Activity

Filter

Cancel
Date Panel Item Activity
1433 actions
Clefting disorders v1.25 CPLANE2 Zornitza Stark Phenotypes for gene: CPLANE2 were changed from Ciliopathy, MONDO:0005308, RSG1-related to Ciliopathy, MONDO:0005308, CPLANE2-related
Clefting disorders v1.24 CPLANE2 Zornitza Stark edited their review of gene: CPLANE2: Changed phenotypes: Ciliopathy, MONDO:0005308, CPLANE2-related
Clefting disorders v1.24 CDK20 Zornitza Stark Phenotypes for gene: CDK20 were changed from Ciliopathy, MONDO:0005308, CDK20-related to Lemire-Marshall-Drivas-Chitayat syndrome, MIM# 621676
Clefting disorders v1.23 CDK20 Zornitza Stark edited their review of gene: CDK20: Changed phenotypes: Lemire-Marshall-Drivas-Chitayat syndrome, MIM# 621676
Clefting disorders v1.23 ISCA-37446-Loss Sarah Milton Chromosome 22q11.2 deletion syndrome, distal was changed to Chromosome 22q11.2 deletion syndrome, DiGeorge syndrome
Source Expert list was removed from Region: ISCA-37446-Loss.
Source Expert list was removed from Region: ISCA-37446-Loss.
Source ClinGen was added to Region: ISCA-37446-Loss.
Clefting disorders v1.22 PIGA chirag patel commented on gene: PIGA
Clefting disorders v1.22 PIGA chirag patel Marked gene: PIGA as ready
Clefting disorders v1.22 PIGA chirag patel Gene: piga has been classified as Red List (Low Evidence).
Clefting disorders v1.22 PIGA chirag patel Publications for gene: PIGA were set to 22305531; 22514539
Clefting disorders v1.21 PIGA chirag patel Phenotypes for gene: PIGA were changed from MCAHS2; MULTIPLE CONGENITAL ANOMALIES-HYPOTONIA-SEIZURES SYNDROME 2 to Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466
Clefting disorders v1.20 CDK20 Zornitza Stark Marked gene: CDK20 as ready
Clefting disorders v1.20 CDK20 Zornitza Stark Gene: cdk20 has been classified as Green List (High Evidence).
Clefting disorders v1.20 Zornitza Stark Copied gene CDK20 from panel Mendeliome
Clefting disorders v1.20 CDK20 Zornitza Stark gene: CDK20 was added
gene: CDK20 was added to Clefting disorders. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CDK20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDK20 were set to 42409022
Phenotypes for gene: CDK20 were set to Ciliopathy, MONDO:0005308, CDK20-related
Clefting disorders v1.19 PORCN chirag patel Marked gene: PORCN as ready
Clefting disorders v1.19 PORCN chirag patel Gene: porcn has been classified as Green List (High Evidence).
Clefting disorders v1.19 PORCN chirag patel Phenotypes for gene: PORCN were changed from Focal dermal hypoplasia, MIM# 305600 to Focal dermal hypoplasia, MIM# 305600
Clefting disorders v1.19 PORCN chirag patel Phenotypes for gene: PORCN were changed from GOLTZ SYNDROME; Focal dermal hypoplasia, 305600 to Focal dermal hypoplasia, MIM# 305600
Clefting disorders v1.18 PORCN chirag patel reviewed gene: PORCN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301712; Phenotypes: Focal dermal hypoplasia, MIM# 305600; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Clefting disorders v1.18 PORCN chirag patel Deleted their review
Clefting disorders v1.18 PORCN chirag patel Deleted their comment
Clefting disorders v1.18 PORCN chirag patel reviewed gene: PORCN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Clefting disorders v1.18 chirag patel Added reviews for gene PORCN from panel Skeletal dysplasia
Clefting disorders v1.17 MBTPS2 chirag patel Publications for gene: MBTPS2 were set to
Clefting disorders v1.16 MBTPS2 chirag patel Marked gene: MBTPS2 as ready
Clefting disorders v1.16 MBTPS2 chirag patel Gene: mbtps2 has been classified as Green List (High Evidence).
Clefting disorders v1.16 MBTPS2 chirag patel reviewed gene: MBTPS2: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005345; Phenotypes: IFAP syndrome with or without BRESHECK syndrome MONDO:0100213; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Clefting disorders v1.16 MBTPS2 chirag patel Phenotypes for gene: MBTPS2 were changed from IFAP SYNDROME WITH OR WITHOUT BRESHECK SYNDROME to IFAP syndrome with or without BRESHECK syndrome MONDO:0100213
Clefting disorders v1.15 GNAI3 chirag patel Classified gene: GNAI3 as Green List (high evidence)
Clefting disorders v1.15 GNAI3 chirag patel Gene: gnai3 has been classified as Green List (High Evidence).
Clefting disorders v1.14 FGD1 chirag patel Marked gene: FGD1 as ready
Clefting disorders v1.14 FGD1 chirag patel Gene: fgd1 has been classified as Green List (High Evidence).
Clefting disorders v1.14 FGD1 chirag patel Phenotypes for gene: FGD1 were changed from AARSKOG-SCOTT SYNDROME; AAS to Aarskog-Scott syndrome, X-linked, MONDO:0010589
Clefting disorders v1.13 FGD1 chirag patel Publications for gene: FGD1 were set to 20082460
Clefting disorders v1.12 FGD1 chirag patel reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 41704117; Phenotypes: Aarskog-Scott syndrome, X-linked, MONDO:0010589; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Clefting disorders v1.12 chirag patel Added reviews for gene FGD1 from panel Mendeliome
Clefting disorders v1.11 EFNB1 chirag patel Marked gene: EFNB1 as ready
Clefting disorders v1.11 EFNB1 chirag patel Gene: efnb1 has been classified as Green List (High Evidence).
Clefting disorders v1.11 EFNB1 chirag patel Phenotypes for gene: EFNB1 were changed from CRANIOFRONTONASAL SYNDROME; CFNS to Craniofrontonasal dysplasia, MIM# 304110
Clefting disorders v1.10 EFNB1 chirag patel Publications for gene: EFNB1 were set to
Clefting disorders v1.9 chirag patel Added reviews for gene EFNB1 from panel Mendeliome
Clefting disorders v1.8 EDNRA chirag patel Phenotypes for gene: EDNRA were changed from MANDIBULOFACIAL DYSOSTOSIS WITH ALOPECIA; MFDA; Cleft palate to Mandibulofacial dysostosis with alopecia, MIM# 616367
Clefting disorders v1.7 EDNRA chirag patel Mode of inheritance for gene: EDNRA was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v1.6 EDNRA chirag patel Publications for gene: EDNRA were set to
Clefting disorders v1.5 EDNRA chirag patel Marked gene: EDNRA as ready
Clefting disorders v1.5 EDNRA chirag patel Gene: ednra has been classified as Green List (High Evidence).
Clefting disorders v1.5 chirag patel Added reviews for gene EDNRA from panel Mendeliome
Clefting disorders v1.4 AXIN2 Zornitza Stark Marked gene: AXIN2 as ready
Clefting disorders v1.4 AXIN2 Zornitza Stark Gene: axin2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v1.4 AXIN2 Zornitza Stark Classified gene: AXIN2 as Amber List (moderate evidence)
Clefting disorders v1.4 AXIN2 Zornitza Stark Gene: axin2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v1.3 Zornitza Stark removed gene:CHAF1A from the panel
Clefting disorders v1.2 CHAF1A Lucy Spencer changed review comment from: PMID 39333427 reports 8 individuals from 6 families with oculoauriculovertebral spectrum and heterozygous variants in CHAF1A- 2 canonical splice and 4 PTC. 5 of the variants were de novo (1 of which was then inherited by the probands affected children) and 1 was inherited from a healthy father. all variants were absent from gnomad and the gene is constrained for LOF variants.
Sources: Literature; to: PMID 39333427 reports 8 individuals from 6 families with oculoauriculovertebral spectrum and heterozygous variants in CHAF1A- 2 canonical splice and 4 PTC. 5 of the variants were de novo (1 of which was then inherited by the probands affected children) and 1 was inherited from a healthy father. all variants were absent from gnomad and the gene is constrained for LOF variants.

Cleft lip/plate was observed in one individual
Sources: Literature
Clefting disorders v1.2 CHAF1A Lucy Spencer Classified gene: CHAF1A as Amber List (moderate evidence)
Clefting disorders v1.2 CHAF1A Lucy Spencer Gene: chaf1a has been classified as Amber List (Moderate Evidence).
Clefting disorders v1.1 Lucy Spencer Copied gene CHAF1A from panel Mendeliome
Clefting disorders v1.1 CHAF1A Lucy Spencer gene: CHAF1A was added
gene: CHAF1A was added to Clefting disorders. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CHAF1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHAF1A were set to 39333427
Phenotypes for gene: CHAF1A were set to oculoauriculovertebral spectrum with radial defects MONDO:0007712, CHAF1A-related
Clefting disorders v1.0 AXIN2 Lauren Rogers changed review comment from: PMID: 36860143: 1x family with an NMD variant with 3/3 cleft palate, 1/3 hypodontia
PMID: 42429102: 1x individual with a de novo missense variant with cleft palate among other features including oligodontia

Also multiple SNP association studies that suggest AXIN2 is associated with cleft lip and palate
(PMID: 26602496, 22370446, 31268379)
Sources: Literature; to: PMID: 36860143: 1x family with an NMD variant with 3/3 cleft palate, 1/3 hypodontia
PMID: 42429102: 1x individual with a de novo missense variant with cleft palate among other features including oligodontia

Also multiple SNP association studies that suggest AXIN2 is associated with cleft lip and palate
(PMID: 26602496, 22370446, 31268379)
Sources: Literature
Clefting disorders v1.0 AXIN2 Lauren Rogers gene: AXIN2 was added
gene: AXIN2 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: AXIN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AXIN2 were set to PMID: 36860143; 42429102; 26602496; 22370446; 31268379
Phenotypes for gene: AXIN2 were set to Oligodontia-colorectal cancer syndrome (MIM#608615)
Review for gene: AXIN2 was set to AMBER
Added comment: PMID: 36860143: 1x family with an NMD variant with 3/3 cleft palate, 1/3 hypodontia
PMID: 42429102: 1x individual with a de novo missense variant with cleft palate among other features including oligodontia

Also multiple SNP association studies that suggest AXIN2 is associated with cleft lip and palate
(PMID: 26602496, 22370446, 31268379)
Sources: Literature
Clefting disorders v1.0 ISCA-46303-Loss Region ISCA-46303-Loss migrated (gene set migration)
Clefting disorders v1.0 ISCA-37446-Loss Region ISCA-37446-Loss migrated (gene set migration)
Clefting disorders v1.0 ISCA-37433-Loss Region ISCA-37433-Loss migrated (gene set migration)
Clefting disorders v1.0 ISCA-37423-Gain Region ISCA-37423-Gain migrated (gene set migration)
Clefting disorders v1.0 ISCA-37393-Gain Region ISCA-37393-Gain migrated (gene set migration)
Clefting disorders v1.0 ZIC2_HPE5_GCN STR ZIC2_HPE5_GCN: gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration)
Clefting disorders v1.0 EIF4A3_RCPS_complex STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Clefting disorders v1.0 CASK Gene migrated from ENSG00000147044 to ENSG00000147044 (gene set migration)
Clefting disorders v1.0 HOXA2 Gene migrated from ENSG00000105996 to ENSG00000105996 (gene set migration)
Clefting disorders v1.0 NKX2-6 Gene migrated from ENSG00000180053 to ENSG00000180053 (gene set migration)
Clefting disorders v1.0 PQBP1 Gene migrated from ENSG00000102103 to ENSG00000102103 (gene set migration)
Clefting disorders v1.0 SMOC1 Gene migrated from ENSG00000198732 to ENSG00000198732 (gene set migration)
Clefting disorders v1.0 STRA6 Gene migrated from ENSG00000137868 to ENSG00000137868 (gene set migration)
Clefting disorders v1.0 TBX2 Gene migrated from ENSG00000121068 to ENSG00000121068 (gene set migration)
Clefting disorders v1.0 TFAP2B Gene migrated from ENSG00000008196 to ENSG00000008196 (gene set migration)
Clefting disorders v1.0 TOGARAM1 Gene migrated from ENSG00000198718 to ENSG00000198718 (gene set migration)
Clefting disorders v1.0 STXBP1 Gene migrated from ENSG00000136854 to ENSG00000136854 (gene set migration)
Clefting disorders v1.0 INTS1 Gene migrated from ENSG00000164880 to ENSG00000164880 (gene set migration)
Clefting disorders v1.0 SELENOI Gene migrated from ENSG00000138018 to ENSG00000138018 (gene set migration)
Clefting disorders v1.0 PSAT1 Gene migrated from ENSG00000135069 to ENSG00000135069 (gene set migration)
Clefting disorders v1.0 TSR2 Gene migrated from ENSG00000158526 to ENSG00000158526 (gene set migration)
Clefting disorders v1.0 SUMO1 Gene migrated from ENSG00000116030 to ENSG00000116030 (gene set migration)
Clefting disorders v1.0 TGFB2 Gene migrated from ENSG00000092969 to ENSG00000092969 (gene set migration)
Clefting disorders v1.0 UQCC2 Gene migrated from ENSG00000137288 to ENSG00000137288 (gene set migration)
Clefting disorders v1.0 DLG1 Gene migrated from ENSG00000075711 to ENSG00000075711 (gene set migration)
Clefting disorders v1.0 CHSY1 Gene migrated from ENSG00000131873 to ENSG00000131873 (gene set migration)
Clefting disorders v1.0 VAX1 Gene migrated from ENSG00000148704 to ENSG00000148704 (gene set migration)
Clefting disorders v1.0 ZBTB24 Gene migrated from ENSG00000112365 to ENSG00000112365 (gene set migration)
Clefting disorders v1.0 CHD1 Gene migrated from ENSG00000153922 to ENSG00000153922 (gene set migration)
Clefting disorders v1.0 WASHC5 Gene migrated from ENSG00000164961 to ENSG00000164961 (gene set migration)
Clefting disorders v1.0 ACBD5 Gene migrated from ENSG00000107897 to ENSG00000107897 (gene set migration)
Clefting disorders v1.0 WNT3 Gene migrated from ENSG00000108379 to ENSG00000108379 (gene set migration)
Clefting disorders v1.0 FST Gene migrated from ENSG00000134363 to ENSG00000134363 (gene set migration)
Clefting disorders v1.0 TAF11 Gene migrated from ENSG00000064995 to ENSG00000064995 (gene set migration)
Clefting disorders v1.0 CKAP2L Gene migrated from ENSG00000169607 to ENSG00000169607 (gene set migration)
Clefting disorders v1.0 DIS3L2 Gene migrated from ENSG00000144535 to ENSG00000144535 (gene set migration)
Clefting disorders v1.0 RYR1 Gene migrated from ENSG00000196218 to ENSG00000196218 (gene set migration)
Clefting disorders v1.0 DNMT3B Gene migrated from ENSG00000088305 to ENSG00000088305 (gene set migration)
Clefting disorders v1.0 STIL Gene migrated from ENSG00000123473 to ENSG00000123473 (gene set migration)
Clefting disorders v1.0 GATA6 Gene migrated from ENSG00000141448 to ENSG00000141448 (gene set migration)
Clefting disorders v1.0 SOX2 Gene migrated from ENSG00000181449 to ENSG00000181449 (gene set migration)
Clefting disorders v1.0 TWIST2 Gene migrated from ENSG00000233608 to ENSG00000233608 (gene set migration)
Clefting disorders v1.0 SEC24D Gene migrated from ENSG00000150961 to ENSG00000150961 (gene set migration)
Clefting disorders v1.0 FAM111A Gene migrated from ENSG00000166801 to ENSG00000166801 (gene set migration)
Clefting disorders v1.0 FANCL Gene migrated from ENSG00000115392 to ENSG00000115392 (gene set migration)
Clefting disorders v1.0 ALG9 Gene migrated from ENSG00000086848 to ENSG00000086848 (gene set migration)
Clefting disorders v1.0 FOXP2 Gene migrated from ENSG00000128573 to ENSG00000128573 (gene set migration)
Clefting disorders v1.0 FREM2 Gene migrated from ENSG00000150893 to ENSG00000150893 (gene set migration)
Clefting disorders v1.0 ATRX Gene migrated from ENSG00000085224 to ENSG00000085224 (gene set migration)
Clefting disorders v1.0 GDF1 Gene migrated from ENSG00000130283 to ENSG00000130283 (gene set migration)
Clefting disorders v1.0 GRIP1 Gene migrated from ENSG00000155974 to ENSG00000155974 (gene set migration)
Clefting disorders v1.0 LMX1B Gene migrated from ENSG00000136944 to ENSG00000136944 (gene set migration)
Clefting disorders v1.0 AFDN Gene migrated from ENSG00000130396 to ENSG00000130396 (gene set migration)
Clefting disorders v1.0 MYCN Gene migrated from ENSG00000134323 to ENSG00000134323 (gene set migration)
Clefting disorders v1.0 KANSL1 Gene migrated from ENSG00000120071 to ENSG00000120071 (gene set migration)
Clefting disorders v1.0 KIF22 Gene migrated from ENSG00000079616 to ENSG00000079616 (gene set migration)
Clefting disorders v1.0 METTL23 Gene migrated from ENSG00000181038 to ENSG00000181038 (gene set migration)
Clefting disorders v1.0 NBN Gene migrated from ENSG00000104320 to ENSG00000104320 (gene set migration)
Clefting disorders v1.0 NKX2-5 Gene migrated from ENSG00000183072 to ENSG00000183072 (gene set migration)
Clefting disorders v1.0 RPS17 Gene migrated from ENSG00000182774 to ENSG00000182774 (gene set migration)
Clefting disorders v1.0 NSDHL Gene migrated from ENSG00000147383 to ENSG00000147383 (gene set migration)
Clefting disorders v1.0 B3GAT3 Gene migrated from ENSG00000149541 to ENSG00000149541 (gene set migration)
Clefting disorders v1.0 PGAP2 Gene migrated from ENSG00000148985 to ENSG00000148985 (gene set migration)
Clefting disorders v1.0 PIGA Gene migrated from ENSG00000165195 to ENSG00000165195 (gene set migration)
Clefting disorders v1.0 SIX5 Gene migrated from ENSG00000177045 to ENSG00000177045 (gene set migration)
Clefting disorders v1.0 PIGL Gene migrated from ENSG00000108474 to ENSG00000108474 (gene set migration)
Clefting disorders v1.0 PIK3R2 Gene migrated from ENSG00000105647 to ENSG00000105647 (gene set migration)
Clefting disorders v1.0 BOC Gene migrated from ENSG00000144857 to ENSG00000144857 (gene set migration)
Clefting disorders v1.0 POMT1 Gene migrated from ENSG00000130714 to ENSG00000130714 (gene set migration)
Clefting disorders v1.0 CANT1 Gene migrated from ENSG00000171302 to ENSG00000171302 (gene set migration)
Clefting disorders v1.0 POMT2 Gene migrated from ENSG00000009830 to ENSG00000009830 (gene set migration)
Clefting disorders v1.0 PTDSS1 Gene migrated from ENSG00000156471 to ENSG00000156471 (gene set migration)
Clefting disorders v1.0 ZNF3 Gene migrated from ENSG00000166526 to ENSG00000166526 (gene set migration)
Clefting disorders v1.0 RAI1 Gene migrated from ENSG00000108557 to ENSG00000108557 (gene set migration)
Clefting disorders v1.0 RBM8A Gene migrated from ENSG00000265241 to ENSG00000265241 (gene set migration)
Clefting disorders v1.0 RPS19 Gene migrated from ENSG00000105372 to ENSG00000105372 (gene set migration)
Clefting disorders v1.0 DLX4 Gene migrated from ENSG00000108813 to ENSG00000108813 (gene set migration)
Clefting disorders v1.0 SMAD2 Gene migrated from ENSG00000175387 to ENSG00000175387 (gene set migration)
Clefting disorders v1.0 GMNN Gene migrated from ENSG00000112312 to ENSG00000112312 (gene set migration)
Clefting disorders v1.0 GNAI3 Gene migrated from ENSG00000065135 to ENSG00000065135 (gene set migration)
Clefting disorders v1.0 CCN2 Gene symbol changed from CTGF to CCN2 during gene set migration (ENSG00000118523 -> ENSG00000118523)
Clefting disorders v1.0 CRELD1 Gene migrated from ENSG00000163703 to ENSG00000163703 (gene set migration)
Clefting disorders v1.0 ARID1A Gene migrated from ENSG00000117713 to ENSG00000117713 (gene set migration)
Clefting disorders v1.0 UBE3B Gene migrated from ENSG00000151148 to ENSG00000151148 (gene set migration)
Clefting disorders v1.0 SMARCB1 Gene migrated from ENSG00000099956 to ENSG00000099956 (gene set migration)
Clefting disorders v1.0 AUTS2 Gene migrated from ENSG00000158321 to ENSG00000158321 (gene set migration)
Clefting disorders v1.0 POGZ Gene migrated from ENSG00000143442 to ENSG00000143442 (gene set migration)
Clefting disorders v1.0 NOTCH2 Gene migrated from ENSG00000134250 to ENSG00000134250 (gene set migration)
Clefting disorders v1.0 KMT2A Gene migrated from ENSG00000118058 to ENSG00000118058 (gene set migration)
Clefting disorders v1.0 FGFR3 Gene migrated from ENSG00000068078 to ENSG00000068078 (gene set migration)
Clefting disorders v1.0 ARID1B Gene migrated from ENSG00000049618 to ENSG00000049618 (gene set migration)
Clefting disorders v1.0 CHD4 Gene migrated from ENSG00000111642 to ENSG00000111642 (gene set migration)
Clefting disorders v1.0 B4GALT7 Gene migrated from ENSG00000027847 to ENSG00000027847 (gene set migration)
Clefting disorders v1.0 FBXO11 Gene migrated from ENSG00000138081 to ENSG00000138081 (gene set migration)
Clefting disorders v1.0 ERBB2 Gene migrated from ENSG00000141736 to ENSG00000141736 (gene set migration)
Clefting disorders v1.0 PLCH1 Gene migrated from ENSG00000114805 to ENSG00000114805 (gene set migration)
Clefting disorders v1.0 ANKRD17 Gene migrated from ENSG00000132466 to ENSG00000132466 (gene set migration)
Clefting disorders v1.0 RAX Gene migrated from ENSG00000134438 to ENSG00000134438 (gene set migration)
Clefting disorders v1.0 PLEKHA5 Gene migrated from ENSG00000052126 to ENSG00000052126 (gene set migration)
Clefting disorders v1.0 SHROOM3 Gene migrated from ENSG00000138771 to ENSG00000138771 (gene set migration)
Clefting disorders v1.0 PLEKHA7 Gene migrated from ENSG00000166689 to ENSG00000166689 (gene set migration)
Clefting disorders v1.0 RPL11 Gene migrated from ENSG00000142676 to ENSG00000142676 (gene set migration)
Clefting disorders v1.0 COBLL1 Gene migrated from ENSG00000082438 to ENSG00000082438 (gene set migration)
Clefting disorders v1.0 ALX3 Gene migrated from ENSG00000156150 to ENSG00000156150 (gene set migration)
Clefting disorders v1.0 FBRSL1 Gene migrated from ENSG00000112787 to ENSG00000112787 (gene set migration)
Clefting disorders v1.0 EDN1 Gene migrated from ENSG00000078401 to ENSG00000078401 (gene set migration)
Clefting disorders v1.0 KAT5 Gene migrated from ENSG00000172977 to ENSG00000172977 (gene set migration)
Clefting disorders v1.0 LRP6 Gene migrated from ENSG00000070018 to ENSG00000070018 (gene set migration)
Clefting disorders v1.0 ARHGEF38 Gene migrated from ENSG00000236699 to ENSG00000236699 (gene set migration)
Clefting disorders v1.0 SEPTIN9 Gene symbol changed from SEPT9 to SEPTIN9 during gene set migration (ENSG00000184640 -> ENSG00000184640)
Clefting disorders v1.0 ZMPSTE24 Gene migrated from ENSG00000084073 to ENSG00000084073 (gene set migration)
Clefting disorders v1.0 DYNC2I1 Gene symbol changed from WDR60 to DYNC2I1 during gene set migration (ENSG00000126870 -> ENSG00000126870)
Clefting disorders v1.0 WDR35 Gene migrated from ENSG00000118965 to ENSG00000118965 (gene set migration)
Clefting disorders v1.0 DYNC2I2 Gene symbol changed from WDR34 to DYNC2I2 during gene set migration (ENSG00000119333 -> ENSG00000119333)
Clefting disorders v1.0 WDR19 Gene migrated from ENSG00000157796 to ENSG00000157796 (gene set migration)
Clefting disorders v1.0 TTC21B Gene migrated from ENSG00000123607 to ENSG00000123607 (gene set migration)
Clefting disorders v1.0 SMG9 Gene migrated from ENSG00000105771 to ENSG00000105771 (gene set migration)
Clefting disorders v1.0 SEC23A Gene migrated from ENSG00000100934 to ENSG00000100934 (gene set migration)
Clefting disorders v1.0 MED13L Gene migrated from ENSG00000123066 to ENSG00000123066 (gene set migration)
Clefting disorders v1.0 PHGDH Gene migrated from ENSG00000092621 to ENSG00000092621 (gene set migration)
Clefting disorders v1.0 MEOX1 Gene migrated from ENSG00000005102 to ENSG00000005102 (gene set migration)
Clefting disorders v1.0 MED25 Gene migrated from ENSG00000104973 to ENSG00000104973 (gene set migration)
Clefting disorders v1.0 LMNA Gene migrated from ENSG00000160789 to ENSG00000160789 (gene set migration)
Clefting disorders v1.0 GATA3 Gene migrated from ENSG00000107485 to ENSG00000107485 (gene set migration)
Clefting disorders v1.0 FTO Gene migrated from ENSG00000140718 to ENSG00000140718 (gene set migration)
Clefting disorders v1.0 DDX59 Gene migrated from ENSG00000118197 to ENSG00000118197 (gene set migration)
Clefting disorders v1.0 COL9A2 Gene migrated from ENSG00000049089 to ENSG00000049089 (gene set migration)
Clefting disorders v1.0 DDX3X Gene migrated from ENSG00000215301 to ENSG00000215301 (gene set migration)
Clefting disorders v1.0 CDC45 Gene migrated from ENSG00000093009 to ENSG00000093009 (gene set migration)
Clefting disorders v1.0 BUB1B Gene migrated from ENSG00000156970 to ENSG00000156970 (gene set migration)
Clefting disorders v1.0 B3GALT6 Gene migrated from ENSG00000176022 to ENSG00000176022 (gene set migration)
Clefting disorders v1.0 IFT52 Gene migrated from ENSG00000101052 to ENSG00000101052 (gene set migration)
Clefting disorders v1.0 RBPJ Gene migrated from ENSG00000168214 to ENSG00000168214 (gene set migration)
Clefting disorders v1.0 RARB Gene migrated from ENSG00000077092 to ENSG00000077092 (gene set migration)
Clefting disorders v1.0 ATR Gene migrated from ENSG00000175054 to ENSG00000175054 (gene set migration)
Clefting disorders v1.0 COL9A3 Gene migrated from ENSG00000092758 to ENSG00000092758 (gene set migration)
Clefting disorders v1.0 SCUBE3 Gene migrated from ENSG00000146197 to ENSG00000146197 (gene set migration)
Clefting disorders v1.0 LRRC32 Gene migrated from ENSG00000137507 to ENSG00000137507 (gene set migration)
Clefting disorders v1.0 ARCN1 Gene migrated from ENSG00000095139 to ENSG00000095139 (gene set migration)
Clefting disorders v1.0 NEK1 Gene migrated from ENSG00000137601 to ENSG00000137601 (gene set migration)
Clefting disorders v1.0 ACTB Gene migrated from ENSG00000075624 to ENSG00000075624 (gene set migration)
Clefting disorders v1.0 ACTG1 Gene migrated from ENSG00000184009 to ENSG00000184009 (gene set migration)
Clefting disorders v1.0 ANKRD11 Gene migrated from ENSG00000167522 to ENSG00000167522 (gene set migration)
Clefting disorders v1.0 AMOTL1 Gene migrated from ENSG00000166025 to ENSG00000166025 (gene set migration)
Clefting disorders v1.0 AMER1 Gene migrated from ENSG00000184675 to ENSG00000184675 (gene set migration)
Clefting disorders v1.0 POLR1A Gene migrated from ENSG00000068654 to ENSG00000068654 (gene set migration)
Clefting disorders v1.0 ZRSR2 Gene migrated from ENSG00000169249 to ENSG00000169249 (gene set migration)
Clefting disorders v1.0 MYMK Gene migrated from ENSG00000187616 to ENSG00000187616 (gene set migration)
Clefting disorders v1.0 RAB34 Gene migrated from ENSG00000109113 to ENSG00000109113 (gene set migration)
Clefting disorders v1.0 CNTNAP1 Gene migrated from ENSG00000108797 to ENSG00000108797 (gene set migration)
Clefting disorders v1.0 GLI2 Gene migrated from ENSG00000074047 to ENSG00000074047 (gene set migration)
Clefting disorders v1.0 KAT6B Gene migrated from ENSG00000156650 to ENSG00000156650 (gene set migration)
Clefting disorders v1.0 PGAP3 Gene migrated from ENSG00000161395 to ENSG00000161395 (gene set migration)
Clefting disorders v1.0 STAG2 Gene migrated from ENSG00000101972 to ENSG00000101972 (gene set migration)
Clefting disorders v1.0 SMARCA4 Gene migrated from ENSG00000127616 to ENSG00000127616 (gene set migration)
Clefting disorders v1.0 ZC4H2 Gene migrated from ENSG00000126970 to ENSG00000126970 (gene set migration)
Clefting disorders v1.0 INTS13 Gene migrated from ENSG00000064102 to ENSG00000064102 (gene set migration)
Clefting disorders v1.0 PLCB4 Gene migrated from ENSG00000101333 to ENSG00000101333 (gene set migration)
Clefting disorders v1.0 ARHGAP29 Gene migrated from ENSG00000137962 to ENSG00000137962 (gene set migration)
Clefting disorders v1.0 PPP1R13L Gene migrated from ENSG00000104881 to ENSG00000104881 (gene set migration)
Clefting disorders v1.0 IFT80 Gene migrated from ENSG00000068885 to ENSG00000068885 (gene set migration)
Clefting disorders v1.0 EYA1 Gene migrated from ENSG00000104313 to ENSG00000104313 (gene set migration)
Clefting disorders v1.0 EPG5 Gene migrated from ENSG00000152223 to ENSG00000152223 (gene set migration)
Clefting disorders v1.0 DVL3 Gene migrated from ENSG00000161202 to ENSG00000161202 (gene set migration)
Clefting disorders v1.0 LOXL3 Gene migrated from ENSG00000115318 to ENSG00000115318 (gene set migration)
Clefting disorders v1.0 SF3B2 Gene migrated from ENSG00000087365 to ENSG00000087365 (gene set migration)
Clefting disorders v1.0 HYAL2 Gene migrated from ENSG00000068001 to ENSG00000068001 (gene set migration)
Clefting disorders v1.0 CTCF Gene migrated from ENSG00000102974 to ENSG00000102974 (gene set migration)
Clefting disorders v1.0 CREBBP Gene migrated from ENSG00000005339 to ENSG00000005339 (gene set migration)
Clefting disorders v1.0 GDF11 Gene migrated from ENSG00000135414 to ENSG00000135414 (gene set migration)
Clefting disorders v1.0 CPLANE2 Gene symbol changed from RSG1 to CPLANE2 during gene set migration (ENSG00000132881 -> ENSG00000132881)
Clefting disorders v1.0 TBX15 Gene migrated from ENSG00000092607 to ENSG00000092607 (gene set migration)
Clefting disorders v1.0 KDM1A Gene migrated from ENSG00000004487 to ENSG00000004487 (gene set migration)
Clefting disorders v1.0 PRKCI Gene migrated from ENSG00000163558 to ENSG00000163558 (gene set migration)
Clefting disorders v1.0 DVL1 Gene migrated from ENSG00000107404 to ENSG00000107404 (gene set migration)
Clefting disorders v1.0 EIF3F Gene migrated from ENSG00000175390 to ENSG00000175390 (gene set migration)
Clefting disorders v1.0 COLEC11 Gene migrated from ENSG00000118004 to ENSG00000118004 (gene set migration)
Clefting disorders v1.0 COLEC10 Gene migrated from ENSG00000184374 to ENSG00000184374 (gene set migration)
Clefting disorders v1.0 CHST14 Gene migrated from ENSG00000169105 to ENSG00000169105 (gene set migration)
Clefting disorders v1.0 GNB1 Gene migrated from ENSG00000078369 to ENSG00000078369 (gene set migration)
Clefting disorders v1.0 ESRP2 Gene migrated from ENSG00000103067 to ENSG00000103067 (gene set migration)
Clefting disorders v1.0 RPS28 Gene migrated from ENSG00000233927 to ENSG00000233927 (gene set migration)
Clefting disorders v1.0 ZSWIM6 Gene migrated from ENSG00000130449 to ENSG00000130449 (gene set migration)
Clefting disorders v1.0 ZIC3 Gene migrated from ENSG00000156925 to ENSG00000156925 (gene set migration)
Clefting disorders v1.0 ZIC2 Gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration)
Clefting disorders v1.0 XYLT1 Gene migrated from ENSG00000103489 to ENSG00000103489 (gene set migration)
Clefting disorders v1.0 WNT5A Gene migrated from ENSG00000114251 to ENSG00000114251 (gene set migration)
Clefting disorders v1.0 TUBB Gene migrated from ENSG00000196230 to ENSG00000196230 (gene set migration)
Clefting disorders v1.0 TRIM37 Gene migrated from ENSG00000108395 to ENSG00000108395 (gene set migration)
Clefting disorders v1.0 TRAPPC9 Gene migrated from ENSG00000167632 to ENSG00000167632 (gene set migration)
Clefting disorders v1.0 TMCO1 Gene migrated from ENSG00000143183 to ENSG00000143183 (gene set migration)
Clefting disorders v1.0 TGFBR2 Gene migrated from ENSG00000163513 to ENSG00000163513 (gene set migration)
Clefting disorders v1.0 TGFBR1 Gene migrated from ENSG00000106799 to ENSG00000106799 (gene set migration)
Clefting disorders v1.0 TGFB3 Gene migrated from ENSG00000119699 to ENSG00000119699 (gene set migration)
Clefting disorders v1.0 TGDS Gene migrated from ENSG00000088451 to ENSG00000088451 (gene set migration)
Clefting disorders v1.0 TELO2 Gene migrated from ENSG00000100726 to ENSG00000100726 (gene set migration)
Clefting disorders v1.0 TCOF1 Gene migrated from ENSG00000070814 to ENSG00000070814 (gene set migration)
Clefting disorders v1.0 TBX22 Gene migrated from ENSG00000122145 to ENSG00000122145 (gene set migration)
Clefting disorders v1.0 SPECC1L Gene migrated from ENSG00000100014 to ENSG00000100014 (gene set migration)
Clefting disorders v1.0 SOX9 Gene migrated from ENSG00000125398 to ENSG00000125398 (gene set migration)
Clefting disorders v1.0 SON Gene migrated from ENSG00000159140 to ENSG00000159140 (gene set migration)
Clefting disorders v1.0 SNRPB Gene migrated from ENSG00000125835 to ENSG00000125835 (gene set migration)
Clefting disorders v1.0 SMC3 Gene migrated from ENSG00000108055 to ENSG00000108055 (gene set migration)
Clefting disorders v1.0 SMC1A Gene migrated from ENSG00000072501 to ENSG00000072501 (gene set migration)
Clefting disorders v1.0 SMAD4 Gene migrated from ENSG00000141646 to ENSG00000141646 (gene set migration)
Clefting disorders v1.0 SMAD3 Gene migrated from ENSG00000166949 to ENSG00000166949 (gene set migration)
Clefting disorders v1.0 SLC26A2 Gene migrated from ENSG00000155850 to ENSG00000155850 (gene set migration)
Clefting disorders v1.0 SF3B4 Gene migrated from ENSG00000143368 to ENSG00000143368 (gene set migration)
Clefting disorders v1.0 SCARF2 Gene migrated from ENSG00000244486 to ENSG00000244486 (gene set migration)
Clefting disorders v1.0 SALL4 Gene migrated from ENSG00000101115 to ENSG00000101115 (gene set migration)
Clefting disorders v1.0 RPS26 Gene migrated from ENSG00000197728 to ENSG00000197728 (gene set migration)
Clefting disorders v1.0 RPL5 Gene migrated from ENSG00000122406 to ENSG00000122406 (gene set migration)
Clefting disorders v1.0 TCTN3 Gene migrated from ENSG00000119977 to ENSG00000119977 (gene set migration)
Clefting disorders v1.0 ROR2 Gene migrated from ENSG00000169071 to ENSG00000169071 (gene set migration)
Clefting disorders v1.0 PORCN Gene migrated from ENSG00000102312 to ENSG00000102312 (gene set migration)
Clefting disorders v1.0 POLR1D Gene migrated from ENSG00000186184 to ENSG00000186184 (gene set migration)
Clefting disorders v1.0 PIGV Gene migrated from ENSG00000060642 to ENSG00000060642 (gene set migration)
Clefting disorders v1.0 PIGN Gene migrated from ENSG00000197563 to ENSG00000197563 (gene set migration)
Clefting disorders v1.0 PIEZO2 Gene migrated from ENSG00000154864 to ENSG00000154864 (gene set migration)
Clefting disorders v1.0 PAX3 Gene migrated from ENSG00000135903 to ENSG00000135903 (gene set migration)
Clefting disorders v1.0 OFD1 Gene migrated from ENSG00000046651 to ENSG00000046651 (gene set migration)
Clefting disorders v1.0 NOTCH1 Gene migrated from ENSG00000148400 to ENSG00000148400 (gene set migration)
Clefting disorders v1.0 NIPBL Gene migrated from ENSG00000164190 to ENSG00000164190 (gene set migration)
Clefting disorders v1.0 NEDD4L Gene migrated from ENSG00000049759 to ENSG00000049759 (gene set migration)
Clefting disorders v1.0 MSX1 Gene migrated from ENSG00000163132 to ENSG00000163132 (gene set migration)
Clefting disorders v1.0 MKS1 Gene migrated from ENSG00000011143 to ENSG00000011143 (gene set migration)
Clefting disorders v1.0 MID1 Gene migrated from ENSG00000101871 to ENSG00000101871 (gene set migration)
Clefting disorders v1.0 MEIS2 Gene migrated from ENSG00000134138 to ENSG00000134138 (gene set migration)
Clefting disorders v1.0 MBTPS2 Gene migrated from ENSG00000012174 to ENSG00000012174 (gene set migration)
Clefting disorders v1.0 MAPRE2 Gene migrated from ENSG00000166974 to ENSG00000166974 (gene set migration)
Clefting disorders v1.0 MAP3K7 Gene migrated from ENSG00000135341 to ENSG00000135341 (gene set migration)
Clefting disorders v1.0 POLR1C Gene migrated from ENSG00000171453 to ENSG00000171453 (gene set migration)
Clefting disorders v1.0 KMT2D Gene migrated from ENSG00000167548 to ENSG00000167548 (gene set migration)
Clefting disorders v1.0 KIF7 Gene migrated from ENSG00000166813 to ENSG00000166813 (gene set migration)
Clefting disorders v1.0 KIAA0586 Gene migrated from ENSG00000100578 to ENSG00000100578 (gene set migration)
Clefting disorders v1.0 KDM6A Gene migrated from ENSG00000147050 to ENSG00000147050 (gene set migration)
Clefting disorders v1.0 KCNJ2 Gene migrated from ENSG00000123700 to ENSG00000123700 (gene set migration)
Clefting disorders v1.0 KAT6A Gene migrated from ENSG00000083168 to ENSG00000083168 (gene set migration)
Clefting disorders v1.0 IRF6 Gene migrated from ENSG00000117595 to ENSG00000117595 (gene set migration)
Clefting disorders v1.0 BPNT2 Gene symbol changed from IMPAD1 to BPNT2 during gene set migration (ENSG00000104331 -> ENSG00000104331)
Clefting disorders v1.0 IFT172 Gene migrated from ENSG00000138002 to ENSG00000138002 (gene set migration)
Clefting disorders v1.0 IFT140 Gene migrated from ENSG00000187535 to ENSG00000187535 (gene set migration)
Clefting disorders v1.0 CILK1 Gene symbol changed from ICK to CILK1 during gene set migration (ENSG00000112144 -> ENSG00000112144)
Clefting disorders v1.0 HYLS1 Gene migrated from ENSG00000198331 to ENSG00000198331 (gene set migration)
Clefting disorders v1.0 HDAC8 Gene migrated from ENSG00000147099 to ENSG00000147099 (gene set migration)
Clefting disorders v1.0 GPC3 Gene migrated from ENSG00000147257 to ENSG00000147257 (gene set migration)
Clefting disorders v1.0 GLI3 Gene migrated from ENSG00000106571 to ENSG00000106571 (gene set migration)
Clefting disorders v1.0 KIFBP Gene symbol changed from KIF1BP to KIFBP during gene set migration (ENSG00000198954 -> ENSG00000198954)
Clefting disorders v1.0 GJA1 Gene migrated from ENSG00000152661 to ENSG00000152661 (gene set migration)
Clefting disorders v1.0 FLNB Gene migrated from ENSG00000136068 to ENSG00000136068 (gene set migration)
Clefting disorders v1.0 FLNA Gene migrated from ENSG00000196924 to ENSG00000196924 (gene set migration)
Clefting disorders v1.0 FRAS1 Gene migrated from ENSG00000138759 to ENSG00000138759 (gene set migration)
Clefting disorders v1.0 FGFR2 Gene migrated from ENSG00000066468 to ENSG00000066468 (gene set migration)
Clefting disorders v1.0 FGFR1 Gene migrated from ENSG00000077782 to ENSG00000077782 (gene set migration)
Clefting disorders v1.0 FGD1 Gene migrated from ENSG00000102302 to ENSG00000102302 (gene set migration)
Clefting disorders v1.0 FAM20C Gene migrated from ENSG00000177706 to ENSG00000177706 (gene set migration)
Clefting disorders v1.0 EOGT Gene migrated from ENSG00000163378 to ENSG00000163378 (gene set migration)
Clefting disorders v1.0 EIF2S3 Gene migrated from ENSG00000130741 to ENSG00000130741 (gene set migration)
Clefting disorders v1.0 EFTUD2 Gene migrated from ENSG00000108883 to ENSG00000108883 (gene set migration)
Clefting disorders v1.0 EDNRA Gene migrated from ENSG00000151617 to ENSG00000151617 (gene set migration)
Clefting disorders v1.0 EBP Gene migrated from ENSG00000147155 to ENSG00000147155 (gene set migration)
Clefting disorders v1.0 DYNC2LI1 Gene migrated from ENSG00000138036 to ENSG00000138036 (gene set migration)
Clefting disorders v1.0 DYNC2H1 Gene migrated from ENSG00000187240 to ENSG00000187240 (gene set migration)
Clefting disorders v1.0 DLL4 Gene migrated from ENSG00000128917 to ENSG00000128917 (gene set migration)
Clefting disorders v1.0 FOXC2 Gene migrated from ENSG00000176692 to ENSG00000176692 (gene set migration)
Clefting disorders v1.0 DHCR7 Gene migrated from ENSG00000172893 to ENSG00000172893 (gene set migration)
Clefting disorders v1.0 COL9A1 Gene migrated from ENSG00000112280 to ENSG00000112280 (gene set migration)
Clefting disorders v1.0 COL2A1 Gene migrated from ENSG00000139219 to ENSG00000139219 (gene set migration)
Clefting disorders v1.0 COL11A1 Gene migrated from ENSG00000060718 to ENSG00000060718 (gene set migration)
Clefting disorders v1.0 CHRNG Gene migrated from ENSG00000196811 to ENSG00000196811 (gene set migration)
Clefting disorders v1.0 CHD7 Gene migrated from ENSG00000171316 to ENSG00000171316 (gene set migration)
Clefting disorders v1.0 CDKN1C Gene migrated from ENSG00000129757 to ENSG00000129757 (gene set migration)
Clefting disorders v1.0 COL11A2 Gene migrated from ENSG00000204248 to ENSG00000204248 (gene set migration)
Clefting disorders v1.0 CC2D2A Gene migrated from ENSG00000048342 to ENSG00000048342 (gene set migration)
Clefting disorders v1.0 ARHGAP31 Gene migrated from ENSG00000031081 to ENSG00000031081 (gene set migration)
Clefting disorders v1.0 C2CD3 Gene migrated from ENSG00000168014 to ENSG00000168014 (gene set migration)
Clefting disorders v1.0 BMP2 Gene migrated from ENSG00000125845 to ENSG00000125845 (gene set migration)
Clefting disorders v1.0 BCOR Gene migrated from ENSG00000183337 to ENSG00000183337 (gene set migration)
Clefting disorders v1.0 B3GLCT Gene migrated from ENSG00000187676 to ENSG00000187676 (gene set migration)
Clefting disorders v1.0 ASXL1 Gene migrated from ENSG00000171456 to ENSG00000171456 (gene set migration)
Clefting disorders v1.0 MED16 Gene migrated from ENSG00000175221 to ENSG00000175221 (gene set migration)
Clefting disorders v1.0 MN1 Gene migrated from ENSG00000169184 to ENSG00000169184 (gene set migration)
Clefting disorders v1.0 TP63 Gene migrated from ENSG00000073282 to ENSG00000073282 (gene set migration)
Clefting disorders v1.0 GRHL3 Gene migrated from ENSG00000158055 to ENSG00000158055 (gene set migration)
Clefting disorders v1.0 ZFHX4 Gene migrated from ENSG00000091656 to ENSG00000091656 (gene set migration)
Clefting disorders v1.0 TFAP2A Gene migrated from ENSG00000137203 to ENSG00000137203 (gene set migration)
Clefting disorders v1.0 STAMBP Gene migrated from ENSG00000124356 to ENSG00000124356 (gene set migration)
Clefting disorders v1.0 DOCK6 Gene migrated from ENSG00000130158 to ENSG00000130158 (gene set migration)
Clefting disorders v1.0 CPLANE1 Gene symbol changed from C5orf42 to CPLANE1 during gene set migration (ENSG00000197603 -> ENSG00000197603)
Clefting disorders v1.0 SKI Gene migrated from ENSG00000157933 to ENSG00000157933 (gene set migration)
Clefting disorders v1.0 FOXE1 Gene migrated from ENSG00000178919 to ENSG00000178919 (gene set migration)
Clefting disorders v1.0 SIX3 Gene migrated from ENSG00000138083 to ENSG00000138083 (gene set migration)
Clefting disorders v1.0 SIX1 Gene migrated from ENSG00000126778 to ENSG00000126778 (gene set migration)
Clefting disorders v1.0 SATB2 Gene migrated from ENSG00000119042 to ENSG00000119042 (gene set migration)
Clefting disorders v1.0 RIC1 Gene migrated from ENSG00000107036 to ENSG00000107036 (gene set migration)
Clefting disorders v1.0 MED12 Gene migrated from ENSG00000184634 to ENSG00000184634 (gene set migration)
Clefting disorders v1.0 MASP1 Gene migrated from ENSG00000127241 to ENSG00000127241 (gene set migration)
Clefting disorders v1.0 EIF4A3 Gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Clefting disorders v1.0 SHH Gene migrated from ENSG00000164690 to ENSG00000164690 (gene set migration)
Clefting disorders v1.0 PTCH1 Gene migrated from ENSG00000185920 to ENSG00000185920 (gene set migration)
Clefting disorders v1.0 DHODH Gene migrated from ENSG00000102967 to ENSG00000102967 (gene set migration)
Clefting disorders v1.0 BMP4 Gene migrated from ENSG00000125378 to ENSG00000125378 (gene set migration)
Clefting disorders v1.0 ALX1 Gene migrated from ENSG00000180318 to ENSG00000180318 (gene set migration)
Clefting disorders v1.0 CTNND1 Gene migrated from ENSG00000198561 to ENSG00000198561 (gene set migration)
Clefting disorders v1.0 PGM1 Gene migrated from ENSG00000079739 to ENSG00000079739 (gene set migration)
Clefting disorders v1.0 USP9X Gene migrated from ENSG00000124486 to ENSG00000124486 (gene set migration)
Clefting disorders v1.0 TRRAP Gene migrated from ENSG00000196367 to ENSG00000196367 (gene set migration)
Clefting disorders v1.0 TBX1 Gene migrated from ENSG00000184058 to ENSG00000184058 (gene set migration)
Clefting disorders v1.0 RSPO2 Gene migrated from ENSG00000147655 to ENSG00000147655 (gene set migration)
Clefting disorders v1.0 PHF8 Gene migrated from ENSG00000172943 to ENSG00000172943 (gene set migration)
Clefting disorders v1.0 ZEB2 Gene migrated from ENSG00000169554 to ENSG00000169554 (gene set migration)
Clefting disorders v1.0 ESCO2 Gene migrated from ENSG00000171320 to ENSG00000171320 (gene set migration)
Clefting disorders v1.0 TXNL4A Gene migrated from ENSG00000141759 to ENSG00000141759 (gene set migration)
Clefting disorders v1.0 IGF2 Gene migrated from ENSG00000167244 to ENSG00000167244 (gene set migration)
Clefting disorders v1.0 RIPK4 Gene migrated from ENSG00000183421 to ENSG00000183421 (gene set migration)
Clefting disorders v1.0 RBM10 Gene migrated from ENSG00000182872 to ENSG00000182872 (gene set migration)
Clefting disorders v1.0 YAP1 Gene migrated from ENSG00000137693 to ENSG00000137693 (gene set migration)
Clefting disorders v1.0 SMS Gene migrated from ENSG00000102172 to ENSG00000102172 (gene set migration)
Clefting disorders v1.0 NECTIN1 Gene migrated from ENSG00000110400 to ENSG00000110400 (gene set migration)
Clefting disorders v1.0 EFNB1 Gene migrated from ENSG00000090776 to ENSG00000090776 (gene set migration)
Clefting disorders v1.0 HNRNPK Gene migrated from ENSG00000165119 to ENSG00000165119 (gene set migration)
Clefting disorders v1.0 CDH1 Gene migrated from ENSG00000039068 to ENSG00000039068 (gene set migration)
Clefting disorders v1.0 Panel migrated to gene set Ensemblv115. Source version: v0.319
Clefting disorders v0.319 Sarah Milton Copied gene ERBB2 from panel Mendeliome
Clefting disorders v0.319 ERBB2 Sarah Milton gene: ERBB2 was added
gene: ERBB2 was added to Clefting disorders. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: ERBB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ERBB2 were set to 40329538; 33720042
Phenotypes for gene: ERBB2 were set to Congenital heart disease - left ventricular outflow tract obstruction defects; MONDO:0005453; Hirschsprung disease (HSCR, aganglionic megacolon, MIM#142623)
Clefting disorders v0.318 ISCA-46303-Loss Zornitza Stark Marked Region: ISCA-46303-Loss as ready
Clefting disorders v0.318 ISCA-46303-Loss Zornitza Stark Region: isca-46303-loss has been classified as Green List (High Evidence).
Clefting disorders v0.318 ISCA-46303-Loss Sarah Milton Phenotypes for Region: ISCA-46303-Loss were changed from to Pierre Robin syndrome MIM#261800
Tag regulatory region was added to Region: ISCA-46303-Loss.
Clefting disorders v0.317 ISCA-46303-Loss Sarah Milton changed review comment from: Deletion of the upstream enhancer of SOX9 has been shown to be associated with Pierre Robin syndrome in a number of affected individuals and this region has been curated by Clingen to be HI3. Coordinates were based on the largest region found in affected individuals.

It should be noted deletions of upstream enhancer elements of SOX9 of different sizes have also been associated with male to female sex reversal. Incomplete penetrance has been noted with approx 75% of individuals with deletions in this region demonstrating a 46,XY sex reversal phenotype ranging from ambiguous genitalia to typical female external genitalia.
Sources: ClinGen; to: Deletion of the upstream enhancer of SOX9 have been associated with Pierre Robin syndrome, campomelic dysplasia, acampomelic dysplasia as well as 46,XY sex reversal.

This region has been curated by Clingen for the Pierre Robin syndrome phenotype and has been called HI3. Coordinates were based on the largest region found in affected individuals.

There are a number of enhancer elements within this region of which there are proposed to be four clusters: a proximal cluster between 50-375 kb, a sex-determining interval RevSex region between 517-595 kb, a distal cluster between 601 and 932 kb, and a PRS cluster between 1.03–1.26 Mb. Defining genotype phenotype has not been conclusively established within the literature in this region however there are some noted correlations.

Incomplete penetrance has been noted for the 46,XY sex reversal with approx 75% of individuals with deletions in this region demonstrating a DSD phenotype ranging from ambiguous genitalia to typical female external genitalia. Note that loss of SOX9 function does not cause sex reversal in individuals with a 46,XX karyotype. See additional entry for gain of this region.

Sources: ClinGen
Clefting disorders v0.317 ISCA-46303-Loss Sarah Milton Classified Region: ISCA-46303-Loss as Green List (high evidence)
Clefting disorders v0.317 ISCA-46303-Loss Sarah Milton Region: isca-46303-loss has been classified as Green List (High Evidence).
Clefting disorders v0.316 ISCA-46303-Loss Sarah Milton changed review comment from: Deletion of the upstream enhancer of SOX9 has been shown to be associated with Pierre Robin syndrome in a number of affected individuals and this region has been curated by Clingen to be HI3. Coordinates were based on the largest region found in affected individuals.

It should be noted deletions of upstream enhancer elements of SOX9 of different sizes have also been associated with male to female sex reversal. Exact coordinates and critical regions are still being defined in the literature.
Sources: ClinGen; to: Deletion of the upstream enhancer of SOX9 has been shown to be associated with Pierre Robin syndrome in a number of affected individuals and this region has been curated by Clingen to be HI3. Coordinates were based on the largest region found in affected individuals.

It should be noted deletions of upstream enhancer elements of SOX9 of different sizes have also been associated with male to female sex reversal. Incomplete penetrance has been noted with approx 75% of individuals with deletions in this region demonstrating a 46,XY sex reversal phenotype ranging from ambiguous genitalia to typical female external genitalia.
Sources: ClinGen
Clefting disorders v0.316 TBX15 Zornitza Stark Marked gene: TBX15 as ready
Clefting disorders v0.316 TBX15 Zornitza Stark Gene: tbx15 has been classified as Green List (High Evidence).
Clefting disorders v0.316 TBX15 Zornitza Stark Phenotypes for gene: TBX15 were changed from COUSIN SYNDROME to Pelviscapular dysplasia (Cousin syndrome), MONDO:0009845; Cleft palate, MONDO:0016064, TBX15-related
Clefting disorders v0.315 TBX15 Zornitza Stark Publications for gene: TBX15 were set to
Clefting disorders v0.314 TBX15 Zornitza Stark Mode of inheritance for gene: TBX15 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Clefting disorders v0.313 TBX15 Zornitza Stark Classified gene: TBX15 as Green List (high evidence)
Clefting disorders v0.313 TBX15 Zornitza Stark Gene: tbx15 has been classified as Green List (High Evidence).
Clefting disorders v0.312 TBX15 Zornitza Stark reviewed gene: TBX15: Rating: GREEN; Mode of pathogenicity: None; Publications: 19068278, 24039145, 41904889, 40693652, 36124393; Phenotypes: Pelviscapular dysplasia (Cousin syndrome), MONDO:0009845, Cleft palate, MONDO:0016064, TBX15-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Clefting disorders v0.312 LRRC32 Zornitza Stark Publications for gene: LRRC32 were set to PMID: 30976112
Clefting disorders v0.311 LRRC32 Zornitza Stark reviewed gene: LRRC32: Rating: AMBER; Mode of pathogenicity: None; Publications: 41041957; Phenotypes: Cleft palate, proliferative retinopathy, and developmental delay (CPPRDD) syndrome, MIM# 619074; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.311 Sarah Milton Copied Region ISCA-46303-Loss from panel Common deletion and duplication syndromes
Clefting disorders v0.311 ISCA-46303-Loss Sarah Milton Region: ISCA-46303-Loss was added
Region: ISCA-46303-Loss was added to Clefting disorders. Sources: ClinGen
Mode of inheritance for Region: ISCA-46303-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-46303-Loss were set to PMID: 24934569, 26663529, 19234473, 26152199, 30552336
Clefting disorders v0.310 ARCN1 Zornitza Stark commented on gene: ARCN1: At least 14 individuals reported, summarised in PMID 35300924. Intrauterine growth restriction, micrognathia, and short stature were present in all patients. Other common features included prematurity (11/15, 73.3%), developmental delay (10/14, 71.4%), genitourinary malformations in males (6/8, 75%), and microcephaly (12/15, 80%).
Clefting disorders v0.310 BOC Zornitza Stark Marked gene: BOC as ready
Clefting disorders v0.310 BOC Zornitza Stark Gene: boc has been classified as Red List (Low Evidence).
Clefting disorders v0.310 BOC Zornitza Stark Phenotypes for gene: BOC were changed from to Orofacial clefting, MONDO:0000358, BOC-related
Clefting disorders v0.309 BOC Zornitza Stark edited their review of gene: BOC: Changed phenotypes: Orofacial clefting, MONDO:0000358, BOC-related
Clefting disorders v0.309 Zornitza Stark Copied gene BOC from panel Mendeliome
Clefting disorders v0.309 BOC Zornitza Stark gene: BOC was added
gene: BOC was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: BOC was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: BOC were set to 40464334; 28677295
Clefting disorders v0.308 Sarah Milton Copied Region ISCA-37446-Loss from panel Common deletion and duplication syndromes
Clefting disorders v0.308 ISCA-37446-Loss Sarah Milton Region: ISCA-37446-Loss was added
Region: ISCA-37446-Loss was added to Clefting disorders. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37446-Loss.
Mode of inheritance for Region: ISCA-37446-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37446-Loss were set to 18179902; 23765049; 21671380
Phenotypes for Region: ISCA-37446-Loss were set to Chromosome 22q11.2 deletion syndrome, distal MIM#611867; intellectual disability; autism; multiple congenital anomalies
Clefting disorders v0.307 ESRP2 Zornitza Stark Phenotypes for gene: ESRP2 were changed from cleft lip; Cleft palate, MONDO:0016064; Hypopituitarism MONDO:0005152 to Orofacial cleft MONDO:0000358, ESRP2-related
Clefting disorders v0.306 ESRP2 Zornitza Stark edited their review of gene: ESRP2: Changed phenotypes: Orofacial cleft MONDO:0000358, ESRP2-related
Clefting disorders v0.306 ESRP2 Zornitza Stark Publications for gene: ESRP2 were set to 29805042
Clefting disorders v0.305 ESRP2 Zornitza Stark Classified gene: ESRP2 as Green List (high evidence)
Clefting disorders v0.305 ESRP2 Zornitza Stark Gene: esrp2 has been classified as Green List (High Evidence).
Clefting disorders v0.304 ESRP2 Zornitza Stark edited their review of gene: ESRP2: Added comment: Further functional work on some of the variants in PMID 39179789.; Changed rating: GREEN; Changed publications: 29805042, 39179789
Clefting disorders v0.304 Sarah Milton Copied Region ISCA-37433-Loss from panel Common deletion and duplication syndromes
Clefting disorders v0.304 ISCA-37433-Loss Sarah Milton Region: ISCA-37433-Loss was added
Region: ISCA-37433-Loss was added to Clefting disorders. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37433-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for Region: ISCA-37433-Loss were set to DiGeorge syndrome MIM#188400
Clefting disorders v0.303 ZFHX4 Zornitza Stark Marked gene: ZFHX4 as ready
Clefting disorders v0.303 ZFHX4 Zornitza Stark Gene: zfhx4 has been classified as Green List (High Evidence).
Clefting disorders v0.303 ZFHX4 Zornitza Stark Phenotypes for gene: ZFHX4 were changed from intellectual disability; short stature; cleft to neurodevelopmental disorder, ZFHX4-related (MONDO:0700092)
Clefting disorders v0.302 ZFHX4 Zornitza Stark Classified gene: ZFHX4 as Green List (high evidence)
Clefting disorders v0.302 ZFHX4 Zornitza Stark Gene: zfhx4 has been classified as Green List (High Evidence).
Clefting disorders v0.301 ZFHX4 Boris Keren gene: ZFHX4 was added
gene: ZFHX4 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: ZFHX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZFHX4 were set to PMID: 40367947
Phenotypes for gene: ZFHX4 were set to intellectual disability; short stature; cleft
Penetrance for gene: ZFHX4 were set to Incomplete
Review for gene: ZFHX4 was set to GREEN
gene: ZFHX4 was marked as current diagnostic
Added comment: New series with 57 probands with neurodevelopmental disorders and ZFHX4 pathogenic variants, mostly LoF and de novo.
Some patients have cleft palate.
Sources: Literature
Clefting disorders v0.301 Bryony Thompson Copied STR ZIC2_HPE5_GCN from panel Repeat Disorders
Clefting disorders v0.301 ZIC2_HPE5_GCN Bryony Thompson STR: ZIC2_HPE5_GCN was added
STR: ZIC2_HPE5_GCN was added to Clefting disorders. Sources: Expert Review Green,Expert list
paediatric-onset tags were added to STR: ZIC2_HPE5_GCN.
Mode of inheritance for STR: ZIC2_HPE5_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ZIC2_HPE5_GCN were set to 11285244; 33811808
Phenotypes for STR: ZIC2_HPE5_GCN were set to Holoprosencephaly 5 MIM#609637
Clefting disorders v0.300 SELENOI Zornitza Stark Phenotypes for gene: SELENOI were changed from Cleft palate; developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals to Spastic paraplegia 81, autosomal recessive, MIM# 618768
Clefting disorders v0.299 SELENOI Zornitza Stark Publications for gene: SELENOI were set to 28052917
Clefting disorders v0.298 SELENOI Zornitza Stark edited their review of gene: SELENOI: Added comment: 8 individuals from 4 families reported now, only one with cleft palate.; Changed publications: 28052917, 39806532, 29500230, 33454747; Changed phenotypes: Spastic paraplegia 81, autosomal recessive, MIM# 618768
Clefting disorders v0.298 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164; Cleft palate to Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164; Cleft palate
Clefting disorders v0.297 RPS28 Zornitza Stark Publications for gene: RPS28 were set to 24942156
Clefting disorders v0.296 RPS28 Zornitza Stark Classified gene: RPS28 as Green List (high evidence)
Clefting disorders v0.296 RPS28 Zornitza Stark Gene: rps28 has been classified as Green List (High Evidence).
Clefting disorders v0.295 RPS28 Zornitza Stark edited their review of gene: RPS28: Added comment: PMID 40135709 reports a new individual with a heterozygous de novo start‑codon loss‑of‑function variant (c.2T>C) causing Diamond‑Blackfan anaemia and Pierre Robin sequence; Changed rating: GREEN; Changed publications: 24942156, 40135709; Changed phenotypes: Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164
Clefting disorders v0.295 ISCA-37423-Gain Zornitza Stark Marked Region: ISCA-37423-Gain as ready
Clefting disorders v0.295 ISCA-37423-Gain Zornitza Stark Region: isca-37423-gain has been classified as Green List (High Evidence).
Clefting disorders v0.295 ISCA-37423-Gain Zornitza Stark Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754
Clefting disorders v0.294 ISCA-37423-Gain Sarah Milton reviewed Region: ISCA-37423-Gain: Rating: ; Mode of pathogenicity: None; Publications: PMID: 23345203; Phenotypes: ; Mode of inheritance: None
Clefting disorders v0.294 Sarah Milton Copied Region ISCA-37423-Gain from panel Common deletion and duplication syndromes
Clefting disorders v0.294 ISCA-37423-Gain Sarah Milton Region: ISCA-37423-Gain was added
Region: ISCA-37423-Gain was added to Clefting disorders. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37423-Gain.
Mode of inheritance for Region: ISCA-37423-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754
Phenotypes for Region: ISCA-37423-Gain were set to 8p23.1 duplication syndrome; intellectual disability; congenital heart disease
Clefting disorders v0.293 ISCA-37393-Gain Zornitza Stark Marked Region: ISCA-37393-Gain as ready
Clefting disorders v0.293 ISCA-37393-Gain Zornitza Stark Region: isca-37393-gain has been classified as Green List (High Evidence).
Clefting disorders v0.293 Sarah Milton Copied Region ISCA-37393-Gain from panel Common deletion and duplication syndromes
Clefting disorders v0.293 ISCA-37393-Gain Sarah Milton Region: ISCA-37393-Gain was added
Region: ISCA-37393-Gain was added to Clefting disorders. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37393-Gain.
Mode of inheritance for Region: ISCA-37393-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37393-Gain were set to Cat eye syndrome, MIM# 115470; coloboma; anal atresia; heart and renal malformations
Clefting disorders v0.292 ESRP2 chirag patel Classified gene: ESRP2 as Amber List (moderate evidence)
Clefting disorders v0.292 ESRP2 chirag patel Gene: esrp2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.291 RAX chirag patel Marked gene: RAX as ready
Clefting disorders v0.291 RAX chirag patel Gene: rax has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.291 RAX chirag patel commented on gene: RAX: Established association with bilateral microphthalmia or anophthalmia.

2 cases reported with bilateral cleft lip.

RAX is a paired-type homeoprotein that plays a critical role in eye and forebrain development of vertebrate species. RAX knockout mice have anophthalmia, cleft palate, and an abnormal hypothalamus and display perinatal lethality
Clefting disorders v0.291 RAX chirag patel Deleted their comment
Clefting disorders v0.291 chirag patel Copied gene RAX from panel Pituitary hormone deficiency
Clefting disorders v0.291 RAX chirag patel gene: RAX was added
gene: RAX was added to Clefting disorders. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: RAX was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAX were set to 30811539, 40321348
Phenotypes for gene: RAX were set to Microphthalmia, syndromic 16, MIM#611038
Clefting disorders v0.290 MED16 Lucy Spencer Phenotypes for gene: MED16 were changed from Neurodevelopmental disorder, MONDO:0700092, MED16-related to Guillouet-Gordon syndrome MIM#621220
Clefting disorders v0.289 AMER1 Zornitza Stark Marked gene: AMER1 as ready
Clefting disorders v0.289 AMER1 Zornitza Stark Gene: amer1 has been classified as Green List (High Evidence).
Clefting disorders v0.289 AMER1 Zornitza Stark Phenotypes for gene: AMER1 were changed from OSTEOPATHIA STRIATA WITH CRANIAL SCLEROSIS; OSCS; Cleft palate to Osteopathia striata with cranial sclerosis, MIM# 300373
Clefting disorders v0.288 AMER1 Zornitza Stark Publications for gene: AMER1 were set to
Clefting disorders v0.287 Zornitza Stark Added reviews for gene AMER1 from panel Mendeliome
Clefting disorders v0.286 ANKRD11 Zornitza Stark Marked gene: ANKRD11 as ready
Clefting disorders v0.286 ANKRD11 Zornitza Stark Gene: ankrd11 has been classified as Green List (High Evidence).
Clefting disorders v0.286 ANKRD11 Zornitza Stark Phenotypes for gene: ANKRD11 were changed from Short stature-facial and skeletal anomalies-intellectual disability-macrodontia syndrome; Orofacial Clefting with skeletal features; KBG syndrome,148050 (orofacial clefting, intellectual disability, dental anomalies, dysmorphism) to KBG syndrome, MIM# 148050
Clefting disorders v0.285 ANKRD11 Zornitza Stark Publications for gene: ANKRD11 were set to 25838844; 2705097; 21782149; 27900361
Clefting disorders v0.284 ANKRD11 Zornitza Stark reviewed gene: ANKRD11: Rating: GREEN; Mode of pathogenicity: None; Publications: 35861666; Phenotypes: KBG syndrome, MIM# 148050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.284 ACTG1 Zornitza Stark Marked gene: ACTG1 as ready
Clefting disorders v0.284 ACTG1 Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence).
Clefting disorders v0.284 ACTG1 Zornitza Stark Phenotypes for gene: ACTG1 were changed from BARAITSER-WINTER SYNDROME 2; BRWS2 to Baraitser-Winter syndrome 2, MIM# 614583
Clefting disorders v0.283 ACTG1 Zornitza Stark reviewed gene: ACTG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Baraitser-Winter syndrome 2, MIM# 614583; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.283 ACTB Zornitza Stark Marked gene: ACTB as ready
Clefting disorders v0.283 ACTB Zornitza Stark Gene: actb has been classified as Green List (High Evidence).
Clefting disorders v0.283 ACTB Zornitza Stark Phenotypes for gene: ACTB were changed from BRWS1; BARAITSER-WINTER SYNDROME 1 to Baraitser-Winter syndrome 1, MIM# 243310
Clefting disorders v0.282 ACTB Zornitza Stark reviewed gene: ACTB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Baraitser-Winter syndrome 1, MIM# 243310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.282 chirag patel Added reviews for gene MSX1 from panel Mendeliome
Clefting disorders v0.281 SIX5 chirag patel Tag disputed tag was added to gene: SIX5.
Clefting disorders v0.281 ESRP2 chirag patel Phenotypes for gene: ESRP2 were changed from cleft lip to cleft lip; Cleft palate, MONDO:0016064; Hypopituitarism MONDO:0005152
Clefting disorders v0.280 ESRP2 chirag patel Classified gene: ESRP2 as Green List (high evidence)
Clefting disorders v0.280 ESRP2 chirag patel Gene: esrp2 has been classified as Green List (High Evidence).
Clefting disorders v0.279 ESRP2 chirag patel reviewed gene: ESRP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 41111330, 29180615, 33234718; Phenotypes: Cleft palate, MONDO:0016064, Hypopituitarism MONDO:0005152; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.279 chirag patel Added reviews for gene KMT2D from panel Mendeliome
Clefting disorders v0.278 KDM1A Zornitza Stark Marked gene: KDM1A as ready
Clefting disorders v0.278 KDM1A Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence).
Clefting disorders v0.278 KDM1A chirag patel Classified gene: KDM1A as Green List (high evidence)
Clefting disorders v0.278 KDM1A chirag patel Gene: kdm1a has been classified as Green List (High Evidence).
Clefting disorders v0.277 KDM1A chirag patel reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.277 LOXL3 Zornitza Stark Marked gene: LOXL3 as ready
Clefting disorders v0.277 LOXL3 Zornitza Stark Gene: loxl3 has been classified as Green List (High Evidence).
Clefting disorders v0.277 Zornitza Stark Copied gene LOXL3 from panel Pierre Robin Sequence
Clefting disorders v0.277 LOXL3 Zornitza Stark gene: LOXL3 was added
gene: LOXL3 was added to Clefting disorders. Sources: Expert Review Green,Literature,Literature
Mode of inheritance for gene: LOXL3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LOXL3 were set to 25663169; 26307084; 26957899; 29802726; 30362103; 34787502; 41052910
Phenotypes for gene: LOXL3 were set to Stickler syndrome, MONDO:0019354, LOXL3-related
Clefting disorders v0.276 DLG1 Zornitza Stark Marked gene: DLG1 as ready
Clefting disorders v0.276 DLG1 Zornitza Stark Gene: dlg1 has been classified as Red List (Low Evidence).
Clefting disorders v0.276 DLG1 Zornitza Stark Mode of inheritance for gene: DLG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.275 DLG1 chirag patel Phenotypes for gene: DLG1 were changed from Non-syndromic cleft lip with or without cleft palate to cleft lip/palate MONDO:0016044
Clefting disorders v0.274 DLG1 chirag patel reviewed gene: DLG1: Rating: RED; Mode of pathogenicity: None; Publications: 28926086; Phenotypes: Non-syndromic cleft lip and palate; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.274 CTGF Zornitza Stark Marked gene: CTGF as ready
Clefting disorders v0.274 CTGF Zornitza Stark Gene: ctgf has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.274 CTGF Zornitza Stark Classified gene: CTGF as Amber List (moderate evidence)
Clefting disorders v0.274 CTGF Zornitza Stark Gene: ctgf has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.273 CTGF Zornitza Stark gene: CTGF was added
gene: CTGF was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: CTGF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CTGF were set to 39506047; 39414788; 12736220
Phenotypes for gene: CTGF were set to Kyphomelic dysplasia, OMIM:211350; kyphomelic dysplasia, MONDO:0008881; spondyloepimetaphyseal dysplasia, MONDO:0100510
Review for gene: CTGF was set to AMBER
Added comment: PMID: 39506047 (2025) reported three individuals from two unrelated families with different homozygous CCN2 variants and kyphomelic dysplasia - all had cleft palate or bifid uvula as part of their phenotype. Ccn2-deficient mice also show skeletal dysmorphisms as well as secondary cleft palate, supporting this association.
Sources: Expert Review
Clefting disorders v0.272 PRKCI Sangavi Sivagnanasundram edited their review of gene: PRKCI: Changed rating: GREEN
Clefting disorders v0.272 PRKCI Sangavi Sivagnanasundram changed review comment from: Multiple reported variants in affected individuals mainly presenting with lower lip pits and orofacial clefts (OFCs). Some individuals presented with a more severe phenotype inclusing seizures, ID/DD and urogenital anomalies. Supportive zebrafish model supporting a loss-of-function mechanism was performed on three recurrent variants [c.389G>A (p.Arg130His), c.1148A>G (p.Asn383Ser), and c.1155A>C (p.Leu385Phe)] however there is not enough evidence to show that LoF is the mechanism of disease.

The gene is not constrained for LoF in gnomAD and there are no pathogenic SNVs reported in ClinVar at this present time. Amber until further evidence is published in support of this gene-disease association.
Sources: Literature; to: Multiple reported variants in affected individuals mainly presenting with lower lip pits and orofacial clefts (OFCs). Some individuals presented with a more severe phenotype inclusing seizures, ID/DD and urogenital anomalies. Supportive zebrafish model supporting a loss-of-function mechanism was performed on three recurrent variants [c.389G>A (p.Arg130His), c.1148A>G (p.Asn383Ser), and c.1155A>C (p.Leu385Phe)] however there is not enough evidence to show that LoF is the mechanism of disease.

Sources: Literature
Clefting disorders v0.272 PRKCI Zornitza Stark Marked gene: PRKCI as ready
Clefting disorders v0.272 PRKCI Zornitza Stark Gene: prkci has been classified as Green List (High Evidence).
Clefting disorders v0.272 PRKCI Zornitza Stark Phenotypes for gene: PRKCI were changed from Van der Woude syndrome MONDO:0019508 to Van der Woude syndrome MONDO:0019508, PRKCI-related
Clefting disorders v0.271 PRKCI Zornitza Stark Classified gene: PRKCI as Green List (high evidence)
Clefting disorders v0.271 PRKCI Zornitza Stark Gene: prkci has been classified as Green List (High Evidence).
Clefting disorders v0.270 PRKCI Zornitza Stark reviewed gene: PRKCI: Rating: GREEN; Mode of pathogenicity: None; Publications: 40902599; Phenotypes: Van der Woude syndrome MONDO:0019508, PRKCI-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.270 PRKCI Sangavi Sivagnanasundram gene: PRKCI was added
gene: PRKCI was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: PRKCI was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRKCI were set to 40902599
Phenotypes for gene: PRKCI were set to Van der Woude syndrome MONDO:0019508
Review for gene: PRKCI was set to AMBER
Added comment: Multiple reported variants in affected individuals mainly presenting with lower lip pits and orofacial clefts (OFCs). Some individuals presented with a more severe phenotype inclusing seizures, ID/DD and urogenital anomalies. Supportive zebrafish model supporting a loss-of-function mechanism was performed on three recurrent variants [c.389G>A (p.Arg130His), c.1148A>G (p.Asn383Ser), and c.1155A>C (p.Leu385Phe)] however there is not enough evidence to show that LoF is the mechanism of disease.

The gene is not constrained for LoF in gnomAD and there are no pathogenic SNVs reported in ClinVar at this present time. Amber until further evidence is published in support of this gene-disease association.
Sources: Literature
Clefting disorders v0.270 RSG1 Zornitza Stark Marked gene: RSG1 as ready
Clefting disorders v0.270 RSG1 Zornitza Stark Gene: rsg1 has been classified as Green List (High Evidence).
Clefting disorders v0.270 RSG1 Zornitza Stark Classified gene: RSG1 as Green List (high evidence)
Clefting disorders v0.270 RSG1 Zornitza Stark Gene: rsg1 has been classified as Green List (High Evidence).
Clefting disorders v0.269 RSG1 Zornitza Stark gene: RSG1 was added
gene: RSG1 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: RSG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RSG1 were set to 40593758
Phenotypes for gene: RSG1 were set to Ciliopathy, MONDO:0005308, RSG1-related
Review for gene: RSG1 was set to GREEN
Added comment: Three individuals from unrelated families reported with bi-allelic variants and displaying cleft palate, tongue lobulations and polydactyly, phenotypes characteristic of Oral-Facial-Digital Syndrome. Variants were shown to disrupt two vital steps of ciliogenesis, basal body docking and recruitment of intraflagellar transport proteins.
Sources: Literature
Clefting disorders v0.268 TP63 Zornitza Stark Marked gene: TP63 as ready
Clefting disorders v0.268 TP63 Zornitza Stark Gene: tp63 has been classified as Green List (High Evidence).
Clefting disorders v0.268 TP63 Zornitza Stark Phenotypes for gene: TP63 were changed from Orofacial cleft 8, EEC SYNDROME 3, Rapp Hodgkins syndrome, 129400; EEC3; Limb-mammary syndrome, 603543; AEC (Ankyloblepharon filiforme adnatum, Ectodermal defects and Clefting), Hay Wells syndrome 106260; EEC syndrome (Ectrodactyly, Ectodermal dysplasia and Clefting); ECTRODACTYLY, ECTODERMAL DYSPLASIA, AND CLEFT LIP/PALATE SYNDROME 3; Cleft lip; Ectrodactyly, ectodermal dysplasia, cleft lip/palate syndrome 3, 604292 to TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001
Clefting disorders v0.267 TP63 Zornitza Stark commented on gene: TP63: DEFINITIVE by ClinGen, lumped multiple disorders.
Clefting disorders v0.267 TP63 Zornitza Stark reviewed gene: TP63: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.267 MN1 Zornitza Stark Publications for gene: MN1 were set to 33351141; 31834374; 33351070
Clefting disorders v0.266 MN1 Zornitza Stark Classified gene: MN1 as Green List (high evidence)
Clefting disorders v0.266 MN1 Zornitza Stark Gene: mn1 has been classified as Green List (High Evidence).
Clefting disorders v0.265 MN1 Sarah Milton reviewed gene: MN1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33351070, 31834374, 31834374, 15870292; Phenotypes: Cleft palate, MONDO:0016064, MN1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.265 HYLS1 chirag patel reviewed gene: HYLS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hydrolethalus syndrome MONDO:0006037; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.265 AMOTL1 Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related to Craniofaciocardiohepatic syndrome, MIM# 621192
Clefting disorders v0.264 AMOTL1 Zornitza Stark edited their review of gene: AMOTL1: Changed rating: GREEN; Changed phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Clefting disorders v0.263 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Clefting disorders v0.262 MED16 Zornitza Stark Marked gene: MED16 as ready
Clefting disorders v0.262 MED16 Zornitza Stark Gene: med16 has been classified as Green List (High Evidence).
Clefting disorders v0.262 MED16 Zornitza Stark Classified gene: MED16 as Green List (high evidence)
Clefting disorders v0.262 MED16 Zornitza Stark Gene: med16 has been classified as Green List (High Evidence).
Clefting disorders v0.261 MED16 Zornitza Stark gene: MED16 was added
gene: MED16 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED16 were set to 40081376
Phenotypes for gene: MED16 were set to Neurodevelopmental disorder, MONDO:0700092, MED16-related
Review for gene: MED16 was set to GREEN
Added comment: 18 families reported with bi-allelic variants in this gene with DD/ID +/- multiple congenital anomalies, including cleft palate in multiple individuals.
Sources: Literature
Clefting disorders v0.260 TAF11 Bryony Thompson Marked gene: TAF11 as ready
Clefting disorders v0.260 TAF11 Bryony Thompson Gene: taf11 has been classified as Red List (Low Evidence).
Clefting disorders v0.260 TAF11 Bryony Thompson gene: TAF11 was added
gene: TAF11 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: TAF11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAF11 were set to 39727181
Phenotypes for gene: TAF11 were set to cleft lip MONDO:0004747
Review for gene: TAF11 was set to RED
Added comment: 2 individuals in a single Chinese family with nonsyndromic cleft lip segregating with the missense p.Leu48Phe. The missense has an AF of 1.8% (including 15 homozygotes) in gnomAD v4 in the East Asian population, which is too common for an autosomal dominant disease—also, a supporting zebrafish model with craniofacial abnormalities (however the genetic evidence for this GDA is lacking).
Sources: Literature
Clefting disorders v0.259 HYAL2 Zornitza Stark Phenotypes for gene: HYAL2 were changed from Cleft lip and palate; cor triatriatum; congenital cardiac malformations to Muggenthaler-Chowdhury-Chioza syndrome, MIM# 621063
Clefting disorders v0.258 ZRSR2 Zornitza Stark Phenotypes for gene: ZRSR2 were changed from Orofacialdigital syndrome MONDO:0015375, ZRSR2-related to Orofaciodigital syndrome XXI, MIM# 301132
Clefting disorders v0.257 ZRSR2 Zornitza Stark reviewed gene: ZRSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Orofaciodigital syndrome XXI, MIM# 301132; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Clefting disorders v0.257 USP9X Ain Roesley Phenotypes for gene: USP9X were changed from Mental retardation, X-linked 99 300919 XLR; Mental retardation, X-linked 99, syndromic, female-restricted 300968 to Intellectual developmental disorder 99 MIM#300919; syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968
Clefting disorders v0.256 CRELD1 Ain Roesley Marked gene: CRELD1 as ready
Clefting disorders v0.256 CRELD1 Ain Roesley Gene: creld1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.256 CRELD1 Ain Roesley Classified gene: CRELD1 as Amber List (moderate evidence)
Clefting disorders v0.256 CRELD1 Ain Roesley Gene: creld1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.255 CRELD1 Ain Roesley gene: CRELD1 was added
gene: CRELD1 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: CRELD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRELD1 were set to 37947183
Phenotypes for gene: CRELD1 were set to Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771
Review for gene: CRELD1 was set to AMBER
gene: CRELD1 was marked as current diagnostic
Added comment: 2 families with cleft palate, intra-familial variability noted
Sources: Literature
Clefting disorders v0.254 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Clefting disorders v0.254 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Clefting disorders v0.254 CREBBP Zornitza Stark Classified gene: CREBBP as Green List (high evidence)
Clefting disorders v0.254 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Clefting disorders v0.253 CREBBP Zornitza Stark gene: CREBBP was added
gene: CREBBP was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CREBBP were set to 35626936
Phenotypes for gene: CREBBP were set to Menke-Hennekam syndrome 1, MIM# 618332
Review for gene: CREBBP was set to GREEN
Added comment: Cleft palate is a reported feature in several patients.
Sources: Expert Review
Clefting disorders v0.252 NEK1 Zornitza Stark Marked gene: NEK1 as ready
Clefting disorders v0.252 NEK1 Zornitza Stark Gene: nek1 has been classified as Green List (High Evidence).
Clefting disorders v0.252 NEK1 Zornitza Stark Phenotypes for gene: NEK1 were changed from SHORT-RIB THORACIC DYSPLASIA 6 WITH OR WITHOUT POLYDACTYLY; SRTD6 to Short-rib thoracic dysplasia 6 with or without polydactyly, MIM# 263520; Orofaciodigital syndrome II , MIM# 252100
Clefting disorders v0.251 NEK1 Zornitza Stark Publications for gene: NEK1 were set to
Clefting disorders v0.250 NEK1 Zornitza Stark reviewed gene: NEK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21211617, 22499340, 25492405, 28123176, 27530628; Phenotypes: Short-rib thoracic dysplasia 6 with or without polydactyly, MIM# 263520, Orofaciodigital syndrome II , MIM# 252100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.250 RAB34 Zornitza Stark Phenotypes for gene: RAB34 were changed from Multiple congenital anomalies, (MONDO:0019042), RAB34-related to Orofaciodigital syndrome 20, MIM#620718
Clefting disorders v0.249 MYMK Zornitza Stark Marked gene: MYMK as ready
Clefting disorders v0.249 MYMK Zornitza Stark Gene: mymk has been classified as Green List (High Evidence).
Clefting disorders v0.249 MYMK Zornitza Stark Phenotypes for gene: MYMK were changed from Carey-Fineman-Ziter syndrome 254940 to Carey-Fineman-Ziter syndrome, MIM# 254940
Clefting disorders v0.248 MYMK Zornitza Stark reviewed gene: MYMK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Carey-Fineman-Ziter syndrome, MIM# 254940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.248 FBXO11 Zornitza Stark Marked gene: FBXO11 as ready
Clefting disorders v0.248 FBXO11 Zornitza Stark Gene: fbxo11 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.248 FBXO11 Zornitza Stark reviewed gene: FBXO11: Rating: AMBER; Mode of pathogenicity: None; Publications: 30057029; Phenotypes: intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 618089; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.248 FOXP2 Zornitza Stark Marked gene: FOXP2 as ready
Clefting disorders v0.248 FOXP2 Zornitza Stark Gene: foxp2 has been classified as Red List (Low Evidence).
Clefting disorders v0.248 FOXP2 Zornitza Stark Phenotypes for gene: FOXP2 were changed from Speech-language disorder-1, 602081 to Speech-language disorder-1, MIM# 602081
Clefting disorders v0.247 FOXP2 Zornitza Stark Classified gene: FOXP2 as Red List (low evidence)
Clefting disorders v0.247 FOXP2 Zornitza Stark Gene: foxp2 has been classified as Red List (Low Evidence).
Clefting disorders v0.246 FOXP2 Zornitza Stark reviewed gene: FOXP2: Rating: RED; Mode of pathogenicity: None; Publications: 36328423; Phenotypes: Speech-language disorder-1, MIM# 602081; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.246 ZRSR2 Zornitza Stark Marked gene: ZRSR2 as ready
Clefting disorders v0.246 ZRSR2 Zornitza Stark Gene: zrsr2 has been classified as Green List (High Evidence).
Clefting disorders v0.246 ZRSR2 Zornitza Stark Classified gene: ZRSR2 as Green List (high evidence)
Clefting disorders v0.246 ZRSR2 Zornitza Stark Gene: zrsr2 has been classified as Green List (High Evidence).
Clefting disorders v0.245 ZRSR2 Chris Ciotta gene: ZRSR2 was added
gene: ZRSR2 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: ZRSR2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ZRSR2 were set to PMID: 38158857
Phenotypes for gene: ZRSR2 were set to Orofacialdigital syndrome MONDO:0015375, ZRSR2-related
Review for gene: ZRSR2 was set to GREEN
Added comment: Oral-facial-digital (OFD) syndrome with brain anomalies ranging from alobar holoprosencephaly to pituitary anomalies.
Six unrelated families with two truncating variants and functional studies:
- p.(Gly404GlufsTer23): detected in one family with 2x affected males
- p.(Arg403GlyfsTer24): 5 unrelated families, both de novo and inherited
Sources: Literature
Clefting disorders v0.245 ARCN1 Zornitza Stark Marked gene: ARCN1 as ready
Clefting disorders v0.245 ARCN1 Zornitza Stark Gene: arcn1 has been classified as Green List (High Evidence).
Clefting disorders v0.245 ARCN1 Zornitza Stark Publications for gene: ARCN1 were set to 27476655
Clefting disorders v0.244 ARCN1 Zornitza Stark Classified gene: ARCN1 as Green List (high evidence)
Clefting disorders v0.244 ARCN1 Zornitza Stark Gene: arcn1 has been classified as Green List (High Evidence).
Clefting disorders v0.243 SEC24D Zornitza Stark Marked gene: SEC24D as ready
Clefting disorders v0.243 SEC24D Zornitza Stark Gene: sec24d has been classified as Red List (Low Evidence).
Clefting disorders v0.243 SEC24D Zornitza Stark Classified gene: SEC24D as Red List (low evidence)
Clefting disorders v0.243 SEC24D Zornitza Stark Gene: sec24d has been classified as Red List (Low Evidence).
Clefting disorders v0.242 SEC24D Ee Ming Wong gene: SEC24D was added
gene: SEC24D was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: SEC24D was set to Unknown
Publications for gene: SEC24D were set to PMID:37676273
Phenotypes for gene: SEC24D were set to Cleft lip with or without cleft palate, MONDO:0016034, SEC24D-related
Review for gene: SEC24D was set to RED
gene: SEC24D was marked as current diagnostic
Added comment: - Subtype-specific genome-wide study to test for genetic modifiers of cleft lip VS cleft lip and palate
- SEC24D was genome-wide significant (p = 6.86 × 10-7), and having a burden of rare variants in cleft lip VS cleft lip and palate
Sources: Literature
Clefting disorders v0.242 PPP1R13L Zornitza Stark Phenotypes for gene: PPP1R13L were changed from Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042 - PPP1R13L-related; Dilated cardiomyopathy, onset in infancy; Cleft lip and palate to Arrhythmogenic cardiomyopathy with or without ectodermal abnormalities, MIM#620519
Clefting disorders v0.241 PPP1R13L Zornitza Stark edited their review of gene: PPP1R13L: Changed phenotypes: Arrhythmogenic cardiomyopathy with or without ectodermal abnormalities, MIM#620519
Clefting disorders v0.241 ARHGAP29 Zornitza Stark Phenotypes for gene: ARHGAP29 were changed from cleft lip with or without cleft palate; Cleft palate to Clefting disorder, MONDO:0000358, ARHGAP29-related
Clefting disorders v0.240 PLCB4 Zornitza Stark Phenotypes for gene: PLCB4 were changed from Auriculocondylar syndrome 2, MIM# 614669; Cleft palate to Auriculocondylar syndrome 2A, MIM# 614669; Auriculocondylar syndrome 2B, MIM# 620458; Cleft palate
Clefting disorders v0.239 PLCB4 Zornitza Stark edited their review of gene: PLCB4: Changed phenotypes: AAuriculocondylar syndrome 2A, MIM# 614669, Auriculocondylar syndrome 2B, MIM# 620458
Clefting disorders v0.239 INTS13 Zornitza Stark Marked gene: INTS13 as ready
Clefting disorders v0.239 INTS13 Zornitza Stark Gene: ints13 has been classified as Green List (High Evidence).
Clefting disorders v0.239 INTS13 Zornitza Stark Phenotypes for gene: INTS13 were changed from Oral-facial-digital syndrome to Oral-facial-digital syndrome, MONDO:0015375, INTS13-related
Clefting disorders v0.238 INTS13 chirag patel Classified gene: INTS13 as Green List (high evidence)
Clefting disorders v0.238 INTS13 chirag patel Gene: ints13 has been classified as Green List (High Evidence).
Clefting disorders v0.237 INTS13 chirag patel gene: INTS13 was added
gene: INTS13 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: INTS13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: INTS13 were set to PMID: 36229431
Phenotypes for gene: INTS13 were set to Oral-facial-digital syndrome
Review for gene: INTS13 was set to GREEN
gene: INTS13 was marked as current diagnostic
Added comment: 2 families with 4 affected individuals with Oral-facial-digital (OFD) phenotype. Homozygosity mapping and WES found 2 homozygous variants in INTS13 gene. This is a subunit of the Integrator complex, which associates with RNA Polymerase II and cleaves nascent RNA to modulate gene expression. Variants segregated with disease. Depletion of INTS13 disrupts ciliogenesis in human cultured cells and causes dysregulation of a broad collection of ciliary genes. Knockdown in Xenopus embryos leads to motile cilia anomalies.
Sources: Literature
Clefting disorders v0.236 UBE3B Zornitza Stark Marked gene: UBE3B as ready
Clefting disorders v0.236 UBE3B Zornitza Stark Gene: ube3b has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.236 UBE3B Zornitza Stark Classified gene: UBE3B as Amber List (moderate evidence)
Clefting disorders v0.236 UBE3B Zornitza Stark Gene: ube3b has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.235 UBE3B Zornitza Stark gene: UBE3B was added
gene: UBE3B was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: UBE3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBE3B were set to 23200864; 23687348; 37010288
Phenotypes for gene: UBE3B were set to Kaufman oculocerebrofacial syndrome, OMIM:244450
Review for gene: UBE3B was set to AMBER
Added comment: Although there are three unrelated cases associated with biallelic variants in UBE3B gene and reported with clefting, clefting has only been reported as a minor clinical indication.

PMID:23687348 - One of two patients reported with biallelic variants in UBE3B in this study and one of four patients reported in PMID:23200864 and reviewed here had submucous cleft palate.

DECIPHER database - One of three patients with homozygous sequence variants in UBE3B had median cleft palate.
Sources: Expert Review
Clefting disorders v0.234 SMARCB1 Zornitza Stark Marked gene: SMARCB1 as ready
Clefting disorders v0.234 SMARCB1 Zornitza Stark Gene: smarcb1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.234 SMARCB1 Zornitza Stark Classified gene: SMARCB1 as Amber List (moderate evidence)
Clefting disorders v0.234 SMARCB1 Zornitza Stark Gene: smarcb1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.233 SMARCB1 Zornitza Stark gene: SMARCB1 was added
gene: SMARCB1 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: SMARCB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCB1 were set to 25168959; 37010288
Phenotypes for gene: SMARCB1 were set to Coffin-Siris syndrome 3, OMIM:614608
Review for gene: SMARCB1 was set to AMBER
Added comment: Although there are 3 unrelated cases reported with cleft palate in total, these represent only a minor fraction of patients (from total of 23) reported with SMARCB1 variants.

PMID:25168959 - Two of ten patients reported with Coffin-Siris syndrome and heterozygous variants in SMARCB1 had cleft palate.

DECIPHER database - One of 13 patients identified with heterozygous sequence variants in SMARCB1 had cleft palate.
Sources: Expert Review
Clefting disorders v0.232 NOTCH2 Zornitza Stark Marked gene: NOTCH2 as ready
Clefting disorders v0.232 NOTCH2 Zornitza Stark Gene: notch2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.232 NOTCH2 Zornitza Stark Classified gene: NOTCH2 as Amber List (moderate evidence)
Clefting disorders v0.232 NOTCH2 Zornitza Stark Gene: notch2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.231 NOTCH2 Zornitza Stark gene: NOTCH2 was added
gene: NOTCH2 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: NOTCH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NOTCH2 were set to 9188663; 30329210; 37010288
Phenotypes for gene: NOTCH2 were set to Hajdu-Cheney syndrome, OMIM:102500
Review for gene: NOTCH2 was set to AMBER
Added comment: Although there are three cases reported with cleft lip/ palate or cleft of uvula, these are reported only in a minor proportion of patients.

PMID:9188663 - An 8.5-year-old boy with NOTCH2 variant and Hajdu-Cheney syndrome was reported with cleft lip and palate.

PMID:30329210 - A 32-year-old male patient with a de novo truncating variant in NOTCH2 and presenting with Hajdu-Cheney syndrome had high arched palate and cleft of uvula.

DECIPHER database - One of seven patients with heterozygous sequence variants in NOTCH2 was identified with submucous cleft hard palate.
Sources: Expert Review
Clefting disorders v0.230 AUTS2 Zornitza Stark Marked gene: AUTS2 as ready
Clefting disorders v0.230 AUTS2 Zornitza Stark Gene: auts2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.230 AUTS2 Zornitza Stark Classified gene: AUTS2 as Amber List (moderate evidence)
Clefting disorders v0.230 AUTS2 Zornitza Stark Gene: auts2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.229 AUTS2 Zornitza Stark gene: AUTS2 was added
gene: AUTS2 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: AUTS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AUTS2 were set to 31788251; 37010288
Phenotypes for gene: AUTS2 were set to Intellectual developmental disorder, autosomal dominant 26, MIM# 615834
Review for gene: AUTS2 was set to AMBER
Added comment: There are a total of five cases reported with cleft lip/ palate. However, clefting has only been reported in less than 10% of patients with monoalellic variants in AUTS2 from the DECIPHER database.

PMID:31788251 - A patient identified with a de novo heterozygous AUTS2 variant (c.1464_1467del ACTC/ p.Tyr488Ter) was reported with autism and cleft lip and palate.

DECIPHER database - Of 44 patients reported with heterozygous sequence variants, 4 patients had cleft lip or cleft palate (2 - cleft palate; 1 - cleft soft palate; 1 - unilateral cleft lip).
Sources: Expert Review
Clefting disorders v0.228 ARID1A Zornitza Stark Marked gene: ARID1A as ready
Clefting disorders v0.228 ARID1A Zornitza Stark Gene: arid1a has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.228 ARID1A Zornitza Stark Classified gene: ARID1A as Amber List (moderate evidence)
Clefting disorders v0.228 ARID1A Zornitza Stark Gene: arid1a has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.227 ARID1A Zornitza Stark gene: ARID1A was added
gene: ARID1A was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARID1A were set to 25168959; 37010288
Phenotypes for gene: ARID1A were set to Coffin-Siris syndrome 2 (MIM#614607)
Review for gene: ARID1A was set to AMBER
Added comment: Clefting is a minor feature on patients with monoallelic variants in ARID1A gene.

PMID:25168959 - Two of eight patients with heterozygous variants in ARID1A gene had cleft palate.

DECIPHER database - One of 26 patients with heterozygous sequence variants in ARID1A gene had cleft palate.
Sources: Expert Review
Clefting disorders v0.226 ZC4H2 Zornitza Stark Marked gene: ZC4H2 as ready
Clefting disorders v0.226 ZC4H2 Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence).
Clefting disorders v0.226 ZC4H2 Zornitza Stark Classified gene: ZC4H2 as Green List (high evidence)
Clefting disorders v0.226 ZC4H2 Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence).
Clefting disorders v0.225 ZC4H2 Zornitza Stark gene: ZC4H2 was added
gene: ZC4H2 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: ZC4H2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: ZC4H2 were set to 31206972; 37010288
Phenotypes for gene: ZC4H2 were set to Wieacker-Wolff syndrome, MIM# 314580
Review for gene: ZC4H2 was set to GREEN
Added comment: There are ten unrelated patients reported with cleft palate.

PMID:31206972 - Of 42 families identified with de novo and inherited variants in ZC4H2 gene, eight patients had cleft palate in addition to several other clinical presentations. These included one patient with cleft palate from the DDD study (DECIPHER database)

DECIPHER database - Of 13 patients with sequence variants, three patients had cleft palate.

Cleft palate has been recorded as one of the clinical presentations of female-restricted Wieacker-Wolff syndrome (MIM #301041) in OMIM.
Sources: Expert Review
Clefting disorders v0.224 STAG2 Zornitza Stark Marked gene: STAG2 as ready
Clefting disorders v0.224 STAG2 Zornitza Stark Gene: stag2 has been classified as Green List (High Evidence).
Clefting disorders v0.224 STAG2 Zornitza Stark Publications for gene: STAG2 were set to
Clefting disorders v0.223 STAG2 Zornitza Stark edited their review of gene: STAG2: Changed publications: 28296084, 29263825, 30158690, 31334757, 33014403, 37010288
Clefting disorders v0.223 STAG2 Zornitza Stark Classified gene: STAG2 as Green List (high evidence)
Clefting disorders v0.223 STAG2 Zornitza Stark Gene: stag2 has been classified as Green List (High Evidence).
Clefting disorders v0.222 STAG2 Zornitza Stark gene: STAG2 was added
gene: STAG2 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: STAG2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: STAG2 were set to Mullegama-Klein-Martinez syndrome, MIM#301022
Review for gene: STAG2 was set to GREEN
Added comment: There are eight unrelated cases identified with cleft lip/ palate and two cases were identified with cleft soft palate or submucous cleft soft palate.

PMID:33014403 - Two female patients identified with de novo variants in STAG2. One had cleft lip/ palate and other had cleft palate. In addition, five additional cases with cleft lip/ palate were also reported from literature review in this publication.

DECIPHER database - Of ten patients with sequence variants in STAG2 gene, one each was identified with cleft palate, cleft soft palate and submucous cleft soft palate (PMID:37010288).
Sources: Expert Review
Clefting disorders v0.221 SMARCA4 Zornitza Stark Marked gene: SMARCA4 as ready
Clefting disorders v0.221 SMARCA4 Zornitza Stark Gene: smarca4 has been classified as Green List (High Evidence).
Clefting disorders v0.221 SMARCA4 Zornitza Stark Classified gene: SMARCA4 as Green List (high evidence)
Clefting disorders v0.221 SMARCA4 Zornitza Stark Gene: smarca4 has been classified as Green List (High Evidence).
Clefting disorders v0.220 SMARCA4 Zornitza Stark gene: SMARCA4 was added
gene: SMARCA4 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: SMARCA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCA4 were set to 25168959; 37010288
Phenotypes for gene: SMARCA4 were set to Coffin-Siris syndrome 4, MIM# 614609
Review for gene: SMARCA4 was set to GREEN
Added comment: There are five unrelated cases with cleft plate and one case each with submucous cleft palate and bifid uvula.

PMID:25168959 - 4 of 12 patients with variants in SMARCA4 had cleft palate and another patient had submucous cleft palate.

DECIPHER database - One of 22 patients with heterozygous sequence variants had cleft palate and another patient had bifid uvula (PMID:37010288)
Sources: Expert Review
Clefting disorders v0.219 POGZ Zornitza Stark Marked gene: POGZ as ready
Clefting disorders v0.219 POGZ Zornitza Stark Gene: pogz has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.219 POGZ Zornitza Stark Classified gene: POGZ as Amber List (moderate evidence)
Clefting disorders v0.219 POGZ Zornitza Stark Gene: pogz has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.218 POGZ Zornitza Stark gene: POGZ was added
gene: POGZ was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: POGZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: POGZ were set to 26942287; 26739615
Phenotypes for gene: POGZ were set to White-Sutton syndrome, MIM# 616364
Review for gene: POGZ was set to AMBER
Added comment: Although there are more than three unrelated cases reported with either cleft palate or bifid uvula in total, this phenotype is not consistently present in patients with monoallelic variants in POGZ gene.

PMID:26739615 - Five unrelated individuals were identified with de novo truncating variants in POGZ gene, of which one individual had cleft palate and another one had bifid uvula.

PMID:31782611 - In this cohort of 22 individuals with 21 different loss of function variants in POGZ, two patients were reported with bifid uvula.

DECIPHER database - Of 42 patients with heterozygous sequence variants, one had cleft palate and another one had bifid uvula (PMID:37010288).
Sources: Expert Review
Clefting disorders v0.217 PGAP3 Zornitza Stark Marked gene: PGAP3 as ready
Clefting disorders v0.217 PGAP3 Zornitza Stark Gene: pgap3 has been classified as Green List (High Evidence).
Clefting disorders v0.217 PGAP3 Zornitza Stark Classified gene: PGAP3 as Green List (high evidence)
Clefting disorders v0.217 PGAP3 Zornitza Stark Gene: pgap3 has been classified as Green List (High Evidence).
Clefting disorders v0.216 PGAP3 Zornitza Stark gene: PGAP3 was added
gene: PGAP3 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: PGAP3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PGAP3 were set to 28390064; 37010288
Phenotypes for gene: PGAP3 were set to Hyperphosphatasia with impaired intellectual development syndrome 4, OMIM:615716
Review for gene: PGAP3 was set to GREEN
Added comment: PMID:28390064 - 10 individuals from eight families presented with developmental delay, severe intellectual disability, distinct facial dysmorphism and increased alkaline phosphatase. Nine individuals from seven families were homozygous for the same variant (c.402dupC/ p.M135Hfs*28), while one had a different homozygous variant ( c.817_820delGACT/ p.D273Sfs*37). Of nine individuals with p.M135Hfs*28 variant, eight from seven families (except one of the two patients from family 7) had cleft palate. But, the only patient with the different variant did not have cleft palate.

DECIPHER database - Of seven individuals reported with biallelic sequence variants, three with homozygous variants were reported with cleft palate and two with compound heterozygous variants were reported with cleft soft palate (PMID:37010288).
Sources: Expert Review
Clefting disorders v0.215 KMT2A Zornitza Stark Marked gene: KMT2A as ready
Clefting disorders v0.215 KMT2A Zornitza Stark Gene: kmt2a has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.215 KMT2A Zornitza Stark Classified gene: KMT2A as Amber List (moderate evidence)
Clefting disorders v0.215 KMT2A Zornitza Stark Gene: kmt2a has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.214 KMT2A Zornitza Stark gene: KMT2A was added
gene: KMT2A was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: KMT2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KMT2A were set to 25929198; 30305169; 31710778; 37010288
Phenotypes for gene: KMT2A were set to Wiedemann-Steiner syndrome, OMIM:605130
Review for gene: KMT2A was set to AMBER
Added comment: Although there are more than three cases reported with clefting, it is only present in a very small subsection of patients with KMT2A monoallelic variants.

PMID:25929198 - De novo KMT2A variant (p.Arg1083Ter) in monozygotic twins and they had submucosal cleft palate.

PMID:30305169 - Two of 14 patients with KMT2A variants and presenting with Wiedemann–Steiner syndrome had cleft palate.

PMID:31710778 - Both patients reported with KMT2A variants had only high arched palate and not cleft palate.

DECIPHER database - None of the reported patients had cleft lip/ palate and only one of 115 had bifid uvula (PMID:37010288)
Sources: Expert Review
Clefting disorders v0.213 KAT6B Zornitza Stark Marked gene: KAT6B as ready
Clefting disorders v0.213 KAT6B Zornitza Stark Gene: kat6b has been classified as Green List (High Evidence).
Clefting disorders v0.213 KAT6B Zornitza Stark Phenotypes for gene: KAT6B were changed from Genitopatellar syndrome, 606170; GTPTS to Genitopatellar syndrome, OMIM:606170; SBBYSS syndrome, OMIM:603736
Clefting disorders v0.212 KAT6B Zornitza Stark Publications for gene: KAT6B were set to 20182757; 27031267
Clefting disorders v0.211 KAT6B Zornitza Stark Mode of inheritance for gene: KAT6B was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.210 KAT6B Zornitza Stark Classified gene: KAT6B as Green List (high evidence)
Clefting disorders v0.210 KAT6B Zornitza Stark Gene: kat6b has been classified as Green List (High Evidence).
Clefting disorders v0.209 GLI2 Zornitza Stark Marked gene: GLI2 as ready
Clefting disorders v0.209 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Clefting disorders v0.209 GLI2 Zornitza Stark Classified gene: GLI2 as Green List (high evidence)
Clefting disorders v0.209 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Clefting disorders v0.208 GLI2 Zornitza Stark gene: GLI2 was added
gene: GLI2 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: GLI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GLI2 were set to 24744436; 37010288
Phenotypes for gene: GLI2 were set to Culler-Jones syndrome, OMIM:615849; Holoprosencephaly 9, OMIM:610829
Review for gene: GLI2 was set to GREEN
Added comment: Although clefting is a minor feature in patients reported with monoallelic GLI2 variants, it has been reported in more than 15 cases.

In ~400 screened individuals with HPE spectrum disorders, 112 individuals were identified with variants in GLI2 gene, of which 16 cases had cleft lip/ palate (PMID:24744436).

Three out of 17 patients reported with heterozygous GLI2 sequence variants in the DECIPHER database presented with cleft lip/ palate as one of the phenotypes (PMID:37010288).
Sources: Expert Review
Clefting disorders v0.207 FGFR3 Zornitza Stark Marked gene: FGFR3 as ready
Clefting disorders v0.207 FGFR3 Zornitza Stark Gene: fgfr3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.207 FGFR3 Zornitza Stark Classified gene: FGFR3 as Amber List (moderate evidence)
Clefting disorders v0.207 FGFR3 Zornitza Stark Gene: fgfr3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.206 FGFR3 Zornitza Stark gene: FGFR3 was added
gene: FGFR3 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: FGFR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FGFR3 were set to 22565872; 29150894; 37010288
Phenotypes for gene: FGFR3 were set to Muenke syndrome, OMIM:602849; Hypochondroplasia, OMIM:146000
Review for gene: FGFR3 was set to AMBER
Added comment: Although there are more than three unrelated cases reported with cleft lip and/or palate, this is not consistently found in individuals with monoallelic variants in FGFR3 gene.

PMID:22565872 included 21 individuals with variants in FGFR3 and presenting with Muenke syndrome in this study, of which 16 had structural anomaly of the palate. However, only one patient had cleft lip and palate.

PMID:29150894 reported a father and two children with FGFR3 variant and presenting with hypochondroplasia, of which only the daughter had cleft palate.

2 out of 15 individuals reported in DECIPHER database with monoallelic sequence variants had cleft palate.
Sources: Expert Review
Clefting disorders v0.205 CNTNAP1 Zornitza Stark Marked gene: CNTNAP1 as ready
Clefting disorders v0.205 CNTNAP1 Zornitza Stark Gene: cntnap1 has been classified as Green List (High Evidence).
Clefting disorders v0.205 CNTNAP1 Zornitza Stark Classified gene: CNTNAP1 as Green List (high evidence)
Clefting disorders v0.205 CNTNAP1 Zornitza Stark Gene: cntnap1 has been classified as Green List (High Evidence).
Clefting disorders v0.204 CNTNAP1 Zornitza Stark gene: CNTNAP1 was added
gene: CNTNAP1 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: CNTNAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CNTNAP1 were set to 28374019; 29511323; 29882456; 37010288
Phenotypes for gene: CNTNAP1 were set to Hypomyelinating neuropathy, congenital, 3, OMIM:618186
Review for gene: CNTNAP1 was set to GREEN
Added comment: There is sufficient evidence (3 unrelated cases) for the association of biallelic variants in this gene with cleft palate.

PMID:28374019 - Cleft palate was reported in two children from a large Israeli consanguineous family of Palestinian ancestry with a homozygous stop-gain variant in CNTNAP1(c.2015G>A/ p.Trp672Ter).

PMID:29511323/ 37010288 - There is one individual reported with compound heterozygous stop gain variants in CNTNAP1 (c.2687G​>A/ p.Trp896Ter & c.1861C​>T/ p.Arg621Ter) had cleft palate from DECIPHER database.

PMID:29882456 - An eight year old American male patient with a homozygous CNTNAP1 variant (c.1163G>C/ p.Arg388Pro) had cleft palate.
Sources: Expert Review
Clefting disorders v0.203 ARID1B Zornitza Stark Marked gene: ARID1B as ready
Clefting disorders v0.203 ARID1B Zornitza Stark Gene: arid1b has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.203 ARID1B Zornitza Stark Classified gene: ARID1B as Amber List (moderate evidence)
Clefting disorders v0.203 ARID1B Zornitza Stark Gene: arid1b has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.202 ARID1B Zornitza Stark gene: ARID1B was added
gene: ARID1B was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARID1B were set to 30349098; 37010288
Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome 1, OMIM:135900
Review for gene: ARID1B was set to AMBER
Added comment: Although there are more than three unrelated cases with ARID1B monoallelic variants reported with either cleft palate, cleft uvula or bifid uvula, clefting is not consistently present in individuals with ARID1B variants.

PMID:30349098 - On this web-based survey based on previously reported features of individuals with variants in ARID1B gene (143 in total), which also included submissions to DECIPHER database, two individuals were identified with cleft palate, one with cleft uvula, two with bifid uvula and three with sub mucous cleft. Although variants identified in these patients are reported in this publication, there is no association of individual patients to phenotypes available.

Of >100 patients with ARID1B variants in the DECIPHER database, only one patient (c.3183_3184​insT/ p.Tyr1062LeufsTer10) was reported with submucous cleft soft palate and two patients (c.4155_4156​insA/ p.Asn1386LysfsTer18 & c.2620+5G​>A) were reported with bifid uvula.
Sources: Expert Review
Clefting disorders v0.201 CHD4 Zornitza Stark Marked gene: CHD4 as ready
Clefting disorders v0.201 CHD4 Zornitza Stark Gene: chd4 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.201 CHD4 Zornitza Stark Classified gene: CHD4 as Amber List (moderate evidence)
Clefting disorders v0.201 CHD4 Zornitza Stark Gene: chd4 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.200 CHD4 Zornitza Stark gene: CHD4 was added
gene: CHD4 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: CHD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHD4 were set to 31388190; 37010288
Phenotypes for gene: CHD4 were set to Sifrim-Hitz-Weiss syndrome, MIM 617159
Review for gene: CHD4 was set to AMBER
Added comment: Although there are four unrelated cases presenting with either cleft palate and/or bifid uvula, this phenotype is not consistent among patients identified with monoallelic variants in CHD4 gene.

PMID:31388190 reported 32 patients with heterozygous variants in CHD4 gene, of which one individual (p.Gln715Ter) had cleft palate and Pierre Robin sequence. In addition, another individual identified with heterozygous variant p.Arg1127Gln was reported with bifid uvula.

In addition, 2 out of 10 individuals with pathogenic/ likely pathogenic heterozygous variants from the DDD study were reported with cleft palate in addition to several other clinical presentations including global developmental delay (PMID:37010288).
Sources: Expert Review
Clefting disorders v0.199 B4GALT7 Zornitza Stark Marked gene: B4GALT7 as ready
Clefting disorders v0.199 B4GALT7 Zornitza Stark Gene: b4galt7 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.199 B4GALT7 Zornitza Stark Phenotypes for gene: B4GALT7 were changed from EHLERS-DANLOS SYNDROME WITH SHORT STATURE AND LIMB ANOMALIES; EDSSLA to Ehlers-Danlos syndrome, spondylodysplastic type, 1, MIM# 130070
Clefting disorders v0.198 B4GALT7 Zornitza Stark reviewed gene: B4GALT7: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Ehlers-Danlos syndrome, spondylodysplastic type, 1, MIM# 130070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.198 RAB34 Elena Savva Marked gene: RAB34 as ready
Clefting disorders v0.198 RAB34 Elena Savva Gene: rab34 has been classified as Green List (High Evidence).
Clefting disorders v0.198 RAB34 Elena Savva Phenotypes for gene: RAB34 were changed from Clefting; corpus callosum; short bones; hypertelorism; polydactyly; cardiac defects; anorectal anomalies to Multiple congenital anomalies, (MONDO:0019042), RAB34-related
Clefting disorders v0.197 RAB34 Elena Savva Classified gene: RAB34 as Green List (high evidence)
Clefting disorders v0.197 RAB34 Elena Savva Gene: rab34 has been classified as Green List (High Evidence).
Clefting disorders v0.196 RAB34 Sarah Pantaleo gene: RAB34 was added
gene: RAB34 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: RAB34 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAB34 were set to PMID: 37384395
Phenotypes for gene: RAB34 were set to Clefting; corpus callosum; short bones; hypertelorism; polydactyly; cardiac defects; anorectal anomalies
Penetrance for gene: RAB34 were set to Complete
Review for gene: RAB34 was set to GREEN
Added comment: Oral-facial-digital syndromes (OFDS) are a group of clinically and genetically heterogenous disorders characterised by defects in the development of the face and oral cavity along with digit anomalies. Pathogenic variants in >20 genes encoding ciliary proteins have been found to cause OFDS.

Identified by WES biallelic missense variants in a novel disease-causing ciliary gene RAB34 in four individuals from three unrelated families (aided by GeneMatcher).

Affected individuals presented a novel form of OFDS accompanied by cardiac, cerebral, skeletal (eg. Shortening of long bones), and anorectal defects.

RAB34 encodes a member of the Lab GTPase superfamily and was recently identified as a key mediator of ciliary membrane formation. Protein products of pathogenic variants clustered near the RAB34 C-terminus exhibit a strong loss of function.

Onset is prenatal (multiple developmental defects including short femur, polydactyly, heart malformations, kidney malformations, brain malformations), resulting in medical termination for three probands.

In the fourth, the only one alive at birth, proband born at 39+5 weeks, normal growth parameters after pregnancy with polyhydramnios, corpus callosum agenesis and polydactyly. Respiratory distress at birth.

All four probands presented typical features of ciliopathy disorders, overlapping with oral, facial and digital abnormalities.

All with homozygous missense variants. All absent in gnomAD (in homozygous state). Sanger sequencing confirmed mode of inheritance.
Sources: Literature
Clefting disorders v0.196 KAT6B Achchuthan Shanmugasundram reviewed gene: KAT6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424177, 37010288; Phenotypes: Genitopatellar syndrome, OMIM:606170, SBBYSS syndrome, OMIM:603736; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.196 B4GALT7 Achchuthan Shanmugasundram Deleted their review
Clefting disorders v0.196 DDX3X Achchuthan Shanmugasundram Deleted their review
Clefting disorders v0.196 DDX3X Achchuthan Shanmugasundram reviewed gene: DDX3X: Rating: GREEN; Mode of pathogenicity: None; Publications: 26235985, 27159028, 37010288; Phenotypes: Intellectual developmental disorder, X-linked syndromic, Snijders Blok type, OMIM:300958; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Clefting disorders v0.196 B4GALT7 Achchuthan Shanmugasundram reviewed gene: B4GALT7: Rating: GREEN; Mode of pathogenicity: None; Publications: 24755949, 26940150, 31278392; Phenotypes: Ehlers-Danlos syndrome, spondylodysplastic type, 1, OMIM:130070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.196 POLR1A Elena Savva Marked gene: POLR1A as ready
Clefting disorders v0.196 POLR1A Elena Savva Gene: polr1a has been classified as Green List (High Evidence).
Clefting disorders v0.196 POLR1A Elena Savva Phenotypes for gene: POLR1A were changed from cleft palte to Acrofacial dysostosis, Cincinnati type MIM#616462
Clefting disorders v0.195 POLR1A Elena Savva Classified gene: POLR1A as Green List (high evidence)
Clefting disorders v0.195 POLR1A Elena Savva Gene: polr1a has been classified as Green List (High Evidence).
Clefting disorders v0.194 POLR1A Elena Savva reviewed gene: POLR1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37075751; Phenotypes: Acrofacial dysostosis, Cincinnati type MIM#616462; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Clefting disorders v0.194 AMOTL1 Seb Lunke Publications for gene: AMOTL1 were set to 33026150; 33026150
Clefting disorders v0.193 AMOTL1 Seb Lunke Publications for gene: AMOTL1 were set to 33026150
Clefting disorders v0.192 AMOTL1 Seb Lunke Phenotypes for gene: AMOTL1 were changed from Cleft lip and palate; imperforate anus; dysmorphism to Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related
Clefting disorders v0.191 AMOTL1 Seb Lunke Classified gene: AMOTL1 as Green List (high evidence)
Clefting disorders v0.191 AMOTL1 Seb Lunke Gene: amotl1 has been classified as Green List (High Evidence).
Clefting disorders v0.190 AMOTL1 Lucy Spencer reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33026150; Phenotypes: Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.190 ARCN1 Zornitza Stark reviewed gene: ARCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35300924; Phenotypes: Short stature-micrognathia syndrome, MIM# 617164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.190 COBLL1 Zornitza Stark Marked gene: COBLL1 as ready
Clefting disorders v0.190 COBLL1 Zornitza Stark Gene: cobll1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.190 COBLL1 Zornitza Stark Classified gene: COBLL1 as Amber List (moderate evidence)
Clefting disorders v0.190 COBLL1 Zornitza Stark Gene: cobll1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.189 COBLL1 Paul De Fazio changed review comment from: PMID:36493769 identified the same multi-exon intragenic deletion by high-res microarray in 3 individuals with non-syndromic cleft lip/palate. The deletion is absent from gnomAD. Inheritance information was only available for 1 individual, in whom it was inherited from an unaffected father.
Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos.
Sources: Literature; to: PMID:36493769 identified the same multi-exon intragenic deletion by high-res microarray in 3 individuals with non-syndromic cleft lip/palate. The deletion is absent from gnomAD. Inheritance information was only available for 1 individual, in whom it was inherited from an unaffected father. Note that the gene is not quite LOF constrained in gnomAD.

Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos.
Sources: Literature
Clefting disorders v0.189 COBLL1 Paul De Fazio gene: COBLL1 was added
gene: COBLL1 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: COBLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: COBLL1 were set to 36493769
Phenotypes for gene: COBLL1 were set to Cleft lip/palate MONDO:0016044, COBLL1-related
Review for gene: COBLL1 was set to AMBER
gene: COBLL1 was marked as current diagnostic
Added comment: PMID:36493769 identified the same multi-exon intragenic deletion by high-res microarray in 3 individuals with non-syndromic cleft lip/palate. The deletion is absent from gnomAD. Inheritance information was only available for 1 individual, in whom it was inherited from an unaffected father.
Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos.
Sources: Literature
Clefting disorders v0.189 RIC1 Zornitza Stark Marked gene: RIC1 as ready
Clefting disorders v0.189 RIC1 Zornitza Stark Gene: ric1 has been classified as Green List (High Evidence).
Clefting disorders v0.189 RIC1 Zornitza Stark Classified gene: RIC1 as Green List (high evidence)
Clefting disorders v0.189 RIC1 Zornitza Stark Gene: ric1 has been classified as Green List (High Evidence).
Clefting disorders v0.188 RIC1 Paul De Fazio gene: RIC1 was added
gene: RIC1 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: RIC1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RIC1 were set to 36493769
Phenotypes for gene: RIC1 were set to Cleft lip/palate MONDO:0016044, RIC1-related
Review for gene: RIC1 was set to GREEN
gene: RIC1 was marked as current diagnostic
Added comment: PMID:36493769 identified an intragenic deletion by high-res microarray of exons 1-2 in 3 individuals with non-syndromic cleft lip/palate. This deleton is not present in gnomAD. Inheritance information was available in 2 individuals; one was de novo, the other inherited from an affected mother. Note that the gene is not LOF constrained in gnomAD.

Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos.
Sources: Literature
Clefting disorders v0.188 ARHGEF38 Zornitza Stark Marked gene: ARHGEF38 as ready
Clefting disorders v0.188 ARHGEF38 Zornitza Stark Gene: arhgef38 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.188 ARHGEF38 Zornitza Stark Classified gene: ARHGEF38 as Amber List (moderate evidence)
Clefting disorders v0.188 ARHGEF38 Zornitza Stark Gene: arhgef38 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.187 ARHGEF38 Paul De Fazio gene: ARHGEF38 was added
gene: ARHGEF38 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: ARHGEF38 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARHGEF38 were set to 36493769
Phenotypes for gene: ARHGEF38 were set to Cleft lip/palate MONDO:0016044, ARHGEF38-related
Review for gene: ARHGEF38 was set to AMBER
gene: ARHGEF38 was marked as current diagnostic
Added comment: PMID:36493769 identified an intragenic deletion by high-res microarray of the same exon (exon 3) in 4 individuals with non-syndromic cleft lip/palate. Deletion of exon 3 is present in 6 individuals in gnomAD. Inheritance information was not available.

Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos.
Sources: Literature
Clefting disorders v0.187 MYCN Achchuthan Shanmugasundram changed review comment from: Comment on classification of this gene: This gene has been added with a RED rating to this panel, as identified from one case and supported by functional studies with mouse model.

Out of the 104 multiplex families with Mendelian non-syndromic cleft lip with or without cleft palate (NSCL/P), a novel pathogenic variant (c.703G>C/ p.A235P) has been identified in MYCN gene from one family. This variant was found in the proband and his affected mother and absent in the unaffected sister, showing co0-segregation with phenotype in this family.

In addition, experimental evidence from conditional knockout mouse model showed that these mice displayed cleft palate, microglossia and micrognathia, resembling the Pierre Robin sequence (PRS) in humans.

This gene has not yet been associated with clefting either in OMIM or in Gene2Phenotype.
Sources: Literature; to: Comment on classification of this gene: This gene has been added with a RED rating to this panel, as identified from one case and supported by functional studies from mouse model.

Out of the 104 multiplex families with Mendelian non-syndromic cleft lip with or without cleft palate (NSCL/P), a novel pathogenic variant (c.703G>C/ p.A235P) has been identified in MYCN gene from one family. This variant was found in the proband and his affected mother and absent in the unaffected sister, showing co0-segregation with phenotype in this family.

In addition, experimental evidence from conditional knockout mouse model showed that these mice displayed cleft palate, microglossia and micrognathia, resembling the Pierre Robin sequence (PRS) in humans.

This gene has not yet been associated with clefting either in OMIM or in Gene2Phenotype.
Sources: Literature
Clefting disorders v0.187 MYCN Zornitza Stark Marked gene: MYCN as ready
Clefting disorders v0.187 MYCN Zornitza Stark Gene: mycn has been classified as Red List (Low Evidence).
Clefting disorders v0.187 MYCN Zornitza Stark Classified gene: MYCN as Red List (low evidence)
Clefting disorders v0.187 MYCN Zornitza Stark Gene: mycn has been classified as Red List (Low Evidence).
Clefting disorders v0.186 AFDN Zornitza Stark Marked gene: AFDN as ready
Clefting disorders v0.186 AFDN Zornitza Stark Gene: afdn has been classified as Red List (Low Evidence).
Clefting disorders v0.186 AFDN Zornitza Stark gene: AFDN was added
gene: AFDN was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: AFDN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AFDN were set to 36384317
Phenotypes for gene: AFDN were set to Cleft lip/palate, MONDO:0016044, AFDN-related
Review for gene: AFDN was set to RED
Added comment: Over-representation of rare AFDN missense variants reported in a cohort of CL/P individuals of African and Brazilian origin. However, almost all of the variants reported have hets in gnomad. The one that is novel has alternative missense at the same aa position.
Sources: Literature
Clefting disorders v0.185 MYCN Achchuthan Shanmugasundram gene: MYCN was added
gene: MYCN was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MYCN were set to 34590686
Phenotypes for gene: MYCN were set to cleft lip with or without cleft palate, MONDO:0016034
Review for gene: MYCN was set to RED
Added comment: Comment on classification of this gene: This gene has been added with a RED rating to this panel, as identified from one case and supported by functional studies with mouse model.

Out of the 104 multiplex families with Mendelian non-syndromic cleft lip with or without cleft palate (NSCL/P), a novel pathogenic variant (c.703G>C/ p.A235P) has been identified in MYCN gene from one family. This variant was found in the proband and his affected mother and absent in the unaffected sister, showing co0-segregation with phenotype in this family.

In addition, experimental evidence from conditional knockout mouse model showed that these mice displayed cleft palate, microglossia and micrognathia, resembling the Pierre Robin sequence (PRS) in humans.

This gene has not yet been associated with clefting either in OMIM or in Gene2Phenotype.
Sources: Literature
Clefting disorders v0.185 Zornitza Stark List of related panels changed from to Oral cleft HP:0000202
Clefting disorders v0.184 COL9A3 Zornitza Stark Phenotypes for gene: COL9A3 were changed from Stickler syndrome; Cleft palate to Stickler syndrome, type VI, MIM# 620022
Clefting disorders v0.183 COL9A3 Zornitza Stark edited their review of gene: COL9A3: Changed phenotypes: Stickler syndrome, type VI, MIM# 620022
Clefting disorders v0.183 PPP1R13L Zornitza Stark Phenotypes for gene: PPP1R13L were changed from Dilated cardiomyopathy, onset in infancy; Cleft lip and palate to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042 - PPP1R13L-related; Dilated cardiomyopathy, onset in infancy; Cleft lip and palate
Clefting disorders v0.182 PPP1R13L Krithika Murali reviewed gene: PPP1R13L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042 - PPP1R13L-related disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.182 RYR1 Zornitza Stark Marked gene: RYR1 as ready
Clefting disorders v0.182 RYR1 Zornitza Stark Gene: ryr1 has been classified as Red List (Low Evidence).
Clefting disorders v0.182 RYR1 Zornitza Stark Phenotypes for gene: RYR1 were changed from CCD; CENTRAL CORE DISEASE OF MUSCLE to RYR1-related myopathy - MONDO:0100150
Clefting disorders v0.181 RYR1 Zornitza Stark Classified gene: RYR1 as Red List (low evidence)
Clefting disorders v0.181 RYR1 Zornitza Stark Gene: ryr1 has been classified as Red List (Low Evidence).
Clefting disorders v0.180 RYR1 Krithika Murali reviewed gene: RYR1: Rating: RED; Mode of pathogenicity: None; Publications: 23553484; Phenotypes: RYR1-related myopathy - MONDO:0100150; Mode of inheritance: None
Clefting disorders v0.180 PLCH1 Zornitza Stark Phenotypes for gene: PLCH1 were changed from Holoprosencephaly spectrum; Severe developmental delay; Brain malformations to Holoprosencephaly 14, MIM# 619895
Clefting disorders v0.179 PLCH1 Zornitza Stark edited their review of gene: PLCH1: Changed phenotypes: Holoprosencephaly 14, MIM# 619895
Clefting disorders v0.179 SMS Zornitza Stark Marked gene: SMS as ready
Clefting disorders v0.179 SMS Zornitza Stark Gene: sms has been classified as Green List (High Evidence).
Clefting disorders v0.179 SMS Zornitza Stark Phenotypes for gene: SMS were changed from MRXSSR; MENTAL RETARDATION, X-LINKED, SYNDROMIC, SNYDER-ROBINSON TYPE to Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583; Syndromic X-linked intellectual disability Snyder type, MONDO:0010664
Clefting disorders v0.178 SMS Zornitza Stark Publications for gene: SMS were set to
Clefting disorders v0.177 SMS Zornitza Stark reviewed gene: SMS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30237987, 34177437, 32838743, 23805436; Phenotypes: Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583, Syndromic X-linked intellectual disability Snyder type, MONDO:0010664; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Clefting disorders v0.177 EFNB1 Bryony Thompson Added comment: Comment on mode of inheritance: X-LINKED: heterozygous females demonstrate more severe disease than hemizygous males
Clefting disorders v0.177 EFNB1 Bryony Thompson Mode of inheritance for gene: EFNB1 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to Other
Clefting disorders v0.176 SF3B2 Zornitza Stark Phenotypes for gene: SF3B2 were changed from Craniofacial microsomia to Craniofacial microsomia, MIM#164210
Clefting disorders v0.175 ZBTB24 Zornitza Stark Marked gene: ZBTB24 as ready
Clefting disorders v0.175 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Red List (Low Evidence).
Clefting disorders v0.175 ZBTB24 Zornitza Stark Phenotypes for gene: ZBTB24 were changed from IMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 2; ICF2 to Immunodeficiency-centromeric instability-facial anomalies syndrome 2 - MIM#614069
Clefting disorders v0.174 ZBTB24 Zornitza Stark Publications for gene: ZBTB24 were set to 23486536
Clefting disorders v0.173 ZBTB24 Zornitza Stark Classified gene: ZBTB24 as Red List (low evidence)
Clefting disorders v0.173 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Red List (Low Evidence).
Clefting disorders v0.172 ZBTB24 Krithika Murali reviewed gene: ZBTB24: Rating: RED; Mode of pathogenicity: None; Publications: 32865561, 21596365, 29023266, 32061411, 21906047, 28128455, 23739126, 22786748; Phenotypes: Immunodeficiency-centromeric instability-facial anomalies syndrome 2 - MIM#614069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.172 HYAL2 Zornitza Stark Publications for gene: HYAL2 were set to 28081210; 23172227; 26515055
Clefting disorders v0.171 HYAL2 Zornitza Stark Classified gene: HYAL2 as Green List (high evidence)
Clefting disorders v0.171 HYAL2 Zornitza Stark Gene: hyal2 has been classified as Green List (High Evidence).
Clefting disorders v0.170 HYAL2 Krithika Murali reviewed gene: HYAL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34906488, 28081210, 23172227, 26515055; Phenotypes: Cleft lip and palate, cor triatriatum, congenital cardiac malformations; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.170 ANKRD17 Krithika Murali reviewed gene: ANKRD17: Rating: AMBER; Mode of pathogenicity: None; Publications: 33909992; Phenotypes: Chopra-Amiel-Gordon syndrome - MIM#619504; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.170 NECTIN1 Zornitza Stark Marked gene: NECTIN1 as ready
Clefting disorders v0.170 NECTIN1 Zornitza Stark Gene: nectin1 has been classified as Green List (High Evidence).
Clefting disorders v0.170 NECTIN1 Zornitza Stark Phenotypes for gene: NECTIN1 were changed from Cleft Lip with or without Cleft Palate; CLP, partial syndactyly of digits, intellectual disability, dysmorphism; Orofacial cleft 7, 225060; Cleft lip/Palate ectodermal dysplasia syndrome, 225060; Ectodermal dysplasia, Margarita Island type; Cleft lip; Zlotogora-Ogur syndrome to Cleft lip/palate-ectodermal dysplasia syndrome MIM#225060; Zlotogora-Ogur syndrome
Clefting disorders v0.169 NECTIN1 Zornitza Stark Publications for gene: NECTIN1 were set to 10932188; 26953873; 11559849
Clefting disorders v0.168 NECTIN1 Ain Roesley reviewed gene: NECTIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25913853, 10932188; Phenotypes: Cleft lip/palate-ectodermal dysplasia syndrome MIM#225060, Zlotogora-Ogur syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Clefting disorders v0.168 YAP1 Zornitza Stark Marked gene: YAP1 as ready
Clefting disorders v0.168 YAP1 Zornitza Stark Gene: yap1 has been classified as Green List (High Evidence).
Clefting disorders v0.168 YAP1 Zornitza Stark Phenotypes for gene: YAP1 were changed from COB1; COLOBOMA, OCULAR, WITH OR WITHOUT HEARING IMPAIRMENT, CLEFT LIP/PALATE, AND/OR MENTAL RETARDATION to Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation, MIM#120433
Clefting disorders v0.167 YAP1 Zornitza Stark Publications for gene: YAP1 were set to 24462371
Clefting disorders v0.166 YAP1 Zornitza Stark Classified gene: YAP1 as Green List (high evidence)
Clefting disorders v0.166 YAP1 Zornitza Stark Gene: yap1 has been classified as Green List (High Evidence).
Clefting disorders v0.165 YAP1 Zornitza Stark reviewed gene: YAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24462371, 27267789, 28801591; Phenotypes: Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation, MIM#120433; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.165 SIX5 Zornitza Stark Marked gene: SIX5 as ready
Clefting disorders v0.165 SIX5 Zornitza Stark Gene: six5 has been classified as Red List (Low Evidence).
Clefting disorders v0.165 SIX5 Zornitza Stark Phenotypes for gene: SIX5 were changed from BOR2; BRANCHIOOTORENAL SYNDROME 2 to Branchiootorenal syndrome 2, MIM# 610896
Clefting disorders v0.164 SIX5 Zornitza Stark Publications for gene: SIX5 were set to
Clefting disorders v0.163 SIX5 Zornitza Stark Mode of inheritance for gene: SIX5 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.162 SIX5 Zornitza Stark Classified gene: SIX5 as Red List (low evidence)
Clefting disorders v0.162 SIX5 Zornitza Stark Gene: six5 has been classified as Red List (Low Evidence).
Clefting disorders v0.161 SIX5 Zornitza Stark reviewed gene: SIX5: Rating: RED; Mode of pathogenicity: None; Publications: 17357085, 33624842, 20301554, 24730701, 22447252, 21280147, 14704431, 11950062, 10802667, 10802668; Phenotypes: Branchiootorenal syndrome 2, MIM# 610896; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.161 MED12 Zornitza Stark Phenotypes for gene: MED12 were changed from Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate; Hardikar syndrome, OMIM #612726 to Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate; Hardikar syndrome, MIM# 301068
Clefting disorders v0.160 MED12 Zornitza Stark reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hardikar syndrome, MIM# 301068; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Clefting disorders v0.160 EIF4A3 Zornitza Stark Tag STR tag was added to gene: EIF4A3.
Clefting disorders v0.160 GNB1 Zornitza Stark Marked gene: GNB1 as ready
Clefting disorders v0.160 GNB1 Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence).
Clefting disorders v0.160 GNB1 Zornitza Stark Phenotypes for gene: GNB1 were changed from Mental retardation, autosomal dominant 42, 616973 to Intellectual developmental disorder, autosomal dominant 42, MIM# 616973
Clefting disorders v0.159 GNB1 Zornitza Stark Publications for gene: GNB1 were set to 27108799
Clefting disorders v0.158 GNB1 Zornitza Stark Mode of inheritance for gene: GNB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.157 GNB1 Zornitza Stark Classified gene: GNB1 as Green List (high evidence)
Clefting disorders v0.157 GNB1 Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence).
Clefting disorders v0.156 GNB1 Zornitza Stark reviewed gene: GNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32134617; Phenotypes: Intellectual developmental disorder, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.156 SCUBE3 Zornitza Stark Marked gene: SCUBE3 as ready
Clefting disorders v0.156 SCUBE3 Zornitza Stark Gene: scube3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.156 SCUBE3 Zornitza Stark Classified gene: SCUBE3 as Amber List (moderate evidence)
Clefting disorders v0.156 SCUBE3 Zornitza Stark Gene: scube3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.155 SCUBE3 Zornitza Stark gene: SCUBE3 was added
gene: SCUBE3 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: SCUBE3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCUBE3 were set to 33308444
Phenotypes for gene: SCUBE3 were set to Short stature, facial dysmorphism, and skeletal anomalies with or without cardiac anomalies, MIM# 619184
Review for gene: SCUBE3 was set to AMBER
Added comment: Eighteen affected individuals from nine unrelated families reported with a consistent phenotype characterised by reduced growth, skeletal features, distinctive craniofacial appearance, and dental anomalies. Mouse model recapitulated phenotype.

Clefting reported in 3 individuals.
Sources: Expert Review
Clefting disorders v0.154 GRHL3 Zornitza Stark Marked gene: GRHL3 as ready
Clefting disorders v0.154 GRHL3 Zornitza Stark Gene: grhl3 has been classified as Green List (High Evidence).
Clefting disorders v0.154 GRHL3 Zornitza Stark Phenotypes for gene: GRHL3 were changed from Cleft lip; VAN DER WOUDE SYNDROME 2 to Van der Woude syndrome 2 MIM#606713
Clefting disorders v0.153 GRHL3 Zornitza Stark Publications for gene: GRHL3 were set to
Clefting disorders v0.152 GRHL3 Zornitza Stark Mode of inheritance for gene: GRHL3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.151 GRHL3 Zornitza Stark reviewed gene: GRHL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360809, 29500247; Phenotypes: Van der Woude syndrome 2 MIM#606713; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.151 CTCF Zornitza Stark Marked gene: CTCF as ready
Clefting disorders v0.151 CTCF Zornitza Stark Gene: ctcf has been classified as Green List (High Evidence).
Clefting disorders v0.151 CTCF Zornitza Stark Phenotypes for gene: CTCF were changed from MENTAL RETARDATION, AUTOSOMAL DOMINANT 21; MRD21 to Mental retardation, autosomal dominant 21 (MIM#615502)
Clefting disorders v0.150 CTCF Zornitza Stark Publications for gene: CTCF were set to
Clefting disorders v0.149 CTCF Zornitza Stark Mode of inheritance for gene: CTCF was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.148 CTCF Zornitza Stark reviewed gene: CTCF: Rating: GREEN; Mode of pathogenicity: None; Publications: 23746550, 31239556; Phenotypes: Mental retardation, autosomal dominant 21 (MIM#615502); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.148 CDH1 Zornitza Stark Marked gene: CDH1 as ready
Clefting disorders v0.148 CDH1 Zornitza Stark Gene: cdh1 has been classified as Green List (High Evidence).
Clefting disorders v0.148 CDH1 Zornitza Stark Phenotypes for gene: CDH1 were changed from Blepharocheilodontic syndrome 1; BLEPHAROCHEILODONTIC to Blepharocheilodontic syndrome 1, MIM# 119580
Clefting disorders v0.147 CDH1 Zornitza Stark Publications for gene: CDH1 were set to 27566442; 28301459
Clefting disorders v0.146 CDH1 Zornitza Stark Mode of inheritance for gene: CDH1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.145 CDH1 Zornitza Stark reviewed gene: CDH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28301459; Phenotypes: Blepharocheilodontic syndrome 1, MIM# 119580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.145 HNRNPK Zornitza Stark Marked gene: HNRNPK as ready
Clefting disorders v0.145 HNRNPK Zornitza Stark Gene: hnrnpk has been classified as Green List (High Evidence).
Clefting disorders v0.145 HNRNPK Zornitza Stark Classified gene: HNRNPK as Green List (high evidence)
Clefting disorders v0.145 HNRNPK Zornitza Stark Gene: hnrnpk has been classified as Green List (High Evidence).
Clefting disorders v0.144 HNRNPK Ain Roesley gene: HNRNPK was added
gene: HNRNPK was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: HNRNPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HNRNPK were set to Au-Kline syndrome MIM#616580
Penetrance for gene: HNRNPK were set to Complete
Review for gene: HNRNPK was set to GREEN
gene: HNRNPK was marked as current diagnostic
Added comment: Caused by de novo variants.

Review of >20 individuals in GeneReviews:
- Brain anomalies have been identified in several individuals. The most common abnormalities were heterotopia and thinning of the corpus callosum.
- Congenital heart disease is present in approximately 75% of individuals with AKS
- Hydronephrosis is present in up to 75% of individuals
- Craniosynostosis is present in approximately 1/3 of individuals with AKS.
- More than half of individuals with AKS have scoliosis and congenital hip dysplasia
- Palate abnormalities, which include cleft palate, high-arched or narrow palate, and bifid uvula, are common.
Sources: Literature
Clefting disorders v0.144 GDF11 Zornitza Stark Publications for gene: GDF11 were set to PubMed: 31215115
Clefting disorders v0.143 GDF11 chirag patel Classified gene: GDF11 as Green List (high evidence)
Clefting disorders v0.143 GDF11 chirag patel Gene: gdf11 has been classified as Green List (High Evidence).
Clefting disorders v0.142 GDF11 chirag patel edited their review of gene: GDF11: Added comment: Ravenscroft et al. (2021) report 6 probands who presented with craniofacial (5/6), vertebral (5/6), neurological (6/6), visual (4/6), cardiac (3/6), auditory (3/6), and connective tissue abnormalities (3/6). They found de novo and inherited variants in GDF11. gdf11 mutant zebrafish showed craniofacial abnormalities and body segmentation defects that matched some patient phenotypes. Expression of the patients’ variants in the fly showed that one nonsense variant in GDF11 is a severe loss-of-function (LOF) allele whereas the missense variants are partial LOF variants.; Changed rating: GREEN; Changed publications: PubMed: 31215115, 34113007; Changed phenotypes: Vertebral hypersegmentation and orofacial anomalies (VHO), OMIM #619122
Clefting disorders v0.142 EIF3F Zornitza Stark Marked gene: EIF3F as ready
Clefting disorders v0.142 EIF3F Zornitza Stark Gene: eif3f has been classified as Green List (High Evidence).
Clefting disorders v0.142 EIF3F Zornitza Stark Phenotypes for gene: EIF3F were changed from EIF3F-related neurodevelopmental disorder to EIF3F-related neurodevelopmental disorder; Mental retardation, autosomal recessive 67, MIM# 618295
Clefting disorders v0.141 EIF3F chirag patel Classified gene: EIF3F as Green List (high evidence)
Clefting disorders v0.141 EIF3F chirag patel Gene: eif3f has been classified as Green List (High Evidence).
Clefting disorders v0.140 EIF3F chirag patel gene: EIF3F was added
gene: EIF3F was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: EIF3F was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3F were set to PMID: 33736665
Phenotypes for gene: EIF3F were set to EIF3F-related neurodevelopmental disorder
Review for gene: EIF3F was set to GREEN
Added comment: Hüffmeier et al (2021) reported 21 patients who were homozygous/compound heterozygous for Phe232Val variant in EIF3F. All affected individuals had developmental delay and speech delay. About half had behavioural problems, altered muscular tone, hearing loss, and short stature. The study suggests that microcephaly, reduced sensitivity to pain, cleft lip/palate, gastrointestinal symptoms and ophthalmological symptoms are part of the phenotypic spectrum.
Sources: Literature
Clefting disorders v0.139 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Clefting disorders v0.138 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Clefting disorders v0.138 RBM10 Zornitza Stark Marked gene: RBM10 as ready
Clefting disorders v0.138 RBM10 Zornitza Stark Gene: rbm10 has been classified as Green List (High Evidence).
Clefting disorders v0.138 RBM10 Zornitza Stark Phenotypes for gene: RBM10 were changed from TARPS; Cleft palate; TARP SYNDROME to TARP syndrome, MIM# 311900
Clefting disorders v0.137 RBM10 Zornitza Stark Publications for gene: RBM10 were set to 20451169
Clefting disorders v0.136 RBM10 Zornitza Stark reviewed gene: RBM10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20451169, 24259342, 30450804, 30189253, 33340101; Phenotypes: TARP syndrome, MIM# 311900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Clefting disorders v0.136 SF3B2 Zornitza Stark Marked gene: SF3B2 as ready
Clefting disorders v0.136 SF3B2 Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence).
Clefting disorders v0.136 SF3B2 Zornitza Stark Classified gene: SF3B2 as Green List (high evidence)
Clefting disorders v0.136 SF3B2 Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence).
Clefting disorders v0.135 SF3B2 Zornitza Stark gene: SF3B2 was added
gene: SF3B2 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: SF3B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SF3B2 were set to 34344887
Phenotypes for gene: SF3B2 were set to Craniofacial microsomia
Review for gene: SF3B2 was set to GREEN
Added comment: Twenty individuals from seven families reported with de novo or transmitted haploinsufficient variants in SF3B2. Affected individuals had mandibular hypoplasia, microtia, facial and preauricular tags, epibulbar dermoids, lateral oral clefts in addition to skeletal and cardiac abnormalities.

Targeted morpholino knockdown of SF3B2 in Xenopus resulted in disruption of cranial neural crest precursor formation and subsequent craniofacial cartilage defects, supporting a link between spliceosome mutations and impaired neural crest development in congenital craniofacial disease.

The families were ascertained from a cohort and the authors suggest that haploinsufficient variants in SF3B2 are the most prevalent genetic cause of CFM, explaining ~3% of sporadic and ~25% of familial cases.
Sources: Literature
Clefting disorders v0.134 EIF4A3 Zornitza Stark Marked gene: EIF4A3 as ready
Clefting disorders v0.134 EIF4A3 Zornitza Stark Gene: eif4a3 has been classified as Green List (High Evidence).
Clefting disorders v0.134 EIF4A3 Zornitza Stark Publications for gene: EIF4A3 were set to 10594883; 29112243; 29922329
Clefting disorders v0.133 EIF4A3 Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.133 RIPK4 Zornitza Stark Marked gene: RIPK4 as ready
Clefting disorders v0.133 RIPK4 Zornitza Stark Gene: ripk4 has been classified as Green List (High Evidence).
Clefting disorders v0.133 RIPK4 chirag patel Classified gene: RIPK4 as Green List (high evidence)
Clefting disorders v0.133 RIPK4 chirag patel Gene: ripk4 has been classified as Green List (High Evidence).
Clefting disorders v0.132 RIPK4 chirag patel Classified gene: RIPK4 as Green List (high evidence)
Clefting disorders v0.132 RIPK4 chirag patel Gene: ripk4 has been classified as Green List (High Evidence).
Clefting disorders v0.131 RIPK4 chirag patel gene: RIPK4 was added
gene: RIPK4 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: RIPK4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RIPK4 were set to PMID: 28940926; 22197489; 22197488
Phenotypes for gene: RIPK4 were set to Popliteal pterygium syndrome, Bartsocas-Papas type 1, MIM# 263650
Review for gene: RIPK4 was set to GREEN
gene: RIPK4 was marked as current diagnostic
Added comment: Clefting well associated with this syndrome
Sources: Literature
Clefting disorders v0.130 IGF2 Zornitza Stark Marked gene: IGF2 as ready
Clefting disorders v0.130 IGF2 Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence).
Clefting disorders v0.130 IGF2 Zornitza Stark Classified gene: IGF2 as Green List (high evidence)
Clefting disorders v0.130 IGF2 Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence).
Clefting disorders v0.129 IGF2 Elena Savva gene: IGF2 was added
gene: IGF2 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: IGF2 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Publications for gene: IGF2 were set to PMID: 31544945
Phenotypes for gene: IGF2 were set to Silver-Russell syndrome 3 MIM#616489
Review for gene: IGF2 was set to GREEN
Added comment: PMID: 31544945 - cleft palate reported in 6/14 patients with SRS
Sources: Literature
Clefting disorders v0.129 PPP1R13L Zornitza Stark Marked gene: PPP1R13L as ready
Clefting disorders v0.129 PPP1R13L Zornitza Stark Gene: ppp1r13l has been classified as Green List (High Evidence).
Clefting disorders v0.129 PPP1R13L Zornitza Stark Classified gene: PPP1R13L as Green List (high evidence)
Clefting disorders v0.129 PPP1R13L Zornitza Stark Gene: ppp1r13l has been classified as Green List (High Evidence).
Clefting disorders v0.128 PPP1R13L Zornitza Stark gene: PPP1R13L was added
gene: PPP1R13L was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: PPP1R13L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPP1R13L were set to 32666529; 28864777
Phenotypes for gene: PPP1R13L were set to Dilated cardiomyopathy, onset in infancy; Cleft lip and palate
Review for gene: PPP1R13L was set to GREEN
Added comment: At least 6 unrelated families. NMD-predicted, missense and stop-loss (extension) variants have been reported in individuals with autosomal recessive PPP1R13L-related syndrome. Patients described with biallelic pathogenic variants in PPP1R13L all had severe infantile-onset dilated cardiomyopathy, with additional features including cleft lip and palate, wedge-shaped teeth, and sparse, dry, woolly hair described in several individuals. Death due to HF progression before 5yo reported in cases that didn't receive a heart transplant. Cognitive delay also reported in two unrelated individuals (PMID: 28069640, PMID: 32666529).
Sources: Expert Review
Clefting disorders v0.127 ZNF3 Zornitza Stark Marked gene: ZNF3 as ready
Clefting disorders v0.127 ZNF3 Zornitza Stark Gene: znf3 has been classified as Red List (Low Evidence).
Clefting disorders v0.127 ZNF3 Zornitza Stark gene: ZNF3 was added
gene: ZNF3 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: ZNF3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF3 were set to 32732226
Phenotypes for gene: ZNF3 were set to Hydrocephalus; cleft palate; microphthalmia
Review for gene: ZNF3 was set to RED
Added comment: Novel candidate gene identified in a fetus with hydrocephaly and facial cleft detected by fetal ultrasound. Autopsy showed multiple congenital abnormalities including a median cleft palate, partial maxillar agenesis, bilateral severe microphthalmia, arhinencephaly, partial thalamic fusion. A homozygous truncating variant (c.396A>G/ p.*132Trpext*69) in ZNF3 was found by exome sequencing.
Sources: Literature
Clefting disorders v0.126 ZEB2 Zornitza Stark Marked gene: ZEB2 as ready
Clefting disorders v0.126 ZEB2 Zornitza Stark Gene: zeb2 has been classified as Green List (High Evidence).
Clefting disorders v0.126 ZEB2 Zornitza Stark Phenotypes for gene: ZEB2 were changed from MOWAT-WILSON SYNDROME; MOWS to Mowat-Wilson syndrome, MIM# 235730; MONDO:0009341
Clefting disorders v0.125 ZEB2 Zornitza Stark Publications for gene: ZEB2 were set to
Clefting disorders v0.124 ZEB2 Zornitza Stark reviewed gene: ZEB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29300384, 27831545, 24715670, 19215041, 17958891; Phenotypes: Mowat-Wilson syndrome, MIM# 235730, MONDO:0009341; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.124 SATB2 Zornitza Stark Marked gene: SATB2 as ready
Clefting disorders v0.124 SATB2 Zornitza Stark Gene: satb2 has been classified as Green List (High Evidence).
Clefting disorders v0.124 SATB2 Zornitza Stark Phenotypes for gene: SATB2 were changed from Glass syndrome; GLASS SYNDROME; Cleft palate; GLASS; Cleft palate, intellectual disability, poor- absent speech, bone fragility- raised serum alkaline phosphatas; Chromosome 2q32-q33 deletion syndrome; Orofacial Clefting with skeletal features to Glass syndrome, MIM# 612313; MONDO:0100147
Clefting disorders v0.123 SATB2 Zornitza Stark Publications for gene: SATB2 were set to 16179223
Clefting disorders v0.122 SATB2 Zornitza Stark Mode of inheritance for gene: SATB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.121 SATB2 Zornitza Stark reviewed gene: SATB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29023086, 28151491, 32446642; Phenotypes: Glass syndrome, MIM# 612313, MONDO:0100147; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.121 MASP1 Zornitza Stark Marked gene: MASP1 as ready
Clefting disorders v0.121 MASP1 Zornitza Stark Gene: masp1 has been classified as Green List (High Evidence).
Clefting disorders v0.121 MASP1 Zornitza Stark Phenotypes for gene: MASP1 were changed from 3MC1; 3MC SYNDROME 1 to 3MC syndrome 1, MIM# 257920; MONDO:0009770
Clefting disorders v0.120 MASP1 Zornitza Stark Publications for gene: MASP1 were set to
Clefting disorders v0.119 MASP1 Zornitza Stark reviewed gene: MASP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26789649, 21258343, 21035106; Phenotypes: 3MC syndrome 1, MIM# 257920, MONDO:0009770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.119 SEPT9 Zornitza Stark Marked gene: SEPT9 as ready
Clefting disorders v0.119 SEPT9 Zornitza Stark Gene: sept9 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.119 SEPT9 Zornitza Stark Tag SV/CNV tag was added to gene: SEPT9.
Tag 5'UTR tag was added to gene: SEPT9.
Tag founder tag was added to gene: SEPT9.
Tag new gene name tag was added to gene: SEPT9.
Clefting disorders v0.119 SEPT9 Zornitza Stark Phenotypes for gene: SEPT9 were changed from HNA; AMYOTROPHY, HEREDITARY NEURALGIC to HNA; Amyotrophy, hereditary neuralgic, MIM# 162100
Clefting disorders v0.118 SEPT9 Zornitza Stark Publications for gene: SEPT9 were set to
Clefting disorders v0.117 SEPT9 Zornitza Stark Mode of inheritance for gene: SEPT9 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.116 SEPT9 Zornitza Stark Classified gene: SEPT9 as Amber List (moderate evidence)
Clefting disorders v0.116 SEPT9 Zornitza Stark Gene: sept9 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.115 SEPT9 Zornitza Stark reviewed gene: SEPT9: Rating: AMBER; Mode of pathogenicity: None; Publications: 16186812, 19451530, 19939853, 19139049, 18492087; Phenotypes: Amyotrophy, hereditary neuralgic, MIM# 162100; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.115 ANKRD17 Zornitza Stark Classified gene: ANKRD17 as Amber List (moderate evidence)
Clefting disorders v0.115 ANKRD17 Zornitza Stark Gene: ankrd17 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.114 ANKRD17 Zornitza Stark Publications for gene: ANKRD17 were set to
Clefting disorders v0.113 ANKRD17 Zornitza Stark Classified gene: ANKRD17 as Green List (high evidence)
Clefting disorders v0.113 ANKRD17 Zornitza Stark Gene: ankrd17 has been classified as Green List (High Evidence).
Clefting disorders v0.112 ANKRD17 Paul De Fazio reviewed gene: ANKRD17: Rating: AMBER; Mode of pathogenicity: None; Publications: 33909992; Phenotypes: Intellectual disability, speech delay, and dysmorphism; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Clefting disorders v0.112 PLCH1 Zornitza Stark Marked gene: PLCH1 as ready
Clefting disorders v0.112 PLCH1 Zornitza Stark Gene: plch1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.112 PLCH1 Zornitza Stark Classified gene: PLCH1 as Amber List (moderate evidence)
Clefting disorders v0.112 PLCH1 Zornitza Stark Gene: plch1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.111 PLCH1 Zornitza Stark gene: PLCH1 was added
gene: PLCH1 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: PLCH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLCH1 were set to 33820834
Phenotypes for gene: PLCH1 were set to Holoprosencephaly spectrum; Severe developmental delay; Brain malformations
Review for gene: PLCH1 was set to AMBER
Added comment: PMID: 33820834 (2021) - Two sibling pairs from two unrelated families with a holoprosencephaly spectrum phenotype and different homozygous PLCH1 variants (c.2065C>T, p.Arg689* and c.4235delA, p.Cys1079ValfsTer16, respectively). One family presented with congenital hydrocephalus, epilepsy, significant developmental delay and a monoventricle or fused thalami; while sibs from the second family had alobar holoprosencephaly and cyclopia. 3/4 individuals also displayed a cleft palate and congenital heart disease. Human embryo immunohistochemistry showed PLCH1 to be expressed in the notorcord, developing spinal cord (in a ventral to dorsal gradient), dorsal root ganglia, cerebellum and dermatomyosome.
Sources: Literature
Clefting disorders v0.110 MED12 Zornitza Stark Marked gene: MED12 as ready
Clefting disorders v0.110 MED12 Zornitza Stark Gene: med12 has been classified as Green List (High Evidence).
Clefting disorders v0.110 MED12 Zornitza Stark Phenotypes for gene: MED12 were changed from Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate to Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate; Hardikar syndrome, OMIM #612726
Clefting disorders v0.109 MED12 Zornitza Stark Publications for gene: MED12 were set to 12784307
Clefting disorders v0.108 MED12 chirag patel Classified gene: MED12 as Green List (high evidence)
Clefting disorders v0.108 MED12 chirag patel Gene: med12 has been classified as Green List (High Evidence).
Clefting disorders v0.107 MED12 chirag patel reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33244166; Phenotypes: Hardikar syndrome, OMIM #612726; Mode of inheritance: Other
Clefting disorders v0.107 TXNL4A Zornitza Stark Marked gene: TXNL4A as ready
Clefting disorders v0.107 TXNL4A Zornitza Stark Gene: txnl4a has been classified as Green List (High Evidence).
Clefting disorders v0.107 TXNL4A Zornitza Stark Tag SV/CNV tag was added to gene: TXNL4A.
Tag 5'UTR tag was added to gene: TXNL4A.
Clefting disorders v0.107 TXNL4A Zornitza Stark Phenotypes for gene: TXNL4A were changed from BURN-MCKEOWN SYNDROME; BMKS; Cleft palate to Burn-McKeown syndrome, MIM# 608572; Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064
Clefting disorders v0.106 TXNL4A Zornitza Stark reviewed gene: TXNL4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25434003; Phenotypes: Burn-McKeown syndrome, MIM# 608572, Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.106 MN1 Zornitza Stark Phenotypes for gene: MN1 were changed from Cleft palate to Cleft palate; CEBALID syndrome, MIM# 618774
Clefting disorders v0.105 MN1 Zornitza Stark Marked gene: MN1 as ready
Clefting disorders v0.105 MN1 Zornitza Stark Gene: mn1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.105 MN1 Zornitza Stark Classified gene: MN1 as Amber List (moderate evidence)
Clefting disorders v0.105 MN1 Zornitza Stark Gene: mn1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.104 MN1 Michelle Torres gene: MN1 was added
gene: MN1 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: MN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MN1 were set to 33351141; 31834374; 33351070
Phenotypes for gene: MN1 were set to Cleft palate
Mode of pathogenicity for gene: MN1 was set to Other
Review for gene: MN1 was set to AMBER
Added comment: MN1 is associated to CEBALID syndrome (MIM# 618774), and many individuals have been reported with a high-arched palate. So far, 2 individuals have been reported with cleft palate, one with a severe form of the condition, associated with a truncating variant at the C-terminal, which are known to result in gain of function (PMID 31834374). And more recently, a NMD variant, established by RT-PCR and Western Blot, has been identified in a family with cleft palate and conductive hearing loss, but no ID and no other dysmorphic features (PMID 33351070). PMID 33351141 mentions that LoF is likely associated with a milder phenotype despite the high MAF of some NMD in the population, as these are in low complexity region.
Sources: Literature
Clefting disorders v0.104 ESCO2 Zornitza Stark Marked gene: ESCO2 as ready
Clefting disorders v0.104 ESCO2 Zornitza Stark Gene: esco2 has been classified as Green List (High Evidence).
Clefting disorders v0.104 ESCO2 Zornitza Stark Phenotypes for gene: ESCO2 were changed from ROBERTS SYNDROME; RBS, SC PHOCOMELIA SYNDROME to Juberg-Hayward syndrome, MIM# 216100; Roberts-SC phocomelia syndrome, MIM#268300
Clefting disorders v0.103 ESCO2 Zornitza Stark Publications for gene: ESCO2 were set to
Clefting disorders v0.102 ESCO2 Zornitza Stark reviewed gene: ESCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32977150; Phenotypes: Juberg-Hayward syndrome, MIM# 216100, Roberts-SC phocomelia syndrome, MIM#268300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.102 SHROOM3 Zornitza Stark Marked gene: SHROOM3 as ready
Clefting disorders v0.102 SHROOM3 Zornitza Stark Gene: shroom3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.102 SHROOM3 Zornitza Stark Classified gene: SHROOM3 as Amber List (moderate evidence)
Clefting disorders v0.102 SHROOM3 Zornitza Stark Gene: shroom3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.101 SHROOM3 Zornitza Stark gene: SHROOM3 was added
gene: SHROOM3 was added to Clefting disorders. Sources: Expert Review
Mode of inheritance for gene: SHROOM3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SHROOM3 were set to 32621286
Phenotypes for gene: SHROOM3 were set to Anencephaly; cleft lip and palate
Review for gene: SHROOM3 was set to AMBER
Added comment: Animal model and other functional data link SHROOM3 to neural tube development. Single family reported with bi-allelic LoF in a fetus with anencephaly and CL/P.
Sources: Expert Review
Clefting disorders v0.100 DHODH Zornitza Stark Marked gene: DHODH as ready
Clefting disorders v0.100 DHODH Zornitza Stark Gene: dhodh has been classified as Green List (High Evidence).
Clefting disorders v0.100 DHODH Zornitza Stark Phenotypes for gene: DHODH were changed from POADS = MILLER; POSTAXIAL ACROFACIAL DYSOSTOSIS to Miller syndrome, MIM# 263750
Clefting disorders v0.99 DHODH Zornitza Stark Publications for gene: DHODH were set to
Clefting disorders v0.98 DHODH Zornitza Stark reviewed gene: DHODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 19915526, 20220176, 33262786, 27370710; Phenotypes: Miller syndrome, MIM# 263750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.98 ALX3 Zornitza Stark Phenotypes for gene: ALX3 were changed from FND1; Frontorhiny; FRONTONASAL DYSPLASIA 1 to Frontonasal dysplasia 1, MIM# 136760; Frontorhiny
Clefting disorders v0.97 ALX3 Zornitza Stark reviewed gene: ALX3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Frontonasal dysplasia 1, MIM# 136760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.97 ALX1 Zornitza Stark Phenotypes for gene: ALX1 were changed from ?Frontonasal dysplasia 3, 613456 to Frontonasal dysplasia 3, MIM#613456; severe facial clefting
Clefting disorders v0.96 ALX1 Zornitza Stark reviewed gene: ALX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Frontonasal dysplasia 3, MIM# 613456; Mode of inheritance: None
Clefting disorders v0.96 USP9X Zornitza Stark Marked gene: USP9X as ready
Clefting disorders v0.96 USP9X Zornitza Stark Gene: usp9x has been classified as Green List (High Evidence).
Clefting disorders v0.96 ALX1 Tiong Tan Classified gene: ALX1 as Green List (high evidence)
Clefting disorders v0.96 ALX1 Tiong Tan Added comment: Comment on list classification: Mediocre reviewer
Clefting disorders v0.96 ALX1 Tiong Tan Gene: alx1 has been classified as Green List (High Evidence).
Clefting disorders v0.95 ALX3 Tiong Tan Marked gene: ALX3 as ready
Clefting disorders v0.95 ALX3 Tiong Tan Gene: alx3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.95 ALX3 Tiong Tan reviewed gene: ALX3: Rating: AMBER; Mode of pathogenicity: None; Publications: 19409524, 29215096, 31914496; Phenotypes: Frontorhiny; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.95 ALX1 Tiong Tan Marked gene: ALX1 as ready
Clefting disorders v0.95 ALX1 Tiong Tan Gene: alx1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.95 ALX1 Tiong Tan reviewed gene: ALX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31914496, 20451171, 24592072; Phenotypes: Frontonasal dysplasia, severe facial clefting; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.95 USP9X Tiong Tan reviewed gene: USP9X: Rating: GREEN; Mode of pathogenicity: None; Publications: 26833328; Phenotypes: 300968 MENTAL RETARDATION, X-LINKED 99, SYNDROMIC, FEMALE-RESTRICTED; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Clefting disorders v0.95 RPS28 Zornitza Stark Marked gene: RPS28 as ready
Clefting disorders v0.95 RPS28 Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.95 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from DBA15; DIAMOND-BLACKFAN ANEMIA 15 WITH MANDIBULOFACIAL DYSOSTOSIS; Cleft palate to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164; Cleft palate
Clefting disorders v0.94 RPS28 Zornitza Stark Publications for gene: RPS28 were set to
Clefting disorders v0.93 INTS1 Zornitza Stark Marked gene: INTS1 as ready
Clefting disorders v0.93 INTS1 Zornitza Stark Gene: ints1 has been classified as Red List (Low Evidence).
Clefting disorders v0.93 INTS1 Zornitza Stark Marked gene: INTS1 as ready
Clefting disorders v0.93 INTS1 Zornitza Stark Gene: ints1 has been classified as Red List (Low Evidence).
Clefting disorders v0.93 INTS1 Zornitza Stark Phenotypes for gene: INTS1 were changed from Cleft palate to Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies, MIM# 618571; Cleft palate
Clefting disorders v0.92 INTS1 Zornitza Stark Publications for gene: INTS1 were set to
Clefting disorders v0.91 INTS1 Zornitza Stark Mode of inheritance for gene: INTS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.90 SELENOI Zornitza Stark Marked gene: SELENOI as ready
Clefting disorders v0.90 SELENOI Zornitza Stark Gene: selenoi has been classified as Red List (Low Evidence).
Clefting disorders v0.90 SELENOI Zornitza Stark Phenotypes for gene: SELENOI were changed from Cleft palate to Cleft palate; developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals
Clefting disorders v0.89 SELENOI Zornitza Stark Publications for gene: SELENOI were set to
Clefting disorders v0.88 SELENOI Zornitza Stark Mode of inheritance for gene: SELENOI was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.87 TBX2 Zornitza Stark Marked gene: TBX2 as ready
Clefting disorders v0.87 TBX2 Zornitza Stark Gene: tbx2 has been classified as Red List (Low Evidence).
Clefting disorders v0.87 TSR2 Zornitza Stark Marked gene: TSR2 as ready
Clefting disorders v0.87 TSR2 Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence).
Clefting disorders v0.87 TSR2 Zornitza Stark Phenotypes for gene: TSR2 were changed from Cleft palate to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946; Cleft palate
Clefting disorders v0.86 TSR2 Zornitza Stark Publications for gene: TSR2 were set to
Clefting disorders v0.85 TSR2 Zornitza Stark Mode of inheritance for gene: TSR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Clefting disorders v0.84 PGM1 Zornitza Stark Marked gene: PGM1 as ready
Clefting disorders v0.84 PGM1 Zornitza Stark Gene: pgm1 has been classified as Green List (High Evidence).
Clefting disorders v0.84 PGM1 Zornitza Stark Phenotypes for gene: PGM1 were changed from Cleft palate to Congenital disorder of glycosylation, type It 614921; Cleft palate
Clefting disorders v0.83 PGM1 Zornitza Stark Publications for gene: PGM1 were set to 31563034; 26303607; 24878975; PMID: 27206562; PMID: 29858906; PMID: 32681750
Clefting disorders v0.82 PGM1 Zornitza Stark Publications for gene: PGM1 were set to PMID: 31563034; PMID: 26303607PMID: 24878975; PMID: 27206562; PMID: 29858906; PMID: 32681750
Clefting disorders v0.81 PGM1 Zornitza Stark Publications for gene: PGM1 were set to
Clefting disorders v0.80 PGM1 Zornitza Stark Mode of inheritance for gene: PGM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.79 CTNND1 Zornitza Stark Marked gene: CTNND1 as ready
Clefting disorders v0.79 CTNND1 Zornitza Stark Gene: ctnnd1 has been classified as Green List (High Evidence).
Clefting disorders v0.79 CTNND1 Zornitza Stark Phenotypes for gene: CTNND1 were changed from BLEPHAROCHEILODONTIC; Cleft palate to Blepharocheilodontic syndrome 2, MIM# 617681
Clefting disorders v0.78 CTNND1 Zornitza Stark Publications for gene: CTNND1 were set to 28301459
Clefting disorders v0.77 ARHGAP29 Zornitza Stark Marked gene: ARHGAP29 as ready
Clefting disorders v0.77 ARHGAP29 Zornitza Stark Gene: arhgap29 has been classified as Green List (High Evidence).
Clefting disorders v0.76 Zornitza Stark Panel name changed from Clefting_GEL to Clefting disorders
Panel status changed from internal to public
Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Rare Disease
Clefting disorders v0.75 FBRSL1 Zornitza Stark Marked gene: FBRSL1 as ready
Clefting disorders v0.75 FBRSL1 Zornitza Stark Gene: fbrsl1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.75 FBRSL1 Zornitza Stark Classified gene: FBRSL1 as Amber List (moderate evidence)
Clefting disorders v0.75 FBRSL1 Zornitza Stark Gene: fbrsl1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.74 FBRSL1 Zornitza Stark gene: FBRSL1 was added
gene: FBRSL1 was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: FBRSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FBRSL1 were set to 32424618
Phenotypes for gene: FBRSL1 were set to Malformation and intellectual disability syndrome; Cleft palate
Review for gene: FBRSL1 was set to AMBER
Added comment: Three children with de novo PTCs that escape NMD, and an overlapping syndromic phenotype.
2/3 had heart defects, cleft palate and hearing impairment.
Variant pathogenicity supported by Xenopus oocyte functional studies
Sources: Expert list
Clefting disorders v0.73 ESRP2 Zornitza Stark Marked gene: ESRP2 as ready
Clefting disorders v0.73 ESRP2 Zornitza Stark Gene: esrp2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.73 ESRP2 Zornitza Stark reviewed gene: ESRP2: Rating: AMBER; Mode of pathogenicity: None; Publications: 29805042; Phenotypes: Cleft lip; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.73 EDN1 Zornitza Stark Marked gene: EDN1 as ready
Clefting disorders v0.73 EDN1 Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.73 EDN1 Zornitza Stark Phenotypes for gene: EDN1 were changed from Cleft palate to Auriculocondylar syndrome 3, MIM# 615706; Cleft palate
Clefting disorders v0.72 EDN1 Zornitza Stark Publications for gene: EDN1 were set to
Clefting disorders v0.71 EDN1 Zornitza Stark Mode of inheritance for gene: EDN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.70 EDN1 Zornitza Stark Classified gene: EDN1 as Amber List (moderate evidence)
Clefting disorders v0.70 EDN1 Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.69 EDN1 Zornitza Stark edited their review of gene: EDN1: Changed rating: AMBER
Clefting disorders v0.69 EDN1 Zornitza Stark reviewed gene: EDN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315542, 23913798; Phenotypes: Auriculocondylar syndrome 3, MIM# 615706; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.68 COL9A3 Zornitza Stark Marked gene: COL9A3 as ready
Clefting disorders v0.68 COL9A3 Zornitza Stark Gene: col9a3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.68 COL9A3 Zornitza Stark Phenotypes for gene: COL9A3 were changed from Cleft palate to Stickler syndrome; Cleft palate
Clefting disorders v0.67 COL9A3 Zornitza Stark Publications for gene: COL9A3 were set to
Clefting disorders v0.66 COL9A3 Zornitza Stark Mode of inheritance for gene: COL9A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.65 COL9A3 Zornitza Stark Classified gene: COL9A3 as Amber List (moderate evidence)
Clefting disorders v0.65 COL9A3 Zornitza Stark Gene: col9a3 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.64 COL9A3 Zornitza Stark reviewed gene: COL9A3: Rating: AMBER; Mode of pathogenicity: None; Publications: 24273071, 30450842, 31090205, 20301479; Phenotypes: Stickler syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.64 Zornitza Stark Panel types changed to Rare Disease
Clefting disorders v0.63 COL9A2 Zornitza Stark Marked gene: COL9A2 as ready
Clefting disorders v0.63 COL9A2 Zornitza Stark Gene: col9a2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.63 COL9A2 Zornitza Stark Phenotypes for gene: COL9A2 were changed from Stickler syndrome; Orofacial Clefting with skeletal features; ?Stickler syndrome type V, 614284; Cleft palate to Stickler syndrome, type V, MIM# 614284
Clefting disorders v0.62 COL9A2 Zornitza Stark Publications for gene: COL9A2 were set to 21671392
Clefting disorders v0.61 COL9A2 Zornitza Stark reviewed gene: COL9A2: Rating: AMBER; Mode of pathogenicity: None; Publications: 21671392, 31090205, 33356723; Phenotypes: Stickler syndrome, type V, MIM# 614284; Mode of inheritance: None
Clefting disorders v0.61 CHD1 Zornitza Stark Marked gene: CHD1 as ready
Clefting disorders v0.61 CHD1 Zornitza Stark Gene: chd1 has been classified as Red List (Low Evidence).
Clefting disorders v0.61 CHD1 Zornitza Stark reviewed gene: CHD1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Clefting disorders v0.61 BMP4 Zornitza Stark Marked gene: BMP4 as ready
Clefting disorders v0.61 BMP4 Zornitza Stark Gene: bmp4 has been classified as Green List (High Evidence).
Clefting disorders v0.61 BMP4 Zornitza Stark Phenotypes for gene: BMP4 were changed from Cleft lip with or without cleft palate, non syndromic, 11; MCOPS6, OROFACIAL CLEFT 11; OFC11; Orofacial Cleft; Cleft Lip with or without Cleft Palate; Cleft lip; MICROPHTHALMIA, SYNDROMIC 6; Orofacial cleft 11, 600625 to Orofacial cleft 11 600625; Microphthalmia, syndromic 6, MIM# 607932
Clefting disorders v0.60 BMP4 Zornitza Stark Publications for gene: BMP4 were set to
Clefting disorders v0.59 BMP4 Zornitza Stark Classified gene: BMP4 as Green List (high evidence)
Clefting disorders v0.59 BMP4 Zornitza Stark Gene: bmp4 has been classified as Green List (High Evidence).
Clefting disorders v0.58 BMP4 Zornitza Stark reviewed gene: BMP4: Rating: GREEN; Mode of pathogenicity: None; Publications: 31053785, 19249007, 31909686; Phenotypes: Orofacial cleft 11 600625, Microphthalmia, syndromic 6, MIM# 607932; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.58 ANKRD17 Zornitza Stark Marked gene: ANKRD17 as ready
Clefting disorders v0.58 ANKRD17 Zornitza Stark Gene: ankrd17 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.58 ANKRD17 Zornitza Stark Classified gene: ANKRD17 as Amber List (moderate evidence)
Clefting disorders v0.58 ANKRD17 Zornitza Stark Gene: ankrd17 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.57 ANKRD17 Zornitza Stark gene: ANKRD17 was added
gene: ANKRD17 was added to Clefting_GEL. Sources: Expert Review
Mode of inheritance for gene: ANKRD17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKRD17 were set to Intellectual disability; dysmorphic features
Review for gene: ANKRD17 was set to AMBER
Added comment: Emerging evidence.
Sources: Expert Review
Clefting disorders v0.56 AMOTL1 Zornitza Stark Marked gene: AMOTL1 as ready
Clefting disorders v0.56 AMOTL1 Zornitza Stark Gene: amotl1 has been classified as Red List (Low Evidence).
Clefting disorders v0.56 AMOTL1 Zornitza Stark gene: AMOTL1 was added
gene: AMOTL1 was added to Clefting_GEL. Sources: Literature
Mode of inheritance for gene: AMOTL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AMOTL1 were set to 33026150
Phenotypes for gene: AMOTL1 were set to Cleft lip and palate; imperforate anus; dysmorphism
Review for gene: AMOTL1 was set to RED
Added comment: Two unrelated families reported. In one, the variant was identified in parent and child who had orofacial cleft and cardiac abnormalities. Second report in PMID 33026150, de novo missense variant and cleft lip/palate, imperforate anus and dysmorphism. Mouse model does not recapitulate phenotype.
Sources: Literature
Clefting disorders v0.55 ACBD5 Zornitza Stark Marked gene: ACBD5 as ready
Clefting disorders v0.55 ACBD5 Zornitza Stark Gene: acbd5 has been classified as Red List (Low Evidence).
Clefting disorders v0.55 ACBD5 Zornitza Stark Phenotypes for gene: ACBD5 were changed from Cleft palate to Retinal dystrophy with leukodystrophy, MIM# 618863; Cleft palate
Clefting disorders v0.54 ACBD5 Zornitza Stark Publications for gene: ACBD5 were set to
Clefting disorders v0.53 ACBD5 Zornitza Stark Mode of inheritance for gene: ACBD5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.52 ACBD5 Zornitza Stark reviewed gene: ACBD5: Rating: RED; Mode of pathogenicity: None; Publications: 27799409, 23105016, 33427402; Phenotypes: Retinal dystrophy with leukodystrophy, MIM# 618863; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.52 FST Zornitza Stark Marked gene: FST as ready
Clefting disorders v0.52 FST Zornitza Stark Gene: fst has been classified as Red List (Low Evidence).
Clefting disorders v0.52 FOXE1 Zornitza Stark Marked gene: FOXE1 as ready
Clefting disorders v0.52 FOXE1 Zornitza Stark Gene: foxe1 has been classified as Green List (High Evidence).
Clefting disorders v0.52 FOXE1 Zornitza Stark Phenotypes for gene: FOXE1 were changed from Cleft palate to Bamforth-Lazarus syndrome, OMIM #241850
Clefting disorders v0.51 FOXE1 Zornitza Stark Publications for gene: FOXE1 were set to
Clefting disorders v0.50 FOXE1 Zornitza Stark Mode of inheritance for gene: FOXE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.49 GDF11 Zornitza Stark Classified gene: GDF11 as Amber List (moderate evidence)
Clefting disorders v0.49 GDF11 Zornitza Stark Gene: gdf11 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.48 GDF11 Zornitza Stark reviewed gene: GDF11: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Clefting disorders v0.48 GDF11 Zornitza Stark Marked gene: GDF11 as ready
Clefting disorders v0.48 GDF11 Zornitza Stark Gene: gdf11 has been classified as Red List (Low Evidence).
Clefting disorders v0.48 GNAI3 Zornitza Stark Marked gene: GNAI3 as ready
Clefting disorders v0.48 GNAI3 Zornitza Stark Gene: gnai3 has been classified as Red List (Low Evidence).
Clefting disorders v0.48 GNAI3 Zornitza Stark Phenotypes for gene: GNAI3 were changed from Cleft palate to Auriculocondylar syndrome 1, OMIM #602483
Clefting disorders v0.47 GNAI3 Zornitza Stark Publications for gene: GNAI3 were set to
Clefting disorders v0.46 GNAI3 Zornitza Stark Mode of inheritance for gene: GNAI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.45 HOXA2 Zornitza Stark Marked gene: HOXA2 as ready
Clefting disorders v0.45 HOXA2 Zornitza Stark Gene: hoxa2 has been classified as Red List (Low Evidence).
Clefting disorders v0.45 HOXA2 Zornitza Stark Mode of inheritance for gene: HOXA2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Clefting disorders v0.44 KAT5 Zornitza Stark Marked gene: KAT5 as ready
Clefting disorders v0.44 KAT5 Zornitza Stark Gene: kat5 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.44 LRP6 Zornitza Stark Marked gene: LRP6 as ready
Clefting disorders v0.44 LRP6 Zornitza Stark Gene: lrp6 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.44 LRRC32 Zornitza Stark Marked gene: LRRC32 as ready
Clefting disorders v0.44 LRRC32 Zornitza Stark Gene: lrrc32 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.44 MED13L Zornitza Stark Marked gene: MED13L as ready
Clefting disorders v0.44 MED13L Zornitza Stark Gene: med13l has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.44 FST chirag patel gene: FST was added
gene: FST was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: FST was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FST were set to PubMed: 31215115
Phenotypes for gene: FST were set to orofacial clefting
Review for gene: FST was set to RED
Added comment: In a cohort of 72 families with orofacial clefting, Cox et al. (2019) performed exome sequencing and identified a father and 2 daughters (family 22) with cleft lip and palate who were heterozygous for missense variant (C56Y) in FST. A highly conserved residue within the 63-residue N-terminal domain. The variant was not found in the unaffected paternal grandmother or in the gnomAD database. Classed as a VUS. Functional analysis in transfected HEK293T cells, using a stable cell line sensitive to stimulation by the FST downstream target GDF11, demonstrated that wildtype FST efficiently and completely antagonized GDF11-stimulated reporter activity. In contrast, the C56Y mutant did not significantly inhibit the stimulation of reporter activity, regardless of the amount of mutant vector transfected.
Sources: Expert list
Clefting disorders v0.43 FOXE1 chirag patel Classified gene: FOXE1 as Green List (high evidence)
Clefting disorders v0.43 FOXE1 chirag patel Gene: foxe1 has been classified as Green List (High Evidence).
Clefting disorders v0.42 FOXE1 chirag patel reviewed gene: FOXE1: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 9697705, 12165566, 16882747; Phenotypes: Bamforth-Lazarus syndrome, OMIM #241850; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.42 GDF11 chirag patel gene: GDF11 was added
gene: GDF11 was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: GDF11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GDF11 were set to PubMed: 31215115
Phenotypes for gene: GDF11 were set to Vertebral hypersegmentation and orofacial anomalies (VHO), MIM#619122
Review for gene: GDF11 was set to RED
Added comment: In 5 affected members over 3 generations of a family segregating vertebral hypersegmentation and orofacial anomalies, Cox et al. (2019) identified heterozygosity for a missense mutation in the GDF11 gene (R298Q) that was not found in unaffected family members or in public variant databases. Functional analysis demonstrated that the R298Q substitution prevents cleavage to the active form of the protein, resulting in loss of function.
Sources: Expert list
Clefting disorders v0.41 GNAI3 chirag patel reviewed gene: GNAI3: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 22560091, 16114046; Phenotypes: Auriculocondylar syndrome 1, OMIM #602483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.41 HOXA2 chirag patel reviewed gene: HOXA2: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 18394579; Phenotypes: ?Microtia, hearing impairment, and cleft palate (AR); Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Clefting disorders v0.41 KAT5 chirag patel Classified gene: KAT5 as Amber List (moderate evidence)
Clefting disorders v0.41 KAT5 chirag patel Gene: kat5 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.40 KAT5 chirag patel gene: KAT5 was added
gene: KAT5 was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: KAT5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KAT5 were set to PMID: 32822602
Phenotypes for gene: KAT5 were set to Neurodevelopmental disorder wtih dysmorphic facies, sleep disturbance, and brain abnormalities, OMIM #619103
Review for gene: KAT5 was set to AMBER
Added comment: In 3 unrelated patients with neurodevelopmental disorder with dysmorphic facies, sleep disturbance, and brain abnormalities, they found 3 different de novo heterozygous missense mutations in the KAT5 gene: R53H, C369S, and S413A. Cleft LP and submucous cleft P were observed in 2/3. The mutations were found by exome sequencing and the patients were ascertained through the GeneMatcher program. None of the mutations were present in the gnomAD database. In vitro functional expression studies showed that the mutations resulted in variably decreased histone acetyltransferase (HAT) activity compared to controls.
Sources: Expert list
Clefting disorders v0.39 LRP6 chirag patel Classified gene: LRP6 as Amber List (moderate evidence)
Clefting disorders v0.39 LRP6 chirag patel Gene: lrp6 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.38 LRP6 chirag patel gene: LRP6 was added
gene: LRP6 was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: LRP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LRP6 were set to PMID: 29500247, 26963285
Phenotypes for gene: LRP6 were set to cleft lip; cleft palate; tooth agenesis; oligodontia
Review for gene: LRP6 was set to AMBER
Added comment: 2 unrelated patients with orofacial clefting reported in two papers with LRP6 variants (p.Cys1532fs, p.?, and p.Arg1125*). no functional data.
Sources: Expert list
Clefting disorders v0.37 LRRC32 chirag patel Classified gene: LRRC32 as Amber List (moderate evidence)
Clefting disorders v0.37 LRRC32 chirag patel Gene: lrrc32 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.36 LRRC32 chirag patel gene: LRRC32 was added
gene: LRRC32 was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: LRRC32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LRRC32 were set to PMID: 30976112
Phenotypes for gene: LRRC32 were set to Cleft palate, proliferative retinopathy, and developmental delay (CPPRDD) syndrome, MIM# 619074
Review for gene: LRRC32 was set to AMBER
Added comment: Three individuals from two consanguineous families with cleft palate, proliferative retinopathy, and developmental delay had the same homozygous biallelic variant, c.1630C>T; p.(Arg544Ter), segregated and shared haplotype indicative of founder effect. Mouse model has cleft palate and neonatal death.
Sources: Expert list
Clefting disorders v0.35 MED13L chirag patel reviewed gene: MED13L: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 25137640, 25712080; Phenotypes: Mental retardation and distinctive facial features with or without cardiac defects, OMIM #616789; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.35 HYAL2 Zornitza Stark Marked gene: HYAL2 as ready
Clefting disorders v0.35 HYAL2 Zornitza Stark Gene: hyal2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.35 HYAL2 Zornitza Stark Classified gene: HYAL2 as Amber List (moderate evidence)
Clefting disorders v0.35 HYAL2 Zornitza Stark Gene: hyal2 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.34 HYAL2 Zornitza Stark gene: HYAL2 was added
gene: HYAL2 was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: HYAL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HYAL2 were set to 28081210; 23172227; 26515055
Phenotypes for gene: HYAL2 were set to Cleft lip and palate; cor triatriatum; congenital cardiac malformations
Review for gene: HYAL2 was set to AMBER
Added comment: 2 unrelated consanguineous extended families (Amish and Arab) with an orofacial clefting phenotype with cardiac anomalies.
Sources: Expert list
Clefting disorders v0.33 Zornitza Stark removed gene:UBB from the panel
Clefting disorders v0.32 Zornitza Stark removed gene:GYPE from the panel
Clefting disorders v0.31 PGM1 chirag patel Classified gene: PGM1 as Green List (high evidence)
Clefting disorders v0.31 PGM1 chirag patel Gene: pgm1 has been classified as Green List (High Evidence).
Clefting disorders v0.30 DLX4 Zornitza Stark Marked gene: DLX4 as ready
Clefting disorders v0.30 DLX4 Zornitza Stark Gene: dlx4 has been classified as Red List (Low Evidence).
Clefting disorders v0.30 DLX4 Zornitza Stark Phenotypes for gene: DLX4 were changed from nonsyndromic cleft/lip palate (CL/P); OFC15; OROFACIAL CLEFT 15; ?Orofacial cleft 15, 616788 to Orofacial cleft 15, MIM# 616788
Clefting disorders v0.29 DLX4 Zornitza Stark Publications for gene: DLX4 were set to 25954033
Clefting disorders v0.28 DLX4 Zornitza Stark Classified gene: DLX4 as Red List (low evidence)
Clefting disorders v0.28 DLX4 Zornitza Stark Gene: dlx4 has been classified as Red List (Low Evidence).
Clefting disorders v0.27 DLX4 Zornitza Stark reviewed gene: DLX4: Rating: RED; Mode of pathogenicity: None; Publications: 25954033, 29738288; Phenotypes: Orofacial cleft 15, MIM# 616788; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.27 PHF8 Zornitza Stark reviewed gene: PHF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Clefting disorders v0.27 PHF8 Zornitza Stark Marked gene: PHF8 as ready
Clefting disorders v0.27 PHF8 Zornitza Stark Gene: phf8 has been classified as Green List (High Evidence).
Clefting disorders v0.27 PHF8 Zornitza Stark Phenotypes for gene: PHF8 were changed from MRXSSD; SIDERIUS X-LINKED MENTAL RETARDATION SYNDROME; Cleft lip to Mental retardation syndrome, X-linked, Siderius type, 300263
Clefting disorders v0.26 PHF8 Zornitza Stark Publications for gene: PHF8 were set to
Clefting disorders v0.25 PLCB4 Zornitza Stark Marked gene: PLCB4 as ready
Clefting disorders v0.25 PLCB4 Zornitza Stark Gene: plcb4 has been classified as Green List (High Evidence).
Clefting disorders v0.25 PLCB4 Zornitza Stark Phenotypes for gene: PLCB4 were changed from Cleft palate to Auriculocondylar syndrome 2, MIM# 614669; Cleft palate
Clefting disorders v0.24 PLCB4 Zornitza Stark Publications for gene: PLCB4 were set to
Clefting disorders v0.23 PLCB4 Zornitza Stark Mode of pathogenicity for gene: PLCB4 was changed from to Other
Clefting disorders v0.22 PLCB4 Zornitza Stark Mode of inheritance for gene: PLCB4 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Clefting disorders v0.21 PLCB4 Zornitza Stark Classified gene: PLCB4 as Green List (high evidence)
Clefting disorders v0.21 PLCB4 Zornitza Stark Gene: plcb4 has been classified as Green List (High Evidence).
Clefting disorders v0.20 PLCB4 Zornitza Stark reviewed gene: PLCB4: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315542, 23913798; Phenotypes: Auriculocondylar syndrome 2, MIM# 614669; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Clefting disorders v0.20 PLEKHA5 Zornitza Stark Marked gene: PLEKHA5 as ready
Clefting disorders v0.20 PLEKHA5 Zornitza Stark Gene: plekha5 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.20 PLEKHA5 Zornitza Stark Phenotypes for gene: PLEKHA5 were changed from cleft lip to Cleft lip and palate
Clefting disorders v0.19 PLEKHA5 Zornitza Stark Classified gene: PLEKHA5 as Amber List (moderate evidence)
Clefting disorders v0.19 PLEKHA5 Zornitza Stark Gene: plekha5 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.17 PLEKHA7 Zornitza Stark Marked gene: PLEKHA7 as ready
Clefting disorders v0.17 PLEKHA7 Zornitza Stark Gene: plekha7 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.17 PLEKHA7 Zornitza Stark Phenotypes for gene: PLEKHA7 were changed from cleft lip to Cleft lip and palate
Clefting disorders v0.16 PLEKHA7 Zornitza Stark reviewed gene: PLEKHA7: Rating: AMBER; Mode of pathogenicity: None; Publications: 29805042; Phenotypes: Cleft palate; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.16 RPL11 Zornitza Stark Marked gene: RPL11 as ready
Clefting disorders v0.16 RPL11 Zornitza Stark Gene: rpl11 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.16 RPL11 Zornitza Stark Phenotypes for gene: RPL11 were changed from Cleft palate to Diamond-Blackfan anemia 7, MIM# 612562; Cleft palate
Clefting disorders v0.15 RPL11 Zornitza Stark Mode of inheritance for gene: RPL11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.14 RPL11 Zornitza Stark Classified gene: RPL11 as Amber List (moderate evidence)
Clefting disorders v0.14 RPL11 Zornitza Stark Gene: rpl11 has been classified as Amber List (Moderate Evidence).
Clefting disorders v0.13 RPL11 Zornitza Stark reviewed gene: RPL11: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Diamond-Blackfan anemia 7, MIM# 612562; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.13 RSPO2 Zornitza Stark Marked gene: RSPO2 as ready
Clefting disorders v0.13 RSPO2 Zornitza Stark Gene: rspo2 has been classified as Green List (High Evidence).
Clefting disorders v0.13 RSPO2 Zornitza Stark Phenotypes for gene: RSPO2 were changed from Cleft lip to Tetraamelia syndrome 2, MIM# 618021; Cleft lip and palate
Clefting disorders v0.12 RSPO2 Zornitza Stark Publications for gene: RSPO2 were set to
Clefting disorders v0.11 RSPO2 Zornitza Stark Mode of inheritance for gene: RSPO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.10 RSPO2 Zornitza Stark Classified gene: RSPO2 as Green List (high evidence)
Clefting disorders v0.10 RSPO2 Zornitza Stark Gene: rspo2 has been classified as Green List (High Evidence).
Clefting disorders v0.9 RSPO2 Zornitza Stark reviewed gene: RSPO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29769720, 32457899; Phenotypes: Tetraamelia syndrome 2, MIM# 618021; Mode of inheritance: None
Clefting disorders v0.9 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Clefting disorders v0.9 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Clefting disorders v0.9 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from CTHM; CONOTRUNCAL HEART MALFORMATIONS; Cleft palate to Velocardiofacial syndrome, MIM# 192430; Cleft palate
Clefting disorders v0.8 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Clefting disorders v0.7 TBX1 Zornitza Stark Classified gene: TBX1 as Green List (high evidence)
Clefting disorders v0.7 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Clefting disorders v0.6 TBX1 Zornitza Stark Tag SV/CNV tag was added to gene: TBX1.
Clefting disorders v0.6 TBX1 Zornitza Stark reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29500247; Phenotypes: Velocardiofacial syndrome, MIM# 192430; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.6 TBX2 Zornitza Stark gene: TBX2 was added
gene: TBX2 was added to Clefting_GEL. Sources: Expert list
Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TBX2 were set to 29726930
Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction, MIM# 618223
Review for gene: TBX2 was set to RED
Added comment: Four individuals reported from two unrelated families with a syndromic disorder, chiefly comprising skeletal, endocrine and immune abnormalities, reminiscent of VCFS. One of the four reported individuals had unilateral cleft lip/palate.
Sources: Expert list
Clefting disorders v0.5 TFAP2B Zornitza Stark Marked gene: TFAP2B as ready
Clefting disorders v0.5 TFAP2B Zornitza Stark Gene: tfap2b has been classified as Red List (Low Evidence).
Clefting disorders v0.5 TFAP2B Zornitza Stark Phenotypes for gene: TFAP2B were changed from Cleft lip to Char syndrome, MIM# 169100
Clefting disorders v0.4 TFAP2B Zornitza Stark Mode of inheritance for gene: TFAP2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.3 TFAP2B Zornitza Stark reviewed gene: TFAP2B: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Char syndrome, MIM# 169100; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.3 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Clefting disorders v0.3 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Clefting disorders v0.3 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Clefting_GEL. Sources: Expert Review
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Expert Review
Clefting disorders v0.2 TRRAP Zornitza Stark Marked gene: TRRAP as ready
Clefting disorders v0.2 TRRAP Zornitza Stark Gene: trrap has been classified as Green List (High Evidence).
Clefting disorders v0.2 TRRAP Zornitza Stark Classified gene: TRRAP as Green List (high evidence)
Clefting disorders v0.2 TRRAP Zornitza Stark Gene: trrap has been classified as Green List (High Evidence).
Clefting disorders v0.1 TRRAP Zornitza Stark gene: TRRAP was added
gene: TRRAP was added to Clefting_GEL. Sources: Expert Review
Mode of inheritance for gene: TRRAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRRAP were set to 30827496
Phenotypes for gene: TRRAP were set to Developmental delay with or without dysmorphic facies and autism, MIM# 618454
Review for gene: TRRAP was set to GREEN
Added comment: 13 unrelated individuals reported with a complex syndromic neurodevelopmental disorder. 5 had cleft lip/palate.
Sources: Expert Review
Clefting disorders v0.0 YAP1 Zornitza Stark gene: YAP1 was added
gene: YAP1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: YAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: YAP1 were set to 24462371
Phenotypes for gene: YAP1 were set to COB1; COLOBOMA, OCULAR, WITH OR WITHOUT HEARING IMPAIRMENT, CLEFT LIP/PALATE, AND/OR MENTAL RETARDATION
Clefting disorders v0.0 WNT3 Zornitza Stark gene: WNT3 was added
gene: WNT3 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WNT3 were set to 14872406
Phenotypes for gene: WNT3 were set to TETRAAMELIA SYNDROME, AUTOSOMAL RECESSIVE; TETAMS
Clefting disorders v0.0 WASHC5 Zornitza Stark gene: WASHC5 was added
gene: WASHC5 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: WASHC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WASHC5 were set to 24065355
Phenotypes for gene: WASHC5 were set to RTSC1; RITSCHER-SCHINZEL SYNDROME 1
Clefting disorders v0.0 VAX1 Zornitza Stark gene: VAX1 was added
gene: VAX1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: VAX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VAX1 were set to 22095910
Phenotypes for gene: VAX1 were set to MCOPS11; MICROPHTHALMIA, SYNDROMIC 11
Clefting disorders v0.0 UQCC2 Zornitza Stark gene: UQCC2 was added
gene: UQCC2 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: UQCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UQCC2 were set to 24385928
Phenotypes for gene: UQCC2 were set to MITOCHONDRIAL COMPLEX III DEFICIENCY, NUCLEAR TYPE 7; MC3DN7
Clefting disorders v0.0 UBB Zornitza Stark gene: UBB was added
gene: UBB was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: UBB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: UBB were set to Cleft palate, isolated, 119540
Clefting disorders v0.0 TWIST2 Zornitza Stark gene: TWIST2 was added
gene: TWIST2 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: TWIST2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: TWIST2 were set to BARBER-SAY SYNDROME; BBRSAY
Clefting disorders v0.0 TSR2 Zornitza Stark gene: TSR2 was added
gene: TSR2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: TSR2 was set to Unknown
Phenotypes for gene: TSR2 were set to Cleft palate
Clefting disorders v0.0 TGFB2 Zornitza Stark gene: TGFB2 was added
gene: TGFB2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: TGFB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TGFB2 were set to 29392890
Phenotypes for gene: TGFB2 were set to Loeys-Dietz syndrome 4, 614816
Clefting disorders v0.0 TFAP2B Zornitza Stark gene: TFAP2B was added
gene: TFAP2B was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: TFAP2B was set to Unknown
Phenotypes for gene: TFAP2B were set to Cleft lip
Clefting disorders v0.0 SUMO1 Zornitza Stark gene: SUMO1 was added
gene: SUMO1 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: SUMO1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SUMO1 were set to 22492558
Phenotypes for gene: SUMO1 were set to Cleft Lip with or without Cleft Palate; Orofacial cleft 10, 613705
Clefting disorders v0.0 STXBP1 Zornitza Stark gene: STXBP1 was added
gene: STXBP1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: STXBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: STXBP1 were set to EIEE4; EPILEPTIC ENCEPHALOPATHY, EARLY INFANTILE, 4
Clefting disorders v0.0 STRA6 Zornitza Stark gene: STRA6 was added
gene: STRA6 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: STRA6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STRA6 were set to MCOPS9; MICROPHTHALMIA, SYNDROMIC 9
Clefting disorders v0.0 STIL Zornitza Stark gene: STIL was added
gene: STIL was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: STIL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STIL were set to MICROCEPHALY 7, PRIMARY, AUTOSOMAL RECESSIVE; MCPH7
Clefting disorders v0.0 SOX2 Zornitza Stark gene: SOX2 was added
gene: SOX2 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: SOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SOX2 were set to MICROPHTHALMIA, SYNDROMIC 3; MCOPS3
Clefting disorders v0.0 SMOC1 Zornitza Stark gene: SMOC1 was added
gene: SMOC1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: SMOC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SMOC1 were set to MLA; MICROPHTHALMIA WITH LIMB ANOMALIES
Clefting disorders v0.0 SMAD2 Zornitza Stark gene: SMAD2 was added
gene: SMAD2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: SMAD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMAD2 were set to 29967133; 29392890
Phenotypes for gene: SMAD2 were set to Loeys-Dietz syndrome
Clefting disorders v0.0 SELENOI Zornitza Stark gene: SELENOI was added
gene: SELENOI was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: SELENOI was set to Unknown
Phenotypes for gene: SELENOI were set to Cleft palate
Clefting disorders v0.0 RSPO2 Zornitza Stark gene: RSPO2 was added
gene: RSPO2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: RSPO2 was set to Unknown
Phenotypes for gene: RSPO2 were set to Cleft lip
Clefting disorders v0.0 RPS19 Zornitza Stark gene: RPS19 was added
gene: RPS19 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: RPS19 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: RPS19 were set to DBA1; DIAMOND-BLACKFAN ANEMIA 1
Clefting disorders v0.0 RPS17 Zornitza Stark gene: RPS17 was added
gene: RPS17 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: RPS17 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: RPS17 were set to DIAMOND-BLACKFAN ANEMIA 4; DBA4
Clefting disorders v0.0 RPL11 Zornitza Stark gene: RPL11 was added
gene: RPL11 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: RPL11 was set to Unknown
Phenotypes for gene: RPL11 were set to Cleft palate
Clefting disorders v0.0 RBM8A Zornitza Stark gene: RBM8A was added
gene: RBM8A was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RBM8A were set to TAR; THROMBOCYTOPENIA-ABSENT RADIUS SYNDROME
Clefting disorders v0.0 RAI1 Zornitza Stark gene: RAI1 was added
gene: RAI1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: RAI1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: RAI1 were set to SMS; SMITH-MAGENIS SYNDROME
Clefting disorders v0.0 PTDSS1 Zornitza Stark gene: PTDSS1 was added
gene: PTDSS1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: PTDSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PTDSS1 were set to 25363158; 15194948; 26117586; 24241535
Phenotypes for gene: PTDSS1 were set to broad prominent forehead; delayed closure of the fontanelles; dental enamel hypoplasia; growth restriction; Lenz-Majewski hyperostotic dwarfism, 151050; choanal atresia; proximal symphalangism cutis laxa; progressive sclerosis and hyperostosis of skull, vertebra and tubular bones; brachydactyly of fingers and toes
Mode of pathogenicity for gene: PTDSS1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Clefting disorders v0.0 PSAT1 Zornitza Stark gene: PSAT1 was added
gene: PSAT1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: PSAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSAT1 were set to 25152457
Phenotypes for gene: PSAT1 were set to Neu-Laxova syndrome 2, 616038
Clefting disorders v0.0 PQBP1 Zornitza Stark gene: PQBP1 was added
gene: PQBP1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: PQBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PQBP1 were set to 7943045
Phenotypes for gene: PQBP1 were set to Renpenning syndrome, 309500
Clefting disorders v0.0 POMT2 Zornitza Stark gene: POMT2 was added
gene: POMT2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: POMT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POMT2 were set to 15894594
Phenotypes for gene: POMT2 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, 613150
Clefting disorders v0.0 POMT1 Zornitza Stark gene: POMT1 was added
gene: POMT1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: POMT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POMT1 were set to 12369018
Phenotypes for gene: POMT1 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, 236670
Clefting disorders v0.0 PLEKHA5 Zornitza Stark gene: PLEKHA5 was added
gene: PLEKHA5 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: PLEKHA5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PLEKHA5 were set to 29805042
Phenotypes for gene: PLEKHA5 were set to cleft lip
Clefting disorders v0.0 PLCB4 Zornitza Stark gene: PLCB4 was added
gene: PLCB4 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: PLCB4 was set to Unknown
Phenotypes for gene: PLCB4 were set to Cleft palate
Clefting disorders v0.0 PIK3R2 Zornitza Stark gene: PIK3R2 was added
gene: PIK3R2 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: PIK3R2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: PIK3R2 were set to MPPH1; MEGALENCEPHALY-POLYMICROGYRIA-POLYDACTYLY-HYDROCEPHALUS SYNDROME 1
Clefting disorders v0.0 PIGL Zornitza Stark gene: PIGL was added
gene: PIGL was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: PIGL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGL were set to 28371479
Phenotypes for gene: PIGL were set to CHIME; COLOBOMA, CONGENITAL HEART DISEASE, ICHTHYOSIFORM DERMATOSIS, MENTAL RETARDATION, AND EAR ANOMALIES SYNDROME
Clefting disorders v0.0 PIGA Zornitza Stark gene: PIGA was added
gene: PIGA was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: PIGA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PIGA were set to 22305531; 22514539
Phenotypes for gene: PIGA were set to MCAHS2; MULTIPLE CONGENITAL ANOMALIES-HYPOTONIA-SEIZURES SYNDROME 2
Clefting disorders v0.0 PGM1 Zornitza Stark gene: PGM1 was added
gene: PGM1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: PGM1 was set to Unknown
Phenotypes for gene: PGM1 were set to Cleft palate
Clefting disorders v0.0 PGAP2 Zornitza Stark gene: PGAP2 was added
gene: PGAP2 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: PGAP2 was set to Unknown
Phenotypes for gene: PGAP2 were set to HYPERPHOSPHATASIA WITH MENTAL RETARDATION SYNDROME 3; HPMRS3
Clefting disorders v0.0 NSDHL Zornitza Stark gene: NSDHL was added
gene: NSDHL was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NSDHL were set to CONGENITAL HEMIDYSPLASIA WITH ICHTHYOSIFORM ERYTHRODERMA AND LIMB DEFECTS
Clefting disorders v0.0 NKX2-6 Zornitza Stark gene: NKX2-6 was added
gene: NKX2-6 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: NKX2-6 was set to Unknown
Phenotypes for gene: NKX2-6 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS
Clefting disorders v0.0 NKX2-5 Zornitza Stark gene: NKX2-5 was added
gene: NKX2-5 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: NKX2-5 was set to Unknown
Publications for gene: NKX2-5 were set to 22155005
Phenotypes for gene: NKX2-5 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS
Clefting disorders v0.0 NBN Zornitza Stark gene: NBN was added
gene: NBN was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: NBN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NBN were set to 3857858; 22373003
Phenotypes for gene: NBN were set to Nijmegen breakage syndrome, 251260; NBS
Clefting disorders v0.0 METTL23 Zornitza Stark gene: METTL23 was added
gene: METTL23 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: METTL23 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: METTL23 were set to 24501276
Phenotypes for gene: METTL23 were set to Mental retardation, autosomal recessive 44, 615942; MRT44
Clefting disorders v0.0 MED12 Zornitza Stark gene: MED12 was added
gene: MED12 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: MED12 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: MED12 were set to 12784307
Phenotypes for gene: MED12 were set to Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate
Clefting disorders v0.0 LMX1B Zornitza Stark gene: LMX1B was added
gene: LMX1B was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: LMX1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: LMX1B were set to 2012138
Phenotypes for gene: LMX1B were set to Nail-patella syndrome, 161200
Clefting disorders v0.0 KIF22 Zornitza Stark gene: KIF22 was added
gene: KIF22 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: KIF22 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KIF22 were set to 22653704
Phenotypes for gene: KIF22 were set to SEMDJL2; Spondyloepimetaphyseal dysplasia with joint laxity, type 2, 603546
Clefting disorders v0.0 KAT6B Zornitza Stark gene: KAT6B was added
gene: KAT6B was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: KAT6B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KAT6B were set to 20182757; 27031267
Phenotypes for gene: KAT6B were set to Genitopatellar syndrome, 606170; GTPTS
Clefting disorders v0.0 KANSL1 Zornitza Stark gene: KANSL1 was added
gene: KANSL1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: KANSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KANSL1 were set to 20301783; 22544363
Phenotypes for gene: KANSL1 were set to KDVS; Koolen-De Vries syndrome, 610443
Clefting disorders v0.0 INTS1 Zornitza Stark gene: INTS1 was added
gene: INTS1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: INTS1 was set to Unknown
Phenotypes for gene: INTS1 were set to Cleft palate
Clefting disorders v0.0 HOXA2 Zornitza Stark gene: HOXA2 was added
gene: HOXA2 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Victorian Clinical Genetics Services
Mode of inheritance for gene: HOXA2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: HOXA2 were set to 18394579; 23775976; 27503514
Phenotypes for gene: HOXA2 were set to Ear anomalies and orofacial clefting; Microtia, Hearing Impairment, and Cleft Palate; Cleft palate; ?Microtia with or without hearing impairment (includes clefting), 612290, (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown); ?Microtia with or without hearing impairment (includes clefting), 612290, (BIALLELIC, autosomal or pseudoautosomal)
Clefting disorders v0.0 GYPE Zornitza Stark gene: GYPE was added
gene: GYPE was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: GYPE was set to Unknown
Clefting disorders v0.0 GRIP1 Zornitza Stark gene: GRIP1 was added
gene: GRIP1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: GRIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: GRIP1 were set to 22510445; 16894541; 18000968
Phenotypes for gene: GRIP1 were set to Fraser syndrome, 219000
Clefting disorders v0.0 GNAI3 Zornitza Stark gene: GNAI3 was added
gene: GNAI3 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: GNAI3 was set to Unknown
Phenotypes for gene: GNAI3 were set to Cleft palate
Clefting disorders v0.0 GMNN Zornitza Stark gene: GMNN was added
gene: GMNN was added to Clefting_GEL. Sources: Expert list,Expert Review Red,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: GMNN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: GMNN were set to 26637980
Phenotypes for gene: GMNN were set to Meier-Gorlin syndrome 6, 616835
Clefting disorders v0.0 GDF1 Zornitza Stark gene: GDF1 was added
gene: GDF1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: GDF1 was set to Unknown
Publications for gene: GDF1 were set to 16564040
Phenotypes for gene: GDF1 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS
Clefting disorders v0.0 GATA6 Zornitza Stark gene: GATA6 was added
gene: GATA6 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: GATA6 was set to Unknown
Publications for gene: GATA6 were set to 27391658
Phenotypes for gene: GATA6 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS
Clefting disorders v0.0 FREM2 Zornitza Stark gene: FREM2 was added
gene: FREM2 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: FREM2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FREM2 were set to 15838507; 16894541; 18671281; 18203166
Phenotypes for gene: FREM2 were set to Fraser syndrome, 219000
Clefting disorders v0.0 FOXE1 Zornitza Stark gene: FOXE1 was added
gene: FOXE1 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services
Mode of inheritance for gene: FOXE1 was set to Unknown
Phenotypes for gene: FOXE1 were set to Cleft palate
Clefting disorders v0.0 FANCL Zornitza Stark gene: FANCL was added
gene: FANCL was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Red
Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCL were set to 25754594
Phenotypes for gene: FANCL were set to Fanconi anemia, complementation group L, 614083
Clefting disorders v0.0 FAM111A Zornitza Stark gene: FAM111A was added
gene: FAM111A was added to Clefting_GEL. Sources: Expert list,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: FAM111A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FAM111A were set to 23684011; 16086393
Phenotypes for gene: FAM111A were set to 602361; Gracile bone dysplasia
Clefting disorders v0.0 EDN1 Zornitza Stark gene: EDN1 was added
gene: EDN1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: EDN1 was set to Unknown
Phenotypes for gene: EDN1 were set to Cleft palate
Clefting disorders v0.0 DNMT3B Zornitza Stark gene: DNMT3B was added
gene: DNMT3B was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNMT3B were set to 17893117; 23486536
Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1, 267000
Clefting disorders v0.0 DLG1 Zornitza Stark gene: DLG1 was added
gene: DLG1 was added to Clefting_GEL. Sources: Literature,Expert Review Red
Mode of inheritance for gene: DLG1 was set to Unknown
Publications for gene: DLG1 were set to PMID: 28926086
Phenotypes for gene: DLG1 were set to Non-syndromic cleft lip with or without cleft palate
Clefting disorders v0.0 DIS3L2 Zornitza Stark gene: DIS3L2 was added
gene: DIS3L2 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services
Mode of inheritance for gene: DIS3L2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DIS3L2 were set to 23486540; 22306653; 28328139
Phenotypes for gene: DIS3L2 were set to Perlman syndrome, 267000
Clefting disorders v0.0 COL9A3 Zornitza Stark gene: COL9A3 was added
gene: COL9A3 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services
Mode of inheritance for gene: COL9A3 was set to Unknown
Phenotypes for gene: COL9A3 were set to Cleft palate
Clefting disorders v0.0 CKAP2L Zornitza Stark gene: CKAP2L was added
gene: CKAP2L was added to Clefting_GEL. Sources: Expert list,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: CKAP2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CKAP2L were set to 12416644; 15365457
Phenotypes for gene: CKAP2L were set to Filippi syndrome, 272440
Clefting disorders v0.0 CHSY1 Zornitza Stark gene: CHSY1 was added
gene: CHSY1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red
Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHSY1 were set to 15365460
Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome, 605282; TPBS
Clefting disorders v0.0 CHD1 Zornitza Stark gene: CHD1 was added
gene: CHD1 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services
Mode of inheritance for gene: CHD1 was set to Unknown
Phenotypes for gene: CHD1 were set to Cleft palate
Clefting disorders v0.0 CASK Zornitza Stark gene: CASK was added
gene: CASK was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: CASK was set to Unknown
Phenotypes for gene: CASK were set to MENTAL RETARDATION AND MICROCEPHALY WITH PONTINE AND CEREBELLAR HYPOPLASIA; MICPCH
Clefting disorders v0.0 CANT1 Zornitza Stark gene: CANT1 was added
gene: CANT1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: CANT1 was set to Unknown
Publications for gene: CANT1 were set to 27881841
Phenotypes for gene: CANT1 were set to DBQD1; DESBUQUOIS DYSPLASIA 1
Clefting disorders v0.0 BMP4 Zornitza Stark gene: BMP4 was added
gene: BMP4 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services
Mode of inheritance for gene: BMP4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: BMP4 were set to Cleft lip with or without cleft palate, non syndromic, 11; MCOPS6, OROFACIAL CLEFT 11; OFC11; Orofacial Cleft; Cleft Lip with or without Cleft Palate; Cleft lip; MICROPHTHALMIA, SYNDROMIC 6; Orofacial cleft 11, 600625
Clefting disorders v0.0 B3GAT3 Zornitza Stark gene: B3GAT3 was added
gene: B3GAT3 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: B3GAT3 was set to Unknown
Phenotypes for gene: B3GAT3 were set to JDSCD; MULTIPLE JOINT DISLOCATIONS, SHORT STATURE, AND CRANIOFACIAL DYSMORPHISM WITH OR WITHOUT CONGENITAL HEART DEFECTS
Clefting disorders v0.0 ATRX Zornitza Stark gene: ATRX was added
gene: ATRX was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: ATRX was set to Unknown
Publications for gene: ATRX were set to 9788563
Phenotypes for gene: ATRX were set to MENTAL RETARDATION-HYPOTONIC FACIES SYNDROME, X-LINKED, 1; MRXHF1
Clefting disorders v0.0 ARCN1 Zornitza Stark gene: ARCN1 was added
gene: ARCN1 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: ARCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARCN1 were set to 27476655
Phenotypes for gene: ARCN1 were set to Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay 617164
Clefting disorders v0.0 ALG9 Zornitza Stark gene: ALG9 was added
gene: ALG9 was added to Clefting_GEL. Sources: Expert Review Red
Mode of inheritance for gene: ALG9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG9 were set to GILLESSEN-KAESBACH-NISHIMURA SYNDROME; GIKANIS
Clefting disorders v0.0 ACBD5 Zornitza Stark gene: ACBD5 was added
gene: ACBD5 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services
Mode of inheritance for gene: ACBD5 was set to Unknown
Phenotypes for gene: ACBD5 were set to Cleft palate
Clefting disorders v0.0 ZMPSTE24 Zornitza Stark gene: ZMPSTE24 was added
gene: ZMPSTE24 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: ZMPSTE24 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZMPSTE24 were set to RESTRICTIVE DERMOPATHY, LETHAL
Clefting disorders v0.0 ZBTB24 Zornitza Stark gene: ZBTB24 was added
gene: ZBTB24 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: ZBTB24 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZBTB24 were set to 23486536
Phenotypes for gene: ZBTB24 were set to IMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 2; ICF2
Clefting disorders v0.0 WDR60 Zornitza Stark gene: WDR60 was added
gene: WDR60 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: WDR60 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR60 were set to SRTD8; SHORT-RIB THORACIC DYSPLASIA 8 WITH OR WITHOUT POLYDACTYLY
Clefting disorders v0.0 WDR35 Zornitza Stark gene: WDR35 was added
gene: WDR35 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: WDR35 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR35 were set to SHORT-RIB THORACIC DYSPLASIA 7 WITH OR WITHOUT POLYDACTYLY; SRTD7
Clefting disorders v0.0 WDR34 Zornitza Stark gene: WDR34 was added
gene: WDR34 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: WDR34 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR34 were set to SRTD11; SHORT-RIB THORACIC DYSPLASIA 11 WITH OR WITHOUT POLYDACTYLY
Clefting disorders v0.0 WDR19 Zornitza Stark gene: WDR19 was added
gene: WDR19 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: WDR19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR19 were set to SRTD5; SHORT-RIB THORACIC DYSPLASIA 5 WITH OR WITHOUT POLYDACTYLY
Clefting disorders v0.0 TTC21B Zornitza Stark gene: TTC21B was added
gene: TTC21B was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: TTC21B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC21B were set to SHORT-RIB THORACIC DYSPLASIA 4 WITH OR WITHOUT POLYDACTYLY; SRTD4
Clefting disorders v0.0 TBX15 Zornitza Stark gene: TBX15 was added
gene: TBX15 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: TBX15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TBX15 were set to COUSIN SYNDROME
Clefting disorders v0.0 TBX1 Zornitza Stark gene: TBX1 was added
gene: TBX1 was added to Clefting_GEL. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: TBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: TBX1 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS; Cleft palate
Clefting disorders v0.0 SMG9 Zornitza Stark gene: SMG9 was added
gene: SMG9 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: SMG9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SMG9 were set to 27018474
Phenotypes for gene: SMG9 were set to HBMS; HEART AND BRAIN MALFORMATION SYNDROME
Clefting disorders v0.0 SEC23A Zornitza Stark gene: SEC23A was added
gene: SEC23A was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: SEC23A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SEC23A were set to CLSD; CRANIOLENTICULOSUTURAL DYSPLASIA
Clefting disorders v0.0 RYR1 Zornitza Stark gene: RYR1 was added
gene: RYR1 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: RYR1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: RYR1 were set to 23553484
Phenotypes for gene: RYR1 were set to CCD; CENTRAL CORE DISEASE OF MUSCLE
Clefting disorders v0.0 RPS28 Zornitza Stark gene: RPS28 was added
gene: RPS28 was added to Clefting_GEL. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: RPS28 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: RPS28 were set to DBA15; DIAMOND-BLACKFAN ANEMIA 15 WITH MANDIBULOFACIAL DYSOSTOSIS; Cleft palate
Clefting disorders v0.0 RBPJ Zornitza Stark gene: RBPJ was added
gene: RBPJ was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: RBPJ was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RBPJ were set to 28160419; 22883147
Phenotypes for gene: RBPJ were set to ADAMS-OLIVER SYNDROME
Clefting disorders v0.0 RARB Zornitza Stark gene: RARB was added
gene: RARB was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: RARB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RARB were set to MICROPHTHALMIA, SYNDROMIC 12; MCOPS12
Clefting disorders v0.0 POLR1A Zornitza Stark gene: POLR1A was added
gene: POLR1A was added to Clefting_GEL. Sources: Expert list,Expert Review Amber
Mode of inheritance for gene: POLR1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: POLR1A were set to 25913037
Phenotypes for gene: POLR1A were set to cleft palte
Clefting disorders v0.0 PLEKHA7 Zornitza Stark gene: PLEKHA7 was added
gene: PLEKHA7 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber
Mode of inheritance for gene: PLEKHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PLEKHA7 were set to 29805042
Phenotypes for gene: PLEKHA7 were set to cleft lip
Clefting disorders v0.0 PHGDH Zornitza Stark gene: PHGDH was added
gene: PHGDH was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: PHGDH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PHGDH were set to 25152457; 24836451
Phenotypes for gene: PHGDH were set to NEU-LAXOVA SYNDROME 1; NLS1
Clefting disorders v0.0 MEOX1 Zornitza Stark gene: MEOX1 was added
gene: MEOX1 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: MEOX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MEOX1 were set to 23290072; 24073994
Phenotypes for gene: MEOX1 were set to KLIPPEL-FEIL SYNDROME 2, AUTOSOMAL RECESSIVE; KFS2
Clefting disorders v0.0 MED25 Zornitza Stark gene: MED25 was added
gene: MED25 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: MED25 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED25 were set to 25792360
Phenotypes for gene: MED25 were set to BASEL-VANAGAITE-SMIRIN-YOSEF SYNDROME; BVSYS
Clefting disorders v0.0 MED13L Zornitza Stark gene: MED13L was added
gene: MED13L was added to Clefting_GEL. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: MED13L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MED13L were set to 25712080; 25137640
Phenotypes for gene: MED13L were set to Mental retardation and distinctive facial features with or without cardiac defects, 616789; Cleft palate; MRFACD
Clefting disorders v0.0 LMNA Zornitza Stark gene: LMNA was added
gene: LMNA was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: LMNA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LMNA were set to RESTRICTIVE DERMOPATHY, LETHAL
Clefting disorders v0.0 KDM1A Zornitza Stark gene: KDM1A was added
gene: KDM1A was added to Clefting_GEL. Sources: Expert Review Amber,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: KDM1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KDM1A were set to 23020937; 24838796; 26656649
Phenotypes for gene: KDM1A were set to Cleft palate,psychomotor retardation,distinctive facial features, 616728
Clefting disorders v0.0 IFT52 Zornitza Stark gene: IFT52 was added
gene: IFT52 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: IFT52 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT52 were set to SHORT-RIB THORACIC DYSPLASIA 16 WITH OR WITHOUT POLYDACTYLY; SRTD16
Clefting disorders v0.0 GNB1 Zornitza Stark gene: GNB1 was added
gene: GNB1 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: GNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: GNB1 were set to 27108799
Phenotypes for gene: GNB1 were set to Mental retardation, autosomal dominant 42, 616973
Clefting disorders v0.0 GATA3 Zornitza Stark gene: GATA3 was added
gene: GATA3 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber,Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: GATA3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: GATA3 were set to 10935639; 11389161; 28303854; 21834031; 19659764
Phenotypes for gene: GATA3 were set to HDR syndrome; Barakat syndrome; Hypoparathyroidism, sensorineural deafness, and renal dysplasia, 146255
Clefting disorders v0.0 FTO Zornitza Stark gene: FTO was added
gene: FTO was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: FTO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FTO were set to 26378117; 19559399
Phenotypes for gene: FTO were set to Growth retardation, developmental delay, facial dysmorphism, 612938; Lethal polymalformative syndrome, Boissel type
Clefting disorders v0.0 FOXP2 Zornitza Stark gene: FOXP2 was added
gene: FOXP2 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: FOXP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOXP2 were set to 27734906; 15326624
Phenotypes for gene: FOXP2 were set to Speech-language disorder-1, 602081
Clefting disorders v0.0 FBXO11 Zornitza Stark gene: FBXO11 was added
gene: FBXO11 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber
Mode of inheritance for gene: FBXO11 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FBXO11 were set to 17035249; 30057029; 30679813
Phenotypes for gene: FBXO11 were set to Intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, 618089; cleft lip
Clefting disorders v0.0 ESRP2 Zornitza Stark gene: ESRP2 was added
gene: ESRP2 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber
Mode of inheritance for gene: ESRP2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ESRP2 were set to 29805042
Phenotypes for gene: ESRP2 were set to cleft lip
Clefting disorders v0.0 DLX4 Zornitza Stark gene: DLX4 was added
gene: DLX4 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: DLX4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DLX4 were set to 25954033
Phenotypes for gene: DLX4 were set to nonsyndromic cleft/lip palate (CL/P); OFC15; OROFACIAL CLEFT 15; ?Orofacial cleft 15, 616788
Clefting disorders v0.0 DDX59 Zornitza Stark gene: DDX59 was added
gene: DDX59 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: DDX59 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDX59 were set to OROFACIODIGITAL SYNDROME V; OFD5
Clefting disorders v0.0 DDX3X Zornitza Stark gene: DDX3X was added
gene: DDX3X was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: DDX3X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: DDX3X were set to MRX102; MENTAL RETARDATION, X-LINKED 102
Clefting disorders v0.0 COL9A2 Zornitza Stark gene: COL9A2 was added
gene: COL9A2 was added to Clefting_GEL. Sources: Expert Review Amber,Illumina TruGenome Clinical Sequencing Services,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services
Mode of inheritance for gene: COL9A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COL9A2 were set to 21671392
Phenotypes for gene: COL9A2 were set to Stickler syndrome; Orofacial Clefting with skeletal features; ?Stickler syndrome type V, 614284; Cleft palate
Clefting disorders v0.0 CDC45 Zornitza Stark gene: CDC45 was added
gene: CDC45 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: CDC45 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDC45 were set to 27374770
Phenotypes for gene: CDC45 were set to Meier-Gorlin syndrome 7, 617063; MGORS7
Clefting disorders v0.0 BUB1B Zornitza Stark gene: BUB1B was added
gene: BUB1B was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: BUB1B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BUB1B were set to MVA1; MOSAIC VARIEGATED ANEUPLOIDY SYNDROME 1
Clefting disorders v0.0 B4GALT7 Zornitza Stark gene: B4GALT7 was added
gene: B4GALT7 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: B4GALT7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: B4GALT7 were set to 24755949
Phenotypes for gene: B4GALT7 were set to EHLERS-DANLOS SYNDROME WITH SHORT STATURE AND LIMB ANOMALIES; EDSSLA
Clefting disorders v0.0 B3GALT6 Zornitza Stark gene: B3GALT6 was added
gene: B3GALT6 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: B3GALT6 was set to Unknown
Phenotypes for gene: B3GALT6 were set to SPONDYLOEPIMETAPHYSEAL DYSPLASIA WITH JOINT LAXITY, TYPE 1, WITH OR WITHOUT FRACTURES; Ehlers-Danlos syndrome, progeroid type, 2 615349; SEMDJL1
Clefting disorders v0.0 ATR Zornitza Stark gene: ATR was added
gene: ATR was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: ATR was set to Unknown
Phenotypes for gene: ATR were set to SECKEL SYNDROME 1; SCKL1
Clefting disorders v0.0 ALX3 Zornitza Stark gene: ALX3 was added
gene: ALX3 was added to Clefting_GEL. Sources: Expert Review Amber
Mode of inheritance for gene: ALX3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALX3 were set to 19409524; 22106187; 19401770
Phenotypes for gene: ALX3 were set to FND1; Frontorhiny; FRONTONASAL DYSPLASIA 1
Clefting disorders v0.0 ALX1 Zornitza Stark gene: ALX1 was added
gene: ALX1 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber
Mode of inheritance for gene: ALX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALX1 were set to 26610632; 20451171; 27324866
Phenotypes for gene: ALX1 were set to ?Frontonasal dysplasia 3, 613456
Clefting disorders v0.0 ZSWIM6 Zornitza Stark gene: ZSWIM6 was added
gene: ZSWIM6 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ZSWIM6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ZSWIM6 were set to 25105228
Phenotypes for gene: ZSWIM6 were set to AFND; ACROMELIC FRONTONASAL DYSOSTOSIS
Clefting disorders v0.0 ZIC3 Zornitza Stark gene: ZIC3 was added
gene: ZIC3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ZIC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ZIC3 were set to VACTERL ASSOCIATION, X-LINKED, WITH OR WITHOUT HYDROCEPHALUS; VACTERLX
Clefting disorders v0.0 ZIC2 Zornitza Stark gene: ZIC2 was added
gene: ZIC2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ZIC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZIC2 were set to 19955556
Phenotypes for gene: ZIC2 were set to HOLOPROSENCEPHALY 5; HPE5
Clefting disorders v0.0 ZEB2 Zornitza Stark gene: ZEB2 was added
gene: ZEB2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ZEB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZEB2 were set to MOWAT-WILSON SYNDROME; MOWS
Clefting disorders v0.0 XYLT1 Zornitza Stark gene: XYLT1 was added
gene: XYLT1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: XYLT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: XYLT1 were set to DESBUQUOIS DYSPLASIA 2; DBQD2
Clefting disorders v0.0 WNT5A Zornitza Stark gene: WNT5A was added
gene: WNT5A was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: WNT5A were set to DRS1; ROBINOW SYNDROME, AUTOSOMAL DOMINANT 1
Clefting disorders v0.0 USP9X Zornitza Stark gene: USP9X was added
gene: USP9X was added to Clefting_GEL. Sources: Expert Review Green,Literature
Mode of inheritance for gene: USP9X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: USP9X were set to 26833328
Phenotypes for gene: USP9X were set to Mental retardation, X-linked 99 300919 XLR; Mental retardation, X-linked 99, syndromic, female-restricted 300968
Clefting disorders v0.0 TXNL4A Zornitza Stark gene: TXNL4A was added
gene: TXNL4A was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TXNL4A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TXNL4A were set to 25434003
Phenotypes for gene: TXNL4A were set to BURN-MCKEOWN SYNDROME; BMKS; Cleft palate
Clefting disorders v0.0 TUBB Zornitza Stark gene: TUBB was added
gene: TUBB was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TUBB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: TUBB were set to CSCSC1; SKIN CREASES, CONGENITAL SYMMETRIC CIRCUMFERENTIAL, 1
Clefting disorders v0.0 TRIM37 Zornitza Stark gene: TRIM37 was added
gene: TRIM37 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TRIM37 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIM37 were set to MULIBREY NANISM
Clefting disorders v0.0 TRAPPC9 Zornitza Stark gene: TRAPPC9 was added
gene: TRAPPC9 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TRAPPC9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC9 were set to 20004764
Phenotypes for gene: TRAPPC9 were set to MENTAL RETARDATION, AUTOSOMAL RECESSIVE 13; MRT13
Clefting disorders v0.0 TP63 Zornitza Stark gene: TP63 was added
gene: TP63 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services,Expert Review Green
Mode of inheritance for gene: TP63 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: TP63 were set to Orofacial cleft 8, EEC SYNDROME 3, Rapp Hodgkins syndrome, 129400; EEC3; Limb-mammary syndrome, 603543; AEC (Ankyloblepharon filiforme adnatum, Ectodermal defects and Clefting), Hay Wells syndrome 106260; EEC syndrome (Ectrodactyly, Ectodermal dysplasia and Clefting); ECTRODACTYLY, ECTODERMAL DYSPLASIA, AND CLEFT LIP/PALATE SYNDROME 3; Cleft lip; Ectrodactyly, ectodermal dysplasia, cleft lip/palate syndrome 3, 604292
Clefting disorders v0.0 TMCO1 Zornitza Stark gene: TMCO1 was added
gene: TMCO1 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TMCO1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMCO1 were set to CRANIOFACIAL DYSMORPHISM, SKELETAL ANOMALIES, AND MENTAL RETARDATION SYNDROME; CFSMR; Cleft palate
Clefting disorders v0.0 TGFBR2 Zornitza Stark gene: TGFBR2 was added
gene: TGFBR2 was added to Clefting_GEL. Sources: Expert Review Green,Expert Review
Mode of inheritance for gene: TGFBR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TGFBR2 were set to 12975342; 15731757; 16928994
Phenotypes for gene: TGFBR2 were set to Loeys-Dietz syndrome; Loeys-Dietz syndrome 2, 610168
Clefting disorders v0.0 TGFBR1 Zornitza Stark gene: TGFBR1 was added
gene: TGFBR1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TGFBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: TGFBR1 were set to LOEYS-DIETZ SYNDROME 1; LDS1
Clefting disorders v0.0 TGFB3 Zornitza Stark gene: TGFB3 was added
gene: TGFB3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TGFB3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: TGFB3 were set to LDS5; LOEYS-DIETZ SYNDROME 5
Clefting disorders v0.0 TGDS Zornitza Stark gene: TGDS was added
gene: TGDS was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TGDS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TGDS were set to 25480037
Phenotypes for gene: TGDS were set to CATEL-MANZKE SYNDROME; Cleft palate; CATMANS
Clefting disorders v0.0 TFAP2A Zornitza Stark gene: TFAP2A was added
gene: TFAP2A was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TFAP2A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TFAP2A were set to 10767004
Phenotypes for gene: TFAP2A were set to BRANCHIOOCULOFACIAL SYNDROME; BOFS; Cleft lip
Clefting disorders v0.0 TELO2 Zornitza Stark gene: TELO2 was added
gene: TELO2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TELO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TELO2 were set to YHFS; YOU-HOOVER-FONG SYNDROME
Clefting disorders v0.0 TCTN3 Zornitza Stark gene: TCTN3 was added
gene: TCTN3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TCTN3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCTN3 were set to OFD4; OROFACIODIGITAL SYNDROME IV
Clefting disorders v0.0 TCOF1 Zornitza Stark gene: TCOF1 was added
gene: TCOF1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: TCOF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TCOF1 were set to TREACHER COLLINS SYNDROME 1; TCS1
Clefting disorders v0.0 TBX22 Zornitza Stark gene: TBX22 was added
gene: TBX22 was added to Clefting_GEL. Sources: Expert Review Green,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services
Mode of inheritance for gene: TBX22 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: TBX22 were set to 19648124; 17846996; 21248356; 12374769; 11559848; 19648291; 22784330; 14729838
Phenotypes for gene: TBX22 were set to Cleft palate with ankyloglossia, 303400; Cleft palate; CPX; cleft lip; palate; CLEFT PALATE WITH OR WITHOUT ANKYLOGLOSSIA, X-LINKED; sub mucous cleft
Clefting disorders v0.0 STAMBP Zornitza Stark gene: STAMBP was added
gene: STAMBP was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: STAMBP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STAMBP were set to MICCAP; MICROCEPHALY-CAPILLARY MALFORMATION SYNDROME
Clefting disorders v0.0 SPECC1L Zornitza Stark gene: SPECC1L was added
gene: SPECC1L was added to Clefting_GEL. Sources: Expert Review Green,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: SPECC1L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPECC1L were set to 8849002; 21703590; 25412741; 1897571
Phenotypes for gene: SPECC1L were set to GBBB2; ?Facial clefting, oblique, 1, 600251; Opitz GBBB syndrome, type II (with clefting), 145410; OPITZ GBBB SYNDROME, TYPE II
Clefting disorders v0.0 SOX9 Zornitza Stark gene: SOX9 was added
gene: SOX9 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services,Expert Review Green
Mode of inheritance for gene: SOX9 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SOX9 were set to 7485151; 7990924; 24038782; 12783851; 19449405; 15806394; 8894698
Phenotypes for gene: SOX9 were set to CAMPOMELIC DYSPLASIA,114290; Campomelic dysplasia with autosomal sex reversal, 114290; CAMPOMELIC DYSPLASIA; Cleft palate; Cleft palate with skeletal abnormalities; Orofacial Clefting with Skeletal Features; Acampomelic campomelic dysplasia, 114290
Clefting disorders v0.0 SON Zornitza Stark gene: SON was added
gene: SON was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SON was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SON were set to 27545680
Phenotypes for gene: SON were set to ZTTK SYNDROME; ZTTKS
Clefting disorders v0.0 SNRPB Zornitza Stark gene: SNRPB was added
gene: SNRPB was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: SNRPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SNRPB were set to 25047197
Phenotypes for gene: SNRPB were set to CEREBROCOSTOMANDIBULAR SYNDROME; CCMS; Cleft palate
Clefting disorders v0.0 SMS Zornitza Stark gene: SMS was added
gene: SMS was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SMS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SMS were set to MRXSSR; MENTAL RETARDATION, X-LINKED, SYNDROMIC, SNYDER-ROBINSON TYPE
Clefting disorders v0.0 SMC3 Zornitza Stark gene: SMC3 was added
gene: SMC3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SMC3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SMC3 were set to CORNELIA DE LANGE SYNDROME 3; CDLS3
Clefting disorders v0.0 SMC1A Zornitza Stark gene: SMC1A was added
gene: SMC1A was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SMC1A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: SMC1A were set to CDLS2; CORNELIA DE LANGE SYNDROME 2
Clefting disorders v0.0 SMAD4 Zornitza Stark gene: SMAD4 was added
gene: SMAD4 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SMAD4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SMAD4 were set to MYHRE SYNDROME; MYHRS
Clefting disorders v0.0 SMAD3 Zornitza Stark gene: SMAD3 was added
gene: SMAD3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SMAD3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SMAD3 were set to LOEYS-DIETZ SYNDROME 3; LDS3
Clefting disorders v0.0 SLC26A2 Zornitza Stark gene: SLC26A2 was added
gene: SLC26A2 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: SLC26A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC26A2 were set to 12866518; 25667404; 8931695; 8571951; 10465113; 18708426; 15316973; 11565064; 7923357
Phenotypes for gene: SLC26A2 were set to De la Chapelle dysplasia (includes clefting), 256050; DIASTROPHIC DYSPLASIA; Diastrophic dysplasia (includes clefting), 222600; Atelosteogenesis II (includes clefting), 256050; DTD; Diastrophic dysplasia, broad bonehplatyspondylic variant, 222600; McAlister Dysplasia; Orofacial Clefting with skeletal features
Clefting disorders v0.0 SKI Zornitza Stark gene: SKI was added
gene: SKI was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SKI was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SKI were set to SHPRINTZEN-GOLDBERG CRANIOSYNOSTOSIS SYNDROME; SGS
Clefting disorders v0.0 SIX5 Zornitza Stark gene: SIX5 was added
gene: SIX5 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SIX5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SIX5 were set to BOR2; BRANCHIOOTORENAL SYNDROME 2
Clefting disorders v0.0 SIX3 Zornitza Stark gene: SIX3 was added
gene: SIX3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SIX3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SIX3 were set to HOLOPROSENCEPHALY 2; HPE2
Clefting disorders v0.0 SIX1 Zornitza Stark gene: SIX1 was added
gene: SIX1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SIX1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SIX1 were set to BOS3; BRANCHIOOTIC SYNDROME 3
Clefting disorders v0.0 SHH Zornitza Stark gene: SHH was added
gene: SHH was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SHH was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SHH were set to HOLOPROSENCEPHALY 3; HPE3
Clefting disorders v0.0 SF3B4 Zornitza Stark gene: SF3B4 was added
gene: SF3B4 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SF3B4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SF3B4 were set to 22541558
Phenotypes for gene: SF3B4 were set to ACROFACIAL DYSOSTOSIS 1, NAGER TYPE; AFD1
Clefting disorders v0.0 SEPT9 Zornitza Stark gene: SEPT9 was added
gene: SEPT9 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SEPT9 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SEPT9 were set to HNA; AMYOTROPHY, HEREDITARY NEURALGIC
Clefting disorders v0.0 SCARF2 Zornitza Stark gene: SCARF2 was added
gene: SCARF2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SCARF2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCARF2 were set to VDEGS; VAN DEN ENDE-GUPTA SYNDROME
Clefting disorders v0.0 SATB2 Zornitza Stark gene: SATB2 was added
gene: SATB2 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services
Mode of inheritance for gene: SATB2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SATB2 were set to 16179223
Phenotypes for gene: SATB2 were set to Glass syndrome; GLASS SYNDROME; Cleft palate; GLASS; Cleft palate, intellectual disability, poor- absent speech, bone fragility- raised serum alkaline phosphatas; Chromosome 2q32-q33 deletion syndrome; Orofacial Clefting with skeletal features
Clefting disorders v0.0 SALL4 Zornitza Stark gene: SALL4 was added
gene: SALL4 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: SALL4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SALL4 were set to DUANE-RADIAL RAY SYNDROME; DRRS
Clefting disorders v0.0 RPS26 Zornitza Stark gene: RPS26 was added
gene: RPS26 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RPS26 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RPS26 were set to 20116044
Phenotypes for gene: RPS26 were set to DBA10; DIAMOND-BLACKFAN ANEMIA 10; Cleft palate
Clefting disorders v0.0 RPL5 Zornitza Stark gene: RPL5 was added
gene: RPL5 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RPL5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RPL5 were set to 19061985
Phenotypes for gene: RPL5 were set to DIAMOND-BLACKFAN ANEMIA 6; Cleft palate; DBA6
Clefting disorders v0.0 ROR2 Zornitza Stark gene: ROR2 was added
gene: ROR2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ROR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ROR2 were set to ROBINOW SYNDROME, AUTOSOMAL RECESSIVE; RRS
Clefting disorders v0.0 RBM10 Zornitza Stark gene: RBM10 was added
gene: RBM10 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RBM10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: RBM10 were set to 20451169
Phenotypes for gene: RBM10 were set to TARPS; Cleft palate; TARP SYNDROME
Clefting disorders v0.0 PTCH1 Zornitza Stark gene: PTCH1 was added
gene: PTCH1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: PTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: PTCH1 were set to HPE7; BCNS, HOLOPROSENCEPHALY 7; BASAL CELL NEVUS SYNDROME
Clefting disorders v0.0 PORCN Zornitza Stark gene: PORCN was added
gene: PORCN was added to Clefting_GEL. Sources: Emory Genetics Laboratory,Expert list,Radboud University Medical Center, Nijmegen,Expert Review Green
Mode of inheritance for gene: PORCN was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: PORCN were set to 12071796; 21484999; 20301712; 10602117; 13948891; 18325042
Phenotypes for gene: PORCN were set to GOLTZ SYNDROME; Focal dermal hypoplasia, 305600
Clefting disorders v0.0 POLR1D Zornitza Stark gene: POLR1D was added
gene: POLR1D was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: POLR1D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: POLR1D were set to TCS2; TREACHER COLLINS SYNDROME 2
Clefting disorders v0.0 POLR1C Zornitza Stark gene: POLR1C was added
gene: POLR1C was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: POLR1C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLR1C were set to TREACHER COLLINS SYNDROME 3; TCS3
Clefting disorders v0.0 PIGV Zornitza Stark gene: PIGV was added
gene: PIGV was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: PIGV was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGV were set to 24129430; 21739589
Phenotypes for gene: PIGV were set to HYPERPHOSPHATASIA WITH MENTAL RETARDATION SYNDROME 1; HPMRS1
Clefting disorders v0.0 PIGN Zornitza Stark gene: PIGN was added
gene: PIGN was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: PIGN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGN were set to 27038415; 24852103
Phenotypes for gene: PIGN were set to MULTIPLE CONGENITAL ANOMALIES-HYPOTONIA-SEIZURES SYNDROME 1; MCAHS1
Clefting disorders v0.0 PIEZO2 Zornitza Stark gene: PIEZO2 was added
gene: PIEZO2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: PIEZO2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PIEZO2 were set to 24726473
Phenotypes for gene: PIEZO2 were set to MWKS; DA3, MARDEN-WALKER SYNDROME; ARTHROGRYPOSIS, DISTAL, TYPE 3
Clefting disorders v0.0 PHF8 Zornitza Stark gene: PHF8 was added
gene: PHF8 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: PHF8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHF8 were set to MRXSSD; SIDERIUS X-LINKED MENTAL RETARDATION SYNDROME; Cleft lip
Clefting disorders v0.0 PAX3 Zornitza Stark gene: PAX3 was added
gene: PAX3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: PAX3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: PAX3 were set to WAARDENBURG
Clefting disorders v0.0 OFD1 Zornitza Stark gene: OFD1 was added
gene: OFD1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: OFD1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: OFD1 were set to OROFACIODIGITAL SYNDROME I; OFD1
Clefting disorders v0.0 NOTCH1 Zornitza Stark gene: NOTCH1 was added
gene: NOTCH1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: NOTCH1 were set to ADAMS-OLIVER SYNDROME
Clefting disorders v0.0 NIPBL Zornitza Stark gene: NIPBL was added
gene: NIPBL was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: NIPBL were set to CDLS1; CORNELIA DE LANGE SYNDROME 1
Clefting disorders v0.0 NEK1 Zornitza Stark gene: NEK1 was added
gene: NEK1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: NEK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEK1 were set to SHORT-RIB THORACIC DYSPLASIA 6 WITH OR WITHOUT POLYDACTYLY; SRTD6
Clefting disorders v0.0 NEDD4L Zornitza Stark gene: NEDD4L was added
gene: NEDD4L was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services,Literature,Expert Review
Mode of inheritance for gene: NEDD4L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NEDD4L were set to 27694961
Phenotypes for gene: NEDD4L were set to Periventricular nodular heterotopia 7 (includes clefting), 617201; Cleft palate; Cleft palate, toe syndactyly, periventricular nodular heterotopia
Clefting disorders v0.0 NECTIN1 Zornitza Stark gene: NECTIN1 was added
gene: NECTIN1 was added to Clefting_GEL. Sources: Expert Review Green,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services
Mode of inheritance for gene: NECTIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NECTIN1 were set to 10932188; 26953873; 11559849
Phenotypes for gene: NECTIN1 were set to Cleft Lip with or without Cleft Palate; CLP, partial syndactyly of digits, intellectual disability, dysmorphism; Orofacial cleft 7, 225060; Cleft lip/Palate ectodermal dysplasia syndrome, 225060; Ectodermal dysplasia, Margarita Island type; Cleft lip; Zlotogora-Ogur syndrome
Clefting disorders v0.0 MYMK Zornitza Stark gene: MYMK was added
gene: MYMK was added to Clefting_GEL. Sources: Expert Review Green,Literature
Mode of inheritance for gene: MYMK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYMK were set to 28681861
Phenotypes for gene: MYMK were set to Carey-Fineman-Ziter syndrome 254940
Clefting disorders v0.0 MSX1 Zornitza Stark gene: MSX1 was added
gene: MSX1 was added to Clefting_GEL. Sources: Expert Review Green,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services
Mode of inheritance for gene: MSX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MSX1 were set to 16498076; 10742093; 27228008; 15264286; 12097313; 12807959; 25565750
Phenotypes for gene: MSX1 were set to Tooth agenesis, selective, 1, with or without orofacial cleft, 106600; Orofacial cleft 5, 608874; Cleft lip; CLP with dental anomalies
Clefting disorders v0.0 MKS1 Zornitza Stark gene: MKS1 was added
gene: MKS1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: MKS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MKS1 were set to 24643152; 26037304; 25182137
Phenotypes for gene: MKS1 were set to Meckel syndrome 1, 249000; Meckel-Gruber Syndrome (MGS); MKS1
Clefting disorders v0.0 MID1 Zornitza Stark gene: MID1 was added
gene: MID1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: MID1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: MID1 were set to OPITZ GBBB SYNDROME, TYPE I; GBBB1
Clefting disorders v0.0 MEIS2 Zornitza Stark gene: MEIS2 was added
gene: MEIS2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services,Expert Review
Mode of inheritance for gene: MEIS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MEIS2 were set to 25712757; 27225850; 24678003
Phenotypes for gene: MEIS2 were set to intellectual disability; cardiac defects; Orofacial clefting; Cleft palate
Clefting disorders v0.0 MBTPS2 Zornitza Stark gene: MBTPS2 was added
gene: MBTPS2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: MBTPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MBTPS2 were set to IFAP SYNDROME WITH OR WITHOUT BRESHECK SYNDROME
Clefting disorders v0.0 MASP1 Zornitza Stark gene: MASP1 was added
gene: MASP1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: MASP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MASP1 were set to 3MC1; 3MC SYNDROME 1
Clefting disorders v0.0 MAPRE2 Zornitza Stark gene: MAPRE2 was added
gene: MAPRE2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: MAPRE2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: MAPRE2 were set to SKIN CREASES, CONGENITAL SYMMETRIC CIRCUMFERENTIAL, 2; CSCSC2
Clefting disorders v0.0 MAP3K7 Zornitza Stark gene: MAP3K7 was added
gene: MAP3K7 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: MAP3K7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAP3K7 were set to 28498505; 25899317
Phenotypes for gene: MAP3K7 were set to AD-FMD; Frontometaphyseal dysplasia 2, 617137; autosomal dominant FMD; FMD2
Clefting disorders v0.0 KMT2D Zornitza Stark gene: KMT2D was added
gene: KMT2D was added to Clefting_GEL. Sources: Expert Review,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Green,Literature
Mode of inheritance for gene: KMT2D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KMT2D were set to 22126750; 20711175; 21671394; 26049589; 25142838
Phenotypes for gene: KMT2D were set to Kabuki syndrome 1, 147920
Clefting disorders v0.0 KIF7 Zornitza Stark gene: KIF7 was added
gene: KIF7 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: KIF7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF7 were set to 21552264
Phenotypes for gene: KIF7 were set to ACLS; ACROCALLOSAL SYNDROME
Clefting disorders v0.0 KIF1BP Zornitza Stark gene: KIF1BP was added
gene: KIF1BP was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF1BP were set to 16760737; 7338549
Phenotypes for gene: KIF1BP were set to GOSHS; Goldberg-Shprintzen megacolon syndrome, 609460
Clefting disorders v0.0 KIAA0586 Zornitza Stark gene: KIAA0586 was added
gene: KIAA0586 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: KIAA0586 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KIAA0586 were set to SRTD14; SHORT-RIB THORACIC DYSPLASIA 14 WITH POLYDACTYLY
Clefting disorders v0.0 KDM6A Zornitza Stark gene: KDM6A was added
gene: KDM6A was added to Clefting_GEL. Sources: Expert Review,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Green
Mode of inheritance for gene: KDM6A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: KDM6A were set to 24664873; 22197486; 23076834
Phenotypes for gene: KDM6A were set to Kabuki syndrome 2, 300867
Clefting disorders v0.0 KCNJ2 Zornitza Stark gene: KCNJ2 was added
gene: KCNJ2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: KCNJ2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KCNJ2 were set to 12163457
Phenotypes for gene: KCNJ2 were set to ANDERSEN CARDIODYSRHYTHMIC PERIODIC PARALYSIS; Cleft palate
Clefting disorders v0.0 KAT6A Zornitza Stark gene: KAT6A was added
gene: KAT6A was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: KAT6A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: KAT6A were set to MENTAL RETARDATION, AUTOSOMAL DOMINANT 32; MRD32
Clefting disorders v0.0 IRF6 Zornitza Stark gene: IRF6 was added
gene: IRF6 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen,Eligibility statement prior genetic testing,Victorian Clinical Genetics Services,Expert Review Green
Mode of inheritance for gene: IRF6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: IRF6 were set to lip pits; Cleft palate; Orofacial cleft 6, 608864; VWS1, POPLITEAL PTERYGIUM SYNDROME; Cleft Lip with or without Cleft Palate; VAN DER WOUDE SYNDROME 1; PPS; Cleft lip +/- palate- unilateral or bilateral; Orofacial Clefting with skeletal features; cleft palate
Clefting disorders v0.0 IMPAD1 Zornitza Stark gene: IMPAD1 was added
gene: IMPAD1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: IMPAD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IMPAD1 were set to 22887726; 21549340
Phenotypes for gene: IMPAD1 were set to Chondrodysplasia with joint dislocations, GPAPP type, 614078 (includes cleft palate)
Clefting disorders v0.0 IFT80 Zornitza Stark gene: IFT80 was added
gene: IFT80 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: IFT80 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT80 were set to SHORT-RIB THORACIC DYSPLASIA 2 WITH OR WITHOUT POLYDACTYLY; SRTD2
Clefting disorders v0.0 IFT172 Zornitza Stark gene: IFT172 was added
gene: IFT172 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: IFT172 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT172 were set to SRTD10; SHORT-RIB THORACIC DYSPLASIA 10 WITH OR WITHOUT POLYDACTYLY
Clefting disorders v0.0 IFT140 Zornitza Stark gene: IFT140 was added
gene: IFT140 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: IFT140 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT140 were set to SHORT-RIB THORACIC DYSPLASIA 9 WITH OR WITHOUT POLYDACTYLY; SRTD9
Clefting disorders v0.0 ICK Zornitza Stark gene: ICK was added
gene: ICK was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ICK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ICK were set to 19185282; 27069622; 24853502
Phenotypes for gene: ICK were set to ECO; Endocrine-cerebroosteodysplasia, 612651 (includes cleft lip, cleft palate)
Clefting disorders v0.0 HYLS1 Zornitza Stark gene: HYLS1 was added
gene: HYLS1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: HYLS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HYLS1 were set to 3296755; 22029171; 8322817; 15843405
Phenotypes for gene: HYLS1 were set to Hydrolethalus syndrome, 236680 (includes Cleft palate, Lateral or midline cleft lip, Lower lip cleft)
Clefting disorders v0.0 HDAC8 Zornitza Stark gene: HDAC8 was added
gene: HDAC8 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: HDAC8 were set to CDLS5; CORNELIA DE LANGE SYNDROME 5
Clefting disorders v0.0 GRHL3 Zornitza Stark gene: GRHL3 was added
gene: GRHL3 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: GRHL3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: GRHL3 were set to Cleft lip; VAN DER WOUDE SYNDROME 2
Clefting disorders v0.0 GPC3 Zornitza Stark gene: GPC3 was added
gene: GPC3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: GPC3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: GPC3 were set to SIMPSON-GOLABI-BEHMEL SYNDROME, TYPE 1; SGBS1
Clefting disorders v0.0 GLI3 Zornitza Stark gene: GLI3 was added
gene: GLI3 was added to Clefting_GEL. Sources: Expert list,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: GLI3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: GLI3 were set to 15739154; 24736735; 7211952; 20301638; 1605268
Phenotypes for gene: GLI3 were set to Pallister-Hall syndrome, 146510
Clefting disorders v0.0 GJA1 Zornitza Stark gene: GJA1 was added
gene: GJA1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Expert Review Green
Mode of inheritance for gene: GJA1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: GJA1 were set to 1057461; 12457340; 19338053; 15108203
Phenotypes for gene: GJA1 were set to Oculodentodigital dysplasia,164200; ODDD
Clefting disorders v0.0 FRAS1 Zornitza Stark gene: FRAS1 was added
gene: FRAS1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Expert Review Green
Mode of inheritance for gene: FRAS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRAS1 were set to 17163535; 16894541; 18203166; 18671281
Phenotypes for gene: FRAS1 were set to Fraser syndrome, 219000
Clefting disorders v0.0 FOXC2 Zornitza Stark gene: FOXC2 was added
gene: FOXC2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: FOXC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: FOXC2 were set to Cleft palate; LYMPHEDEMA-DISTICHIASIS SYNDROME
Clefting disorders v0.0 FLNB Zornitza Stark gene: FLNB was added
gene: FLNB was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: FLNB was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: FLNB were set to Spondylocarpotarsal synostosis syndrome (includes clefting), BIALLELIC, autosomal or pseudoautosomal, 272460; Atelosteogenesis, type I (includes clefting), MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown, 108720; Atelosteogenesis, type III MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown (includes clefting), 108721; Larsen syndrome (includes clefting) MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown, 150250; Orofacial Clefting with skeletal features; Skeletal dysplasia with midline cleft palate
Clefting disorders v0.0 FLNA Zornitza Stark gene: FLNA was added
gene: FLNA was added to Clefting_GEL. Sources: Expert Review Green,UKGTN
Mode of inheritance for gene: FLNA was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: FLNA were set to 10706363; 20301567; 12612583; 16538226
Phenotypes for gene: FLNA were set to OTOPALATODIGITAL SYNDROME, TYPE I; Otopalatodigital syndrome, type II, 304120 (includes clefting); Orofacial Clefting with skeletal anomalies; OPD1, OTOPALATODIGITAL SYNDROME, TYPE II; OPD2, FRONTOMETAPHYSEAL DYSPLASIA 1; FMD1; Melnick-Needles syndrome, 309350 (includes clefting); Otopalatodigital syndrome, type I, 311300 (includes clefting)
Clefting disorders v0.0 FGFR2 Zornitza Stark gene: FGFR2 was added
gene: FGFR2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: FGFR2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: FGFR2 were set to APERT SYNDROME
Clefting disorders v0.0 FGFR1 Zornitza Stark gene: FGFR1 was added
gene: FGFR1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: FGFR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FGFR1 were set to 19504604; 25394172; 1342859; 16606836; 14564207; 12627230
Phenotypes for gene: FGFR1 were set to Kallmann syndrome 2; Hartsfield syndrome, 615465; Hypogonadotropic hypogonadism 2 with or without anosmia, 147950
Clefting disorders v0.0 FGD1 Zornitza Stark gene: FGD1 was added
gene: FGD1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: FGD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: FGD1 were set to 20082460
Phenotypes for gene: FGD1 were set to AARSKOG-SCOTT SYNDROME; AAS
Clefting disorders v0.0 FAM20C Zornitza Stark gene: FAM20C was added
gene: FAM20C was added to Clefting_GEL. Sources: Emory Genetics Laboratory,Expert list,Radboud University Medical Center, Nijmegen,Expert Review Green
Mode of inheritance for gene: FAM20C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM20C were set to 2194867118000911; 2614802; 25974638; 17924334; 10482879
Phenotypes for gene: FAM20C were set to Raine syndrome, 259775
Clefting disorders v0.0 EYA1 Zornitza Stark gene: EYA1 was added
gene: EYA1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: EYA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EYA1 were set to BOR1; BRANCHIOOTORENAL SYNDROME 1
Clefting disorders v0.0 ESCO2 Zornitza Stark gene: ESCO2 was added
gene: ESCO2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ESCO2 were set to ROBERTS SYNDROME; RBS, SC PHOCOMELIA SYNDROME
Clefting disorders v0.0 EPG5 Zornitza Stark gene: EPG5 was added
gene: EPG5 was added to Clefting_GEL. Sources: Expert list,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Green
Mode of inheritance for gene: EPG5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EPG5 were set to 23222957; 26927810; 20583151; 3344762; 17163544
Phenotypes for gene: EPG5 were set to Vici syndrome, 242840
Clefting disorders v0.0 EOGT Zornitza Stark gene: EOGT was added
gene: EOGT was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: EOGT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EOGT were set to ADAMS-OLIVER SYNDROME
Clefting disorders v0.0 EIF4A3 Zornitza Stark gene: EIF4A3 was added
gene: EIF4A3 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EIF4A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF4A3 were set to 10594883; 29112243; 29922329
Phenotypes for gene: EIF4A3 were set to Richieri-Costa-Pereira syndrome; Robin sequence with cleft mandible and limb anomalies, 268305; Cleft palate
Clefting disorders v0.0 EIF2S3 Zornitza Stark gene: EIF2S3 was added
gene: EIF2S3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: EIF2S3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: EIF2S3 were set to MRXSBRK; MENTAL RETARDATION, X-LINKED, SYNDROMIC, BORCK TYPE
Clefting disorders v0.0 EFTUD2 Zornitza Stark gene: EFTUD2 was added
gene: EFTUD2 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: EFTUD2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: EFTUD2 were set to MANDIBULOFACIAL DYSOSTOSIS, GUION-ALMEIDA TYPE; MFDGA
Clefting disorders v0.0 EFNB1 Zornitza Stark gene: EFNB1 was added
gene: EFNB1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: EFNB1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: EFNB1 were set to CRANIOFRONTONASAL SYNDROME; CFNS
Clefting disorders v0.0 EDNRA Zornitza Stark gene: EDNRA was added
gene: EDNRA was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EDNRA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: EDNRA were set to MANDIBULOFACIAL DYSOSTOSIS WITH ALOPECIA; MFDA; Cleft palate
Clefting disorders v0.0 EBP Zornitza Stark gene: EBP was added
gene: EBP was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: EBP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: EBP were set to MEND SYNDROME; MEND
Clefting disorders v0.0 DYNC2LI1 Zornitza Stark gene: DYNC2LI1 was added
gene: DYNC2LI1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: DYNC2LI1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DYNC2LI1 were set to SHORT-RIB THORACIC DYSPLASIA 15 WITH POLYDACTYLY; SRTD15
Clefting disorders v0.0 DYNC2H1 Zornitza Stark gene: DYNC2H1 was added
gene: DYNC2H1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: DYNC2H1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DYNC2H1 were set to SHORT-RIB THORACIC DYSPLASIA 3 WITH OR WITHOUT POLYDACTYLY; SRTD3
Clefting disorders v0.0 DVL3 Zornitza Stark gene: DVL3 was added
gene: DVL3 was added to Clefting_GEL. Sources: Expert Review Green,Other
Mode of inheritance for gene: DVL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DVL3 were set to 26924530; 29575616
Phenotypes for gene: DVL3 were set to Robinow syndrome, autosomal dominant 3, 616894
Clefting disorders v0.0 DVL1 Zornitza Stark gene: DVL1 was added
gene: DVL1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: DVL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: DVL1 were set to DRS2; ROBINOW SYNDROME, AUTOSOMAL DOMINANT 2
Clefting disorders v0.0 DOCK6 Zornitza Stark gene: DOCK6 was added
gene: DOCK6 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: DOCK6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DOCK6 were set to ADAMS-OLIVER SYNDROME
Clefting disorders v0.0 DLL4 Zornitza Stark gene: DLL4 was added
gene: DLL4 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: DLL4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: DLL4 were set to ADAMS-OLIVER SYNDROME
Clefting disorders v0.0 DHODH Zornitza Stark gene: DHODH was added
gene: DHODH was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: DHODH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHODH were set to POADS = MILLER; POSTAXIAL ACROFACIAL DYSOSTOSIS
Clefting disorders v0.0 DHCR7 Zornitza Stark gene: DHCR7 was added
gene: DHCR7 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHCR7 were set to SMITH-LEMLI-OPITZ SYNDROME; SLOS
Clefting disorders v0.0 CTNND1 Zornitza Stark gene: CTNND1 was added
gene: CTNND1 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CTNND1 were set to 28301459
Phenotypes for gene: CTNND1 were set to BLEPHAROCHEILODONTIC; Cleft palate
Clefting disorders v0.0 CTCF Zornitza Stark gene: CTCF was added
gene: CTCF was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: CTCF was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: CTCF were set to MENTAL RETARDATION, AUTOSOMAL DOMINANT 21; MRD21
Clefting disorders v0.0 COLEC11 Zornitza Stark gene: COLEC11 was added
gene: COLEC11 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: COLEC11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COLEC11 were set to 3MC2; 3MC SYNDROME 2
Clefting disorders v0.0 COLEC10 Zornitza Stark gene: COLEC10 was added
gene: COLEC10 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: COLEC10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COLEC10 were set to 21258343
Phenotypes for gene: COLEC10 were set to 3MC SYNDROME 3; 3MC3
Clefting disorders v0.0 COL9A1 Zornitza Stark gene: COL9A1 was added
gene: COL9A1 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services
Mode of inheritance for gene: COL9A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COL9A1 were set to 16909383; 21421862
Phenotypes for gene: COL9A1 were set to Autosomal recessive Stickler syndrome; Stickler syndrome, type IV (ophthalmological: myopia, retinal detachment and cataracts, orofacial: micrognathia, midface hypoplasia and cleft palate, auditory:sensorineural hearing loss and articular: epiphyseal dysplasia) symptoms; Orofacial Clefting with skeletal features; Cleft palate
Clefting disorders v0.0 COL2A1 Zornitza Stark gene: COL2A1 was added
gene: COL2A1 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Victorian Clinical Genetics Services,Eligibility statement prior genetic testing
Mode of inheritance for gene: COL2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: COL2A1 were set to 16752401; 17721977; 1677770
Phenotypes for gene: COL2A1 were set to STL1; Stickler syndrome (cleft palate,micrognathia,vireo-retinal anomalies, severe myopia, joint problems, hearing loss); Stickler sydrome, type I, non syndromic ocular; Cleft palate; STICKLER SYNDROME, MEMBRANOUS VITREOUS TYPE; ARTHROOPHTHALMOPATHY, HEREDITARY PROGRESSIVE, AOM; STICKLER SYNDROME, TYPE I; Orofacial Clefting with skeletal features; Stickler Syndrome; STICKLER SYNDROME, TYPE I (STL1), 108300; STICKLER SYNDROME, VITREOUS TYPE 1
Clefting disorders v0.0 COL11A2 Zornitza Stark gene: COL11A2 was added
gene: COL11A2 was added to Clefting_GEL. Sources: UKGTN,Radboud University Medical Center, Nijmegen,Eligibility statement prior genetic testing,Victorian Clinical Genetics Services,Expert Review Green
Mode of inheritance for gene: COL11A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL11A2 were set to Cleft palate; OSMED; STL3; Stickler syndrome, type III; Non-ocular Stickler syndrome; STICKLER SYNDROME, NONOCULAR TYPE
Clefting disorders v0.0 COL11A1 Zornitza Stark gene: COL11A1 was added
gene: COL11A1 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Victorian Clinical Genetics Services,Eligibility statement prior genetic testing
Mode of inheritance for gene: COL11A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL11A1 were set to Orofacial Clefting with skeletal features; Stickler Syndrome; Cleft palate
Clefting disorders v0.0 CHST14 Zornitza Stark gene: CHST14 was added
gene: CHST14 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: CHST14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHST14 were set to EHLERS-DANLOS SYNDROME, MUSCULOCONTRACTURAL TYPE, 1; EDSMC1
Clefting disorders v0.0 CHRNG Zornitza Stark gene: CHRNG was added
gene: CHRNG was added to Clefting_GEL. Sources: Expert list,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: CHRNG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHRNG were set to 16826520; 22167768; 27843868
Phenotypes for gene: CHRNG were set to PTERYGIUM SYNDROME, MULTIPLE, LETHAL TYPE; MULTIPLE PTERYGIUM SYNDROME, NONLETHAL TYPE; Multiple pterygium syndrome, lethal type, 253290; Escobar syndrome, 265000
Clefting disorders v0.0 CHD7 Zornitza Stark gene: CHD7 was added
gene: CHD7 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: CHD7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: CHD7 were set to CHARGE SYNDROME
Clefting disorders v0.0 CDKN1C Zornitza Stark gene: CDKN1C was added
gene: CDKN1C was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: CDKN1C was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Publications for gene: CDKN1C were set to 20503313
Phenotypes for gene: CDKN1C were set to BECKWITH-WIEDEMANN SYNDROME; BWS
Clefting disorders v0.0 CDH1 Zornitza Stark gene: CDH1 was added
gene: CDH1 was added to Clefting_GEL. Sources: Expert Review Green,Other
Mode of inheritance for gene: CDH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CDH1 were set to 27566442; 28301459
Phenotypes for gene: CDH1 were set to Blepharocheilodontic syndrome 1; BLEPHAROCHEILODONTIC
Clefting disorders v0.0 CC2D2A Zornitza Stark gene: CC2D2A was added
gene: CC2D2A was added to Clefting_GEL. Sources: Expert list,Expert Review Green
Mode of inheritance for gene: CC2D2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CC2D2A were set to 18513680; 19777577
Phenotypes for gene: CC2D2A were set to MKS6; Meckel-Gruber syndrome; Meckel syndrome 6, 612284
Clefting disorders v0.0 C5orf42 Zornitza Stark gene: C5orf42 was added
gene: C5orf42 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: C5orf42 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C5orf42 were set to OFD6; OROFACIODIGITAL SYNDROME VI
Clefting disorders v0.0 C2CD3 Zornitza Stark gene: C2CD3 was added
gene: C2CD3 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: C2CD3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C2CD3 were set to OFD14; OROFACIODIGITAL SYNDROME XIV
Clefting disorders v0.0 BMP2 Zornitza Stark gene: BMP2 was added
gene: BMP2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: BMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: BMP2 were set to 29198724; 21671386
Phenotypes for gene: BMP2 were set to Short stature, facial dysmorphism, and skeletal anomalies with or without cardiac anomalies, 617877; Cleft palate
Clefting disorders v0.0 BCOR Zornitza Stark gene: BCOR was added
gene: BCOR was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: BCOR was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: BCOR were set to MCOPS2; MICROPHTHALMIA, SYNDROMIC 2
Clefting disorders v0.0 B3GLCT Zornitza Stark gene: B3GLCT was added
gene: B3GLCT was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B3GLCT were set to PETERS-PLUS SYNDROME
Clefting disorders v0.0 ASXL1 Zornitza Stark gene: ASXL1 was added
gene: ASXL1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ASXL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: ASXL1 were set to BOPS; BOHRING-OPITZ SYNDROME
Clefting disorders v0.0 ARHGAP31 Zornitza Stark gene: ARHGAP31 was added
gene: ARHGAP31 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: ARHGAP31 were set to AOS1; ADAMS-OLIVER SYNDROME 1
Clefting disorders v0.0 ARHGAP29 Zornitza Stark gene: ARHGAP29 was added
gene: ARHGAP29 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services,Research
Mode of inheritance for gene: ARHGAP29 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARHGAP29 were set to 23008150; 27369588; 25704602; 27350171; 25512736; 27033726; 28029220
Phenotypes for gene: ARHGAP29 were set to cleft lip with or without cleft palate; Cleft palate
Clefting disorders v0.0 ANKRD11 Zornitza Stark gene: ANKRD11 was added
gene: ANKRD11 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: ANKRD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKRD11 were set to 25838844; 2705097; 21782149; 27900361
Phenotypes for gene: ANKRD11 were set to Short stature-facial and skeletal anomalies-intellectual disability-macrodontia syndrome; Orofacial Clefting with skeletal features; KBG syndrome,148050 (orofacial clefting, intellectual disability, dental anomalies, dysmorphism)
Clefting disorders v0.0 AMER1 Zornitza Stark gene: AMER1 was added
gene: AMER1 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: AMER1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: AMER1 were set to OSTEOPATHIA STRIATA WITH CRANIAL SCLEROSIS; OSCS; Cleft palate
Clefting disorders v0.0 ACTG1 Zornitza Stark gene: ACTG1 was added
gene: ACTG1 was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ACTG1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ACTG1 were set to 22366783
Phenotypes for gene: ACTG1 were set to BARAITSER-WINTER SYNDROME 2; BRWS2
Clefting disorders v0.0 ACTB Zornitza Stark gene: ACTB was added
gene: ACTB was added to Clefting_GEL. Sources: Expert Review Green
Mode of inheritance for gene: ACTB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ACTB were set to 22366783
Phenotypes for gene: ACTB were set to BRWS1; BARAITSER-WINTER SYNDROME 1
Clefting disorders v0.0 Zornitza Stark Added panel Clefting_GEL