| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Clefting disorders v0.312 | LRRC32 | Zornitza Stark Publications for gene: LRRC32 were set to PMID: 30976112 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.311 | LRRC32 | Zornitza Stark reviewed gene: LRRC32: Rating: AMBER; Mode of pathogenicity: None; Publications: 41041957; Phenotypes: Cleft palate, proliferative retinopathy, and developmental delay (CPPRDD) syndrome, MIM# 619074; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.311 | Sarah Milton Copied Region ISCA-46303-Loss from panel Common deletion and duplication syndromes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.311 | ISCA-46303-Loss |
Sarah Milton Region: ISCA-46303-Loss was added Region: ISCA-46303-Loss was added to Clefting disorders. Sources: ClinGen Mode of inheritance for Region: ISCA-46303-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-46303-Loss were set to PMID: 24934569, 26663529, 19234473, 26152199, 30552336 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.310 | ARCN1 | Zornitza Stark commented on gene: ARCN1: At least 14 individuals reported, summarised in PMID 35300924. Intrauterine growth restriction, micrognathia, and short stature were present in all patients. Other common features included prematurity (11/15, 73.3%), developmental delay (10/14, 71.4%), genitourinary malformations in males (6/8, 75%), and microcephaly (12/15, 80%). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.310 | BOC | Zornitza Stark Marked gene: BOC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.310 | BOC | Zornitza Stark Gene: boc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.310 | BOC | Zornitza Stark Phenotypes for gene: BOC were changed from to Orofacial clefting, MONDO:0000358, BOC-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.309 | BOC | Zornitza Stark edited their review of gene: BOC: Changed phenotypes: Orofacial clefting, MONDO:0000358, BOC-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.309 | Zornitza Stark Copied gene BOC from panel Mendeliome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.309 | BOC |
Zornitza Stark gene: BOC was added gene: BOC was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: BOC was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: BOC were set to 40464334; 28677295 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.308 | Sarah Milton Copied Region ISCA-37446-Loss from panel Common deletion and duplication syndromes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.308 | ISCA-37446-Loss |
Sarah Milton Region: ISCA-37446-Loss was added Region: ISCA-37446-Loss was added to Clefting disorders. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37446-Loss. Mode of inheritance for Region: ISCA-37446-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37446-Loss were set to 18179902; 23765049; 21671380 Phenotypes for Region: ISCA-37446-Loss were set to Chromosome 22q11.2 deletion syndrome, distal MIM#611867; intellectual disability; autism; multiple congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.307 | ESRP2 | Zornitza Stark Phenotypes for gene: ESRP2 were changed from cleft lip; Cleft palate, MONDO:0016064; Hypopituitarism MONDO:0005152 to Orofacial cleft MONDO:0000358, ESRP2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.306 | ESRP2 | Zornitza Stark edited their review of gene: ESRP2: Changed phenotypes: Orofacial cleft MONDO:0000358, ESRP2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.306 | ESRP2 | Zornitza Stark Publications for gene: ESRP2 were set to 29805042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.305 | ESRP2 | Zornitza Stark Classified gene: ESRP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.305 | ESRP2 | Zornitza Stark Gene: esrp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.304 | ESRP2 | Zornitza Stark edited their review of gene: ESRP2: Added comment: Further functional work on some of the variants in PMID 39179789.; Changed rating: GREEN; Changed publications: 29805042, 39179789 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.304 | Sarah Milton Copied Region ISCA-37433-Loss from panel Common deletion and duplication syndromes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.304 | ISCA-37433-Loss |
Sarah Milton Region: ISCA-37433-Loss was added Region: ISCA-37433-Loss was added to Clefting disorders. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37433-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for Region: ISCA-37433-Loss were set to DiGeorge syndrome MIM#188400 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.303 | ZFHX4 | Zornitza Stark Marked gene: ZFHX4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.303 | ZFHX4 | Zornitza Stark Gene: zfhx4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.303 | ZFHX4 | Zornitza Stark Phenotypes for gene: ZFHX4 were changed from intellectual disability; short stature; cleft to neurodevelopmental disorder, ZFHX4-related (MONDO:0700092) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.302 | ZFHX4 | Zornitza Stark Classified gene: ZFHX4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.302 | ZFHX4 | Zornitza Stark Gene: zfhx4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.301 | ZFHX4 |
Boris Keren gene: ZFHX4 was added gene: ZFHX4 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: ZFHX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZFHX4 were set to PMID: 40367947 Phenotypes for gene: ZFHX4 were set to intellectual disability; short stature; cleft Penetrance for gene: ZFHX4 were set to Incomplete Review for gene: ZFHX4 was set to GREEN gene: ZFHX4 was marked as current diagnostic Added comment: New series with 57 probands with neurodevelopmental disorders and ZFHX4 pathogenic variants, mostly LoF and de novo. Some patients have cleft palate. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.301 | Bryony Thompson Copied STR ZIC2_HPE5_GCN from panel Repeat Disorders | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.301 | ZIC2_HPE5_GCN |
Bryony Thompson STR: ZIC2_HPE5_GCN was added STR: ZIC2_HPE5_GCN was added to Clefting disorders. Sources: Expert Review Green,Expert list paediatric-onset tags were added to STR: ZIC2_HPE5_GCN. Mode of inheritance for STR: ZIC2_HPE5_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ZIC2_HPE5_GCN were set to 11285244; 33811808 Phenotypes for STR: ZIC2_HPE5_GCN were set to Holoprosencephaly 5 MIM#609637 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.300 | SELENOI | Zornitza Stark Phenotypes for gene: SELENOI were changed from Cleft palate; developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals to Spastic paraplegia 81, autosomal recessive, MIM# 618768 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.299 | SELENOI | Zornitza Stark Publications for gene: SELENOI were set to 28052917 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.298 | SELENOI | Zornitza Stark edited their review of gene: SELENOI: Added comment: 8 individuals from 4 families reported now, only one with cleft palate.; Changed publications: 28052917, 39806532, 29500230, 33454747; Changed phenotypes: Spastic paraplegia 81, autosomal recessive, MIM# 618768 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.298 | RPS28 | Zornitza Stark Phenotypes for gene: RPS28 were changed from Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164; Cleft palate to Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.297 | RPS28 | Zornitza Stark Publications for gene: RPS28 were set to 24942156 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.296 | RPS28 | Zornitza Stark Classified gene: RPS28 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.296 | RPS28 | Zornitza Stark Gene: rps28 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.295 | RPS28 | Zornitza Stark edited their review of gene: RPS28: Added comment: PMID 40135709 reports a new individual with a heterozygous de novo start‑codon loss‑of‑function variant (c.2T>C) causing Diamond‑Blackfan anaemia and Pierre Robin sequence; Changed rating: GREEN; Changed publications: 24942156, 40135709; Changed phenotypes: Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.295 | ISCA-37423-Gain | Zornitza Stark Marked Region: ISCA-37423-Gain as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.295 | ISCA-37423-Gain | Zornitza Stark Region: isca-37423-gain has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.295 | ISCA-37423-Gain | Zornitza Stark Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.294 | ISCA-37423-Gain | Sarah Milton reviewed Region: ISCA-37423-Gain: Rating: ; Mode of pathogenicity: None; Publications: PMID: 23345203; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.294 | Sarah Milton Copied Region ISCA-37423-Gain from panel Common deletion and duplication syndromes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.294 | ISCA-37423-Gain |
Sarah Milton Region: ISCA-37423-Gain was added Region: ISCA-37423-Gain was added to Clefting disorders. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37423-Gain. Mode of inheritance for Region: ISCA-37423-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754 Phenotypes for Region: ISCA-37423-Gain were set to 8p23.1 duplication syndrome; intellectual disability; congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.293 | ISCA-37393-Gain | Zornitza Stark Marked Region: ISCA-37393-Gain as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.293 | ISCA-37393-Gain | Zornitza Stark Region: isca-37393-gain has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.293 | Sarah Milton Copied Region ISCA-37393-Gain from panel Common deletion and duplication syndromes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.293 | ISCA-37393-Gain |
Sarah Milton Region: ISCA-37393-Gain was added Region: ISCA-37393-Gain was added to Clefting disorders. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37393-Gain. Mode of inheritance for Region: ISCA-37393-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37393-Gain were set to Cat eye syndrome, MIM# 115470; coloboma; anal atresia; heart and renal malformations |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.292 | ESRP2 | Chirag Patel Classified gene: ESRP2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.292 | ESRP2 | Chirag Patel Gene: esrp2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.291 | RAX | Chirag Patel Marked gene: RAX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.291 | RAX | Chirag Patel Gene: rax has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.291 | RAX |
Chirag Patel commented on gene: RAX: Established association with bilateral microphthalmia or anophthalmia. 2 cases reported with bilateral cleft lip. RAX is a paired-type homeoprotein that plays a critical role in eye and forebrain development of vertebrate species. RAX knockout mice have anophthalmia, cleft palate, and an abnormal hypothalamus and display perinatal lethality |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.291 | RAX | Chirag Patel Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.291 | Chirag Patel Copied gene RAX from panel Pituitary hormone deficiency | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.291 | RAX |
Chirag Patel gene: RAX was added gene: RAX was added to Clefting disorders. Sources: Expert Review Amber,Literature Mode of inheritance for gene: RAX was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RAX were set to 30811539, 40321348 Phenotypes for gene: RAX were set to Microphthalmia, syndromic 16, MIM#611038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.290 | MED16 | Lucy Spencer Phenotypes for gene: MED16 were changed from Neurodevelopmental disorder, MONDO:0700092, MED16-related to Guillouet-Gordon syndrome MIM#621220 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.289 | AMER1 | Zornitza Stark Marked gene: AMER1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.289 | AMER1 | Zornitza Stark Gene: amer1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.289 | AMER1 | Zornitza Stark Phenotypes for gene: AMER1 were changed from OSTEOPATHIA STRIATA WITH CRANIAL SCLEROSIS; OSCS; Cleft palate to Osteopathia striata with cranial sclerosis, MIM# 300373 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.288 | AMER1 | Zornitza Stark Publications for gene: AMER1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.287 | Zornitza Stark Added reviews for gene AMER1 from panel Mendeliome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.286 | ANKRD11 | Zornitza Stark Marked gene: ANKRD11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.286 | ANKRD11 | Zornitza Stark Gene: ankrd11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.286 | ANKRD11 | Zornitza Stark Phenotypes for gene: ANKRD11 were changed from Short stature-facial and skeletal anomalies-intellectual disability-macrodontia syndrome; Orofacial Clefting with skeletal features; KBG syndrome,148050 (orofacial clefting, intellectual disability, dental anomalies, dysmorphism) to KBG syndrome, MIM# 148050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.285 | ANKRD11 | Zornitza Stark Publications for gene: ANKRD11 were set to 25838844; 2705097; 21782149; 27900361 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.284 | ANKRD11 | Zornitza Stark reviewed gene: ANKRD11: Rating: GREEN; Mode of pathogenicity: None; Publications: 35861666; Phenotypes: KBG syndrome, MIM# 148050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.284 | ACTG1 | Zornitza Stark Marked gene: ACTG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.284 | ACTG1 | Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.284 | ACTG1 | Zornitza Stark Phenotypes for gene: ACTG1 were changed from BARAITSER-WINTER SYNDROME 2; BRWS2 to Baraitser-Winter syndrome 2, MIM# 614583 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.283 | ACTG1 | Zornitza Stark reviewed gene: ACTG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Baraitser-Winter syndrome 2, MIM# 614583; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.283 | ACTB | Zornitza Stark Marked gene: ACTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.283 | ACTB | Zornitza Stark Gene: actb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.283 | ACTB | Zornitza Stark Phenotypes for gene: ACTB were changed from BRWS1; BARAITSER-WINTER SYNDROME 1 to Baraitser-Winter syndrome 1, MIM# 243310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.282 | ACTB | Zornitza Stark reviewed gene: ACTB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Baraitser-Winter syndrome 1, MIM# 243310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.282 | Chirag Patel Added reviews for gene MSX1 from panel Mendeliome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.281 | SIX5 | Chirag Patel Tag disputed tag was added to gene: SIX5. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.281 | ESRP2 | Chirag Patel Phenotypes for gene: ESRP2 were changed from cleft lip to cleft lip; Cleft palate, MONDO:0016064; Hypopituitarism MONDO:0005152 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.280 | ESRP2 | Chirag Patel Classified gene: ESRP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.280 | ESRP2 | Chirag Patel Gene: esrp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.279 | ESRP2 | Chirag Patel reviewed gene: ESRP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 41111330, 29180615, 33234718; Phenotypes: Cleft palate, MONDO:0016064, Hypopituitarism MONDO:0005152; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.279 | Chirag Patel Added reviews for gene KMT2D from panel Mendeliome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.278 | KDM1A | Zornitza Stark Marked gene: KDM1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.278 | KDM1A | Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.278 | KDM1A | Chirag Patel Classified gene: KDM1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.278 | KDM1A | Chirag Patel Gene: kdm1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.277 | KDM1A | Chirag Patel reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.277 | LOXL3 | Zornitza Stark Marked gene: LOXL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.277 | LOXL3 | Zornitza Stark Gene: loxl3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.277 | Zornitza Stark Copied gene LOXL3 from panel Pierre Robin Sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.277 | LOXL3 |
Zornitza Stark gene: LOXL3 was added gene: LOXL3 was added to Clefting disorders. Sources: Expert Review Green,Literature,Literature Mode of inheritance for gene: LOXL3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LOXL3 were set to 25663169; 26307084; 26957899; 29802726; 30362103; 34787502; 41052910 Phenotypes for gene: LOXL3 were set to Stickler syndrome, MONDO:0019354, LOXL3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.276 | DLG1 | Zornitza Stark Marked gene: DLG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.276 | DLG1 | Zornitza Stark Gene: dlg1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.276 | DLG1 | Zornitza Stark Mode of inheritance for gene: DLG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.275 | DLG1 | Chirag Patel Phenotypes for gene: DLG1 were changed from Non-syndromic cleft lip with or without cleft palate to cleft lip/palate MONDO:0016044 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.274 | DLG1 | Chirag Patel reviewed gene: DLG1: Rating: RED; Mode of pathogenicity: None; Publications: 28926086; Phenotypes: Non-syndromic cleft lip and palate; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.274 | CTGF | Zornitza Stark Marked gene: CTGF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.274 | CTGF | Zornitza Stark Gene: ctgf has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.274 | CTGF | Zornitza Stark Classified gene: CTGF as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.274 | CTGF | Zornitza Stark Gene: ctgf has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.273 | CTGF |
Zornitza Stark gene: CTGF was added gene: CTGF was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: CTGF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CTGF were set to 39506047; 39414788; 12736220 Phenotypes for gene: CTGF were set to Kyphomelic dysplasia, OMIM:211350; kyphomelic dysplasia, MONDO:0008881; spondyloepimetaphyseal dysplasia, MONDO:0100510 Review for gene: CTGF was set to AMBER Added comment: PMID: 39506047 (2025) reported three individuals from two unrelated families with different homozygous CCN2 variants and kyphomelic dysplasia - all had cleft palate or bifid uvula as part of their phenotype. Ccn2-deficient mice also show skeletal dysmorphisms as well as secondary cleft palate, supporting this association. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.272 | PRKCI | Sangavi Sivagnanasundram edited their review of gene: PRKCI: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.272 | PRKCI |
Sangavi Sivagnanasundram changed review comment from: Multiple reported variants in affected individuals mainly presenting with lower lip pits and orofacial clefts (OFCs). Some individuals presented with a more severe phenotype inclusing seizures, ID/DD and urogenital anomalies. Supportive zebrafish model supporting a loss-of-function mechanism was performed on three recurrent variants [c.389G>A (p.Arg130His), c.1148A>G (p.Asn383Ser), and c.1155A>C (p.Leu385Phe)] however there is not enough evidence to show that LoF is the mechanism of disease. The gene is not constrained for LoF in gnomAD and there are no pathogenic SNVs reported in ClinVar at this present time. Amber until further evidence is published in support of this gene-disease association. Sources: Literature; to: Multiple reported variants in affected individuals mainly presenting with lower lip pits and orofacial clefts (OFCs). Some individuals presented with a more severe phenotype inclusing seizures, ID/DD and urogenital anomalies. Supportive zebrafish model supporting a loss-of-function mechanism was performed on three recurrent variants [c.389G>A (p.Arg130His), c.1148A>G (p.Asn383Ser), and c.1155A>C (p.Leu385Phe)] however there is not enough evidence to show that LoF is the mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.272 | PRKCI | Zornitza Stark Marked gene: PRKCI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.272 | PRKCI | Zornitza Stark Gene: prkci has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.272 | PRKCI | Zornitza Stark Phenotypes for gene: PRKCI were changed from Van der Woude syndrome MONDO:0019508 to Van der Woude syndrome MONDO:0019508, PRKCI-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.271 | PRKCI | Zornitza Stark Classified gene: PRKCI as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.271 | PRKCI | Zornitza Stark Gene: prkci has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.270 | PRKCI | Zornitza Stark reviewed gene: PRKCI: Rating: GREEN; Mode of pathogenicity: None; Publications: 40902599; Phenotypes: Van der Woude syndrome MONDO:0019508, PRKCI-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.270 | PRKCI |
Sangavi Sivagnanasundram gene: PRKCI was added gene: PRKCI was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: PRKCI was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRKCI were set to 40902599 Phenotypes for gene: PRKCI were set to Van der Woude syndrome MONDO:0019508 Review for gene: PRKCI was set to AMBER Added comment: Multiple reported variants in affected individuals mainly presenting with lower lip pits and orofacial clefts (OFCs). Some individuals presented with a more severe phenotype inclusing seizures, ID/DD and urogenital anomalies. Supportive zebrafish model supporting a loss-of-function mechanism was performed on three recurrent variants [c.389G>A (p.Arg130His), c.1148A>G (p.Asn383Ser), and c.1155A>C (p.Leu385Phe)] however there is not enough evidence to show that LoF is the mechanism of disease. The gene is not constrained for LoF in gnomAD and there are no pathogenic SNVs reported in ClinVar at this present time. Amber until further evidence is published in support of this gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.270 | RSG1 | Zornitza Stark Marked gene: RSG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.270 | RSG1 | Zornitza Stark Gene: rsg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.270 | RSG1 | Zornitza Stark Classified gene: RSG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.270 | RSG1 | Zornitza Stark Gene: rsg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.269 | RSG1 |
Zornitza Stark gene: RSG1 was added gene: RSG1 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: RSG1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RSG1 were set to 40593758 Phenotypes for gene: RSG1 were set to Ciliopathy, MONDO:0005308, RSG1-related Review for gene: RSG1 was set to GREEN Added comment: Three individuals from unrelated families reported with bi-allelic variants and displaying cleft palate, tongue lobulations and polydactyly, phenotypes characteristic of Oral-Facial-Digital Syndrome. Variants were shown to disrupt two vital steps of ciliogenesis, basal body docking and recruitment of intraflagellar transport proteins. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.268 | TP63 | Zornitza Stark Marked gene: TP63 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.268 | TP63 | Zornitza Stark Gene: tp63 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.268 | TP63 | Zornitza Stark Phenotypes for gene: TP63 were changed from Orofacial cleft 8, EEC SYNDROME 3, Rapp Hodgkins syndrome, 129400; EEC3; Limb-mammary syndrome, 603543; AEC (Ankyloblepharon filiforme adnatum, Ectodermal defects and Clefting), Hay Wells syndrome 106260; EEC syndrome (Ectrodactyly, Ectodermal dysplasia and Clefting); ECTRODACTYLY, ECTODERMAL DYSPLASIA, AND CLEFT LIP/PALATE SYNDROME 3; Cleft lip; Ectrodactyly, ectodermal dysplasia, cleft lip/palate syndrome 3, 604292 to TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.267 | TP63 | Zornitza Stark commented on gene: TP63: DEFINITIVE by ClinGen, lumped multiple disorders. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.267 | TP63 | Zornitza Stark reviewed gene: TP63: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.267 | MN1 | Zornitza Stark Publications for gene: MN1 were set to 33351141; 31834374; 33351070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.266 | MN1 | Zornitza Stark Classified gene: MN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.266 | MN1 | Zornitza Stark Gene: mn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.265 | MN1 | Sarah Milton reviewed gene: MN1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33351070, 31834374, 31834374, 15870292; Phenotypes: Cleft palate, MONDO:0016064, MN1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.265 | HYLS1 | Chirag Patel reviewed gene: HYLS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hydrolethalus syndrome MONDO:0006037; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.265 | AMOTL1 | Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related to Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | AMOTL1 | Zornitza Stark edited their review of gene: AMOTL1: Changed rating: GREEN; Changed phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.263 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.262 | MED16 | Zornitza Stark Marked gene: MED16 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.262 | MED16 | Zornitza Stark Gene: med16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.262 | MED16 | Zornitza Stark Classified gene: MED16 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.262 | MED16 | Zornitza Stark Gene: med16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.261 | MED16 |
Zornitza Stark gene: MED16 was added gene: MED16 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MED16 were set to 40081376 Phenotypes for gene: MED16 were set to Neurodevelopmental disorder, MONDO:0700092, MED16-related Review for gene: MED16 was set to GREEN Added comment: 18 families reported with bi-allelic variants in this gene with DD/ID +/- multiple congenital anomalies, including cleft palate in multiple individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.260 | TAF11 | Bryony Thompson Marked gene: TAF11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.260 | TAF11 | Bryony Thompson Gene: taf11 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.260 | TAF11 |
Bryony Thompson gene: TAF11 was added gene: TAF11 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: TAF11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAF11 were set to 39727181 Phenotypes for gene: TAF11 were set to cleft lip MONDO:0004747 Review for gene: TAF11 was set to RED Added comment: 2 individuals in a single Chinese family with nonsyndromic cleft lip segregating with the missense p.Leu48Phe. The missense has an AF of 1.8% (including 15 homozygotes) in gnomAD v4 in the East Asian population, which is too common for an autosomal dominant disease—also, a supporting zebrafish model with craniofacial abnormalities (however the genetic evidence for this GDA is lacking). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.259 | HYAL2 | Zornitza Stark Phenotypes for gene: HYAL2 were changed from Cleft lip and palate; cor triatriatum; congenital cardiac malformations to Muggenthaler-Chowdhury-Chioza syndrome, MIM# 621063 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.258 | ZRSR2 | Zornitza Stark Phenotypes for gene: ZRSR2 were changed from Orofacialdigital syndrome MONDO:0015375, ZRSR2-related to Orofaciodigital syndrome XXI, MIM# 301132 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.257 | ZRSR2 | Zornitza Stark reviewed gene: ZRSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Orofaciodigital syndrome XXI, MIM# 301132; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.257 | USP9X | Ain Roesley Phenotypes for gene: USP9X were changed from Mental retardation, X-linked 99 300919 XLR; Mental retardation, X-linked 99, syndromic, female-restricted 300968 to Intellectual developmental disorder 99 MIM#300919; syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.256 | CRELD1 | Ain Roesley Marked gene: CRELD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.256 | CRELD1 | Ain Roesley Gene: creld1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.256 | CRELD1 | Ain Roesley Classified gene: CRELD1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.256 | CRELD1 | Ain Roesley Gene: creld1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.255 | CRELD1 |
Ain Roesley gene: CRELD1 was added gene: CRELD1 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: CRELD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRELD1 were set to 37947183 Phenotypes for gene: CRELD1 were set to Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771 Review for gene: CRELD1 was set to AMBER gene: CRELD1 was marked as current diagnostic Added comment: 2 families with cleft palate, intra-familial variability noted Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.254 | CREBBP | Zornitza Stark Marked gene: CREBBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.254 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.254 | CREBBP | Zornitza Stark Classified gene: CREBBP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.254 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.253 | CREBBP |
Zornitza Stark gene: CREBBP was added gene: CREBBP was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CREBBP were set to 35626936 Phenotypes for gene: CREBBP were set to Menke-Hennekam syndrome 1, MIM# 618332 Review for gene: CREBBP was set to GREEN Added comment: Cleft palate is a reported feature in several patients. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.252 | NEK1 | Zornitza Stark Marked gene: NEK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.252 | NEK1 | Zornitza Stark Gene: nek1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.252 | NEK1 | Zornitza Stark Phenotypes for gene: NEK1 were changed from SHORT-RIB THORACIC DYSPLASIA 6 WITH OR WITHOUT POLYDACTYLY; SRTD6 to Short-rib thoracic dysplasia 6 with or without polydactyly, MIM# 263520; Orofaciodigital syndrome II , MIM# 252100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.251 | NEK1 | Zornitza Stark Publications for gene: NEK1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.250 | NEK1 | Zornitza Stark reviewed gene: NEK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21211617, 22499340, 25492405, 28123176, 27530628; Phenotypes: Short-rib thoracic dysplasia 6 with or without polydactyly, MIM# 263520, Orofaciodigital syndrome II , MIM# 252100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.250 | RAB34 | Zornitza Stark Phenotypes for gene: RAB34 were changed from Multiple congenital anomalies, (MONDO:0019042), RAB34-related to Orofaciodigital syndrome 20, MIM#620718 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.249 | MYMK | Zornitza Stark Marked gene: MYMK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.249 | MYMK | Zornitza Stark Gene: mymk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.249 | MYMK | Zornitza Stark Phenotypes for gene: MYMK were changed from Carey-Fineman-Ziter syndrome 254940 to Carey-Fineman-Ziter syndrome, MIM# 254940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.248 | MYMK | Zornitza Stark reviewed gene: MYMK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Carey-Fineman-Ziter syndrome, MIM# 254940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.248 | FBXO11 | Zornitza Stark Marked gene: FBXO11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.248 | FBXO11 | Zornitza Stark Gene: fbxo11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.248 | FBXO11 | Zornitza Stark reviewed gene: FBXO11: Rating: AMBER; Mode of pathogenicity: None; Publications: 30057029; Phenotypes: intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 618089; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.248 | FOXP2 | Zornitza Stark Marked gene: FOXP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.248 | FOXP2 | Zornitza Stark Gene: foxp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.248 | FOXP2 | Zornitza Stark Phenotypes for gene: FOXP2 were changed from Speech-language disorder-1, 602081 to Speech-language disorder-1, MIM# 602081 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.247 | FOXP2 | Zornitza Stark Classified gene: FOXP2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.247 | FOXP2 | Zornitza Stark Gene: foxp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.246 | FOXP2 | Zornitza Stark reviewed gene: FOXP2: Rating: RED; Mode of pathogenicity: None; Publications: 36328423; Phenotypes: Speech-language disorder-1, MIM# 602081; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.246 | ZRSR2 | Zornitza Stark Marked gene: ZRSR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.246 | ZRSR2 | Zornitza Stark Gene: zrsr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.246 | ZRSR2 | Zornitza Stark Classified gene: ZRSR2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.246 | ZRSR2 | Zornitza Stark Gene: zrsr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.245 | ZRSR2 |
Chris Ciotta gene: ZRSR2 was added gene: ZRSR2 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: ZRSR2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: ZRSR2 were set to PMID: 38158857 Phenotypes for gene: ZRSR2 were set to Orofacialdigital syndrome MONDO:0015375, ZRSR2-related Review for gene: ZRSR2 was set to GREEN Added comment: Oral-facial-digital (OFD) syndrome with brain anomalies ranging from alobar holoprosencephaly to pituitary anomalies. Six unrelated families with two truncating variants and functional studies: - p.(Gly404GlufsTer23): detected in one family with 2x affected males - p.(Arg403GlyfsTer24): 5 unrelated families, both de novo and inherited Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.245 | ARCN1 | Zornitza Stark Marked gene: ARCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.245 | ARCN1 | Zornitza Stark Gene: arcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.245 | ARCN1 | Zornitza Stark Publications for gene: ARCN1 were set to 27476655 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.244 | ARCN1 | Zornitza Stark Classified gene: ARCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.244 | ARCN1 | Zornitza Stark Gene: arcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.243 | SEC24D | Zornitza Stark Marked gene: SEC24D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.243 | SEC24D | Zornitza Stark Gene: sec24d has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.243 | SEC24D | Zornitza Stark Classified gene: SEC24D as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.243 | SEC24D | Zornitza Stark Gene: sec24d has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.242 | SEC24D |
Ee Ming Wong gene: SEC24D was added gene: SEC24D was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: SEC24D was set to Unknown Publications for gene: SEC24D were set to PMID:37676273 Phenotypes for gene: SEC24D were set to Cleft lip with or without cleft palate, MONDO:0016034, SEC24D-related Review for gene: SEC24D was set to RED gene: SEC24D was marked as current diagnostic Added comment: - Subtype-specific genome-wide study to test for genetic modifiers of cleft lip VS cleft lip and palate - SEC24D was genome-wide significant (p = 6.86 × 10-7), and having a burden of rare variants in cleft lip VS cleft lip and palate Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.242 | PPP1R13L | Zornitza Stark Phenotypes for gene: PPP1R13L were changed from Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042 - PPP1R13L-related; Dilated cardiomyopathy, onset in infancy; Cleft lip and palate to Arrhythmogenic cardiomyopathy with or without ectodermal abnormalities, MIM#620519 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.241 | PPP1R13L | Zornitza Stark edited their review of gene: PPP1R13L: Changed phenotypes: Arrhythmogenic cardiomyopathy with or without ectodermal abnormalities, MIM#620519 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.241 | ARHGAP29 | Zornitza Stark Phenotypes for gene: ARHGAP29 were changed from cleft lip with or without cleft palate; Cleft palate to Clefting disorder, MONDO:0000358, ARHGAP29-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.240 | PLCB4 | Zornitza Stark Phenotypes for gene: PLCB4 were changed from Auriculocondylar syndrome 2, MIM# 614669; Cleft palate to Auriculocondylar syndrome 2A, MIM# 614669; Auriculocondylar syndrome 2B, MIM# 620458; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.239 | PLCB4 | Zornitza Stark edited their review of gene: PLCB4: Changed phenotypes: AAuriculocondylar syndrome 2A, MIM# 614669, Auriculocondylar syndrome 2B, MIM# 620458 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.239 | INTS13 | Zornitza Stark Marked gene: INTS13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.239 | INTS13 | Zornitza Stark Gene: ints13 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.239 | INTS13 | Zornitza Stark Phenotypes for gene: INTS13 were changed from Oral-facial-digital syndrome to Oral-facial-digital syndrome, MONDO:0015375, INTS13-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.238 | INTS13 | Chirag Patel Classified gene: INTS13 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.238 | INTS13 | Chirag Patel Gene: ints13 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.237 | INTS13 |
Chirag Patel gene: INTS13 was added gene: INTS13 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: INTS13 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: INTS13 were set to PMID: 36229431 Phenotypes for gene: INTS13 were set to Oral-facial-digital syndrome Review for gene: INTS13 was set to GREEN gene: INTS13 was marked as current diagnostic Added comment: 2 families with 4 affected individuals with Oral-facial-digital (OFD) phenotype. Homozygosity mapping and WES found 2 homozygous variants in INTS13 gene. This is a subunit of the Integrator complex, which associates with RNA Polymerase II and cleaves nascent RNA to modulate gene expression. Variants segregated with disease. Depletion of INTS13 disrupts ciliogenesis in human cultured cells and causes dysregulation of a broad collection of ciliary genes. Knockdown in Xenopus embryos leads to motile cilia anomalies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.236 | UBE3B | Zornitza Stark Marked gene: UBE3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.236 | UBE3B | Zornitza Stark Gene: ube3b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.236 | UBE3B | Zornitza Stark Classified gene: UBE3B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.236 | UBE3B | Zornitza Stark Gene: ube3b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.235 | UBE3B |
Zornitza Stark gene: UBE3B was added gene: UBE3B was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: UBE3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UBE3B were set to 23200864; 23687348; 37010288 Phenotypes for gene: UBE3B were set to Kaufman oculocerebrofacial syndrome, OMIM:244450 Review for gene: UBE3B was set to AMBER Added comment: Although there are three unrelated cases associated with biallelic variants in UBE3B gene and reported with clefting, clefting has only been reported as a minor clinical indication. PMID:23687348 - One of two patients reported with biallelic variants in UBE3B in this study and one of four patients reported in PMID:23200864 and reviewed here had submucous cleft palate. DECIPHER database - One of three patients with homozygous sequence variants in UBE3B had median cleft palate. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.234 | SMARCB1 | Zornitza Stark Marked gene: SMARCB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.234 | SMARCB1 | Zornitza Stark Gene: smarcb1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.234 | SMARCB1 | Zornitza Stark Classified gene: SMARCB1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.234 | SMARCB1 | Zornitza Stark Gene: smarcb1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.233 | SMARCB1 |
Zornitza Stark gene: SMARCB1 was added gene: SMARCB1 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: SMARCB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCB1 were set to 25168959; 37010288 Phenotypes for gene: SMARCB1 were set to Coffin-Siris syndrome 3, OMIM:614608 Review for gene: SMARCB1 was set to AMBER Added comment: Although there are 3 unrelated cases reported with cleft palate in total, these represent only a minor fraction of patients (from total of 23) reported with SMARCB1 variants. PMID:25168959 - Two of ten patients reported with Coffin-Siris syndrome and heterozygous variants in SMARCB1 had cleft palate. DECIPHER database - One of 13 patients identified with heterozygous sequence variants in SMARCB1 had cleft palate. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.232 | NOTCH2 | Zornitza Stark Marked gene: NOTCH2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.232 | NOTCH2 | Zornitza Stark Gene: notch2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.232 | NOTCH2 | Zornitza Stark Classified gene: NOTCH2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.232 | NOTCH2 | Zornitza Stark Gene: notch2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.231 | NOTCH2 |
Zornitza Stark gene: NOTCH2 was added gene: NOTCH2 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: NOTCH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NOTCH2 were set to 9188663; 30329210; 37010288 Phenotypes for gene: NOTCH2 were set to Hajdu-Cheney syndrome, OMIM:102500 Review for gene: NOTCH2 was set to AMBER Added comment: Although there are three cases reported with cleft lip/ palate or cleft of uvula, these are reported only in a minor proportion of patients. PMID:9188663 - An 8.5-year-old boy with NOTCH2 variant and Hajdu-Cheney syndrome was reported with cleft lip and palate. PMID:30329210 - A 32-year-old male patient with a de novo truncating variant in NOTCH2 and presenting with Hajdu-Cheney syndrome had high arched palate and cleft of uvula. DECIPHER database - One of seven patients with heterozygous sequence variants in NOTCH2 was identified with submucous cleft hard palate. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.230 | AUTS2 | Zornitza Stark Marked gene: AUTS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.230 | AUTS2 | Zornitza Stark Gene: auts2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.230 | AUTS2 | Zornitza Stark Classified gene: AUTS2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.230 | AUTS2 | Zornitza Stark Gene: auts2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.229 | AUTS2 |
Zornitza Stark gene: AUTS2 was added gene: AUTS2 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: AUTS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AUTS2 were set to 31788251; 37010288 Phenotypes for gene: AUTS2 were set to Intellectual developmental disorder, autosomal dominant 26, MIM# 615834 Review for gene: AUTS2 was set to AMBER Added comment: There are a total of five cases reported with cleft lip/ palate. However, clefting has only been reported in less than 10% of patients with monoalellic variants in AUTS2 from the DECIPHER database. PMID:31788251 - A patient identified with a de novo heterozygous AUTS2 variant (c.1464_1467del ACTC/ p.Tyr488Ter) was reported with autism and cleft lip and palate. DECIPHER database - Of 44 patients reported with heterozygous sequence variants, 4 patients had cleft lip or cleft palate (2 - cleft palate; 1 - cleft soft palate; 1 - unilateral cleft lip). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.228 | ARID1A | Zornitza Stark Marked gene: ARID1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.228 | ARID1A | Zornitza Stark Gene: arid1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.228 | ARID1A | Zornitza Stark Classified gene: ARID1A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.228 | ARID1A | Zornitza Stark Gene: arid1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.227 | ARID1A |
Zornitza Stark gene: ARID1A was added gene: ARID1A was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARID1A were set to 25168959; 37010288 Phenotypes for gene: ARID1A were set to Coffin-Siris syndrome 2 (MIM#614607) Review for gene: ARID1A was set to AMBER Added comment: Clefting is a minor feature on patients with monoallelic variants in ARID1A gene. PMID:25168959 - Two of eight patients with heterozygous variants in ARID1A gene had cleft palate. DECIPHER database - One of 26 patients with heterozygous sequence variants in ARID1A gene had cleft palate. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.226 | ZC4H2 | Zornitza Stark Marked gene: ZC4H2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.226 | ZC4H2 | Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.226 | ZC4H2 | Zornitza Stark Classified gene: ZC4H2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.226 | ZC4H2 | Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.225 | ZC4H2 |
Zornitza Stark gene: ZC4H2 was added gene: ZC4H2 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: ZC4H2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: ZC4H2 were set to 31206972; 37010288 Phenotypes for gene: ZC4H2 were set to Wieacker-Wolff syndrome, MIM# 314580 Review for gene: ZC4H2 was set to GREEN Added comment: There are ten unrelated patients reported with cleft palate. PMID:31206972 - Of 42 families identified with de novo and inherited variants in ZC4H2 gene, eight patients had cleft palate in addition to several other clinical presentations. These included one patient with cleft palate from the DDD study (DECIPHER database) DECIPHER database - Of 13 patients with sequence variants, three patients had cleft palate. Cleft palate has been recorded as one of the clinical presentations of female-restricted Wieacker-Wolff syndrome (MIM #301041) in OMIM. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.224 | STAG2 | Zornitza Stark Marked gene: STAG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.224 | STAG2 | Zornitza Stark Gene: stag2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.224 | STAG2 | Zornitza Stark Publications for gene: STAG2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.223 | STAG2 | Zornitza Stark edited their review of gene: STAG2: Changed publications: 28296084, 29263825, 30158690, 31334757, 33014403, 37010288 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.223 | STAG2 | Zornitza Stark Classified gene: STAG2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.223 | STAG2 | Zornitza Stark Gene: stag2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.222 | STAG2 |
Zornitza Stark gene: STAG2 was added gene: STAG2 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: STAG2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: STAG2 were set to Mullegama-Klein-Martinez syndrome, MIM#301022 Review for gene: STAG2 was set to GREEN Added comment: There are eight unrelated cases identified with cleft lip/ palate and two cases were identified with cleft soft palate or submucous cleft soft palate. PMID:33014403 - Two female patients identified with de novo variants in STAG2. One had cleft lip/ palate and other had cleft palate. In addition, five additional cases with cleft lip/ palate were also reported from literature review in this publication. DECIPHER database - Of ten patients with sequence variants in STAG2 gene, one each was identified with cleft palate, cleft soft palate and submucous cleft soft palate (PMID:37010288). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.221 | SMARCA4 | Zornitza Stark Marked gene: SMARCA4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.221 | SMARCA4 | Zornitza Stark Gene: smarca4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.221 | SMARCA4 | Zornitza Stark Classified gene: SMARCA4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.221 | SMARCA4 | Zornitza Stark Gene: smarca4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.220 | SMARCA4 |
Zornitza Stark gene: SMARCA4 was added gene: SMARCA4 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: SMARCA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCA4 were set to 25168959; 37010288 Phenotypes for gene: SMARCA4 were set to Coffin-Siris syndrome 4, MIM# 614609 Review for gene: SMARCA4 was set to GREEN Added comment: There are five unrelated cases with cleft plate and one case each with submucous cleft palate and bifid uvula. PMID:25168959 - 4 of 12 patients with variants in SMARCA4 had cleft palate and another patient had submucous cleft palate. DECIPHER database - One of 22 patients with heterozygous sequence variants had cleft palate and another patient had bifid uvula (PMID:37010288) Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.219 | POGZ | Zornitza Stark Marked gene: POGZ as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.219 | POGZ | Zornitza Stark Gene: pogz has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.219 | POGZ | Zornitza Stark Classified gene: POGZ as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.219 | POGZ | Zornitza Stark Gene: pogz has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.218 | POGZ |
Zornitza Stark gene: POGZ was added gene: POGZ was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: POGZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POGZ were set to 26942287; 26739615 Phenotypes for gene: POGZ were set to White-Sutton syndrome, MIM# 616364 Review for gene: POGZ was set to AMBER Added comment: Although there are more than three unrelated cases reported with either cleft palate or bifid uvula in total, this phenotype is not consistently present in patients with monoallelic variants in POGZ gene. PMID:26739615 - Five unrelated individuals were identified with de novo truncating variants in POGZ gene, of which one individual had cleft palate and another one had bifid uvula. PMID:31782611 - In this cohort of 22 individuals with 21 different loss of function variants in POGZ, two patients were reported with bifid uvula. DECIPHER database - Of 42 patients with heterozygous sequence variants, one had cleft palate and another one had bifid uvula (PMID:37010288). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.217 | PGAP3 | Zornitza Stark Marked gene: PGAP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.217 | PGAP3 | Zornitza Stark Gene: pgap3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.217 | PGAP3 | Zornitza Stark Classified gene: PGAP3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.217 | PGAP3 | Zornitza Stark Gene: pgap3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.216 | PGAP3 |
Zornitza Stark gene: PGAP3 was added gene: PGAP3 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: PGAP3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PGAP3 were set to 28390064; 37010288 Phenotypes for gene: PGAP3 were set to Hyperphosphatasia with impaired intellectual development syndrome 4, OMIM:615716 Review for gene: PGAP3 was set to GREEN Added comment: PMID:28390064 - 10 individuals from eight families presented with developmental delay, severe intellectual disability, distinct facial dysmorphism and increased alkaline phosphatase. Nine individuals from seven families were homozygous for the same variant (c.402dupC/ p.M135Hfs*28), while one had a different homozygous variant ( c.817_820delGACT/ p.D273Sfs*37). Of nine individuals with p.M135Hfs*28 variant, eight from seven families (except one of the two patients from family 7) had cleft palate. But, the only patient with the different variant did not have cleft palate. DECIPHER database - Of seven individuals reported with biallelic sequence variants, three with homozygous variants were reported with cleft palate and two with compound heterozygous variants were reported with cleft soft palate (PMID:37010288). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.215 | KMT2A | Zornitza Stark Marked gene: KMT2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.215 | KMT2A | Zornitza Stark Gene: kmt2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.215 | KMT2A | Zornitza Stark Classified gene: KMT2A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.215 | KMT2A | Zornitza Stark Gene: kmt2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.214 | KMT2A |
Zornitza Stark gene: KMT2A was added gene: KMT2A was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: KMT2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KMT2A were set to 25929198; 30305169; 31710778; 37010288 Phenotypes for gene: KMT2A were set to Wiedemann-Steiner syndrome, OMIM:605130 Review for gene: KMT2A was set to AMBER Added comment: Although there are more than three cases reported with clefting, it is only present in a very small subsection of patients with KMT2A monoallelic variants. PMID:25929198 - De novo KMT2A variant (p.Arg1083Ter) in monozygotic twins and they had submucosal cleft palate. PMID:30305169 - Two of 14 patients with KMT2A variants and presenting with Wiedemann–Steiner syndrome had cleft palate. PMID:31710778 - Both patients reported with KMT2A variants had only high arched palate and not cleft palate. DECIPHER database - None of the reported patients had cleft lip/ palate and only one of 115 had bifid uvula (PMID:37010288) Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.213 | KAT6B | Zornitza Stark Marked gene: KAT6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.213 | KAT6B | Zornitza Stark Gene: kat6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.213 | KAT6B | Zornitza Stark Phenotypes for gene: KAT6B were changed from Genitopatellar syndrome, 606170; GTPTS to Genitopatellar syndrome, OMIM:606170; SBBYSS syndrome, OMIM:603736 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.212 | KAT6B | Zornitza Stark Publications for gene: KAT6B were set to 20182757; 27031267 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.211 | KAT6B | Zornitza Stark Mode of inheritance for gene: KAT6B was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.210 | KAT6B | Zornitza Stark Classified gene: KAT6B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.210 | KAT6B | Zornitza Stark Gene: kat6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.209 | GLI2 | Zornitza Stark Marked gene: GLI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.209 | GLI2 | Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.209 | GLI2 | Zornitza Stark Classified gene: GLI2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.209 | GLI2 | Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.208 | GLI2 |
Zornitza Stark gene: GLI2 was added gene: GLI2 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: GLI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GLI2 were set to 24744436; 37010288 Phenotypes for gene: GLI2 were set to Culler-Jones syndrome, OMIM:615849; Holoprosencephaly 9, OMIM:610829 Review for gene: GLI2 was set to GREEN Added comment: Although clefting is a minor feature in patients reported with monoallelic GLI2 variants, it has been reported in more than 15 cases. In ~400 screened individuals with HPE spectrum disorders, 112 individuals were identified with variants in GLI2 gene, of which 16 cases had cleft lip/ palate (PMID:24744436). Three out of 17 patients reported with heterozygous GLI2 sequence variants in the DECIPHER database presented with cleft lip/ palate as one of the phenotypes (PMID:37010288). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.207 | FGFR3 | Zornitza Stark Marked gene: FGFR3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.207 | FGFR3 | Zornitza Stark Gene: fgfr3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.207 | FGFR3 | Zornitza Stark Classified gene: FGFR3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.207 | FGFR3 | Zornitza Stark Gene: fgfr3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.206 | FGFR3 |
Zornitza Stark gene: FGFR3 was added gene: FGFR3 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: FGFR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FGFR3 were set to 22565872; 29150894; 37010288 Phenotypes for gene: FGFR3 were set to Muenke syndrome, OMIM:602849; Hypochondroplasia, OMIM:146000 Review for gene: FGFR3 was set to AMBER Added comment: Although there are more than three unrelated cases reported with cleft lip and/or palate, this is not consistently found in individuals with monoallelic variants in FGFR3 gene. PMID:22565872 included 21 individuals with variants in FGFR3 and presenting with Muenke syndrome in this study, of which 16 had structural anomaly of the palate. However, only one patient had cleft lip and palate. PMID:29150894 reported a father and two children with FGFR3 variant and presenting with hypochondroplasia, of which only the daughter had cleft palate. 2 out of 15 individuals reported in DECIPHER database with monoallelic sequence variants had cleft palate. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.205 | CNTNAP1 | Zornitza Stark Marked gene: CNTNAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.205 | CNTNAP1 | Zornitza Stark Gene: cntnap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.205 | CNTNAP1 | Zornitza Stark Classified gene: CNTNAP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.205 | CNTNAP1 | Zornitza Stark Gene: cntnap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.204 | CNTNAP1 |
Zornitza Stark gene: CNTNAP1 was added gene: CNTNAP1 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: CNTNAP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CNTNAP1 were set to 28374019; 29511323; 29882456; 37010288 Phenotypes for gene: CNTNAP1 were set to Hypomyelinating neuropathy, congenital, 3, OMIM:618186 Review for gene: CNTNAP1 was set to GREEN Added comment: There is sufficient evidence (3 unrelated cases) for the association of biallelic variants in this gene with cleft palate. PMID:28374019 - Cleft palate was reported in two children from a large Israeli consanguineous family of Palestinian ancestry with a homozygous stop-gain variant in CNTNAP1(c.2015G>A/ p.Trp672Ter). PMID:29511323/ 37010288 - There is one individual reported with compound heterozygous stop gain variants in CNTNAP1 (c.2687G>A/ p.Trp896Ter & c.1861C>T/ p.Arg621Ter) had cleft palate from DECIPHER database. PMID:29882456 - An eight year old American male patient with a homozygous CNTNAP1 variant (c.1163G>C/ p.Arg388Pro) had cleft palate. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.203 | ARID1B | Zornitza Stark Marked gene: ARID1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.203 | ARID1B | Zornitza Stark Gene: arid1b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.203 | ARID1B | Zornitza Stark Classified gene: ARID1B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.203 | ARID1B | Zornitza Stark Gene: arid1b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.202 | ARID1B |
Zornitza Stark gene: ARID1B was added gene: ARID1B was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARID1B were set to 30349098; 37010288 Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome 1, OMIM:135900 Review for gene: ARID1B was set to AMBER Added comment: Although there are more than three unrelated cases with ARID1B monoallelic variants reported with either cleft palate, cleft uvula or bifid uvula, clefting is not consistently present in individuals with ARID1B variants. PMID:30349098 - On this web-based survey based on previously reported features of individuals with variants in ARID1B gene (143 in total), which also included submissions to DECIPHER database, two individuals were identified with cleft palate, one with cleft uvula, two with bifid uvula and three with sub mucous cleft. Although variants identified in these patients are reported in this publication, there is no association of individual patients to phenotypes available. Of >100 patients with ARID1B variants in the DECIPHER database, only one patient (c.3183_3184insT/ p.Tyr1062LeufsTer10) was reported with submucous cleft soft palate and two patients (c.4155_4156insA/ p.Asn1386LysfsTer18 & c.2620+5G>A) were reported with bifid uvula. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.201 | CHD4 | Zornitza Stark Marked gene: CHD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.201 | CHD4 | Zornitza Stark Gene: chd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.201 | CHD4 | Zornitza Stark Classified gene: CHD4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.201 | CHD4 | Zornitza Stark Gene: chd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.200 | CHD4 |
Zornitza Stark gene: CHD4 was added gene: CHD4 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: CHD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHD4 were set to 31388190; 37010288 Phenotypes for gene: CHD4 were set to Sifrim-Hitz-Weiss syndrome, MIM 617159 Review for gene: CHD4 was set to AMBER Added comment: Although there are four unrelated cases presenting with either cleft palate and/or bifid uvula, this phenotype is not consistent among patients identified with monoallelic variants in CHD4 gene. PMID:31388190 reported 32 patients with heterozygous variants in CHD4 gene, of which one individual (p.Gln715Ter) had cleft palate and Pierre Robin sequence. In addition, another individual identified with heterozygous variant p.Arg1127Gln was reported with bifid uvula. In addition, 2 out of 10 individuals with pathogenic/ likely pathogenic heterozygous variants from the DDD study were reported with cleft palate in addition to several other clinical presentations including global developmental delay (PMID:37010288). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.199 | B4GALT7 | Zornitza Stark Marked gene: B4GALT7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.199 | B4GALT7 | Zornitza Stark Gene: b4galt7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.199 | B4GALT7 | Zornitza Stark Phenotypes for gene: B4GALT7 were changed from EHLERS-DANLOS SYNDROME WITH SHORT STATURE AND LIMB ANOMALIES; EDSSLA to Ehlers-Danlos syndrome, spondylodysplastic type, 1, MIM# 130070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.198 | B4GALT7 | Zornitza Stark reviewed gene: B4GALT7: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Ehlers-Danlos syndrome, spondylodysplastic type, 1, MIM# 130070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.198 | RAB34 | Elena Savva Marked gene: RAB34 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.198 | RAB34 | Elena Savva Gene: rab34 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.198 | RAB34 | Elena Savva Phenotypes for gene: RAB34 were changed from Clefting; corpus callosum; short bones; hypertelorism; polydactyly; cardiac defects; anorectal anomalies to Multiple congenital anomalies, (MONDO:0019042), RAB34-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.197 | RAB34 | Elena Savva Classified gene: RAB34 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.197 | RAB34 | Elena Savva Gene: rab34 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | RAB34 |
Sarah Pantaleo gene: RAB34 was added gene: RAB34 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: RAB34 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RAB34 were set to PMID: 37384395 Phenotypes for gene: RAB34 were set to Clefting; corpus callosum; short bones; hypertelorism; polydactyly; cardiac defects; anorectal anomalies Penetrance for gene: RAB34 were set to Complete Review for gene: RAB34 was set to GREEN Added comment: Oral-facial-digital syndromes (OFDS) are a group of clinically and genetically heterogenous disorders characterised by defects in the development of the face and oral cavity along with digit anomalies. Pathogenic variants in >20 genes encoding ciliary proteins have been found to cause OFDS. Identified by WES biallelic missense variants in a novel disease-causing ciliary gene RAB34 in four individuals from three unrelated families (aided by GeneMatcher). Affected individuals presented a novel form of OFDS accompanied by cardiac, cerebral, skeletal (eg. Shortening of long bones), and anorectal defects. RAB34 encodes a member of the Lab GTPase superfamily and was recently identified as a key mediator of ciliary membrane formation. Protein products of pathogenic variants clustered near the RAB34 C-terminus exhibit a strong loss of function. Onset is prenatal (multiple developmental defects including short femur, polydactyly, heart malformations, kidney malformations, brain malformations), resulting in medical termination for three probands. In the fourth, the only one alive at birth, proband born at 39+5 weeks, normal growth parameters after pregnancy with polyhydramnios, corpus callosum agenesis and polydactyly. Respiratory distress at birth. All four probands presented typical features of ciliopathy disorders, overlapping with oral, facial and digital abnormalities. All with homozygous missense variants. All absent in gnomAD (in homozygous state). Sanger sequencing confirmed mode of inheritance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | KAT6B | Achchuthan Shanmugasundram reviewed gene: KAT6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424177, 37010288; Phenotypes: Genitopatellar syndrome, OMIM:606170, SBBYSS syndrome, OMIM:603736; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | B4GALT7 | Achchuthan Shanmugasundram Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | DDX3X | Achchuthan Shanmugasundram Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | DDX3X | Achchuthan Shanmugasundram reviewed gene: DDX3X: Rating: GREEN; Mode of pathogenicity: None; Publications: 26235985, 27159028, 37010288; Phenotypes: Intellectual developmental disorder, X-linked syndromic, Snijders Blok type, OMIM:300958; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | B4GALT7 | Achchuthan Shanmugasundram reviewed gene: B4GALT7: Rating: GREEN; Mode of pathogenicity: None; Publications: 24755949, 26940150, 31278392; Phenotypes: Ehlers-Danlos syndrome, spondylodysplastic type, 1, OMIM:130070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | POLR1A | Elena Savva Marked gene: POLR1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | POLR1A | Elena Savva Gene: polr1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.196 | POLR1A | Elena Savva Phenotypes for gene: POLR1A were changed from cleft palte to Acrofacial dysostosis, Cincinnati type MIM#616462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.195 | POLR1A | Elena Savva Classified gene: POLR1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.195 | POLR1A | Elena Savva Gene: polr1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.194 | POLR1A | Elena Savva reviewed gene: POLR1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37075751; Phenotypes: Acrofacial dysostosis, Cincinnati type MIM#616462; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.194 | AMOTL1 | Seb Lunke Publications for gene: AMOTL1 were set to 33026150; 33026150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.193 | AMOTL1 | Seb Lunke Publications for gene: AMOTL1 were set to 33026150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.192 | AMOTL1 | Seb Lunke Phenotypes for gene: AMOTL1 were changed from Cleft lip and palate; imperforate anus; dysmorphism to Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.191 | AMOTL1 | Seb Lunke Classified gene: AMOTL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.191 | AMOTL1 | Seb Lunke Gene: amotl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.190 | AMOTL1 | Lucy Spencer reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33026150; Phenotypes: Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.190 | ARCN1 | Zornitza Stark reviewed gene: ARCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35300924; Phenotypes: Short stature-micrognathia syndrome, MIM# 617164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.190 | COBLL1 | Zornitza Stark Marked gene: COBLL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.190 | COBLL1 | Zornitza Stark Gene: cobll1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.190 | COBLL1 | Zornitza Stark Classified gene: COBLL1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.190 | COBLL1 | Zornitza Stark Gene: cobll1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.189 | COBLL1 |
Paul De Fazio changed review comment from: PMID:36493769 identified the same multi-exon intragenic deletion by high-res microarray in 3 individuals with non-syndromic cleft lip/palate. The deletion is absent from gnomAD. Inheritance information was only available for 1 individual, in whom it was inherited from an unaffected father. Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos. Sources: Literature; to: PMID:36493769 identified the same multi-exon intragenic deletion by high-res microarray in 3 individuals with non-syndromic cleft lip/palate. The deletion is absent from gnomAD. Inheritance information was only available for 1 individual, in whom it was inherited from an unaffected father. Note that the gene is not quite LOF constrained in gnomAD. Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.189 | COBLL1 |
Paul De Fazio gene: COBLL1 was added gene: COBLL1 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: COBLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: COBLL1 were set to 36493769 Phenotypes for gene: COBLL1 were set to Cleft lip/palate MONDO:0016044, COBLL1-related Review for gene: COBLL1 was set to AMBER gene: COBLL1 was marked as current diagnostic Added comment: PMID:36493769 identified the same multi-exon intragenic deletion by high-res microarray in 3 individuals with non-syndromic cleft lip/palate. The deletion is absent from gnomAD. Inheritance information was only available for 1 individual, in whom it was inherited from an unaffected father. Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.189 | RIC1 | Zornitza Stark Marked gene: RIC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.189 | RIC1 | Zornitza Stark Gene: ric1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.189 | RIC1 | Zornitza Stark Classified gene: RIC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.189 | RIC1 | Zornitza Stark Gene: ric1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.188 | RIC1 |
Paul De Fazio gene: RIC1 was added gene: RIC1 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: RIC1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RIC1 were set to 36493769 Phenotypes for gene: RIC1 were set to Cleft lip/palate MONDO:0016044, RIC1-related Review for gene: RIC1 was set to GREEN gene: RIC1 was marked as current diagnostic Added comment: PMID:36493769 identified an intragenic deletion by high-res microarray of exons 1-2 in 3 individuals with non-syndromic cleft lip/palate. This deleton is not present in gnomAD. Inheritance information was available in 2 individuals; one was de novo, the other inherited from an affected mother. Note that the gene is not LOF constrained in gnomAD. Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.188 | ARHGEF38 | Zornitza Stark Marked gene: ARHGEF38 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.188 | ARHGEF38 | Zornitza Stark Gene: arhgef38 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.188 | ARHGEF38 | Zornitza Stark Classified gene: ARHGEF38 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.188 | ARHGEF38 | Zornitza Stark Gene: arhgef38 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.187 | ARHGEF38 |
Paul De Fazio gene: ARHGEF38 was added gene: ARHGEF38 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: ARHGEF38 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ARHGEF38 were set to 36493769 Phenotypes for gene: ARHGEF38 were set to Cleft lip/palate MONDO:0016044, ARHGEF38-related Review for gene: ARHGEF38 was set to AMBER gene: ARHGEF38 was marked as current diagnostic Added comment: PMID:36493769 identified an intragenic deletion by high-res microarray of the same exon (exon 3) in 4 individuals with non-syndromic cleft lip/palate. Deletion of exon 3 is present in 6 individuals in gnomAD. Inheritance information was not available. Knockdown and knockout of the gene in Xenopus and Zebrafish resulted in craniofacial malformations in a large proportion (but not 100%) of embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.187 | MYCN |
Achchuthan Shanmugasundram changed review comment from: Comment on classification of this gene: This gene has been added with a RED rating to this panel, as identified from one case and supported by functional studies with mouse model. Out of the 104 multiplex families with Mendelian non-syndromic cleft lip with or without cleft palate (NSCL/P), a novel pathogenic variant (c.703G>C/ p.A235P) has been identified in MYCN gene from one family. This variant was found in the proband and his affected mother and absent in the unaffected sister, showing co0-segregation with phenotype in this family. In addition, experimental evidence from conditional knockout mouse model showed that these mice displayed cleft palate, microglossia and micrognathia, resembling the Pierre Robin sequence (PRS) in humans. This gene has not yet been associated with clefting either in OMIM or in Gene2Phenotype. Sources: Literature; to: Comment on classification of this gene: This gene has been added with a RED rating to this panel, as identified from one case and supported by functional studies from mouse model. Out of the 104 multiplex families with Mendelian non-syndromic cleft lip with or without cleft palate (NSCL/P), a novel pathogenic variant (c.703G>C/ p.A235P) has been identified in MYCN gene from one family. This variant was found in the proband and his affected mother and absent in the unaffected sister, showing co0-segregation with phenotype in this family. In addition, experimental evidence from conditional knockout mouse model showed that these mice displayed cleft palate, microglossia and micrognathia, resembling the Pierre Robin sequence (PRS) in humans. This gene has not yet been associated with clefting either in OMIM or in Gene2Phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.187 | MYCN | Zornitza Stark Marked gene: MYCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.187 | MYCN | Zornitza Stark Gene: mycn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.187 | MYCN | Zornitza Stark Classified gene: MYCN as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.187 | MYCN | Zornitza Stark Gene: mycn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.186 | AFDN | Zornitza Stark Marked gene: AFDN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.186 | AFDN | Zornitza Stark Gene: afdn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.186 | AFDN |
Zornitza Stark gene: AFDN was added gene: AFDN was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: AFDN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AFDN were set to 36384317 Phenotypes for gene: AFDN were set to Cleft lip/palate, MONDO:0016044, AFDN-related Review for gene: AFDN was set to RED Added comment: Over-representation of rare AFDN missense variants reported in a cohort of CL/P individuals of African and Brazilian origin. However, almost all of the variants reported have hets in gnomad. The one that is novel has alternative missense at the same aa position. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.185 | MYCN |
Achchuthan Shanmugasundram gene: MYCN was added gene: MYCN was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MYCN were set to 34590686 Phenotypes for gene: MYCN were set to cleft lip with or without cleft palate, MONDO:0016034 Review for gene: MYCN was set to RED Added comment: Comment on classification of this gene: This gene has been added with a RED rating to this panel, as identified from one case and supported by functional studies with mouse model. Out of the 104 multiplex families with Mendelian non-syndromic cleft lip with or without cleft palate (NSCL/P), a novel pathogenic variant (c.703G>C/ p.A235P) has been identified in MYCN gene from one family. This variant was found in the proband and his affected mother and absent in the unaffected sister, showing co0-segregation with phenotype in this family. In addition, experimental evidence from conditional knockout mouse model showed that these mice displayed cleft palate, microglossia and micrognathia, resembling the Pierre Robin sequence (PRS) in humans. This gene has not yet been associated with clefting either in OMIM or in Gene2Phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.185 | Zornitza Stark List of related panels changed from to Oral cleft HP:0000202 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.184 | COL9A3 | Zornitza Stark Phenotypes for gene: COL9A3 were changed from Stickler syndrome; Cleft palate to Stickler syndrome, type VI, MIM# 620022 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.183 | COL9A3 | Zornitza Stark edited their review of gene: COL9A3: Changed phenotypes: Stickler syndrome, type VI, MIM# 620022 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.183 | PPP1R13L | Zornitza Stark Phenotypes for gene: PPP1R13L were changed from Dilated cardiomyopathy, onset in infancy; Cleft lip and palate to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042 - PPP1R13L-related; Dilated cardiomyopathy, onset in infancy; Cleft lip and palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.182 | PPP1R13L | Krithika Murali reviewed gene: PPP1R13L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042 - PPP1R13L-related disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.182 | RYR1 | Zornitza Stark Marked gene: RYR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.182 | RYR1 | Zornitza Stark Gene: ryr1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.182 | RYR1 | Zornitza Stark Phenotypes for gene: RYR1 were changed from CCD; CENTRAL CORE DISEASE OF MUSCLE to RYR1-related myopathy - MONDO:0100150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.181 | RYR1 | Zornitza Stark Classified gene: RYR1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.181 | RYR1 | Zornitza Stark Gene: ryr1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.180 | RYR1 | Krithika Murali reviewed gene: RYR1: Rating: RED; Mode of pathogenicity: None; Publications: 23553484; Phenotypes: RYR1-related myopathy - MONDO:0100150; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.180 | PLCH1 | Zornitza Stark Phenotypes for gene: PLCH1 were changed from Holoprosencephaly spectrum; Severe developmental delay; Brain malformations to Holoprosencephaly 14, MIM# 619895 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.179 | PLCH1 | Zornitza Stark edited their review of gene: PLCH1: Changed phenotypes: Holoprosencephaly 14, MIM# 619895 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.179 | SMS | Zornitza Stark Marked gene: SMS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.179 | SMS | Zornitza Stark Gene: sms has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.179 | SMS | Zornitza Stark Phenotypes for gene: SMS were changed from MRXSSR; MENTAL RETARDATION, X-LINKED, SYNDROMIC, SNYDER-ROBINSON TYPE to Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583; Syndromic X-linked intellectual disability Snyder type, MONDO:0010664 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.178 | SMS | Zornitza Stark Publications for gene: SMS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.177 | SMS | Zornitza Stark reviewed gene: SMS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30237987, 34177437, 32838743, 23805436; Phenotypes: Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583, Syndromic X-linked intellectual disability Snyder type, MONDO:0010664; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.177 | EFNB1 | Bryony Thompson Added comment: Comment on mode of inheritance: X-LINKED: heterozygous females demonstrate more severe disease than hemizygous males | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.177 | EFNB1 | Bryony Thompson Mode of inheritance for gene: EFNB1 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.176 | SF3B2 | Zornitza Stark Phenotypes for gene: SF3B2 were changed from Craniofacial microsomia to Craniofacial microsomia, MIM#164210 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.175 | ZBTB24 | Zornitza Stark Marked gene: ZBTB24 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.175 | ZBTB24 | Zornitza Stark Gene: zbtb24 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.175 | ZBTB24 | Zornitza Stark Phenotypes for gene: ZBTB24 were changed from IMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 2; ICF2 to Immunodeficiency-centromeric instability-facial anomalies syndrome 2 - MIM#614069 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.174 | ZBTB24 | Zornitza Stark Publications for gene: ZBTB24 were set to 23486536 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.173 | ZBTB24 | Zornitza Stark Classified gene: ZBTB24 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.173 | ZBTB24 | Zornitza Stark Gene: zbtb24 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.172 | ZBTB24 | Krithika Murali reviewed gene: ZBTB24: Rating: RED; Mode of pathogenicity: None; Publications: 32865561, 21596365, 29023266, 32061411, 21906047, 28128455, 23739126, 22786748; Phenotypes: Immunodeficiency-centromeric instability-facial anomalies syndrome 2 - MIM#614069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.172 | HYAL2 | Zornitza Stark Publications for gene: HYAL2 were set to 28081210; 23172227; 26515055 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.171 | HYAL2 | Zornitza Stark Classified gene: HYAL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.171 | HYAL2 | Zornitza Stark Gene: hyal2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.170 | HYAL2 | Krithika Murali reviewed gene: HYAL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34906488, 28081210, 23172227, 26515055; Phenotypes: Cleft lip and palate, cor triatriatum, congenital cardiac malformations; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.170 | ANKRD17 | Krithika Murali reviewed gene: ANKRD17: Rating: AMBER; Mode of pathogenicity: None; Publications: 33909992; Phenotypes: Chopra-Amiel-Gordon syndrome - MIM#619504; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.170 | NECTIN1 | Zornitza Stark Marked gene: NECTIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.170 | NECTIN1 | Zornitza Stark Gene: nectin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.170 | NECTIN1 | Zornitza Stark Phenotypes for gene: NECTIN1 were changed from Cleft Lip with or without Cleft Palate; CLP, partial syndactyly of digits, intellectual disability, dysmorphism; Orofacial cleft 7, 225060; Cleft lip/Palate ectodermal dysplasia syndrome, 225060; Ectodermal dysplasia, Margarita Island type; Cleft lip; Zlotogora-Ogur syndrome to Cleft lip/palate-ectodermal dysplasia syndrome MIM#225060; Zlotogora-Ogur syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.169 | NECTIN1 | Zornitza Stark Publications for gene: NECTIN1 were set to 10932188; 26953873; 11559849 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.168 | NECTIN1 | Ain Roesley reviewed gene: NECTIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25913853, 10932188; Phenotypes: Cleft lip/palate-ectodermal dysplasia syndrome MIM#225060, Zlotogora-Ogur syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.168 | YAP1 | Zornitza Stark Marked gene: YAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.168 | YAP1 | Zornitza Stark Gene: yap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.168 | YAP1 | Zornitza Stark Phenotypes for gene: YAP1 were changed from COB1; COLOBOMA, OCULAR, WITH OR WITHOUT HEARING IMPAIRMENT, CLEFT LIP/PALATE, AND/OR MENTAL RETARDATION to Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation, MIM#120433 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.167 | YAP1 | Zornitza Stark Publications for gene: YAP1 were set to 24462371 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.166 | YAP1 | Zornitza Stark Classified gene: YAP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.166 | YAP1 | Zornitza Stark Gene: yap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.165 | YAP1 | Zornitza Stark reviewed gene: YAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24462371, 27267789, 28801591; Phenotypes: Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation, MIM#120433; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.165 | SIX5 | Zornitza Stark Marked gene: SIX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.165 | SIX5 | Zornitza Stark Gene: six5 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.165 | SIX5 | Zornitza Stark Phenotypes for gene: SIX5 were changed from BOR2; BRANCHIOOTORENAL SYNDROME 2 to Branchiootorenal syndrome 2, MIM# 610896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.164 | SIX5 | Zornitza Stark Publications for gene: SIX5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.163 | SIX5 | Zornitza Stark Mode of inheritance for gene: SIX5 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.162 | SIX5 | Zornitza Stark Classified gene: SIX5 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.162 | SIX5 | Zornitza Stark Gene: six5 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.161 | SIX5 | Zornitza Stark reviewed gene: SIX5: Rating: RED; Mode of pathogenicity: None; Publications: 17357085, 33624842, 20301554, 24730701, 22447252, 21280147, 14704431, 11950062, 10802667, 10802668; Phenotypes: Branchiootorenal syndrome 2, MIM# 610896; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.161 | MED12 | Zornitza Stark Phenotypes for gene: MED12 were changed from Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate; Hardikar syndrome, OMIM #612726 to Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate; Hardikar syndrome, MIM# 301068 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.160 | MED12 | Zornitza Stark reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hardikar syndrome, MIM# 301068; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.160 | EIF4A3 | Zornitza Stark Tag STR tag was added to gene: EIF4A3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.160 | GNB1 | Zornitza Stark Marked gene: GNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.160 | GNB1 | Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.160 | GNB1 | Zornitza Stark Phenotypes for gene: GNB1 were changed from Mental retardation, autosomal dominant 42, 616973 to Intellectual developmental disorder, autosomal dominant 42, MIM# 616973 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.159 | GNB1 | Zornitza Stark Publications for gene: GNB1 were set to 27108799 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.158 | GNB1 | Zornitza Stark Mode of inheritance for gene: GNB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.157 | GNB1 | Zornitza Stark Classified gene: GNB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.157 | GNB1 | Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.156 | GNB1 | Zornitza Stark reviewed gene: GNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32134617; Phenotypes: Intellectual developmental disorder, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.156 | SCUBE3 | Zornitza Stark Marked gene: SCUBE3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.156 | SCUBE3 | Zornitza Stark Gene: scube3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.156 | SCUBE3 | Zornitza Stark Classified gene: SCUBE3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.156 | SCUBE3 | Zornitza Stark Gene: scube3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.155 | SCUBE3 |
Zornitza Stark gene: SCUBE3 was added gene: SCUBE3 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: SCUBE3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SCUBE3 were set to 33308444 Phenotypes for gene: SCUBE3 were set to Short stature, facial dysmorphism, and skeletal anomalies with or without cardiac anomalies, MIM# 619184 Review for gene: SCUBE3 was set to AMBER Added comment: Eighteen affected individuals from nine unrelated families reported with a consistent phenotype characterised by reduced growth, skeletal features, distinctive craniofacial appearance, and dental anomalies. Mouse model recapitulated phenotype. Clefting reported in 3 individuals. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.154 | GRHL3 | Zornitza Stark Marked gene: GRHL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.154 | GRHL3 | Zornitza Stark Gene: grhl3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.154 | GRHL3 | Zornitza Stark Phenotypes for gene: GRHL3 were changed from Cleft lip; VAN DER WOUDE SYNDROME 2 to Van der Woude syndrome 2 MIM#606713 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.153 | GRHL3 | Zornitza Stark Publications for gene: GRHL3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.152 | GRHL3 | Zornitza Stark Mode of inheritance for gene: GRHL3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.151 | GRHL3 | Zornitza Stark reviewed gene: GRHL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360809, 29500247; Phenotypes: Van der Woude syndrome 2 MIM#606713; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.151 | CTCF | Zornitza Stark Marked gene: CTCF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.151 | CTCF | Zornitza Stark Gene: ctcf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.151 | CTCF | Zornitza Stark Phenotypes for gene: CTCF were changed from MENTAL RETARDATION, AUTOSOMAL DOMINANT 21; MRD21 to Mental retardation, autosomal dominant 21 (MIM#615502) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.150 | CTCF | Zornitza Stark Publications for gene: CTCF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.149 | CTCF | Zornitza Stark Mode of inheritance for gene: CTCF was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.148 | CTCF | Zornitza Stark reviewed gene: CTCF: Rating: GREEN; Mode of pathogenicity: None; Publications: 23746550, 31239556; Phenotypes: Mental retardation, autosomal dominant 21 (MIM#615502); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.148 | CDH1 | Zornitza Stark Marked gene: CDH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.148 | CDH1 | Zornitza Stark Gene: cdh1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.148 | CDH1 | Zornitza Stark Phenotypes for gene: CDH1 were changed from Blepharocheilodontic syndrome 1; BLEPHAROCHEILODONTIC to Blepharocheilodontic syndrome 1, MIM# 119580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.147 | CDH1 | Zornitza Stark Publications for gene: CDH1 were set to 27566442; 28301459 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.146 | CDH1 | Zornitza Stark Mode of inheritance for gene: CDH1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.145 | CDH1 | Zornitza Stark reviewed gene: CDH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28301459; Phenotypes: Blepharocheilodontic syndrome 1, MIM# 119580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.145 | HNRNPK | Zornitza Stark Marked gene: HNRNPK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.145 | HNRNPK | Zornitza Stark Gene: hnrnpk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.145 | HNRNPK | Zornitza Stark Classified gene: HNRNPK as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.145 | HNRNPK | Zornitza Stark Gene: hnrnpk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.144 | HNRNPK |
Ain Roesley gene: HNRNPK was added gene: HNRNPK was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: HNRNPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HNRNPK were set to Au-Kline syndrome MIM#616580 Penetrance for gene: HNRNPK were set to Complete Review for gene: HNRNPK was set to GREEN gene: HNRNPK was marked as current diagnostic Added comment: Caused by de novo variants. Review of >20 individuals in GeneReviews: - Brain anomalies have been identified in several individuals. The most common abnormalities were heterotopia and thinning of the corpus callosum. - Congenital heart disease is present in approximately 75% of individuals with AKS - Hydronephrosis is present in up to 75% of individuals - Craniosynostosis is present in approximately 1/3 of individuals with AKS. - More than half of individuals with AKS have scoliosis and congenital hip dysplasia - Palate abnormalities, which include cleft palate, high-arched or narrow palate, and bifid uvula, are common. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.144 | GDF11 | Zornitza Stark Publications for gene: GDF11 were set to PubMed: 31215115 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.143 | GDF11 | Chirag Patel Classified gene: GDF11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.143 | GDF11 | Chirag Patel Gene: gdf11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.142 | GDF11 | Chirag Patel edited their review of gene: GDF11: Added comment: Ravenscroft et al. (2021) report 6 probands who presented with craniofacial (5/6), vertebral (5/6), neurological (6/6), visual (4/6), cardiac (3/6), auditory (3/6), and connective tissue abnormalities (3/6). They found de novo and inherited variants in GDF11. gdf11 mutant zebrafish showed craniofacial abnormalities and body segmentation defects that matched some patient phenotypes. Expression of the patients’ variants in the fly showed that one nonsense variant in GDF11 is a severe loss-of-function (LOF) allele whereas the missense variants are partial LOF variants.; Changed rating: GREEN; Changed publications: PubMed: 31215115, 34113007; Changed phenotypes: Vertebral hypersegmentation and orofacial anomalies (VHO), OMIM #619122 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.142 | EIF3F | Zornitza Stark Marked gene: EIF3F as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.142 | EIF3F | Zornitza Stark Gene: eif3f has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.142 | EIF3F | Zornitza Stark Phenotypes for gene: EIF3F were changed from EIF3F-related neurodevelopmental disorder to EIF3F-related neurodevelopmental disorder; Mental retardation, autosomal recessive 67, MIM# 618295 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.141 | EIF3F | Chirag Patel Classified gene: EIF3F as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.141 | EIF3F | Chirag Patel Gene: eif3f has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.140 | EIF3F |
Chirag Patel gene: EIF3F was added gene: EIF3F was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: EIF3F was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3F were set to PMID: 33736665 Phenotypes for gene: EIF3F were set to EIF3F-related neurodevelopmental disorder Review for gene: EIF3F was set to GREEN Added comment: Hüffmeier et al (2021) reported 21 patients who were homozygous/compound heterozygous for Phe232Val variant in EIF3F. All affected individuals had developmental delay and speech delay. About half had behavioural problems, altered muscular tone, hearing loss, and short stature. The study suggests that microcephaly, reduced sensitivity to pain, cleft lip/palate, gastrointestinal symptoms and ophthalmological symptoms are part of the phenotypic spectrum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.139 | ANKRD17 | Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.138 | ANKRD17 | Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.138 | RBM10 | Zornitza Stark Marked gene: RBM10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.138 | RBM10 | Zornitza Stark Gene: rbm10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.138 | RBM10 | Zornitza Stark Phenotypes for gene: RBM10 were changed from TARPS; Cleft palate; TARP SYNDROME to TARP syndrome, MIM# 311900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.137 | RBM10 | Zornitza Stark Publications for gene: RBM10 were set to 20451169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.136 | RBM10 | Zornitza Stark reviewed gene: RBM10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20451169, 24259342, 30450804, 30189253, 33340101; Phenotypes: TARP syndrome, MIM# 311900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.136 | SF3B2 | Zornitza Stark Marked gene: SF3B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.136 | SF3B2 | Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.136 | SF3B2 | Zornitza Stark Classified gene: SF3B2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.136 | SF3B2 | Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.135 | SF3B2 |
Zornitza Stark gene: SF3B2 was added gene: SF3B2 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: SF3B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SF3B2 were set to 34344887 Phenotypes for gene: SF3B2 were set to Craniofacial microsomia Review for gene: SF3B2 was set to GREEN Added comment: Twenty individuals from seven families reported with de novo or transmitted haploinsufficient variants in SF3B2. Affected individuals had mandibular hypoplasia, microtia, facial and preauricular tags, epibulbar dermoids, lateral oral clefts in addition to skeletal and cardiac abnormalities. Targeted morpholino knockdown of SF3B2 in Xenopus resulted in disruption of cranial neural crest precursor formation and subsequent craniofacial cartilage defects, supporting a link between spliceosome mutations and impaired neural crest development in congenital craniofacial disease. The families were ascertained from a cohort and the authors suggest that haploinsufficient variants in SF3B2 are the most prevalent genetic cause of CFM, explaining ~3% of sporadic and ~25% of familial cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.134 | EIF4A3 | Zornitza Stark Marked gene: EIF4A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.134 | EIF4A3 | Zornitza Stark Gene: eif4a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.134 | EIF4A3 | Zornitza Stark Publications for gene: EIF4A3 were set to 10594883; 29112243; 29922329 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.133 | EIF4A3 | Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.133 | RIPK4 | Zornitza Stark Marked gene: RIPK4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.133 | RIPK4 | Zornitza Stark Gene: ripk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.133 | RIPK4 | Chirag Patel Classified gene: RIPK4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.133 | RIPK4 | Chirag Patel Gene: ripk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.132 | RIPK4 | Chirag Patel Classified gene: RIPK4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.132 | RIPK4 | Chirag Patel Gene: ripk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.131 | RIPK4 |
Chirag Patel gene: RIPK4 was added gene: RIPK4 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: RIPK4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RIPK4 were set to PMID: 28940926; 22197489; 22197488 Phenotypes for gene: RIPK4 were set to Popliteal pterygium syndrome, Bartsocas-Papas type 1, MIM# 263650 Review for gene: RIPK4 was set to GREEN gene: RIPK4 was marked as current diagnostic Added comment: Clefting well associated with this syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.130 | IGF2 | Zornitza Stark Marked gene: IGF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.130 | IGF2 | Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.130 | IGF2 | Zornitza Stark Classified gene: IGF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.130 | IGF2 | Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.129 | IGF2 |
Elena Savva gene: IGF2 was added gene: IGF2 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: IGF2 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Publications for gene: IGF2 were set to PMID: 31544945 Phenotypes for gene: IGF2 were set to Silver-Russell syndrome 3 MIM#616489 Review for gene: IGF2 was set to GREEN Added comment: PMID: 31544945 - cleft palate reported in 6/14 patients with SRS Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.129 | PPP1R13L | Zornitza Stark Marked gene: PPP1R13L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.129 | PPP1R13L | Zornitza Stark Gene: ppp1r13l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.129 | PPP1R13L | Zornitza Stark Classified gene: PPP1R13L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.129 | PPP1R13L | Zornitza Stark Gene: ppp1r13l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.128 | PPP1R13L |
Zornitza Stark gene: PPP1R13L was added gene: PPP1R13L was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: PPP1R13L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PPP1R13L were set to 32666529; 28864777 Phenotypes for gene: PPP1R13L were set to Dilated cardiomyopathy, onset in infancy; Cleft lip and palate Review for gene: PPP1R13L was set to GREEN Added comment: At least 6 unrelated families. NMD-predicted, missense and stop-loss (extension) variants have been reported in individuals with autosomal recessive PPP1R13L-related syndrome. Patients described with biallelic pathogenic variants in PPP1R13L all had severe infantile-onset dilated cardiomyopathy, with additional features including cleft lip and palate, wedge-shaped teeth, and sparse, dry, woolly hair described in several individuals. Death due to HF progression before 5yo reported in cases that didn't receive a heart transplant. Cognitive delay also reported in two unrelated individuals (PMID: 28069640, PMID: 32666529). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.127 | ZNF3 | Zornitza Stark Marked gene: ZNF3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.127 | ZNF3 | Zornitza Stark Gene: znf3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.127 | ZNF3 |
Zornitza Stark gene: ZNF3 was added gene: ZNF3 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: ZNF3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF3 were set to 32732226 Phenotypes for gene: ZNF3 were set to Hydrocephalus; cleft palate; microphthalmia Review for gene: ZNF3 was set to RED Added comment: Novel candidate gene identified in a fetus with hydrocephaly and facial cleft detected by fetal ultrasound. Autopsy showed multiple congenital abnormalities including a median cleft palate, partial maxillar agenesis, bilateral severe microphthalmia, arhinencephaly, partial thalamic fusion. A homozygous truncating variant (c.396A>G/ p.*132Trpext*69) in ZNF3 was found by exome sequencing. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.126 | ZEB2 | Zornitza Stark Marked gene: ZEB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.126 | ZEB2 | Zornitza Stark Gene: zeb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.126 | ZEB2 | Zornitza Stark Phenotypes for gene: ZEB2 were changed from MOWAT-WILSON SYNDROME; MOWS to Mowat-Wilson syndrome, MIM# 235730; MONDO:0009341 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.125 | ZEB2 | Zornitza Stark Publications for gene: ZEB2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.124 | ZEB2 | Zornitza Stark reviewed gene: ZEB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29300384, 27831545, 24715670, 19215041, 17958891; Phenotypes: Mowat-Wilson syndrome, MIM# 235730, MONDO:0009341; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.124 | SATB2 | Zornitza Stark Marked gene: SATB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.124 | SATB2 | Zornitza Stark Gene: satb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.124 | SATB2 | Zornitza Stark Phenotypes for gene: SATB2 were changed from Glass syndrome; GLASS SYNDROME; Cleft palate; GLASS; Cleft palate, intellectual disability, poor- absent speech, bone fragility- raised serum alkaline phosphatas; Chromosome 2q32-q33 deletion syndrome; Orofacial Clefting with skeletal features to Glass syndrome, MIM# 612313; MONDO:0100147 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.123 | SATB2 | Zornitza Stark Publications for gene: SATB2 were set to 16179223 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.122 | SATB2 | Zornitza Stark Mode of inheritance for gene: SATB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.121 | SATB2 | Zornitza Stark reviewed gene: SATB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29023086, 28151491, 32446642; Phenotypes: Glass syndrome, MIM# 612313, MONDO:0100147; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.121 | MASP1 | Zornitza Stark Marked gene: MASP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.121 | MASP1 | Zornitza Stark Gene: masp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.121 | MASP1 | Zornitza Stark Phenotypes for gene: MASP1 were changed from 3MC1; 3MC SYNDROME 1 to 3MC syndrome 1, MIM# 257920; MONDO:0009770 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.120 | MASP1 | Zornitza Stark Publications for gene: MASP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.119 | MASP1 | Zornitza Stark reviewed gene: MASP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26789649, 21258343, 21035106; Phenotypes: 3MC syndrome 1, MIM# 257920, MONDO:0009770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.119 | SEPT9 | Zornitza Stark Marked gene: SEPT9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.119 | SEPT9 | Zornitza Stark Gene: sept9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.119 | SEPT9 |
Zornitza Stark Tag SV/CNV tag was added to gene: SEPT9. Tag 5'UTR tag was added to gene: SEPT9. Tag founder tag was added to gene: SEPT9. Tag new gene name tag was added to gene: SEPT9. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.119 | SEPT9 | Zornitza Stark Phenotypes for gene: SEPT9 were changed from HNA; AMYOTROPHY, HEREDITARY NEURALGIC to HNA; Amyotrophy, hereditary neuralgic, MIM# 162100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.118 | SEPT9 | Zornitza Stark Publications for gene: SEPT9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.117 | SEPT9 | Zornitza Stark Mode of inheritance for gene: SEPT9 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.116 | SEPT9 | Zornitza Stark Classified gene: SEPT9 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.116 | SEPT9 | Zornitza Stark Gene: sept9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.115 | SEPT9 | Zornitza Stark reviewed gene: SEPT9: Rating: AMBER; Mode of pathogenicity: None; Publications: 16186812, 19451530, 19939853, 19139049, 18492087; Phenotypes: Amyotrophy, hereditary neuralgic, MIM# 162100; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.115 | ANKRD17 | Zornitza Stark Classified gene: ANKRD17 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.115 | ANKRD17 | Zornitza Stark Gene: ankrd17 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.114 | ANKRD17 | Zornitza Stark Publications for gene: ANKRD17 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.113 | ANKRD17 | Zornitza Stark Classified gene: ANKRD17 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.113 | ANKRD17 | Zornitza Stark Gene: ankrd17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.112 | ANKRD17 | Paul De Fazio reviewed gene: ANKRD17: Rating: AMBER; Mode of pathogenicity: None; Publications: 33909992; Phenotypes: Intellectual disability, speech delay, and dysmorphism; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.112 | PLCH1 | Zornitza Stark Marked gene: PLCH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.112 | PLCH1 | Zornitza Stark Gene: plch1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.112 | PLCH1 | Zornitza Stark Classified gene: PLCH1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.112 | PLCH1 | Zornitza Stark Gene: plch1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.111 | PLCH1 |
Zornitza Stark gene: PLCH1 was added gene: PLCH1 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: PLCH1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLCH1 were set to 33820834 Phenotypes for gene: PLCH1 were set to Holoprosencephaly spectrum; Severe developmental delay; Brain malformations Review for gene: PLCH1 was set to AMBER Added comment: PMID: 33820834 (2021) - Two sibling pairs from two unrelated families with a holoprosencephaly spectrum phenotype and different homozygous PLCH1 variants (c.2065C>T, p.Arg689* and c.4235delA, p.Cys1079ValfsTer16, respectively). One family presented with congenital hydrocephalus, epilepsy, significant developmental delay and a monoventricle or fused thalami; while sibs from the second family had alobar holoprosencephaly and cyclopia. 3/4 individuals also displayed a cleft palate and congenital heart disease. Human embryo immunohistochemistry showed PLCH1 to be expressed in the notorcord, developing spinal cord (in a ventral to dorsal gradient), dorsal root ganglia, cerebellum and dermatomyosome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.110 | MED12 | Zornitza Stark Marked gene: MED12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.110 | MED12 | Zornitza Stark Gene: med12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.110 | MED12 | Zornitza Stark Phenotypes for gene: MED12 were changed from Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate to Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate; Hardikar syndrome, OMIM #612726 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.109 | MED12 | Zornitza Stark Publications for gene: MED12 were set to 12784307 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.108 | MED12 | Chirag Patel Classified gene: MED12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.108 | MED12 | Chirag Patel Gene: med12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.107 | MED12 | Chirag Patel reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33244166; Phenotypes: Hardikar syndrome, OMIM #612726; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.107 | TXNL4A | Zornitza Stark Marked gene: TXNL4A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.107 | TXNL4A | Zornitza Stark Gene: txnl4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.107 | TXNL4A |
Zornitza Stark Tag SV/CNV tag was added to gene: TXNL4A. Tag 5'UTR tag was added to gene: TXNL4A. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.107 | TXNL4A | Zornitza Stark Phenotypes for gene: TXNL4A were changed from BURN-MCKEOWN SYNDROME; BMKS; Cleft palate to Burn-McKeown syndrome, MIM# 608572; Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.106 | TXNL4A | Zornitza Stark reviewed gene: TXNL4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25434003; Phenotypes: Burn-McKeown syndrome, MIM# 608572, Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.106 | MN1 | Zornitza Stark Phenotypes for gene: MN1 were changed from Cleft palate to Cleft palate; CEBALID syndrome, MIM# 618774 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.105 | MN1 | Zornitza Stark Marked gene: MN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.105 | MN1 | Zornitza Stark Gene: mn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.105 | MN1 | Zornitza Stark Classified gene: MN1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.105 | MN1 | Zornitza Stark Gene: mn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.104 | MN1 |
Michelle Torres gene: MN1 was added gene: MN1 was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: MN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MN1 were set to 33351141; 31834374; 33351070 Phenotypes for gene: MN1 were set to Cleft palate Mode of pathogenicity for gene: MN1 was set to Other Review for gene: MN1 was set to AMBER Added comment: MN1 is associated to CEBALID syndrome (MIM# 618774), and many individuals have been reported with a high-arched palate. So far, 2 individuals have been reported with cleft palate, one with a severe form of the condition, associated with a truncating variant at the C-terminal, which are known to result in gain of function (PMID 31834374). And more recently, a NMD variant, established by RT-PCR and Western Blot, has been identified in a family with cleft palate and conductive hearing loss, but no ID and no other dysmorphic features (PMID 33351070). PMID 33351141 mentions that LoF is likely associated with a milder phenotype despite the high MAF of some NMD in the population, as these are in low complexity region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.104 | ESCO2 | Zornitza Stark Marked gene: ESCO2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.104 | ESCO2 | Zornitza Stark Gene: esco2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.104 | ESCO2 | Zornitza Stark Phenotypes for gene: ESCO2 were changed from ROBERTS SYNDROME; RBS, SC PHOCOMELIA SYNDROME to Juberg-Hayward syndrome, MIM# 216100; Roberts-SC phocomelia syndrome, MIM#268300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.103 | ESCO2 | Zornitza Stark Publications for gene: ESCO2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.102 | ESCO2 | Zornitza Stark reviewed gene: ESCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32977150; Phenotypes: Juberg-Hayward syndrome, MIM# 216100, Roberts-SC phocomelia syndrome, MIM#268300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.102 | SHROOM3 | Zornitza Stark Marked gene: SHROOM3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.102 | SHROOM3 | Zornitza Stark Gene: shroom3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.102 | SHROOM3 | Zornitza Stark Classified gene: SHROOM3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.102 | SHROOM3 | Zornitza Stark Gene: shroom3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.101 | SHROOM3 |
Zornitza Stark gene: SHROOM3 was added gene: SHROOM3 was added to Clefting disorders. Sources: Expert Review Mode of inheritance for gene: SHROOM3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SHROOM3 were set to 32621286 Phenotypes for gene: SHROOM3 were set to Anencephaly; cleft lip and palate Review for gene: SHROOM3 was set to AMBER Added comment: Animal model and other functional data link SHROOM3 to neural tube development. Single family reported with bi-allelic LoF in a fetus with anencephaly and CL/P. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.100 | DHODH | Zornitza Stark Marked gene: DHODH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.100 | DHODH | Zornitza Stark Gene: dhodh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.100 | DHODH | Zornitza Stark Phenotypes for gene: DHODH were changed from POADS = MILLER; POSTAXIAL ACROFACIAL DYSOSTOSIS to Miller syndrome, MIM# 263750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.99 | DHODH | Zornitza Stark Publications for gene: DHODH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.98 | DHODH | Zornitza Stark reviewed gene: DHODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 19915526, 20220176, 33262786, 27370710; Phenotypes: Miller syndrome, MIM# 263750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.98 | ALX3 | Zornitza Stark Phenotypes for gene: ALX3 were changed from FND1; Frontorhiny; FRONTONASAL DYSPLASIA 1 to Frontonasal dysplasia 1, MIM# 136760; Frontorhiny | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.97 | ALX3 | Zornitza Stark reviewed gene: ALX3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Frontonasal dysplasia 1, MIM# 136760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.97 | ALX1 | Zornitza Stark Phenotypes for gene: ALX1 were changed from ?Frontonasal dysplasia 3, 613456 to Frontonasal dysplasia 3, MIM#613456; severe facial clefting | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.96 | ALX1 | Zornitza Stark reviewed gene: ALX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Frontonasal dysplasia 3, MIM# 613456; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.96 | USP9X | Zornitza Stark Marked gene: USP9X as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.96 | USP9X | Zornitza Stark Gene: usp9x has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.96 | ALX1 | Tiong Tan Classified gene: ALX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.96 | ALX1 | Tiong Tan Added comment: Comment on list classification: Mediocre reviewer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.96 | ALX1 | Tiong Tan Gene: alx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | ALX3 | Tiong Tan Marked gene: ALX3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | ALX3 | Tiong Tan Gene: alx3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | ALX3 | Tiong Tan reviewed gene: ALX3: Rating: AMBER; Mode of pathogenicity: None; Publications: 19409524, 29215096, 31914496; Phenotypes: Frontorhiny; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | ALX1 | Tiong Tan Marked gene: ALX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | ALX1 | Tiong Tan Gene: alx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | ALX1 | Tiong Tan reviewed gene: ALX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31914496, 20451171, 24592072; Phenotypes: Frontonasal dysplasia, severe facial clefting; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | USP9X | Tiong Tan reviewed gene: USP9X: Rating: GREEN; Mode of pathogenicity: None; Publications: 26833328; Phenotypes: 300968 MENTAL RETARDATION, X-LINKED 99, SYNDROMIC, FEMALE-RESTRICTED; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | RPS28 | Zornitza Stark Marked gene: RPS28 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | RPS28 | Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.95 | RPS28 | Zornitza Stark Phenotypes for gene: RPS28 were changed from DBA15; DIAMOND-BLACKFAN ANEMIA 15 WITH MANDIBULOFACIAL DYSOSTOSIS; Cleft palate to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.94 | RPS28 | Zornitza Stark Publications for gene: RPS28 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.93 | INTS1 | Zornitza Stark Marked gene: INTS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.93 | INTS1 | Zornitza Stark Gene: ints1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.93 | INTS1 | Zornitza Stark Marked gene: INTS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.93 | INTS1 | Zornitza Stark Gene: ints1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.93 | INTS1 | Zornitza Stark Phenotypes for gene: INTS1 were changed from Cleft palate to Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies, MIM# 618571; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.92 | INTS1 | Zornitza Stark Publications for gene: INTS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.91 | INTS1 | Zornitza Stark Mode of inheritance for gene: INTS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.90 | SELENOI | Zornitza Stark Marked gene: SELENOI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.90 | SELENOI | Zornitza Stark Gene: selenoi has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.90 | SELENOI | Zornitza Stark Phenotypes for gene: SELENOI were changed from Cleft palate to Cleft palate; developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.89 | SELENOI | Zornitza Stark Publications for gene: SELENOI were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.88 | SELENOI | Zornitza Stark Mode of inheritance for gene: SELENOI was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.87 | TBX2 | Zornitza Stark Marked gene: TBX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.87 | TBX2 | Zornitza Stark Gene: tbx2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.87 | TSR2 | Zornitza Stark Marked gene: TSR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.87 | TSR2 | Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.87 | TSR2 | Zornitza Stark Phenotypes for gene: TSR2 were changed from Cleft palate to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.86 | TSR2 | Zornitza Stark Publications for gene: TSR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.85 | TSR2 | Zornitza Stark Mode of inheritance for gene: TSR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.84 | PGM1 | Zornitza Stark Marked gene: PGM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.84 | PGM1 | Zornitza Stark Gene: pgm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.84 | PGM1 | Zornitza Stark Phenotypes for gene: PGM1 were changed from Cleft palate to Congenital disorder of glycosylation, type It 614921; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.83 | PGM1 | Zornitza Stark Publications for gene: PGM1 were set to 31563034; 26303607; 24878975; PMID: 27206562; PMID: 29858906; PMID: 32681750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.82 | PGM1 | Zornitza Stark Publications for gene: PGM1 were set to PMID: 31563034; PMID: 26303607PMID: 24878975; PMID: 27206562; PMID: 29858906; PMID: 32681750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.81 | PGM1 | Zornitza Stark Publications for gene: PGM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.80 | PGM1 | Zornitza Stark Mode of inheritance for gene: PGM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.79 | CTNND1 | Zornitza Stark Marked gene: CTNND1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.79 | CTNND1 | Zornitza Stark Gene: ctnnd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.79 | CTNND1 | Zornitza Stark Phenotypes for gene: CTNND1 were changed from BLEPHAROCHEILODONTIC; Cleft palate to Blepharocheilodontic syndrome 2, MIM# 617681 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.78 | CTNND1 | Zornitza Stark Publications for gene: CTNND1 were set to 28301459 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.77 | ARHGAP29 | Zornitza Stark Marked gene: ARHGAP29 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.77 | ARHGAP29 | Zornitza Stark Gene: arhgap29 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.76 |
Zornitza Stark Panel name changed from Clefting_GEL to Clefting disorders Panel status changed from internal to public Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Rare Disease |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.75 | FBRSL1 | Zornitza Stark Marked gene: FBRSL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.75 | FBRSL1 | Zornitza Stark Gene: fbrsl1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.75 | FBRSL1 | Zornitza Stark Classified gene: FBRSL1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.75 | FBRSL1 | Zornitza Stark Gene: fbrsl1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.74 | FBRSL1 |
Zornitza Stark gene: FBRSL1 was added gene: FBRSL1 was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: FBRSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FBRSL1 were set to 32424618 Phenotypes for gene: FBRSL1 were set to Malformation and intellectual disability syndrome; Cleft palate Review for gene: FBRSL1 was set to AMBER Added comment: Three children with de novo PTCs that escape NMD, and an overlapping syndromic phenotype. 2/3 had heart defects, cleft palate and hearing impairment. Variant pathogenicity supported by Xenopus oocyte functional studies Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.73 | ESRP2 | Zornitza Stark Marked gene: ESRP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.73 | ESRP2 | Zornitza Stark Gene: esrp2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.73 | ESRP2 | Zornitza Stark reviewed gene: ESRP2: Rating: AMBER; Mode of pathogenicity: None; Publications: 29805042; Phenotypes: Cleft lip; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.73 | EDN1 | Zornitza Stark Marked gene: EDN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.73 | EDN1 | Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.73 | EDN1 | Zornitza Stark Phenotypes for gene: EDN1 were changed from Cleft palate to Auriculocondylar syndrome 3, MIM# 615706; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.72 | EDN1 | Zornitza Stark Publications for gene: EDN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.71 | EDN1 | Zornitza Stark Mode of inheritance for gene: EDN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.70 | EDN1 | Zornitza Stark Classified gene: EDN1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.70 | EDN1 | Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.69 | EDN1 | Zornitza Stark edited their review of gene: EDN1: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.69 | EDN1 | Zornitza Stark reviewed gene: EDN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315542, 23913798; Phenotypes: Auriculocondylar syndrome 3, MIM# 615706; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.68 | COL9A3 | Zornitza Stark Marked gene: COL9A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.68 | COL9A3 | Zornitza Stark Gene: col9a3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.68 | COL9A3 | Zornitza Stark Phenotypes for gene: COL9A3 were changed from Cleft palate to Stickler syndrome; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.67 | COL9A3 | Zornitza Stark Publications for gene: COL9A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.66 | COL9A3 | Zornitza Stark Mode of inheritance for gene: COL9A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.65 | COL9A3 | Zornitza Stark Classified gene: COL9A3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.65 | COL9A3 | Zornitza Stark Gene: col9a3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.64 | COL9A3 | Zornitza Stark reviewed gene: COL9A3: Rating: AMBER; Mode of pathogenicity: None; Publications: 24273071, 30450842, 31090205, 20301479; Phenotypes: Stickler syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.64 | Zornitza Stark Panel types changed to Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.63 | COL9A2 | Zornitza Stark Marked gene: COL9A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.63 | COL9A2 | Zornitza Stark Gene: col9a2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.63 | COL9A2 | Zornitza Stark Phenotypes for gene: COL9A2 were changed from Stickler syndrome; Orofacial Clefting with skeletal features; ?Stickler syndrome type V, 614284; Cleft palate to Stickler syndrome, type V, MIM# 614284 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.62 | COL9A2 | Zornitza Stark Publications for gene: COL9A2 were set to 21671392 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.61 | COL9A2 | Zornitza Stark reviewed gene: COL9A2: Rating: AMBER; Mode of pathogenicity: None; Publications: 21671392, 31090205, 33356723; Phenotypes: Stickler syndrome, type V, MIM# 614284; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.61 | CHD1 | Zornitza Stark Marked gene: CHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.61 | CHD1 | Zornitza Stark Gene: chd1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.61 | CHD1 | Zornitza Stark reviewed gene: CHD1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.61 | BMP4 | Zornitza Stark Marked gene: BMP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.61 | BMP4 | Zornitza Stark Gene: bmp4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.61 | BMP4 | Zornitza Stark Phenotypes for gene: BMP4 were changed from Cleft lip with or without cleft palate, non syndromic, 11; MCOPS6, OROFACIAL CLEFT 11; OFC11; Orofacial Cleft; Cleft Lip with or without Cleft Palate; Cleft lip; MICROPHTHALMIA, SYNDROMIC 6; Orofacial cleft 11, 600625 to Orofacial cleft 11 600625; Microphthalmia, syndromic 6, MIM# 607932 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.60 | BMP4 | Zornitza Stark Publications for gene: BMP4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.59 | BMP4 | Zornitza Stark Classified gene: BMP4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.59 | BMP4 | Zornitza Stark Gene: bmp4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.58 | BMP4 | Zornitza Stark reviewed gene: BMP4: Rating: GREEN; Mode of pathogenicity: None; Publications: 31053785, 19249007, 31909686; Phenotypes: Orofacial cleft 11 600625, Microphthalmia, syndromic 6, MIM# 607932; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.58 | ANKRD17 | Zornitza Stark Marked gene: ANKRD17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.58 | ANKRD17 | Zornitza Stark Gene: ankrd17 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.58 | ANKRD17 | Zornitza Stark Classified gene: ANKRD17 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.58 | ANKRD17 | Zornitza Stark Gene: ankrd17 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.57 | ANKRD17 |
Zornitza Stark gene: ANKRD17 was added gene: ANKRD17 was added to Clefting_GEL. Sources: Expert Review Mode of inheritance for gene: ANKRD17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANKRD17 were set to Intellectual disability; dysmorphic features Review for gene: ANKRD17 was set to AMBER Added comment: Emerging evidence. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.56 | AMOTL1 | Zornitza Stark Marked gene: AMOTL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.56 | AMOTL1 | Zornitza Stark Gene: amotl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.56 | AMOTL1 |
Zornitza Stark gene: AMOTL1 was added gene: AMOTL1 was added to Clefting_GEL. Sources: Literature Mode of inheritance for gene: AMOTL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AMOTL1 were set to 33026150 Phenotypes for gene: AMOTL1 were set to Cleft lip and palate; imperforate anus; dysmorphism Review for gene: AMOTL1 was set to RED Added comment: Two unrelated families reported. In one, the variant was identified in parent and child who had orofacial cleft and cardiac abnormalities. Second report in PMID 33026150, de novo missense variant and cleft lip/palate, imperforate anus and dysmorphism. Mouse model does not recapitulate phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.55 | ACBD5 | Zornitza Stark Marked gene: ACBD5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.55 | ACBD5 | Zornitza Stark Gene: acbd5 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.55 | ACBD5 | Zornitza Stark Phenotypes for gene: ACBD5 were changed from Cleft palate to Retinal dystrophy with leukodystrophy, MIM# 618863; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.54 | ACBD5 | Zornitza Stark Publications for gene: ACBD5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.53 | ACBD5 | Zornitza Stark Mode of inheritance for gene: ACBD5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.52 | ACBD5 | Zornitza Stark reviewed gene: ACBD5: Rating: RED; Mode of pathogenicity: None; Publications: 27799409, 23105016, 33427402; Phenotypes: Retinal dystrophy with leukodystrophy, MIM# 618863; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.52 | FST | Zornitza Stark Marked gene: FST as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.52 | FST | Zornitza Stark Gene: fst has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.52 | FOXE1 | Zornitza Stark Marked gene: FOXE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.52 | FOXE1 | Zornitza Stark Gene: foxe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.52 | FOXE1 | Zornitza Stark Phenotypes for gene: FOXE1 were changed from Cleft palate to Bamforth-Lazarus syndrome, OMIM #241850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.51 | FOXE1 | Zornitza Stark Publications for gene: FOXE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.50 | FOXE1 | Zornitza Stark Mode of inheritance for gene: FOXE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.49 | GDF11 | Zornitza Stark Classified gene: GDF11 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.49 | GDF11 | Zornitza Stark Gene: gdf11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.48 | GDF11 | Zornitza Stark reviewed gene: GDF11: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.48 | GDF11 | Zornitza Stark Marked gene: GDF11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.48 | GDF11 | Zornitza Stark Gene: gdf11 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.48 | GNAI3 | Zornitza Stark Marked gene: GNAI3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.48 | GNAI3 | Zornitza Stark Gene: gnai3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.48 | GNAI3 | Zornitza Stark Phenotypes for gene: GNAI3 were changed from Cleft palate to Auriculocondylar syndrome 1, OMIM #602483 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.47 | GNAI3 | Zornitza Stark Publications for gene: GNAI3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.46 | GNAI3 | Zornitza Stark Mode of inheritance for gene: GNAI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.45 | HOXA2 | Zornitza Stark Marked gene: HOXA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.45 | HOXA2 | Zornitza Stark Gene: hoxa2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.45 | HOXA2 | Zornitza Stark Mode of inheritance for gene: HOXA2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | KAT5 | Zornitza Stark Marked gene: KAT5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | KAT5 | Zornitza Stark Gene: kat5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | LRP6 | Zornitza Stark Marked gene: LRP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | LRP6 | Zornitza Stark Gene: lrp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | LRRC32 | Zornitza Stark Marked gene: LRRC32 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | LRRC32 | Zornitza Stark Gene: lrrc32 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | MED13L | Zornitza Stark Marked gene: MED13L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | MED13L | Zornitza Stark Gene: med13l has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.44 | FST |
Chirag Patel gene: FST was added gene: FST was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: FST was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FST were set to PubMed: 31215115 Phenotypes for gene: FST were set to orofacial clefting Review for gene: FST was set to RED Added comment: In a cohort of 72 families with orofacial clefting, Cox et al. (2019) performed exome sequencing and identified a father and 2 daughters (family 22) with cleft lip and palate who were heterozygous for missense variant (C56Y) in FST. A highly conserved residue within the 63-residue N-terminal domain. The variant was not found in the unaffected paternal grandmother or in the gnomAD database. Classed as a VUS. Functional analysis in transfected HEK293T cells, using a stable cell line sensitive to stimulation by the FST downstream target GDF11, demonstrated that wildtype FST efficiently and completely antagonized GDF11-stimulated reporter activity. In contrast, the C56Y mutant did not significantly inhibit the stimulation of reporter activity, regardless of the amount of mutant vector transfected. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.43 | FOXE1 | Chirag Patel Classified gene: FOXE1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.43 | FOXE1 | Chirag Patel Gene: foxe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.42 | FOXE1 | Chirag Patel reviewed gene: FOXE1: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 9697705, 12165566, 16882747; Phenotypes: Bamforth-Lazarus syndrome, OMIM #241850; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.42 | GDF11 |
Chirag Patel gene: GDF11 was added gene: GDF11 was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: GDF11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GDF11 were set to PubMed: 31215115 Phenotypes for gene: GDF11 were set to Vertebral hypersegmentation and orofacial anomalies (VHO), MIM#619122 Review for gene: GDF11 was set to RED Added comment: In 5 affected members over 3 generations of a family segregating vertebral hypersegmentation and orofacial anomalies, Cox et al. (2019) identified heterozygosity for a missense mutation in the GDF11 gene (R298Q) that was not found in unaffected family members or in public variant databases. Functional analysis demonstrated that the R298Q substitution prevents cleavage to the active form of the protein, resulting in loss of function. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.41 | GNAI3 | Chirag Patel reviewed gene: GNAI3: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 22560091, 16114046; Phenotypes: Auriculocondylar syndrome 1, OMIM #602483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.41 | HOXA2 | Chirag Patel reviewed gene: HOXA2: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 18394579; Phenotypes: ?Microtia, hearing impairment, and cleft palate (AR); Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.41 | KAT5 | Chirag Patel Classified gene: KAT5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.41 | KAT5 | Chirag Patel Gene: kat5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.40 | KAT5 |
Chirag Patel gene: KAT5 was added gene: KAT5 was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: KAT5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KAT5 were set to PMID: 32822602 Phenotypes for gene: KAT5 were set to Neurodevelopmental disorder wtih dysmorphic facies, sleep disturbance, and brain abnormalities, OMIM #619103 Review for gene: KAT5 was set to AMBER Added comment: In 3 unrelated patients with neurodevelopmental disorder with dysmorphic facies, sleep disturbance, and brain abnormalities, they found 3 different de novo heterozygous missense mutations in the KAT5 gene: R53H, C369S, and S413A. Cleft LP and submucous cleft P were observed in 2/3. The mutations were found by exome sequencing and the patients were ascertained through the GeneMatcher program. None of the mutations were present in the gnomAD database. In vitro functional expression studies showed that the mutations resulted in variably decreased histone acetyltransferase (HAT) activity compared to controls. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.39 | LRP6 | Chirag Patel Classified gene: LRP6 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.39 | LRP6 | Chirag Patel Gene: lrp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.38 | LRP6 |
Chirag Patel gene: LRP6 was added gene: LRP6 was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: LRP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LRP6 were set to PMID: 29500247, 26963285 Phenotypes for gene: LRP6 were set to cleft lip; cleft palate; tooth agenesis; oligodontia Review for gene: LRP6 was set to AMBER Added comment: 2 unrelated patients with orofacial clefting reported in two papers with LRP6 variants (p.Cys1532fs, p.?, and p.Arg1125*). no functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.37 | LRRC32 | Chirag Patel Classified gene: LRRC32 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.37 | LRRC32 | Chirag Patel Gene: lrrc32 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.36 | LRRC32 |
Chirag Patel gene: LRRC32 was added gene: LRRC32 was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: LRRC32 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LRRC32 were set to PMID: 30976112 Phenotypes for gene: LRRC32 were set to Cleft palate, proliferative retinopathy, and developmental delay (CPPRDD) syndrome, MIM# 619074 Review for gene: LRRC32 was set to AMBER Added comment: Three individuals from two consanguineous families with cleft palate, proliferative retinopathy, and developmental delay had the same homozygous biallelic variant, c.1630C>T; p.(Arg544Ter), segregated and shared haplotype indicative of founder effect. Mouse model has cleft palate and neonatal death. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.35 | MED13L | Chirag Patel reviewed gene: MED13L: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 25137640, 25712080; Phenotypes: Mental retardation and distinctive facial features with or without cardiac defects, OMIM #616789; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.35 | HYAL2 | Zornitza Stark Marked gene: HYAL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.35 | HYAL2 | Zornitza Stark Gene: hyal2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.35 | HYAL2 | Zornitza Stark Classified gene: HYAL2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.35 | HYAL2 | Zornitza Stark Gene: hyal2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.34 | HYAL2 |
Zornitza Stark gene: HYAL2 was added gene: HYAL2 was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: HYAL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HYAL2 were set to 28081210; 23172227; 26515055 Phenotypes for gene: HYAL2 were set to Cleft lip and palate; cor triatriatum; congenital cardiac malformations Review for gene: HYAL2 was set to AMBER Added comment: 2 unrelated consanguineous extended families (Amish and Arab) with an orofacial clefting phenotype with cardiac anomalies. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.33 | Zornitza Stark removed gene:UBB from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.32 | Zornitza Stark removed gene:GYPE from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.31 | PGM1 | Chirag Patel Classified gene: PGM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.31 | PGM1 | Chirag Patel Gene: pgm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.30 | DLX4 | Zornitza Stark Marked gene: DLX4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.30 | DLX4 | Zornitza Stark Gene: dlx4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.30 | DLX4 | Zornitza Stark Phenotypes for gene: DLX4 were changed from nonsyndromic cleft/lip palate (CL/P); OFC15; OROFACIAL CLEFT 15; ?Orofacial cleft 15, 616788 to Orofacial cleft 15, MIM# 616788 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.29 | DLX4 | Zornitza Stark Publications for gene: DLX4 were set to 25954033 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.28 | DLX4 | Zornitza Stark Classified gene: DLX4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.28 | DLX4 | Zornitza Stark Gene: dlx4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.27 | DLX4 | Zornitza Stark reviewed gene: DLX4: Rating: RED; Mode of pathogenicity: None; Publications: 25954033, 29738288; Phenotypes: Orofacial cleft 15, MIM# 616788; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.27 | PHF8 | Zornitza Stark reviewed gene: PHF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.27 | PHF8 | Zornitza Stark Marked gene: PHF8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.27 | PHF8 | Zornitza Stark Gene: phf8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.27 | PHF8 | Zornitza Stark Phenotypes for gene: PHF8 were changed from MRXSSD; SIDERIUS X-LINKED MENTAL RETARDATION SYNDROME; Cleft lip to Mental retardation syndrome, X-linked, Siderius type, 300263 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.26 | PHF8 | Zornitza Stark Publications for gene: PHF8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.25 | PLCB4 | Zornitza Stark Marked gene: PLCB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.25 | PLCB4 | Zornitza Stark Gene: plcb4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.25 | PLCB4 | Zornitza Stark Phenotypes for gene: PLCB4 were changed from Cleft palate to Auriculocondylar syndrome 2, MIM# 614669; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.24 | PLCB4 | Zornitza Stark Publications for gene: PLCB4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.23 | PLCB4 | Zornitza Stark Mode of pathogenicity for gene: PLCB4 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.22 | PLCB4 | Zornitza Stark Mode of inheritance for gene: PLCB4 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.21 | PLCB4 | Zornitza Stark Classified gene: PLCB4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.21 | PLCB4 | Zornitza Stark Gene: plcb4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.20 | PLCB4 | Zornitza Stark reviewed gene: PLCB4: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315542, 23913798; Phenotypes: Auriculocondylar syndrome 2, MIM# 614669; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.20 | PLEKHA5 | Zornitza Stark Marked gene: PLEKHA5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.20 | PLEKHA5 | Zornitza Stark Gene: plekha5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.20 | PLEKHA5 | Zornitza Stark Phenotypes for gene: PLEKHA5 were changed from cleft lip to Cleft lip and palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.19 | PLEKHA5 | Zornitza Stark Classified gene: PLEKHA5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.19 | PLEKHA5 | Zornitza Stark Gene: plekha5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.17 | PLEKHA7 | Zornitza Stark Marked gene: PLEKHA7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.17 | PLEKHA7 | Zornitza Stark Gene: plekha7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.17 | PLEKHA7 | Zornitza Stark Phenotypes for gene: PLEKHA7 were changed from cleft lip to Cleft lip and palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.16 | PLEKHA7 | Zornitza Stark reviewed gene: PLEKHA7: Rating: AMBER; Mode of pathogenicity: None; Publications: 29805042; Phenotypes: Cleft palate; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.16 | RPL11 | Zornitza Stark Marked gene: RPL11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.16 | RPL11 | Zornitza Stark Gene: rpl11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.16 | RPL11 | Zornitza Stark Phenotypes for gene: RPL11 were changed from Cleft palate to Diamond-Blackfan anemia 7, MIM# 612562; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.15 | RPL11 | Zornitza Stark Mode of inheritance for gene: RPL11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.14 | RPL11 | Zornitza Stark Classified gene: RPL11 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.14 | RPL11 | Zornitza Stark Gene: rpl11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.13 | RPL11 | Zornitza Stark reviewed gene: RPL11: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Diamond-Blackfan anemia 7, MIM# 612562; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.13 | RSPO2 | Zornitza Stark Marked gene: RSPO2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.13 | RSPO2 | Zornitza Stark Gene: rspo2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.13 | RSPO2 | Zornitza Stark Phenotypes for gene: RSPO2 were changed from Cleft lip to Tetraamelia syndrome 2, MIM# 618021; Cleft lip and palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.12 | RSPO2 | Zornitza Stark Publications for gene: RSPO2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.11 | RSPO2 | Zornitza Stark Mode of inheritance for gene: RSPO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.10 | RSPO2 | Zornitza Stark Classified gene: RSPO2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.10 | RSPO2 | Zornitza Stark Gene: rspo2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.9 | RSPO2 | Zornitza Stark reviewed gene: RSPO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29769720, 32457899; Phenotypes: Tetraamelia syndrome 2, MIM# 618021; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.9 | TBX1 | Zornitza Stark Marked gene: TBX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.9 | TBX1 | Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.9 | TBX1 | Zornitza Stark Phenotypes for gene: TBX1 were changed from CTHM; CONOTRUNCAL HEART MALFORMATIONS; Cleft palate to Velocardiofacial syndrome, MIM# 192430; Cleft palate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.8 | TBX1 | Zornitza Stark Publications for gene: TBX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.7 | TBX1 | Zornitza Stark Classified gene: TBX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.7 | TBX1 | Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.6 | TBX1 | Zornitza Stark Tag SV/CNV tag was added to gene: TBX1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.6 | TBX1 | Zornitza Stark reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29500247; Phenotypes: Velocardiofacial syndrome, MIM# 192430; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.6 | TBX2 |
Zornitza Stark gene: TBX2 was added gene: TBX2 was added to Clefting_GEL. Sources: Expert list Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TBX2 were set to 29726930 Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction, MIM# 618223 Review for gene: TBX2 was set to RED Added comment: Four individuals reported from two unrelated families with a syndromic disorder, chiefly comprising skeletal, endocrine and immune abnormalities, reminiscent of VCFS. One of the four reported individuals had unilateral cleft lip/palate. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.5 | TFAP2B | Zornitza Stark Marked gene: TFAP2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.5 | TFAP2B | Zornitza Stark Gene: tfap2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.5 | TFAP2B | Zornitza Stark Phenotypes for gene: TFAP2B were changed from Cleft lip to Char syndrome, MIM# 169100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.4 | TFAP2B | Zornitza Stark Mode of inheritance for gene: TFAP2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.3 | TFAP2B | Zornitza Stark reviewed gene: TFAP2B: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Char syndrome, MIM# 169100; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.3 | TOGARAM1 | Zornitza Stark Marked gene: TOGARAM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.3 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.3 | TOGARAM1 |
Zornitza Stark gene: TOGARAM1 was added gene: TOGARAM1 was added to Clefting_GEL. Sources: Expert Review Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TOGARAM1 were set to 32747439 Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus Review for gene: TOGARAM1 was set to RED Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.2 | TRRAP | Zornitza Stark Marked gene: TRRAP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.2 | TRRAP | Zornitza Stark Gene: trrap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.2 | TRRAP | Zornitza Stark Classified gene: TRRAP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.2 | TRRAP | Zornitza Stark Gene: trrap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.1 | TRRAP |
Zornitza Stark gene: TRRAP was added gene: TRRAP was added to Clefting_GEL. Sources: Expert Review Mode of inheritance for gene: TRRAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRRAP were set to 30827496 Phenotypes for gene: TRRAP were set to Developmental delay with or without dysmorphic facies and autism, MIM# 618454 Review for gene: TRRAP was set to GREEN Added comment: 13 unrelated individuals reported with a complex syndromic neurodevelopmental disorder. 5 had cleft lip/palate. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | YAP1 |
Zornitza Stark gene: YAP1 was added gene: YAP1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: YAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: YAP1 were set to 24462371 Phenotypes for gene: YAP1 were set to COB1; COLOBOMA, OCULAR, WITH OR WITHOUT HEARING IMPAIRMENT, CLEFT LIP/PALATE, AND/OR MENTAL RETARDATION |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | WNT3 |
Zornitza Stark gene: WNT3 was added gene: WNT3 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WNT3 were set to 14872406 Phenotypes for gene: WNT3 were set to TETRAAMELIA SYNDROME, AUTOSOMAL RECESSIVE; TETAMS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | WASHC5 |
Zornitza Stark gene: WASHC5 was added gene: WASHC5 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: WASHC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WASHC5 were set to 24065355 Phenotypes for gene: WASHC5 were set to RTSC1; RITSCHER-SCHINZEL SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | VAX1 |
Zornitza Stark gene: VAX1 was added gene: VAX1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: VAX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VAX1 were set to 22095910 Phenotypes for gene: VAX1 were set to MCOPS11; MICROPHTHALMIA, SYNDROMIC 11 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | UQCC2 |
Zornitza Stark gene: UQCC2 was added gene: UQCC2 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: UQCC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UQCC2 were set to 24385928 Phenotypes for gene: UQCC2 were set to MITOCHONDRIAL COMPLEX III DEFICIENCY, NUCLEAR TYPE 7; MC3DN7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | UBB |
Zornitza Stark gene: UBB was added gene: UBB was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: UBB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: UBB were set to Cleft palate, isolated, 119540 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TWIST2 |
Zornitza Stark gene: TWIST2 was added gene: TWIST2 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: TWIST2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: TWIST2 were set to BARBER-SAY SYNDROME; BBRSAY |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TSR2 |
Zornitza Stark gene: TSR2 was added gene: TSR2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: TSR2 was set to Unknown Phenotypes for gene: TSR2 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TGFB2 |
Zornitza Stark gene: TGFB2 was added gene: TGFB2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: TGFB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TGFB2 were set to 29392890 Phenotypes for gene: TGFB2 were set to Loeys-Dietz syndrome 4, 614816 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TFAP2B |
Zornitza Stark gene: TFAP2B was added gene: TFAP2B was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: TFAP2B was set to Unknown Phenotypes for gene: TFAP2B were set to Cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SUMO1 |
Zornitza Stark gene: SUMO1 was added gene: SUMO1 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: SUMO1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SUMO1 were set to 22492558 Phenotypes for gene: SUMO1 were set to Cleft Lip with or without Cleft Palate; Orofacial cleft 10, 613705 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | STXBP1 |
Zornitza Stark gene: STXBP1 was added gene: STXBP1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: STXBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: STXBP1 were set to EIEE4; EPILEPTIC ENCEPHALOPATHY, EARLY INFANTILE, 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | STRA6 |
Zornitza Stark gene: STRA6 was added gene: STRA6 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: STRA6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STRA6 were set to MCOPS9; MICROPHTHALMIA, SYNDROMIC 9 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | STIL |
Zornitza Stark gene: STIL was added gene: STIL was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: STIL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STIL were set to MICROCEPHALY 7, PRIMARY, AUTOSOMAL RECESSIVE; MCPH7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SOX2 |
Zornitza Stark gene: SOX2 was added gene: SOX2 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: SOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SOX2 were set to MICROPHTHALMIA, SYNDROMIC 3; MCOPS3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMOC1 |
Zornitza Stark gene: SMOC1 was added gene: SMOC1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: SMOC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SMOC1 were set to MLA; MICROPHTHALMIA WITH LIMB ANOMALIES |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMAD2 |
Zornitza Stark gene: SMAD2 was added gene: SMAD2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: SMAD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMAD2 were set to 29967133; 29392890 Phenotypes for gene: SMAD2 were set to Loeys-Dietz syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SELENOI |
Zornitza Stark gene: SELENOI was added gene: SELENOI was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: SELENOI was set to Unknown Phenotypes for gene: SELENOI were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RSPO2 |
Zornitza Stark gene: RSPO2 was added gene: RSPO2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: RSPO2 was set to Unknown Phenotypes for gene: RSPO2 were set to Cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RPS19 |
Zornitza Stark gene: RPS19 was added gene: RPS19 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: RPS19 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: RPS19 were set to DBA1; DIAMOND-BLACKFAN ANEMIA 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RPS17 |
Zornitza Stark gene: RPS17 was added gene: RPS17 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: RPS17 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: RPS17 were set to DIAMOND-BLACKFAN ANEMIA 4; DBA4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RPL11 |
Zornitza Stark gene: RPL11 was added gene: RPL11 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: RPL11 was set to Unknown Phenotypes for gene: RPL11 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RBM8A |
Zornitza Stark gene: RBM8A was added gene: RBM8A was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RBM8A were set to TAR; THROMBOCYTOPENIA-ABSENT RADIUS SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RAI1 |
Zornitza Stark gene: RAI1 was added gene: RAI1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: RAI1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: RAI1 were set to SMS; SMITH-MAGENIS SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PTDSS1 |
Zornitza Stark gene: PTDSS1 was added gene: PTDSS1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: PTDSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PTDSS1 were set to 25363158; 15194948; 26117586; 24241535 Phenotypes for gene: PTDSS1 were set to broad prominent forehead; delayed closure of the fontanelles; dental enamel hypoplasia; growth restriction; Lenz-Majewski hyperostotic dwarfism, 151050; choanal atresia; proximal symphalangism cutis laxa; progressive sclerosis and hyperostosis of skull, vertebra and tubular bones; brachydactyly of fingers and toes Mode of pathogenicity for gene: PTDSS1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PSAT1 |
Zornitza Stark gene: PSAT1 was added gene: PSAT1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: PSAT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSAT1 were set to 25152457 Phenotypes for gene: PSAT1 were set to Neu-Laxova syndrome 2, 616038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PQBP1 |
Zornitza Stark gene: PQBP1 was added gene: PQBP1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: PQBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: PQBP1 were set to 7943045 Phenotypes for gene: PQBP1 were set to Renpenning syndrome, 309500 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | POMT2 |
Zornitza Stark gene: POMT2 was added gene: POMT2 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: POMT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POMT2 were set to 15894594 Phenotypes for gene: POMT2 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, 613150 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | POMT1 |
Zornitza Stark gene: POMT1 was added gene: POMT1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: POMT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POMT1 were set to 12369018 Phenotypes for gene: POMT1 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, 236670 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PLEKHA5 |
Zornitza Stark gene: PLEKHA5 was added gene: PLEKHA5 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: PLEKHA5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PLEKHA5 were set to 29805042 Phenotypes for gene: PLEKHA5 were set to cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PLCB4 |
Zornitza Stark gene: PLCB4 was added gene: PLCB4 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: PLCB4 was set to Unknown Phenotypes for gene: PLCB4 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PIK3R2 |
Zornitza Stark gene: PIK3R2 was added gene: PIK3R2 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: PIK3R2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: PIK3R2 were set to MPPH1; MEGALENCEPHALY-POLYMICROGYRIA-POLYDACTYLY-HYDROCEPHALUS SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PIGL |
Zornitza Stark gene: PIGL was added gene: PIGL was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: PIGL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGL were set to 28371479 Phenotypes for gene: PIGL were set to CHIME; COLOBOMA, CONGENITAL HEART DISEASE, ICHTHYOSIFORM DERMATOSIS, MENTAL RETARDATION, AND EAR ANOMALIES SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PIGA |
Zornitza Stark gene: PIGA was added gene: PIGA was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: PIGA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: PIGA were set to 22305531; 22514539 Phenotypes for gene: PIGA were set to MCAHS2; MULTIPLE CONGENITAL ANOMALIES-HYPOTONIA-SEIZURES SYNDROME 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PGM1 |
Zornitza Stark gene: PGM1 was added gene: PGM1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: PGM1 was set to Unknown Phenotypes for gene: PGM1 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PGAP2 |
Zornitza Stark gene: PGAP2 was added gene: PGAP2 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: PGAP2 was set to Unknown Phenotypes for gene: PGAP2 were set to HYPERPHOSPHATASIA WITH MENTAL RETARDATION SYNDROME 3; HPMRS3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NSDHL |
Zornitza Stark gene: NSDHL was added gene: NSDHL was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: NSDHL were set to CONGENITAL HEMIDYSPLASIA WITH ICHTHYOSIFORM ERYTHRODERMA AND LIMB DEFECTS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NKX2-6 |
Zornitza Stark gene: NKX2-6 was added gene: NKX2-6 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: NKX2-6 was set to Unknown Phenotypes for gene: NKX2-6 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NKX2-5 |
Zornitza Stark gene: NKX2-5 was added gene: NKX2-5 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: NKX2-5 was set to Unknown Publications for gene: NKX2-5 were set to 22155005 Phenotypes for gene: NKX2-5 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NBN |
Zornitza Stark gene: NBN was added gene: NBN was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: NBN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NBN were set to 3857858; 22373003 Phenotypes for gene: NBN were set to Nijmegen breakage syndrome, 251260; NBS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | METTL23 |
Zornitza Stark gene: METTL23 was added gene: METTL23 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: METTL23 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: METTL23 were set to 24501276 Phenotypes for gene: METTL23 were set to Mental retardation, autosomal recessive 44, 615942; MRT44 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MED12 |
Zornitza Stark gene: MED12 was added gene: MED12 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: MED12 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: MED12 were set to 12784307 Phenotypes for gene: MED12 were set to Opitz-Kaveggia syndrome, 305450; Lujan-Fryns syndrome, 309520; OKS; submucous cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | LMX1B |
Zornitza Stark gene: LMX1B was added gene: LMX1B was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: LMX1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LMX1B were set to 2012138 Phenotypes for gene: LMX1B were set to Nail-patella syndrome, 161200 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KIF22 |
Zornitza Stark gene: KIF22 was added gene: KIF22 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: KIF22 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KIF22 were set to 22653704 Phenotypes for gene: KIF22 were set to SEMDJL2; Spondyloepimetaphyseal dysplasia with joint laxity, type 2, 603546 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KAT6B |
Zornitza Stark gene: KAT6B was added gene: KAT6B was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: KAT6B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KAT6B were set to 20182757; 27031267 Phenotypes for gene: KAT6B were set to Genitopatellar syndrome, 606170; GTPTS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KANSL1 |
Zornitza Stark gene: KANSL1 was added gene: KANSL1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: KANSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KANSL1 were set to 20301783; 22544363 Phenotypes for gene: KANSL1 were set to KDVS; Koolen-De Vries syndrome, 610443 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | INTS1 |
Zornitza Stark gene: INTS1 was added gene: INTS1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: INTS1 was set to Unknown Phenotypes for gene: INTS1 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | HOXA2 |
Zornitza Stark gene: HOXA2 was added gene: HOXA2 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Victorian Clinical Genetics Services Mode of inheritance for gene: HOXA2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: HOXA2 were set to 18394579; 23775976; 27503514 Phenotypes for gene: HOXA2 were set to Ear anomalies and orofacial clefting; Microtia, Hearing Impairment, and Cleft Palate; Cleft palate; ?Microtia with or without hearing impairment (includes clefting), 612290, (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown); ?Microtia with or without hearing impairment (includes clefting), 612290, (BIALLELIC, autosomal or pseudoautosomal) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GYPE |
Zornitza Stark gene: GYPE was added gene: GYPE was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: GYPE was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GRIP1 |
Zornitza Stark gene: GRIP1 was added gene: GRIP1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: GRIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: GRIP1 were set to 22510445; 16894541; 18000968 Phenotypes for gene: GRIP1 were set to Fraser syndrome, 219000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GNAI3 |
Zornitza Stark gene: GNAI3 was added gene: GNAI3 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: GNAI3 was set to Unknown Phenotypes for gene: GNAI3 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GMNN |
Zornitza Stark gene: GMNN was added gene: GMNN was added to Clefting_GEL. Sources: Expert list,Expert Review Red,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: GMNN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: GMNN were set to 26637980 Phenotypes for gene: GMNN were set to Meier-Gorlin syndrome 6, 616835 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GDF1 |
Zornitza Stark gene: GDF1 was added gene: GDF1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: GDF1 was set to Unknown Publications for gene: GDF1 were set to 16564040 Phenotypes for gene: GDF1 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GATA6 |
Zornitza Stark gene: GATA6 was added gene: GATA6 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: GATA6 was set to Unknown Publications for gene: GATA6 were set to 27391658 Phenotypes for gene: GATA6 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FREM2 |
Zornitza Stark gene: FREM2 was added gene: FREM2 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: FREM2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FREM2 were set to 15838507; 16894541; 18671281; 18203166 Phenotypes for gene: FREM2 were set to Fraser syndrome, 219000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FOXE1 |
Zornitza Stark gene: FOXE1 was added gene: FOXE1 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services Mode of inheritance for gene: FOXE1 was set to Unknown Phenotypes for gene: FOXE1 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FANCL |
Zornitza Stark gene: FANCL was added gene: FANCL was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Red Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCL were set to 25754594 Phenotypes for gene: FANCL were set to Fanconi anemia, complementation group L, 614083 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FAM111A |
Zornitza Stark gene: FAM111A was added gene: FAM111A was added to Clefting_GEL. Sources: Expert list,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: FAM111A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FAM111A were set to 23684011; 16086393 Phenotypes for gene: FAM111A were set to 602361; Gracile bone dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EDN1 |
Zornitza Stark gene: EDN1 was added gene: EDN1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: EDN1 was set to Unknown Phenotypes for gene: EDN1 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DNMT3B |
Zornitza Stark gene: DNMT3B was added gene: DNMT3B was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNMT3B were set to 17893117; 23486536 Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1, 267000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DLG1 |
Zornitza Stark gene: DLG1 was added gene: DLG1 was added to Clefting_GEL. Sources: Literature,Expert Review Red Mode of inheritance for gene: DLG1 was set to Unknown Publications for gene: DLG1 were set to PMID: 28926086 Phenotypes for gene: DLG1 were set to Non-syndromic cleft lip with or without cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DIS3L2 |
Zornitza Stark gene: DIS3L2 was added gene: DIS3L2 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services Mode of inheritance for gene: DIS3L2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DIS3L2 were set to 23486540; 22306653; 28328139 Phenotypes for gene: DIS3L2 were set to Perlman syndrome, 267000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COL9A3 |
Zornitza Stark gene: COL9A3 was added gene: COL9A3 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services Mode of inheritance for gene: COL9A3 was set to Unknown Phenotypes for gene: COL9A3 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CKAP2L |
Zornitza Stark gene: CKAP2L was added gene: CKAP2L was added to Clefting_GEL. Sources: Expert list,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: CKAP2L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CKAP2L were set to 12416644; 15365457 Phenotypes for gene: CKAP2L were set to Filippi syndrome, 272440 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CHSY1 |
Zornitza Stark gene: CHSY1 was added gene: CHSY1 was added to Clefting_GEL. Sources: Expert list,Expert Review Red Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHSY1 were set to 15365460 Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome, 605282; TPBS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CHD1 |
Zornitza Stark gene: CHD1 was added gene: CHD1 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services Mode of inheritance for gene: CHD1 was set to Unknown Phenotypes for gene: CHD1 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CASK |
Zornitza Stark gene: CASK was added gene: CASK was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: CASK was set to Unknown Phenotypes for gene: CASK were set to MENTAL RETARDATION AND MICROCEPHALY WITH PONTINE AND CEREBELLAR HYPOPLASIA; MICPCH |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CANT1 |
Zornitza Stark gene: CANT1 was added gene: CANT1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: CANT1 was set to Unknown Publications for gene: CANT1 were set to 27881841 Phenotypes for gene: CANT1 were set to DBQD1; DESBUQUOIS DYSPLASIA 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | BMP4 |
Zornitza Stark gene: BMP4 was added gene: BMP4 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Expert Review Red,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services Mode of inheritance for gene: BMP4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: BMP4 were set to Cleft lip with or without cleft palate, non syndromic, 11; MCOPS6, OROFACIAL CLEFT 11; OFC11; Orofacial Cleft; Cleft Lip with or without Cleft Palate; Cleft lip; MICROPHTHALMIA, SYNDROMIC 6; Orofacial cleft 11, 600625 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | B3GAT3 |
Zornitza Stark gene: B3GAT3 was added gene: B3GAT3 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: B3GAT3 was set to Unknown Phenotypes for gene: B3GAT3 were set to JDSCD; MULTIPLE JOINT DISLOCATIONS, SHORT STATURE, AND CRANIOFACIAL DYSMORPHISM WITH OR WITHOUT CONGENITAL HEART DEFECTS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ATRX |
Zornitza Stark gene: ATRX was added gene: ATRX was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: ATRX was set to Unknown Publications for gene: ATRX were set to 9788563 Phenotypes for gene: ATRX were set to MENTAL RETARDATION-HYPOTONIC FACIES SYNDROME, X-LINKED, 1; MRXHF1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ARCN1 |
Zornitza Stark gene: ARCN1 was added gene: ARCN1 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: ARCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ARCN1 were set to 27476655 Phenotypes for gene: ARCN1 were set to Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay 617164 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ALG9 |
Zornitza Stark gene: ALG9 was added gene: ALG9 was added to Clefting_GEL. Sources: Expert Review Red Mode of inheritance for gene: ALG9 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG9 were set to GILLESSEN-KAESBACH-NISHIMURA SYNDROME; GIKANIS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ACBD5 |
Zornitza Stark gene: ACBD5 was added gene: ACBD5 was added to Clefting_GEL. Sources: Victorian Clinical Genetics Services Mode of inheritance for gene: ACBD5 was set to Unknown Phenotypes for gene: ACBD5 were set to Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ZMPSTE24 |
Zornitza Stark gene: ZMPSTE24 was added gene: ZMPSTE24 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: ZMPSTE24 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ZMPSTE24 were set to RESTRICTIVE DERMOPATHY, LETHAL |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ZBTB24 |
Zornitza Stark gene: ZBTB24 was added gene: ZBTB24 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: ZBTB24 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZBTB24 were set to 23486536 Phenotypes for gene: ZBTB24 were set to IMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 2; ICF2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | WDR60 |
Zornitza Stark gene: WDR60 was added gene: WDR60 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: WDR60 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WDR60 were set to SRTD8; SHORT-RIB THORACIC DYSPLASIA 8 WITH OR WITHOUT POLYDACTYLY |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | WDR35 |
Zornitza Stark gene: WDR35 was added gene: WDR35 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: WDR35 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WDR35 were set to SHORT-RIB THORACIC DYSPLASIA 7 WITH OR WITHOUT POLYDACTYLY; SRTD7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | WDR34 |
Zornitza Stark gene: WDR34 was added gene: WDR34 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: WDR34 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WDR34 were set to SRTD11; SHORT-RIB THORACIC DYSPLASIA 11 WITH OR WITHOUT POLYDACTYLY |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | WDR19 |
Zornitza Stark gene: WDR19 was added gene: WDR19 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: WDR19 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WDR19 were set to SRTD5; SHORT-RIB THORACIC DYSPLASIA 5 WITH OR WITHOUT POLYDACTYLY |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TTC21B |
Zornitza Stark gene: TTC21B was added gene: TTC21B was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: TTC21B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTC21B were set to SHORT-RIB THORACIC DYSPLASIA 4 WITH OR WITHOUT POLYDACTYLY; SRTD4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TBX15 |
Zornitza Stark gene: TBX15 was added gene: TBX15 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: TBX15 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TBX15 were set to COUSIN SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TBX1 |
Zornitza Stark gene: TBX1 was added gene: TBX1 was added to Clefting_GEL. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: TBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: TBX1 were set to CTHM; CONOTRUNCAL HEART MALFORMATIONS; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMG9 |
Zornitza Stark gene: SMG9 was added gene: SMG9 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: SMG9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SMG9 were set to 27018474 Phenotypes for gene: SMG9 were set to HBMS; HEART AND BRAIN MALFORMATION SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SEC23A |
Zornitza Stark gene: SEC23A was added gene: SEC23A was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: SEC23A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SEC23A were set to CLSD; CRANIOLENTICULOSUTURAL DYSPLASIA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RYR1 |
Zornitza Stark gene: RYR1 was added gene: RYR1 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: RYR1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: RYR1 were set to 23553484 Phenotypes for gene: RYR1 were set to CCD; CENTRAL CORE DISEASE OF MUSCLE |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RPS28 |
Zornitza Stark gene: RPS28 was added gene: RPS28 was added to Clefting_GEL. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: RPS28 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: RPS28 were set to DBA15; DIAMOND-BLACKFAN ANEMIA 15 WITH MANDIBULOFACIAL DYSOSTOSIS; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RBPJ |
Zornitza Stark gene: RBPJ was added gene: RBPJ was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: RBPJ was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RBPJ were set to 28160419; 22883147 Phenotypes for gene: RBPJ were set to ADAMS-OLIVER SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RARB |
Zornitza Stark gene: RARB was added gene: RARB was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: RARB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RARB were set to MICROPHTHALMIA, SYNDROMIC 12; MCOPS12 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | POLR1A |
Zornitza Stark gene: POLR1A was added gene: POLR1A was added to Clefting_GEL. Sources: Expert list,Expert Review Amber Mode of inheritance for gene: POLR1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: POLR1A were set to 25913037 Phenotypes for gene: POLR1A were set to cleft palte |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PLEKHA7 |
Zornitza Stark gene: PLEKHA7 was added gene: PLEKHA7 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber Mode of inheritance for gene: PLEKHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PLEKHA7 were set to 29805042 Phenotypes for gene: PLEKHA7 were set to cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PHGDH |
Zornitza Stark gene: PHGDH was added gene: PHGDH was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: PHGDH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PHGDH were set to 25152457; 24836451 Phenotypes for gene: PHGDH were set to NEU-LAXOVA SYNDROME 1; NLS1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MEOX1 |
Zornitza Stark gene: MEOX1 was added gene: MEOX1 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: MEOX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MEOX1 were set to 23290072; 24073994 Phenotypes for gene: MEOX1 were set to KLIPPEL-FEIL SYNDROME 2, AUTOSOMAL RECESSIVE; KFS2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MED25 |
Zornitza Stark gene: MED25 was added gene: MED25 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: MED25 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MED25 were set to 25792360 Phenotypes for gene: MED25 were set to BASEL-VANAGAITE-SMIRIN-YOSEF SYNDROME; BVSYS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MED13L |
Zornitza Stark gene: MED13L was added gene: MED13L was added to Clefting_GEL. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: MED13L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MED13L were set to 25712080; 25137640 Phenotypes for gene: MED13L were set to Mental retardation and distinctive facial features with or without cardiac defects, 616789; Cleft palate; MRFACD |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | LMNA |
Zornitza Stark gene: LMNA was added gene: LMNA was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: LMNA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LMNA were set to RESTRICTIVE DERMOPATHY, LETHAL |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KDM1A |
Zornitza Stark gene: KDM1A was added gene: KDM1A was added to Clefting_GEL. Sources: Expert Review Amber,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: KDM1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KDM1A were set to 23020937; 24838796; 26656649 Phenotypes for gene: KDM1A were set to Cleft palate,psychomotor retardation,distinctive facial features, 616728 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | IFT52 |
Zornitza Stark gene: IFT52 was added gene: IFT52 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: IFT52 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT52 were set to SHORT-RIB THORACIC DYSPLASIA 16 WITH OR WITHOUT POLYDACTYLY; SRTD16 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GNB1 |
Zornitza Stark gene: GNB1 was added gene: GNB1 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: GNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: GNB1 were set to 27108799 Phenotypes for gene: GNB1 were set to Mental retardation, autosomal dominant 42, 616973 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GATA3 |
Zornitza Stark gene: GATA3 was added gene: GATA3 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber,Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: GATA3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: GATA3 were set to 10935639; 11389161; 28303854; 21834031; 19659764 Phenotypes for gene: GATA3 were set to HDR syndrome; Barakat syndrome; Hypoparathyroidism, sensorineural deafness, and renal dysplasia, 146255 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FTO |
Zornitza Stark gene: FTO was added gene: FTO was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: FTO was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FTO were set to 26378117; 19559399 Phenotypes for gene: FTO were set to Growth retardation, developmental delay, facial dysmorphism, 612938; Lethal polymalformative syndrome, Boissel type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FOXP2 |
Zornitza Stark gene: FOXP2 was added gene: FOXP2 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: FOXP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOXP2 were set to 27734906; 15326624 Phenotypes for gene: FOXP2 were set to Speech-language disorder-1, 602081 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FBXO11 |
Zornitza Stark gene: FBXO11 was added gene: FBXO11 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber Mode of inheritance for gene: FBXO11 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FBXO11 were set to 17035249; 30057029; 30679813 Phenotypes for gene: FBXO11 were set to Intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, 618089; cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ESRP2 |
Zornitza Stark gene: ESRP2 was added gene: ESRP2 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber Mode of inheritance for gene: ESRP2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ESRP2 were set to 29805042 Phenotypes for gene: ESRP2 were set to cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DLX4 |
Zornitza Stark gene: DLX4 was added gene: DLX4 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: DLX4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DLX4 were set to 25954033 Phenotypes for gene: DLX4 were set to nonsyndromic cleft/lip palate (CL/P); OFC15; OROFACIAL CLEFT 15; ?Orofacial cleft 15, 616788 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DDX59 |
Zornitza Stark gene: DDX59 was added gene: DDX59 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: DDX59 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DDX59 were set to OROFACIODIGITAL SYNDROME V; OFD5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DDX3X |
Zornitza Stark gene: DDX3X was added gene: DDX3X was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: DDX3X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: DDX3X were set to MRX102; MENTAL RETARDATION, X-LINKED 102 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COL9A2 |
Zornitza Stark gene: COL9A2 was added gene: COL9A2 was added to Clefting_GEL. Sources: Expert Review Amber,Illumina TruGenome Clinical Sequencing Services,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services Mode of inheritance for gene: COL9A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COL9A2 were set to 21671392 Phenotypes for gene: COL9A2 were set to Stickler syndrome; Orofacial Clefting with skeletal features; ?Stickler syndrome type V, 614284; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CDC45 |
Zornitza Stark gene: CDC45 was added gene: CDC45 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: CDC45 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDC45 were set to 27374770 Phenotypes for gene: CDC45 were set to Meier-Gorlin syndrome 7, 617063; MGORS7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | BUB1B |
Zornitza Stark gene: BUB1B was added gene: BUB1B was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: BUB1B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BUB1B were set to MVA1; MOSAIC VARIEGATED ANEUPLOIDY SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | B4GALT7 |
Zornitza Stark gene: B4GALT7 was added gene: B4GALT7 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: B4GALT7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: B4GALT7 were set to 24755949 Phenotypes for gene: B4GALT7 were set to EHLERS-DANLOS SYNDROME WITH SHORT STATURE AND LIMB ANOMALIES; EDSSLA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | B3GALT6 |
Zornitza Stark gene: B3GALT6 was added gene: B3GALT6 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: B3GALT6 was set to Unknown Phenotypes for gene: B3GALT6 were set to SPONDYLOEPIMETAPHYSEAL DYSPLASIA WITH JOINT LAXITY, TYPE 1, WITH OR WITHOUT FRACTURES; Ehlers-Danlos syndrome, progeroid type, 2 615349; SEMDJL1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ATR |
Zornitza Stark gene: ATR was added gene: ATR was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: ATR was set to Unknown Phenotypes for gene: ATR were set to SECKEL SYNDROME 1; SCKL1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ALX3 |
Zornitza Stark gene: ALX3 was added gene: ALX3 was added to Clefting_GEL. Sources: Expert Review Amber Mode of inheritance for gene: ALX3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALX3 were set to 19409524; 22106187; 19401770 Phenotypes for gene: ALX3 were set to FND1; Frontorhiny; FRONTONASAL DYSPLASIA 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ALX1 |
Zornitza Stark gene: ALX1 was added gene: ALX1 was added to Clefting_GEL. Sources: Expert list,Expert Review Amber Mode of inheritance for gene: ALX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALX1 were set to 26610632; 20451171; 27324866 Phenotypes for gene: ALX1 were set to ?Frontonasal dysplasia 3, 613456 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ZSWIM6 |
Zornitza Stark gene: ZSWIM6 was added gene: ZSWIM6 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ZSWIM6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ZSWIM6 were set to 25105228 Phenotypes for gene: ZSWIM6 were set to AFND; ACROMELIC FRONTONASAL DYSOSTOSIS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ZIC3 |
Zornitza Stark gene: ZIC3 was added gene: ZIC3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ZIC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ZIC3 were set to VACTERL ASSOCIATION, X-LINKED, WITH OR WITHOUT HYDROCEPHALUS; VACTERLX |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ZIC2 |
Zornitza Stark gene: ZIC2 was added gene: ZIC2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ZIC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZIC2 were set to 19955556 Phenotypes for gene: ZIC2 were set to HOLOPROSENCEPHALY 5; HPE5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ZEB2 |
Zornitza Stark gene: ZEB2 was added gene: ZEB2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ZEB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ZEB2 were set to MOWAT-WILSON SYNDROME; MOWS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | XYLT1 |
Zornitza Stark gene: XYLT1 was added gene: XYLT1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: XYLT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: XYLT1 were set to DESBUQUOIS DYSPLASIA 2; DBQD2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | WNT5A |
Zornitza Stark gene: WNT5A was added gene: WNT5A was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: WNT5A were set to DRS1; ROBINOW SYNDROME, AUTOSOMAL DOMINANT 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | USP9X |
Zornitza Stark gene: USP9X was added gene: USP9X was added to Clefting_GEL. Sources: Expert Review Green,Literature Mode of inheritance for gene: USP9X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: USP9X were set to 26833328 Phenotypes for gene: USP9X were set to Mental retardation, X-linked 99 300919 XLR; Mental retardation, X-linked 99, syndromic, female-restricted 300968 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TXNL4A |
Zornitza Stark gene: TXNL4A was added gene: TXNL4A was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TXNL4A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TXNL4A were set to 25434003 Phenotypes for gene: TXNL4A were set to BURN-MCKEOWN SYNDROME; BMKS; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TUBB |
Zornitza Stark gene: TUBB was added gene: TUBB was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TUBB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: TUBB were set to CSCSC1; SKIN CREASES, CONGENITAL SYMMETRIC CIRCUMFERENTIAL, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TRIM37 |
Zornitza Stark gene: TRIM37 was added gene: TRIM37 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TRIM37 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRIM37 were set to MULIBREY NANISM |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TRAPPC9 |
Zornitza Stark gene: TRAPPC9 was added gene: TRAPPC9 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TRAPPC9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC9 were set to 20004764 Phenotypes for gene: TRAPPC9 were set to MENTAL RETARDATION, AUTOSOMAL RECESSIVE 13; MRT13 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TP63 |
Zornitza Stark gene: TP63 was added gene: TP63 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services,Expert Review Green Mode of inheritance for gene: TP63 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: TP63 were set to Orofacial cleft 8, EEC SYNDROME 3, Rapp Hodgkins syndrome, 129400; EEC3; Limb-mammary syndrome, 603543; AEC (Ankyloblepharon filiforme adnatum, Ectodermal defects and Clefting), Hay Wells syndrome 106260; EEC syndrome (Ectrodactyly, Ectodermal dysplasia and Clefting); ECTRODACTYLY, ECTODERMAL DYSPLASIA, AND CLEFT LIP/PALATE SYNDROME 3; Cleft lip; Ectrodactyly, ectodermal dysplasia, cleft lip/palate syndrome 3, 604292 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TMCO1 |
Zornitza Stark gene: TMCO1 was added gene: TMCO1 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TMCO1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMCO1 were set to CRANIOFACIAL DYSMORPHISM, SKELETAL ANOMALIES, AND MENTAL RETARDATION SYNDROME; CFSMR; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TGFBR2 |
Zornitza Stark gene: TGFBR2 was added gene: TGFBR2 was added to Clefting_GEL. Sources: Expert Review Green,Expert Review Mode of inheritance for gene: TGFBR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TGFBR2 were set to 12975342; 15731757; 16928994 Phenotypes for gene: TGFBR2 were set to Loeys-Dietz syndrome; Loeys-Dietz syndrome 2, 610168 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TGFBR1 |
Zornitza Stark gene: TGFBR1 was added gene: TGFBR1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TGFBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: TGFBR1 were set to LOEYS-DIETZ SYNDROME 1; LDS1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TGFB3 |
Zornitza Stark gene: TGFB3 was added gene: TGFB3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TGFB3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: TGFB3 were set to LDS5; LOEYS-DIETZ SYNDROME 5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TGDS |
Zornitza Stark gene: TGDS was added gene: TGDS was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TGDS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TGDS were set to 25480037 Phenotypes for gene: TGDS were set to CATEL-MANZKE SYNDROME; Cleft palate; CATMANS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TFAP2A |
Zornitza Stark gene: TFAP2A was added gene: TFAP2A was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TFAP2A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TFAP2A were set to 10767004 Phenotypes for gene: TFAP2A were set to BRANCHIOOCULOFACIAL SYNDROME; BOFS; Cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TELO2 |
Zornitza Stark gene: TELO2 was added gene: TELO2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TELO2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TELO2 were set to YHFS; YOU-HOOVER-FONG SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TCTN3 |
Zornitza Stark gene: TCTN3 was added gene: TCTN3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TCTN3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TCTN3 were set to OFD4; OROFACIODIGITAL SYNDROME IV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TCOF1 |
Zornitza Stark gene: TCOF1 was added gene: TCOF1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: TCOF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TCOF1 were set to TREACHER COLLINS SYNDROME 1; TCS1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | TBX22 |
Zornitza Stark gene: TBX22 was added gene: TBX22 was added to Clefting_GEL. Sources: Expert Review Green,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services Mode of inheritance for gene: TBX22 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: TBX22 were set to 19648124; 17846996; 21248356; 12374769; 11559848; 19648291; 22784330; 14729838 Phenotypes for gene: TBX22 were set to Cleft palate with ankyloglossia, 303400; Cleft palate; CPX; cleft lip; palate; CLEFT PALATE WITH OR WITHOUT ANKYLOGLOSSIA, X-LINKED; sub mucous cleft |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | STAMBP |
Zornitza Stark gene: STAMBP was added gene: STAMBP was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: STAMBP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STAMBP were set to MICCAP; MICROCEPHALY-CAPILLARY MALFORMATION SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SPECC1L |
Zornitza Stark gene: SPECC1L was added gene: SPECC1L was added to Clefting_GEL. Sources: Expert Review Green,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: SPECC1L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPECC1L were set to 8849002; 21703590; 25412741; 1897571 Phenotypes for gene: SPECC1L were set to GBBB2; ?Facial clefting, oblique, 1, 600251; Opitz GBBB syndrome, type II (with clefting), 145410; OPITZ GBBB SYNDROME, TYPE II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SOX9 |
Zornitza Stark gene: SOX9 was added gene: SOX9 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services,Expert Review Green Mode of inheritance for gene: SOX9 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SOX9 were set to 7485151; 7990924; 24038782; 12783851; 19449405; 15806394; 8894698 Phenotypes for gene: SOX9 were set to CAMPOMELIC DYSPLASIA,114290; Campomelic dysplasia with autosomal sex reversal, 114290; CAMPOMELIC DYSPLASIA; Cleft palate; Cleft palate with skeletal abnormalities; Orofacial Clefting with Skeletal Features; Acampomelic campomelic dysplasia, 114290 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SON |
Zornitza Stark gene: SON was added gene: SON was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SON was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SON were set to 27545680 Phenotypes for gene: SON were set to ZTTK SYNDROME; ZTTKS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SNRPB |
Zornitza Stark gene: SNRPB was added gene: SNRPB was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: SNRPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SNRPB were set to 25047197 Phenotypes for gene: SNRPB were set to CEREBROCOSTOMANDIBULAR SYNDROME; CCMS; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMS |
Zornitza Stark gene: SMS was added gene: SMS was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SMS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: SMS were set to MRXSSR; MENTAL RETARDATION, X-LINKED, SYNDROMIC, SNYDER-ROBINSON TYPE |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMC3 |
Zornitza Stark gene: SMC3 was added gene: SMC3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SMC3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SMC3 were set to CORNELIA DE LANGE SYNDROME 3; CDLS3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMC1A |
Zornitza Stark gene: SMC1A was added gene: SMC1A was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SMC1A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: SMC1A were set to CDLS2; CORNELIA DE LANGE SYNDROME 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMAD4 |
Zornitza Stark gene: SMAD4 was added gene: SMAD4 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SMAD4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SMAD4 were set to MYHRE SYNDROME; MYHRS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SMAD3 |
Zornitza Stark gene: SMAD3 was added gene: SMAD3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SMAD3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SMAD3 were set to LOEYS-DIETZ SYNDROME 3; LDS3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SLC26A2 |
Zornitza Stark gene: SLC26A2 was added gene: SLC26A2 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: SLC26A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC26A2 were set to 12866518; 25667404; 8931695; 8571951; 10465113; 18708426; 15316973; 11565064; 7923357 Phenotypes for gene: SLC26A2 were set to De la Chapelle dysplasia (includes clefting), 256050; DIASTROPHIC DYSPLASIA; Diastrophic dysplasia (includes clefting), 222600; Atelosteogenesis II (includes clefting), 256050; DTD; Diastrophic dysplasia, broad bonehplatyspondylic variant, 222600; McAlister Dysplasia; Orofacial Clefting with skeletal features |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SKI |
Zornitza Stark gene: SKI was added gene: SKI was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SKI was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SKI were set to SHPRINTZEN-GOLDBERG CRANIOSYNOSTOSIS SYNDROME; SGS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SIX5 |
Zornitza Stark gene: SIX5 was added gene: SIX5 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SIX5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SIX5 were set to BOR2; BRANCHIOOTORENAL SYNDROME 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SIX3 |
Zornitza Stark gene: SIX3 was added gene: SIX3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SIX3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SIX3 were set to HOLOPROSENCEPHALY 2; HPE2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SIX1 |
Zornitza Stark gene: SIX1 was added gene: SIX1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SIX1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SIX1 were set to BOS3; BRANCHIOOTIC SYNDROME 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SHH |
Zornitza Stark gene: SHH was added gene: SHH was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SHH was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SHH were set to HOLOPROSENCEPHALY 3; HPE3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SF3B4 |
Zornitza Stark gene: SF3B4 was added gene: SF3B4 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SF3B4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SF3B4 were set to 22541558 Phenotypes for gene: SF3B4 were set to ACROFACIAL DYSOSTOSIS 1, NAGER TYPE; AFD1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SEPT9 |
Zornitza Stark gene: SEPT9 was added gene: SEPT9 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SEPT9 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SEPT9 were set to HNA; AMYOTROPHY, HEREDITARY NEURALGIC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SCARF2 |
Zornitza Stark gene: SCARF2 was added gene: SCARF2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SCARF2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCARF2 were set to VDEGS; VAN DEN ENDE-GUPTA SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SATB2 |
Zornitza Stark gene: SATB2 was added gene: SATB2 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services Mode of inheritance for gene: SATB2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SATB2 were set to 16179223 Phenotypes for gene: SATB2 were set to Glass syndrome; GLASS SYNDROME; Cleft palate; GLASS; Cleft palate, intellectual disability, poor- absent speech, bone fragility- raised serum alkaline phosphatas; Chromosome 2q32-q33 deletion syndrome; Orofacial Clefting with skeletal features |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | SALL4 |
Zornitza Stark gene: SALL4 was added gene: SALL4 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: SALL4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SALL4 were set to DUANE-RADIAL RAY SYNDROME; DRRS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RPS26 |
Zornitza Stark gene: RPS26 was added gene: RPS26 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RPS26 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RPS26 were set to 20116044 Phenotypes for gene: RPS26 were set to DBA10; DIAMOND-BLACKFAN ANEMIA 10; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RPL5 |
Zornitza Stark gene: RPL5 was added gene: RPL5 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RPL5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RPL5 were set to 19061985 Phenotypes for gene: RPL5 were set to DIAMOND-BLACKFAN ANEMIA 6; Cleft palate; DBA6 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ROR2 |
Zornitza Stark gene: ROR2 was added gene: ROR2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ROR2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ROR2 were set to ROBINOW SYNDROME, AUTOSOMAL RECESSIVE; RRS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | RBM10 |
Zornitza Stark gene: RBM10 was added gene: RBM10 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RBM10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: RBM10 were set to 20451169 Phenotypes for gene: RBM10 were set to TARPS; Cleft palate; TARP SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PTCH1 |
Zornitza Stark gene: PTCH1 was added gene: PTCH1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: PTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: PTCH1 were set to HPE7; BCNS, HOLOPROSENCEPHALY 7; BASAL CELL NEVUS SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PORCN |
Zornitza Stark gene: PORCN was added gene: PORCN was added to Clefting_GEL. Sources: Emory Genetics Laboratory,Expert list,Radboud University Medical Center, Nijmegen,Expert Review Green Mode of inheritance for gene: PORCN was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: PORCN were set to 12071796; 21484999; 20301712; 10602117; 13948891; 18325042 Phenotypes for gene: PORCN were set to GOLTZ SYNDROME; Focal dermal hypoplasia, 305600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | POLR1D |
Zornitza Stark gene: POLR1D was added gene: POLR1D was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: POLR1D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: POLR1D were set to TCS2; TREACHER COLLINS SYNDROME 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | POLR1C |
Zornitza Stark gene: POLR1C was added gene: POLR1C was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: POLR1C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POLR1C were set to TREACHER COLLINS SYNDROME 3; TCS3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PIGV |
Zornitza Stark gene: PIGV was added gene: PIGV was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: PIGV was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGV were set to 24129430; 21739589 Phenotypes for gene: PIGV were set to HYPERPHOSPHATASIA WITH MENTAL RETARDATION SYNDROME 1; HPMRS1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PIGN |
Zornitza Stark gene: PIGN was added gene: PIGN was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: PIGN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGN were set to 27038415; 24852103 Phenotypes for gene: PIGN were set to MULTIPLE CONGENITAL ANOMALIES-HYPOTONIA-SEIZURES SYNDROME 1; MCAHS1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PIEZO2 |
Zornitza Stark gene: PIEZO2 was added gene: PIEZO2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: PIEZO2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PIEZO2 were set to 24726473 Phenotypes for gene: PIEZO2 were set to MWKS; DA3, MARDEN-WALKER SYNDROME; ARTHROGRYPOSIS, DISTAL, TYPE 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PHF8 |
Zornitza Stark gene: PHF8 was added gene: PHF8 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: PHF8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PHF8 were set to MRXSSD; SIDERIUS X-LINKED MENTAL RETARDATION SYNDROME; Cleft lip |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | PAX3 |
Zornitza Stark gene: PAX3 was added gene: PAX3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: PAX3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: PAX3 were set to WAARDENBURG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | OFD1 |
Zornitza Stark gene: OFD1 was added gene: OFD1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: OFD1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: OFD1 were set to OROFACIODIGITAL SYNDROME I; OFD1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NOTCH1 |
Zornitza Stark gene: NOTCH1 was added gene: NOTCH1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: NOTCH1 were set to ADAMS-OLIVER SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NIPBL |
Zornitza Stark gene: NIPBL was added gene: NIPBL was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: NIPBL were set to CDLS1; CORNELIA DE LANGE SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NEK1 |
Zornitza Stark gene: NEK1 was added gene: NEK1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: NEK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NEK1 were set to SHORT-RIB THORACIC DYSPLASIA 6 WITH OR WITHOUT POLYDACTYLY; SRTD6 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NEDD4L |
Zornitza Stark gene: NEDD4L was added gene: NEDD4L was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services,Literature,Expert Review Mode of inheritance for gene: NEDD4L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NEDD4L were set to 27694961 Phenotypes for gene: NEDD4L were set to Periventricular nodular heterotopia 7 (includes clefting), 617201; Cleft palate; Cleft palate, toe syndactyly, periventricular nodular heterotopia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | NECTIN1 |
Zornitza Stark gene: NECTIN1 was added gene: NECTIN1 was added to Clefting_GEL. Sources: Expert Review Green,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services Mode of inheritance for gene: NECTIN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NECTIN1 were set to 10932188; 26953873; 11559849 Phenotypes for gene: NECTIN1 were set to Cleft Lip with or without Cleft Palate; CLP, partial syndactyly of digits, intellectual disability, dysmorphism; Orofacial cleft 7, 225060; Cleft lip/Palate ectodermal dysplasia syndrome, 225060; Ectodermal dysplasia, Margarita Island type; Cleft lip; Zlotogora-Ogur syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MYMK |
Zornitza Stark gene: MYMK was added gene: MYMK was added to Clefting_GEL. Sources: Expert Review Green,Literature Mode of inheritance for gene: MYMK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MYMK were set to 28681861 Phenotypes for gene: MYMK were set to Carey-Fineman-Ziter syndrome 254940 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MSX1 |
Zornitza Stark gene: MSX1 was added gene: MSX1 was added to Clefting_GEL. Sources: Expert Review Green,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services Mode of inheritance for gene: MSX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MSX1 were set to 16498076; 10742093; 27228008; 15264286; 12097313; 12807959; 25565750 Phenotypes for gene: MSX1 were set to Tooth agenesis, selective, 1, with or without orofacial cleft, 106600; Orofacial cleft 5, 608874; Cleft lip; CLP with dental anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MKS1 |
Zornitza Stark gene: MKS1 was added gene: MKS1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: MKS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MKS1 were set to 24643152; 26037304; 25182137 Phenotypes for gene: MKS1 were set to Meckel syndrome 1, 249000; Meckel-Gruber Syndrome (MGS); MKS1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MID1 |
Zornitza Stark gene: MID1 was added gene: MID1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: MID1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: MID1 were set to OPITZ GBBB SYNDROME, TYPE I; GBBB1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MEIS2 |
Zornitza Stark gene: MEIS2 was added gene: MEIS2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services,Expert Review Mode of inheritance for gene: MEIS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MEIS2 were set to 25712757; 27225850; 24678003 Phenotypes for gene: MEIS2 were set to intellectual disability; cardiac defects; Orofacial clefting; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MBTPS2 |
Zornitza Stark gene: MBTPS2 was added gene: MBTPS2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: MBTPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: MBTPS2 were set to IFAP SYNDROME WITH OR WITHOUT BRESHECK SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MASP1 |
Zornitza Stark gene: MASP1 was added gene: MASP1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: MASP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MASP1 were set to 3MC1; 3MC SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MAPRE2 |
Zornitza Stark gene: MAPRE2 was added gene: MAPRE2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: MAPRE2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: MAPRE2 were set to SKIN CREASES, CONGENITAL SYMMETRIC CIRCUMFERENTIAL, 2; CSCSC2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | MAP3K7 |
Zornitza Stark gene: MAP3K7 was added gene: MAP3K7 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: MAP3K7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAP3K7 were set to 28498505; 25899317 Phenotypes for gene: MAP3K7 were set to AD-FMD; Frontometaphyseal dysplasia 2, 617137; autosomal dominant FMD; FMD2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KMT2D |
Zornitza Stark gene: KMT2D was added gene: KMT2D was added to Clefting_GEL. Sources: Expert Review,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Green,Literature Mode of inheritance for gene: KMT2D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KMT2D were set to 22126750; 20711175; 21671394; 26049589; 25142838 Phenotypes for gene: KMT2D were set to Kabuki syndrome 1, 147920 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KIF7 |
Zornitza Stark gene: KIF7 was added gene: KIF7 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: KIF7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF7 were set to 21552264 Phenotypes for gene: KIF7 were set to ACLS; ACROCALLOSAL SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KIF1BP |
Zornitza Stark gene: KIF1BP was added gene: KIF1BP was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF1BP were set to 16760737; 7338549 Phenotypes for gene: KIF1BP were set to GOSHS; Goldberg-Shprintzen megacolon syndrome, 609460 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KIAA0586 |
Zornitza Stark gene: KIAA0586 was added gene: KIAA0586 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: KIAA0586 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KIAA0586 were set to SRTD14; SHORT-RIB THORACIC DYSPLASIA 14 WITH POLYDACTYLY |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KDM6A |
Zornitza Stark gene: KDM6A was added gene: KDM6A was added to Clefting_GEL. Sources: Expert Review,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Green Mode of inheritance for gene: KDM6A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: KDM6A were set to 24664873; 22197486; 23076834 Phenotypes for gene: KDM6A were set to Kabuki syndrome 2, 300867 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KCNJ2 |
Zornitza Stark gene: KCNJ2 was added gene: KCNJ2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: KCNJ2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KCNJ2 were set to 12163457 Phenotypes for gene: KCNJ2 were set to ANDERSEN CARDIODYSRHYTHMIC PERIODIC PARALYSIS; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | KAT6A |
Zornitza Stark gene: KAT6A was added gene: KAT6A was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: KAT6A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: KAT6A were set to MENTAL RETARDATION, AUTOSOMAL DOMINANT 32; MRD32 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | IRF6 |
Zornitza Stark gene: IRF6 was added gene: IRF6 was added to Clefting_GEL. Sources: Illumina TruGenome Clinical Sequencing Services,UKGTN,Radboud University Medical Center, Nijmegen,Eligibility statement prior genetic testing,Victorian Clinical Genetics Services,Expert Review Green Mode of inheritance for gene: IRF6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: IRF6 were set to lip pits; Cleft palate; Orofacial cleft 6, 608864; VWS1, POPLITEAL PTERYGIUM SYNDROME; Cleft Lip with or without Cleft Palate; VAN DER WOUDE SYNDROME 1; PPS; Cleft lip +/- palate- unilateral or bilateral; Orofacial Clefting with skeletal features; cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | IMPAD1 |
Zornitza Stark gene: IMPAD1 was added gene: IMPAD1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: IMPAD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IMPAD1 were set to 22887726; 21549340 Phenotypes for gene: IMPAD1 were set to Chondrodysplasia with joint dislocations, GPAPP type, 614078 (includes cleft palate) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | IFT80 |
Zornitza Stark gene: IFT80 was added gene: IFT80 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: IFT80 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT80 were set to SHORT-RIB THORACIC DYSPLASIA 2 WITH OR WITHOUT POLYDACTYLY; SRTD2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | IFT172 |
Zornitza Stark gene: IFT172 was added gene: IFT172 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: IFT172 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT172 were set to SRTD10; SHORT-RIB THORACIC DYSPLASIA 10 WITH OR WITHOUT POLYDACTYLY |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | IFT140 |
Zornitza Stark gene: IFT140 was added gene: IFT140 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: IFT140 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT140 were set to SHORT-RIB THORACIC DYSPLASIA 9 WITH OR WITHOUT POLYDACTYLY; SRTD9 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ICK |
Zornitza Stark gene: ICK was added gene: ICK was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ICK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ICK were set to 19185282; 27069622; 24853502 Phenotypes for gene: ICK were set to ECO; Endocrine-cerebroosteodysplasia, 612651 (includes cleft lip, cleft palate) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | HYLS1 |
Zornitza Stark gene: HYLS1 was added gene: HYLS1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: HYLS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HYLS1 were set to 3296755; 22029171; 8322817; 15843405 Phenotypes for gene: HYLS1 were set to Hydrolethalus syndrome, 236680 (includes Cleft palate, Lateral or midline cleft lip, Lower lip cleft) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | HDAC8 |
Zornitza Stark gene: HDAC8 was added gene: HDAC8 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: HDAC8 were set to CDLS5; CORNELIA DE LANGE SYNDROME 5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GRHL3 |
Zornitza Stark gene: GRHL3 was added gene: GRHL3 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: GRHL3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: GRHL3 were set to Cleft lip; VAN DER WOUDE SYNDROME 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GPC3 |
Zornitza Stark gene: GPC3 was added gene: GPC3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: GPC3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: GPC3 were set to SIMPSON-GOLABI-BEHMEL SYNDROME, TYPE 1; SGBS1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GLI3 |
Zornitza Stark gene: GLI3 was added gene: GLI3 was added to Clefting_GEL. Sources: Expert list,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: GLI3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: GLI3 were set to 15739154; 24736735; 7211952; 20301638; 1605268 Phenotypes for gene: GLI3 were set to Pallister-Hall syndrome, 146510 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | GJA1 |
Zornitza Stark gene: GJA1 was added gene: GJA1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Expert Review Green Mode of inheritance for gene: GJA1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: GJA1 were set to 1057461; 12457340; 19338053; 15108203 Phenotypes for gene: GJA1 were set to Oculodentodigital dysplasia,164200; ODDD |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FRAS1 |
Zornitza Stark gene: FRAS1 was added gene: FRAS1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen,Expert Review Green Mode of inheritance for gene: FRAS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FRAS1 were set to 17163535; 16894541; 18203166; 18671281 Phenotypes for gene: FRAS1 were set to Fraser syndrome, 219000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FOXC2 |
Zornitza Stark gene: FOXC2 was added gene: FOXC2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: FOXC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: FOXC2 were set to Cleft palate; LYMPHEDEMA-DISTICHIASIS SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FLNB |
Zornitza Stark gene: FLNB was added gene: FLNB was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: FLNB was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: FLNB were set to Spondylocarpotarsal synostosis syndrome (includes clefting), BIALLELIC, autosomal or pseudoautosomal, 272460; Atelosteogenesis, type I (includes clefting), MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown, 108720; Atelosteogenesis, type III MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown (includes clefting), 108721; Larsen syndrome (includes clefting) MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown, 150250; Orofacial Clefting with skeletal features; Skeletal dysplasia with midline cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FLNA |
Zornitza Stark gene: FLNA was added gene: FLNA was added to Clefting_GEL. Sources: Expert Review Green,UKGTN Mode of inheritance for gene: FLNA was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: FLNA were set to 10706363; 20301567; 12612583; 16538226 Phenotypes for gene: FLNA were set to OTOPALATODIGITAL SYNDROME, TYPE I; Otopalatodigital syndrome, type II, 304120 (includes clefting); Orofacial Clefting with skeletal anomalies; OPD1, OTOPALATODIGITAL SYNDROME, TYPE II; OPD2, FRONTOMETAPHYSEAL DYSPLASIA 1; FMD1; Melnick-Needles syndrome, 309350 (includes clefting); Otopalatodigital syndrome, type I, 311300 (includes clefting) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FGFR2 |
Zornitza Stark gene: FGFR2 was added gene: FGFR2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: FGFR2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: FGFR2 were set to APERT SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FGFR1 |
Zornitza Stark gene: FGFR1 was added gene: FGFR1 was added to Clefting_GEL. Sources: Expert list,Illumina TruGenome Clinical Sequencing Services,Emory Genetics Laboratory,UKGTN,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: FGFR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FGFR1 were set to 19504604; 25394172; 1342859; 16606836; 14564207; 12627230 Phenotypes for gene: FGFR1 were set to Kallmann syndrome 2; Hartsfield syndrome, 615465; Hypogonadotropic hypogonadism 2 with or without anosmia, 147950 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FGD1 |
Zornitza Stark gene: FGD1 was added gene: FGD1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: FGD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: FGD1 were set to 20082460 Phenotypes for gene: FGD1 were set to AARSKOG-SCOTT SYNDROME; AAS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | FAM20C |
Zornitza Stark gene: FAM20C was added gene: FAM20C was added to Clefting_GEL. Sources: Emory Genetics Laboratory,Expert list,Radboud University Medical Center, Nijmegen,Expert Review Green Mode of inheritance for gene: FAM20C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM20C were set to 2194867118000911; 2614802; 25974638; 17924334; 10482879 Phenotypes for gene: FAM20C were set to Raine syndrome, 259775 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EYA1 |
Zornitza Stark gene: EYA1 was added gene: EYA1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: EYA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EYA1 were set to BOR1; BRANCHIOOTORENAL SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ESCO2 |
Zornitza Stark gene: ESCO2 was added gene: ESCO2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ESCO2 were set to ROBERTS SYNDROME; RBS, SC PHOCOMELIA SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EPG5 |
Zornitza Stark gene: EPG5 was added gene: EPG5 was added to Clefting_GEL. Sources: Expert list,UKGTN,Radboud University Medical Center, Nijmegen,Expert Review Green Mode of inheritance for gene: EPG5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EPG5 were set to 23222957; 26927810; 20583151; 3344762; 17163544 Phenotypes for gene: EPG5 were set to Vici syndrome, 242840 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EOGT |
Zornitza Stark gene: EOGT was added gene: EOGT was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: EOGT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EOGT were set to ADAMS-OLIVER SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EIF4A3 |
Zornitza Stark gene: EIF4A3 was added gene: EIF4A3 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EIF4A3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF4A3 were set to 10594883; 29112243; 29922329 Phenotypes for gene: EIF4A3 were set to Richieri-Costa-Pereira syndrome; Robin sequence with cleft mandible and limb anomalies, 268305; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EIF2S3 |
Zornitza Stark gene: EIF2S3 was added gene: EIF2S3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: EIF2S3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: EIF2S3 were set to MRXSBRK; MENTAL RETARDATION, X-LINKED, SYNDROMIC, BORCK TYPE |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EFTUD2 |
Zornitza Stark gene: EFTUD2 was added gene: EFTUD2 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: EFTUD2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: EFTUD2 were set to MANDIBULOFACIAL DYSOSTOSIS, GUION-ALMEIDA TYPE; MFDGA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EFNB1 |
Zornitza Stark gene: EFNB1 was added gene: EFNB1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: EFNB1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: EFNB1 were set to CRANIOFRONTONASAL SYNDROME; CFNS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EDNRA |
Zornitza Stark gene: EDNRA was added gene: EDNRA was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EDNRA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: EDNRA were set to MANDIBULOFACIAL DYSOSTOSIS WITH ALOPECIA; MFDA; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | EBP |
Zornitza Stark gene: EBP was added gene: EBP was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: EBP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: EBP were set to MEND SYNDROME; MEND |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DYNC2LI1 |
Zornitza Stark gene: DYNC2LI1 was added gene: DYNC2LI1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: DYNC2LI1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DYNC2LI1 were set to SHORT-RIB THORACIC DYSPLASIA 15 WITH POLYDACTYLY; SRTD15 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DYNC2H1 |
Zornitza Stark gene: DYNC2H1 was added gene: DYNC2H1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: DYNC2H1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DYNC2H1 were set to SHORT-RIB THORACIC DYSPLASIA 3 WITH OR WITHOUT POLYDACTYLY; SRTD3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DVL3 |
Zornitza Stark gene: DVL3 was added gene: DVL3 was added to Clefting_GEL. Sources: Expert Review Green,Other Mode of inheritance for gene: DVL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DVL3 were set to 26924530; 29575616 Phenotypes for gene: DVL3 were set to Robinow syndrome, autosomal dominant 3, 616894 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DVL1 |
Zornitza Stark gene: DVL1 was added gene: DVL1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: DVL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: DVL1 were set to DRS2; ROBINOW SYNDROME, AUTOSOMAL DOMINANT 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DOCK6 |
Zornitza Stark gene: DOCK6 was added gene: DOCK6 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: DOCK6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DOCK6 were set to ADAMS-OLIVER SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DLL4 |
Zornitza Stark gene: DLL4 was added gene: DLL4 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: DLL4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: DLL4 were set to ADAMS-OLIVER SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DHODH |
Zornitza Stark gene: DHODH was added gene: DHODH was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: DHODH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHODH were set to POADS = MILLER; POSTAXIAL ACROFACIAL DYSOSTOSIS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | DHCR7 |
Zornitza Stark gene: DHCR7 was added gene: DHCR7 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHCR7 were set to SMITH-LEMLI-OPITZ SYNDROME; SLOS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CTNND1 |
Zornitza Stark gene: CTNND1 was added gene: CTNND1 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CTNND1 were set to 28301459 Phenotypes for gene: CTNND1 were set to BLEPHAROCHEILODONTIC; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CTCF |
Zornitza Stark gene: CTCF was added gene: CTCF was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: CTCF was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: CTCF were set to MENTAL RETARDATION, AUTOSOMAL DOMINANT 21; MRD21 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COLEC11 |
Zornitza Stark gene: COLEC11 was added gene: COLEC11 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: COLEC11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COLEC11 were set to 3MC2; 3MC SYNDROME 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COLEC10 |
Zornitza Stark gene: COLEC10 was added gene: COLEC10 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: COLEC10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COLEC10 were set to 21258343 Phenotypes for gene: COLEC10 were set to 3MC SYNDROME 3; 3MC3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COL9A1 |
Zornitza Stark gene: COL9A1 was added gene: COL9A1 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Radboud University Medical Center, Nijmegen,Victorian Clinical Genetics Services Mode of inheritance for gene: COL9A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COL9A1 were set to 16909383; 21421862 Phenotypes for gene: COL9A1 were set to Autosomal recessive Stickler syndrome; Stickler syndrome, type IV (ophthalmological: myopia, retinal detachment and cataracts, orofacial: micrognathia, midface hypoplasia and cleft palate, auditory:sensorineural hearing loss and articular: epiphyseal dysplasia) symptoms; Orofacial Clefting with skeletal features; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COL2A1 |
Zornitza Stark gene: COL2A1 was added gene: COL2A1 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Victorian Clinical Genetics Services,Eligibility statement prior genetic testing Mode of inheritance for gene: COL2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: COL2A1 were set to 16752401; 17721977; 1677770 Phenotypes for gene: COL2A1 were set to STL1; Stickler syndrome (cleft palate,micrognathia,vireo-retinal anomalies, severe myopia, joint problems, hearing loss); Stickler sydrome, type I, non syndromic ocular; Cleft palate; STICKLER SYNDROME, MEMBRANOUS VITREOUS TYPE; ARTHROOPHTHALMOPATHY, HEREDITARY PROGRESSIVE, AOM; STICKLER SYNDROME, TYPE I; Orofacial Clefting with skeletal features; Stickler Syndrome; STICKLER SYNDROME, TYPE I (STL1), 108300; STICKLER SYNDROME, VITREOUS TYPE 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COL11A2 |
Zornitza Stark gene: COL11A2 was added gene: COL11A2 was added to Clefting_GEL. Sources: UKGTN,Radboud University Medical Center, Nijmegen,Eligibility statement prior genetic testing,Victorian Clinical Genetics Services,Expert Review Green Mode of inheritance for gene: COL11A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL11A2 were set to Cleft palate; OSMED; STL3; Stickler syndrome, type III; Non-ocular Stickler syndrome; STICKLER SYNDROME, NONOCULAR TYPE |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | COL11A1 |
Zornitza Stark gene: COL11A1 was added gene: COL11A1 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Victorian Clinical Genetics Services,Eligibility statement prior genetic testing Mode of inheritance for gene: COL11A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL11A1 were set to Orofacial Clefting with skeletal features; Stickler Syndrome; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CHST14 |
Zornitza Stark gene: CHST14 was added gene: CHST14 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: CHST14 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHST14 were set to EHLERS-DANLOS SYNDROME, MUSCULOCONTRACTURAL TYPE, 1; EDSMC1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CHRNG |
Zornitza Stark gene: CHRNG was added gene: CHRNG was added to Clefting_GEL. Sources: Expert list,UKGTN,Illumina TruGenome Clinical Sequencing Services,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: CHRNG was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHRNG were set to 16826520; 22167768; 27843868 Phenotypes for gene: CHRNG were set to PTERYGIUM SYNDROME, MULTIPLE, LETHAL TYPE; MULTIPLE PTERYGIUM SYNDROME, NONLETHAL TYPE; Multiple pterygium syndrome, lethal type, 253290; Escobar syndrome, 265000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CHD7 |
Zornitza Stark gene: CHD7 was added gene: CHD7 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: CHD7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: CHD7 were set to CHARGE SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CDKN1C |
Zornitza Stark gene: CDKN1C was added gene: CDKN1C was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: CDKN1C was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Publications for gene: CDKN1C were set to 20503313 Phenotypes for gene: CDKN1C were set to BECKWITH-WIEDEMANN SYNDROME; BWS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CDH1 |
Zornitza Stark gene: CDH1 was added gene: CDH1 was added to Clefting_GEL. Sources: Expert Review Green,Other Mode of inheritance for gene: CDH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CDH1 were set to 27566442; 28301459 Phenotypes for gene: CDH1 were set to Blepharocheilodontic syndrome 1; BLEPHAROCHEILODONTIC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | CC2D2A |
Zornitza Stark gene: CC2D2A was added gene: CC2D2A was added to Clefting_GEL. Sources: Expert list,Expert Review Green Mode of inheritance for gene: CC2D2A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CC2D2A were set to 18513680; 19777577 Phenotypes for gene: CC2D2A were set to MKS6; Meckel-Gruber syndrome; Meckel syndrome 6, 612284 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | C5orf42 |
Zornitza Stark gene: C5orf42 was added gene: C5orf42 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: C5orf42 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C5orf42 were set to OFD6; OROFACIODIGITAL SYNDROME VI |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | C2CD3 |
Zornitza Stark gene: C2CD3 was added gene: C2CD3 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: C2CD3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C2CD3 were set to OFD14; OROFACIODIGITAL SYNDROME XIV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | BMP2 |
Zornitza Stark gene: BMP2 was added gene: BMP2 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: BMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: BMP2 were set to 29198724; 21671386 Phenotypes for gene: BMP2 were set to Short stature, facial dysmorphism, and skeletal anomalies with or without cardiac anomalies, 617877; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | BCOR |
Zornitza Stark gene: BCOR was added gene: BCOR was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: BCOR was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: BCOR were set to MCOPS2; MICROPHTHALMIA, SYNDROMIC 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | B3GLCT |
Zornitza Stark gene: B3GLCT was added gene: B3GLCT was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B3GLCT were set to PETERS-PLUS SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ASXL1 |
Zornitza Stark gene: ASXL1 was added gene: ASXL1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ASXL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: ASXL1 were set to BOPS; BOHRING-OPITZ SYNDROME |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ARHGAP31 |
Zornitza Stark gene: ARHGAP31 was added gene: ARHGAP31 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: ARHGAP31 were set to AOS1; ADAMS-OLIVER SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ARHGAP29 |
Zornitza Stark gene: ARHGAP29 was added gene: ARHGAP29 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services,Research Mode of inheritance for gene: ARHGAP29 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARHGAP29 were set to 23008150; 27369588; 25704602; 27350171; 25512736; 27033726; 28029220 Phenotypes for gene: ARHGAP29 were set to cleft lip with or without cleft palate; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ANKRD11 |
Zornitza Stark gene: ANKRD11 was added gene: ANKRD11 was added to Clefting_GEL. Sources: Expert Review Green,UKGTN,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: ANKRD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKRD11 were set to 25838844; 2705097; 21782149; 27900361 Phenotypes for gene: ANKRD11 were set to Short stature-facial and skeletal anomalies-intellectual disability-macrodontia syndrome; Orofacial Clefting with skeletal features; KBG syndrome,148050 (orofacial clefting, intellectual disability, dental anomalies, dysmorphism) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | AMER1 |
Zornitza Stark gene: AMER1 was added gene: AMER1 was added to Clefting_GEL. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: AMER1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: AMER1 were set to OSTEOPATHIA STRIATA WITH CRANIAL SCLEROSIS; OSCS; Cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ACTG1 |
Zornitza Stark gene: ACTG1 was added gene: ACTG1 was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ACTG1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ACTG1 were set to 22366783 Phenotypes for gene: ACTG1 were set to BARAITSER-WINTER SYNDROME 2; BRWS2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | ACTB |
Zornitza Stark gene: ACTB was added gene: ACTB was added to Clefting_GEL. Sources: Expert Review Green Mode of inheritance for gene: ACTB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ACTB were set to 22366783 Phenotypes for gene: ACTB were set to BRWS1; BARAITSER-WINTER SYNDROME 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.0 | Zornitza Stark Added panel Clefting_GEL | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||