability syndromic and non-syndromic v0.6208 DNMT3B Zornitza Stark Mode of inheritance for gene: DNMT3B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6207 DNMT3B Ken Lee Wan reviewed gene: DNMT3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6207 DNAJC19 Ken Lee Wan reviewed gene: DNAJC19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria type 5 MONDO:0012435; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6207 DIS3L2 Ken Lee Wan changed review comment from: Perlman syndrome is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649)

Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000).

PMID 16278893: 6 out of 22 patients have developmental delay

PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay.

PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay

Mechanism of disease causation: loss of function; to: DIS3L2 is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649)

Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000).

PMID 16278893: 6 out of 22 patients have developmental delay

PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay.

PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay

Mechanism of disease causation: loss of function
Intellectual disability syndromic and non-syndromic v0.6207 DIS3L2 Ken Lee Wan reviewed gene: DIS3L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16278893, 22306653, 28328139; Phenotypes: Perlman syndrome MONDO:0009965; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6207 DIAPH1 Ken Lee Wan reviewed gene: DIAPH1: Rating: AMBER; Mode of pathogenicity: None; Publications: 24781755, 26463574; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6207 RBSN Zornitza Stark Phenotypes for gene: RBSN were changed from intellectual disability, MONDO:0001071 to Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937
Intellectual disability syndromic and non-syndromic v0.6206 RBSN Zornitza Stark reviewed gene: RBSN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6206 RNU2-2P Zornitza Stark Marked gene: RNU2-2P as ready
Intellectual disability syndromic and non-syndromic v0.6206 RNU2-2P Zornitza Stark Gene: rnu2-2p has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6206 RNU2-2P Zornitza Stark Classified gene: RNU2-2P as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6206 RNU2-2P Zornitza Stark Gene: rnu2-2p has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6205 RNU2-2P Zornitza Stark gene: RNU2-2P was added
gene: RNU2-2P was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU2-2P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Phenotypes for gene: RNU2-2P were set to Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related
Review for gene: RNU2-2P was set to GREEN
Added comment: 15 individuals reported with de novo, recurrent variants in this gene at nucleotide positions 4 and 35. The disorder is characterized by intellectual disability, neurodevelopmental delay, autistic behavior, microcephaly, hypotonia, epilepsy and hyperventilation. All cases display a severe and complex seizure phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6204 REPS2 Bryony Thompson Marked gene: REPS2 as ready
Intellectual disability syndromic and non-syndromic v0.6204 REPS2 Bryony Thompson Gene: reps2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6204 REPS2 Bryony Thompson Classified gene: REPS2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6204 REPS2 Bryony Thompson Gene: reps2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6203 TTL Bryony Thompson Marked gene: TTL as ready
Intellectual disability syndromic and non-syndromic v0.6203 TTL Bryony Thompson Gene: ttl has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6203 TTL Bryony Thompson Classified gene: TTL as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6203 TTL Bryony Thompson Gene: ttl has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6202 GPN2 Bryony Thompson Marked gene: GPN2 as ready
Intellectual disability syndromic and non-syndromic v0.6202 GPN2 Bryony Thompson Gene: gpn2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6202 GPN2 Bryony Thompson Classified gene: GPN2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6202 GPN2 Bryony Thompson Gene: gpn2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6201 FKBP4 Bryony Thompson Marked gene: FKBP4 as ready
Intellectual disability syndromic and non-syndromic v0.6201 FKBP4 Bryony Thompson Gene: fkbp4 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6201 FKBP4 Bryony Thompson Classified gene: FKBP4 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6201 FKBP4 Bryony Thompson Gene: fkbp4 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6200 EIF3I Bryony Thompson Marked gene: EIF3I as ready
Intellectual disability syndromic and non-syndromic v0.6200 EIF3I Bryony Thompson Gene: eif3i has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6200 EIF3I Bryony Thompson Classified gene: EIF3I as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6200 EIF3I Bryony Thompson Gene: eif3i has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6199 EIF3I Bryony Thompson Classified gene: EIF3I as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.6199 EIF3I Bryony Thompson Gene: eif3i has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.6198 CEP76 Bryony Thompson Marked gene: CEP76 as ready
Intellectual disability syndromic and non-syndromic v0.6198 CEP76 Bryony Thompson Gene: cep76 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6198 CEP76 Bryony Thompson Classified gene: CEP76 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6198 CEP76 Bryony Thompson Gene: cep76 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6197 MRAS Krithika Murali Mode of inheritance for gene: MRAS was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6197 MRAS Krithika Murali Classified gene: MRAS as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6197 MRAS Krithika Murali Gene: mras has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6196 MRAS Krithika Murali Marked gene: MRAS as ready
Intellectual disability syndromic and non-syndromic v0.6196 MRAS Krithika Murali Gene: mras has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.6196 MRAS Krithika Murali gene: MRAS was added
gene: MRAS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MRAS were set to Noonan syndrome 11 - MIM#618499
Review for gene: MRAS was set to GREEN
Added comment: Developmental delay is a phenotypic feature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6195 CEP76 Mark Cleghorn gene: CEP76 was added
gene: CEP76 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038; Joubert syndrome; Bardet-Biedl syndrome; retinitis pigmentosa
Penetrance for gene: CEP76 were set to unknown
Review for gene: CEP76 was set to GREEN
Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago
ESHG presentation 4/6/24, unpublished

CEP76 associated with syndromic ciliopathy

CEP76 localizes to centrioles and basal body primary cilia
Role in normal centriolar duplication

Index case
Bardet Biedl syndrome
Compound heterozygous pLoF variants in CEP76

Via Gene matcher
7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum:
Obesity
Ocular phenotype
Structural brain anomalies
Renal?

3/7 families clinical Dx Joubert syndrome
1/7 BBS
1/7 GDD/ID NOS
2/7 retinitis pigmentosa (1 of these with learning difficulties)

Mixture of biallelic pLOF and missense variant

CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant

Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6195 EIF3I Mark Cleghorn gene: EIF3I was added
gene: EIF3I was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EIF3I were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: EIF3I were set to unknown
Review for gene: EIF3I was set to AMBER
Added comment: Marcello Scala, Genoa
ESHG presentation 4/6/24, unpublished

De novo EIF3I missense variants as a cause for novel NDD syndrome

EIF3 complex involved in regulating initiation of mRNA translation
Negative regulator of the TGF beta pathway

8 individuals from 8 families
Mod/severe GDD or ID
Short stature
Midline brain anomalies (hypoplasia/agenesis of corpus callosum and pituitary hypoplasia)
Frontal bossing, hypertelorism, long philtrum
All w rare de novo missense variants om EIF3I, clustering within highly conserved WD repeats

Functional studies
Transfected HEK293 cell studies suggested EIF3I protein from variant alleles (from patients above) had disrupted interaction with other EIF subunits, and cells had reduced protein synthesis overall
No animal models
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6195 DDHD2 Bryony Thompson Phenotypes for gene: DDHD2 were changed from hereditary spastic paraplegia 54 MONDO:0014018 to hereditary spastic paraplegia 54 MONDO:0014018
Intellectual disability syndromic and non-syndromic v0.6194 DDHD2 Bryony Thompson Marked gene: DDHD2 as ready
Intellectual disability syndromic and non-syndromic v0.6194 DDHD2 Bryony Thompson Gene: ddhd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6194 DDHD2 Bryony Thompson Phenotypes for gene: DDHD2 were changed from to hereditary spastic paraplegia 54 MONDO:0014018
Intellectual disability syndromic and non-syndromic v0.6193 DDHD2 Bryony Thompson Publications for gene: DDHD2 were set to
Intellectual disability syndromic and non-syndromic v0.6192 DDHD2 Bryony Thompson Mode of inheritance for gene: DDHD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6191 DDHD2 Bryony Thompson reviewed gene: DDHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23486545, 23176823, 36090575, 26113134, 25417924; Phenotypes: hereditary spastic paraplegia 54 MONDO:0014018; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6191 DDC Bryony Thompson Marked gene: DDC as ready
Intellectual disability syndromic and non-syndromic v0.6191 DDC Bryony Thompson Gene: ddc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6191 DDC Bryony Thompson Publications for gene: DDC were set to
Intellectual disability syndromic and non-syndromic v0.6190 DDC Bryony Thompson Mode of inheritance for gene: DDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6189 DDC Bryony Thompson reviewed gene: DDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 37824694; Phenotypes: Aromatic L-amino acid decarboxylase deficiency MONDO:0012084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6189 FKBP4 Mark Cleghorn gene: FKBP4 was added
gene: FKBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: FKBP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FKBP4 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: FKBP4 were set to unknown
Review for gene: FKBP4 was set to AMBER
Added comment: Rebecca Yarwood, University of Manchester
ESHG presentation 4/6/24, unpublished

Bilalleic FKBP4 w NDD + DSD
Protein has functions in hormone receptor trafficking
FKPB4 highly expressed in stem cell and progenitor cells in gonad and neuronal degeneration

Index case
Severe GDD
abN external genitalia
CV AbN
FBBP4 p.E196*

Via GeneMatcher
7 families (12 individuals)

12/12 severe GDD/ID
9/10 microcephaly
11/12 external genital abnormalities (details not provided)

All w homozygous pLoF variants (mixture of canonical splice, frameshift, nonsense)
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6189 MED16 Bryony Thompson Classified gene: MED16 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.6189 MED16 Bryony Thompson Gene: med16 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6188 MED16 Mark Cleghorn gene: MED16 was added
gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: MED16 were set to unknown
Review for gene: MED16 was set to GREEN
Added comment: MED16
Charlotte Guillouet, Imagine institute Paris
ESHG presentation 4/6/24, unpublished

MED16 is part of tail of ‘mediator complex’
Plays a role in enhancer/promotor regions

Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders

Cases
index family
Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly
WES: biallelic MED16 p.Asp217Asn

Via genematcher
16 families total, 22 individuals, homozygous or compound het rare MED16 variants
Mixture of pLoF and missense variants

Motor delay in 16/17
DD or ID in 17/17
Speech delay in 15/15
6/19 ToF
7/19 other septal/aortic defects
6/18 deafness
11/18 microretognathia
6/17 cleft palate
8/19 preauricular tags
9/20 puffy eyelids
12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip)
7/20 corpus callosum anomalies

Not clear that functional work recapitulated phenotype as yet?
Immunofluroescence on HeLa cells transfected with variants observed ?conclusion
MED16 knockout mouse > growth delay, pre weaning lethality
MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6188 LARS2 Chirag Patel reviewed gene: LARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29205794, 32423379, 30737337, 26537577, 23541342; Phenotypes: Perrault syndrome 4, MIM# 615300, Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 LARGE1 Chirag Patel reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 12966029, 19067344, 17436019, 21248746, 19299310; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 LAMP2 Chirag Patel reviewed gene: LAMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 10972294; Phenotypes: Danon disease, MIM# 300257, MONDO:0010281; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 PARN Chirag Patel reviewed gene: PARN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25893599, 26342108; Phenotypes: Dyskeratosis congenita, autosomal recessive 6, MIM# 616353; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 PAX6 Chirag Patel reviewed gene: PAX6: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 26130484, 31700164; Phenotypes: Microphthalmia/coloboma 12, OMIM #120200; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6188 PAX8 Chirag Patel reviewed gene: PAX8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33272083, 9590296 11232006 15356023 15718293; Phenotypes: Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 PC Chirag Patel reviewed gene: PC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9585612, 12112657; Phenotypes: Pyruvate carboxylase deficiency - MIM#266150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6188 SLC6A3 Zornitza Stark Marked gene: SLC6A3 as ready
Intellectual disability syndromic and non-syndromic v0.6188 SLC6A3 Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6188 SLC6A3 Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135
Intellectual disability syndromic and non-syndromic v0.6187 SLC6A3 Zornitza Stark Publications for gene: SLC6A3 were set to
Intellectual disability syndromic and non-syndromic v0.6186 SLC6A3 Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6185 SLC6A3 Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6185 SRD5A3 Zornitza Stark Marked gene: SRD5A3 as ready
Intellectual disability syndromic and non-syndromic v0.6185 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6185 SRD5A3 Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM#612379; Kahrizi syndrome, MIM# 612713
Intellectual disability syndromic and non-syndromic v0.6184 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Intellectual disability syndromic and non-syndromic v0.6183 SRD5A3 Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6182 SRD5A3 Zornitza Stark reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323; Phenotypes: Congenital disorder of glycosylation, type Iq, MIM#612379, Kahrizi syndrome, MIM# 612713; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6182 SLC6A8 Zornitza Stark Marked gene: SLC6A8 as ready
Intellectual disability syndromic and non-syndromic v0.6182 SLC6A8 Zornitza Stark Gene: slc6a8 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6182 SLC6A8 Zornitza Stark Phenotypes for gene: SLC6A8 were changed from to Cerebral creatine deficiency syndrome 1, MIM# 300352
Intellectual disability syndromic and non-syndromic v0.6181 SLC6A8 Zornitza Stark Publications for gene: SLC6A8 were set to