PanelApp

Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Repeat Disorders v0.123 GDPAG Zornitza Stark Tag paediatric-onset tag was added to STR: GDPAG.
Repeat Disorders v0.123 FXTAS Zornitza Stark Tag adult-onset tag was added to STR: FXTAS.
Repeat Disorders v0.123 FXS Zornitza Stark Tag paediatric-onset tag was added to STR: FXS.
Repeat Disorders v0.123 FXPOI Zornitza Stark Tag adult-onset tag was added to STR: FXPOI.
Mirror movements v0.3 DCC Bryony Thompson Classified gene: DCC as Green List (high evidence)
Mirror movements v0.3 DCC Bryony Thompson Gene: dcc has been classified as Green List (High Evidence).
Mirror movements v0.2 DCC Bryony Thompson gene: DCC was added
gene: DCC was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: DCC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DCC were set to 20431009; 25763452; 28250454
Phenotypes for gene: DCC were set to Mirror movements 1 and/or agenesis of the corpus callosum MIM#157600
Review for gene: DCC was set to GREEN
gene: DCC was marked as current diagnostic
Added comment: Well-established and most common cause of congenital mirror movements. >20 cases reported.
Sources: Expert list
Mirror movements v0.1 Bryony Thompson Panel name changed from Osteoporosis to Mirror movements
Panel status changed from deleted to internal
Repeat Disorders v0.123 FTDALS Zornitza Stark Tag adult-onset tag was added to STR: FTDALS.
Repeat Disorders v0.123 FRDA Zornitza Stark Tag paediatric-onset tag was added to STR: FRDA.
Repeat Disorders v0.123 FRAXE Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXE.
Repeat Disorders v0.123 FECD3 Zornitza Stark Tag adult-onset tag was added to STR: FECD3.
Repeat Disorders v0.123 FAME3 Zornitza Stark Tag adult-onset tag was added to STR: FAME3.
Repeat Disorders v0.123 FAME2 Zornitza Stark Tag adult-onset tag was added to STR: FAME2.
Repeat Disorders v0.123 FAME1 Zornitza Stark Tag adult-onset tag was added to STR: FAME1.
Repeat Disorders v0.123 EPM1 Zornitza Stark Tag paediatric-onset tag was added to STR: EPM1.
Repeat Disorders v0.123 EIEE1_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract2.
Repeat Disorders v0.123 EIEE1_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract1.
Repeat Disorders v0.123 DRPLA Zornitza Stark Tag adult-onset tag was added to STR: DRPLA.
Tag paediatric-onset tag was added to STR: DRPLA.
Repeat Disorders v0.123 DM2 Zornitza Stark Tag adult-onset tag was added to STR: DM2.
Repeat Disorders v0.123 DM1 Zornitza Stark Tag adult-onset tag was added to STR: DM1.
Tag paediatric-onset tag was added to STR: DM1.
Repeat Disorders v0.123 DBQD2 Zornitza Stark Tag paediatric-onset tag was added to STR: DBQD2.
Repeat Disorders v0.123 CJD Zornitza Stark Tag adult-onset tag was added to STR: CJD.
Repeat Disorders v0.123 CCHS Zornitza Stark Tag paediatric-onset tag was added to STR: CCHS.
Repeat Disorders v0.123 CANVAS Zornitza Stark Tag adult-onset tag was added to STR: CANVAS.
Repeat Disorders v0.123 BPES Zornitza Stark Tag paediatric-onset tag was added to STR: BPES.
Growth failure v0.381 MSTO1 Zornitza Stark Marked gene: MSTO1 as ready
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.381 MSTO1 Zornitza Stark Classified gene: MSTO1 as Green List (high evidence)
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.380 MSTO1 Zornitza Stark reviewed gene: MSTO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28544275, 29339779, 30684668; Phenotypes: Myopathy, mitochondrial, and ataxia, MIM# 617675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9007 KCTD7 Zornitza Stark Marked gene: KCTD7 as ready
Mendeliome v0.9007 KCTD7 Zornitza Stark Gene: kctd7 has been classified as Green List (High Evidence).
Mendeliome v0.9007 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726)
Mendeliome v0.9006 KCTD7 Zornitza Stark Publications for gene: KCTD7 were set to
Mendeliome v0.9005 KCTD7 Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9004 KCTD7 Kristin Rigbye reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 22693283, 22748208; Phenotypes: Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.139 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Clefting disorders v0.138 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4092 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4091 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Genetic Epilepsy v0.1181 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Genetic Epilepsy v0.1180 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Mendeliome v0.9004 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Mendeliome v0.9003 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Growth failure v0.380 RPL10 Zornitza Stark Marked gene: RPL10 as ready
Growth failure v0.380 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Growth failure v0.380 RPL10 Zornitza Stark Phenotypes for gene: RPL10 were changed from Mental retardation, X-linked, syndromic, 35 to Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998; severe growth retardation; intrauterine growth restriction; short stature; dysmorphic facial features (prognathism, dental crowding, thin upper lip); microcephaly; seizures; hypotonia; genitourinary abnormalities; cerebellar hypoplasia
Growth failure v0.379 RPL10 Zornitza Stark Publications for gene: RPL10 were set to 25316788
Growth failure v0.378 RPL10 Zornitza Stark Classified gene: RPL10 as Green List (high evidence)
Growth failure v0.378 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Mendeliome v0.9003 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face; Brachydactyly, type B1 MIM# 113000; hypoplasia/aplasia of distal phalanges and nails (2-5)
Mendeliome v0.9002 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Mendeliome v0.9001 ROR2 Zornitza Stark Mode of inheritance for gene: ROR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9000 ROR2 Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.377 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Growth failure v0.377 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Growth failure v0.377 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face
Growth failure v0.376 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Growth failure v0.375 ROR2 Zornitza Stark Classified gene: ROR2 as Green List (high evidence)
Growth failure v0.375 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Mendeliome v0.9000 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Mendeliome v0.8999 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Mendeliome v0.8998 PROP1 Zornitza Stark Mode of inheritance for gene: PROP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 PROP1 Zornitza Stark reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.374 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Growth failure v0.374 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.374 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from Pituitary hormone deficiency, combined to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Growth failure v0.373 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Growth failure v0.372 PROP1 Zornitza Stark Classified gene: PROP1 as Green List (high evidence)
Growth failure v0.372 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Marked gene: PROKR2 as ready
Growth failure v0.371 PROKR2 Zornitza Stark Gene: prokr2 has been classified as Red List (Low Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Phenotypes for gene: PROKR2 were changed from hypopituitarism, Hypoplastic corpus callosum, normal or small anterior pituitary, Club foot, syrinx spinal cord, microcephaly, epilepsy to Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200; Kallmann syndrome (KS); normosmic idiopathic hypogonadotropic hypogonadism (nIHH); Anosmia; GnRH deficiency; cleft lip and palate; renal agenesis; Hypogonadotropic hypogonadism; low testosterone/ estradiol; Absent/ partial Puberty; Hearing loss
Growth failure v0.370 PROKR2 Zornitza Stark Publications for gene: PROKR2 were set to 22319038
Growth failure v0.369 PROKR2 Zornitza Stark Mode of inheritance for gene: PROKR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 RPL10 Danielle Ariti Deleted their comment
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti edited their review of gene: RPL10: Added comment: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; Changed phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, short stature, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, severe growth restriction (IUGR), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti reviewed gene: RPL10: Rating: GREEN; Mode of pathogenicity: None; Publications: 25316788, 25846674, 26290468; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature in early childhood is not a prominent feature; Changed rating: RED
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 ROR2 Danielle Ariti reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.368 PROP1 Danielle Ariti reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/ partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their review
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), Normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Marked gene: WRN as ready
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Cancer Predisposition_Paediatric v0.112 WRN Zornitza Stark Publications for gene: WRN were set to
Cancer Predisposition_Paediatric v0.111 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cancer Predisposition_Paediatric v0.110 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 WRN Zornitza Stark Marked gene: WRN as ready
Mendeliome v0.8997 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Mendeliome v0.8997 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Mendeliome v0.8996 WRN Zornitza Stark Publications for gene: WRN were set to
Mendeliome v0.8995 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8994 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 WRN Zornitza Stark Marked gene: WRN as ready
Growth failure v0.368 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.368 WRN Zornitza Stark Phenotypes for gene: WRN were changed from Werner syndrome to Werner syndrome, MIM# 277700; MONDO:0010196
Growth failure v0.367 WRN Zornitza Stark Publications for gene: WRN were set to
Growth failure v0.366 WRN Zornitza Stark Classified gene: WRN as Green List (high evidence)
Growth failure v0.366 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.365 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from Pituitary hormone deficiency, combined, 1 (613038) to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Pituitary hormone deficiency v0.16 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Pituitary hormone deficiency v0.15 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.148 CJD Bryony Thompson Marked STR: CJD as ready
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.148 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.147 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8994 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Mendeliome v0.8994 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8994 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Mendeliome v0.8993 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Mendeliome v0.8992 POU1F1 Zornitza Stark Mode of inheritance for gene: POU1F1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8991 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.146 Bryony Thompson removed STR:PRNP from the panel
Repeat Disorders v0.123 CJD Bryony Thompson Marked STR: CJD as ready
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.123 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.122 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8991 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Growth failure v0.365 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from GH, PRL deficiencies; variable degree of TSH deficiency to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Growth failure v0.364 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Growth failure v0.363 POU1F1 Zornitza Stark Classified gene: POU1F1 as Green List (high evidence)
Growth failure v0.363 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8991 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.363 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Regression. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Growth failure v0.362 POU1F1 Danielle Ariti reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Regression v0.362 NOP56 Bryony Thompson Classified gene: NOP56 as No list
Regression v0.362 NOP56 Bryony Thompson Added comment: Comment on list classification: STR expansion is the only reported cause of disease for this gene. An STR has been added to this panel under SCA36
Regression v0.362 NOP56 Bryony Thompson Gene: nop56 has been removed from the panel.
Mendeliome v0.8990 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Literature
Repeat Disorders v0.121 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.121 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.120 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Expert list
Mendeliome v0.8989 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Mendeliome v0.8989 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Mendeliome v0.8989 GIPC1 Bryony Thompson Classified gene: GIPC1 as No list
Mendeliome v0.8989 GIPC1 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under OPDM2
Mendeliome v0.8989 GIPC1 Bryony Thompson Gene: gipc1 has been removed from the panel.
Mendeliome v0.8988 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Mendeliome v0.8988 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Marked STR: FAME3 as ready
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Classified STR: FAME3 as Green List (high evidence)
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.118 FAME3 Bryony Thompson STR: FAME3 was added
STR: FAME3 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME3 were set to 31664039
Phenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: FAME3 was set to GREEN
STR: FAME3 was marked as clinically relevant
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Mendeliome v0.8987 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.85 BRWD3 Chirag Patel Classified gene: BRWD3 as Green List (high evidence)
Macrocephaly_Megalencephaly v0.85 BRWD3 Chirag Patel Gene: brwd3 has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.84 BRWD3 Chirag Patel gene: BRWD3 was added
gene: BRWD3 was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: BRWD3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: BRWD3 were set to PMID: 30628072, 24462886
Phenotypes for gene: BRWD3 were set to Intellectual developmental disorder, X-linked 93; OMIM # 300659
Review for gene: BRWD3 was set to GREEN
Added comment: 10 patients (from 6 unrelated families) with ID, macrocephaly and dysmorphic facial features.
Sources: Literature
Mendeliome v0.8986 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Mendeliome v0.8986 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Mendeliome v0.8986 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Overgrowth v1.4 BRWD3 Chirag Patel Classified gene: BRWD3 as Green List (high evidence)
Overgrowth v1.4 BRWD3 Chirag Patel Gene: brwd3 has been classified as Green List (High Evidence).
Overgrowth v1.3 BRWD3 Chirag Patel reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, OMIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1179 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Repeat Disorders v0.117 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.117 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.116 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.83 PPP2R5D Chirag Patel Classified gene: PPP2R5D as Green List (high evidence)
Macrocephaly_Megalencephaly v0.83 PPP2R5D Chirag Patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Overgrowth v1.3 PPP2R5D Chirag Patel Classified gene: PPP2R5D as Green List (high evidence)
Overgrowth v1.3 PPP2R5D Chirag Patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.82 PPP2R5D Chirag Patel gene: PPP2R5D was added
gene: PPP2R5D was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: PPP2R5D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5D were set to PMID: 26168268, 25972378, 25533962; 34448180
Phenotypes for gene: PPP2R5D were set to Mental retardation, autosomal dominant 35, MIM# 616355
Review for gene: PPP2R5D was set to GREEN
Added comment: Phenotype of macrocephaly is consistent, and multiple patients reported
Sources: Literature
Overgrowth v1.2 PPP2R5D Chirag Patel reviewed gene: PPP2R5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Repeat Disorders v0.115 FAME4 Bryony Thompson Marked STR: FAME4 as ready
Repeat Disorders v0.115 FAME4 Bryony Thompson Str: fame4 has been classified as Red List (Low Evidence).
Repeat Disorders v0.115 FAME4 Bryony Thompson STR: FAME4 was added
STR: FAME4 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME4 were set to 31539032
Phenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127
Review for STR: FAME4 was set to RED
Added comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease.
Sources: Literature
Repeat Disorders v0.114 OPML1 Bryony Thompson Marked STR: OPML1 as ready
Repeat Disorders v0.114 OPML1 Bryony Thompson Str: opml1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.114 OPML1 Bryony Thompson STR: OPML1 was added
STR: OPML1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPML1 were set to 31332380
Phenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637
Review for STR: OPML1 was set to RED
Added comment: NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Mendeliome v0.8985 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986; 24355708
Mendeliome v0.8984 PNPLA6 Zornitza Stark changed review comment from: Ataxia is part of the phenotype.
Sources: Expert list; to: Variants in this gene are associated with multiple phenotypes.

Oliver-McFarlane syndrome is a rare congenital disorder characterized by trichomegaly, severe chorioretinal atrophy and multiple pituitary hormone deficiencies, including growth hormone. At least 10 families reported.

Laurence-Moon syndrome has a clinical presentation similar to that of Oliver-McFarlane syndrome, including chorioretinopathy and pituitary dysfunction, but with childhood onset of ataxia, peripheral neuropathy, and spastic paraplegia and without trichomegaly. Single family reported.
Mendeliome v0.8984 PNPLA6 Zornitza Stark edited their review of gene: PNPLA6: Changed publications: 25480986, 33818269, 32758583, 30097146; Changed phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800
Growth failure v0.362 PNPLA6 Zornitza Stark Marked gene: PNPLA6 as ready
Growth failure v0.362 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.362 PNPLA6 Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Oliver-Mcfarlane syndrome, Trichomegaly, GH deficiency, retinal dystrophy, hypogonadotrophic hypogonadism to Oliver-McFarlane syndrome, MIM# 275400; Laurence-Moon syndrome, MIM# 245800
Growth failure v0.361 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986
Growth failure v0.360 PNPLA6 Zornitza Stark Classified gene: PNPLA6 as Green List (high evidence)
Growth failure v0.360 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.359 PNPLA6 Zornitza Stark reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480986, 33818269, 32758583, 30097146; Phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8984 PI4KA Zornitza Stark Phenotypes for gene: PI4KA were changed from Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531 to Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531; Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Mendeliome v0.8983 PI4KA Zornitza Stark Publications for gene: PI4KA were set to 25855803
Mendeliome v0.8982 PI4KA Zornitza Stark Classified gene: PI4KA as Green List (high evidence)
Mendeliome v0.8982 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Mendeliome v0.8981 PI4KA Zornitza Stark changed review comment from: Single family reported, aware of at least one other yet to be published family identified internally.; to: PMG: Single family reported, aware of at least one other yet to be published family identified internally.
Mendeliome v0.8981 PI4KA Zornitza Stark edited their review of gene: PI4KA: Added comment: Neurodevelopmental syndrome with hypomyelinating leukodystrophy: 10 unrelated patients harbouring biallelic variants in PI4KA reported with a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.; Changed rating: GREEN; Changed publications: 25855803, 34415322; Changed phenotypes: Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531, Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Hereditary Spastic Paraplegia - paediatric v1.17 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Hereditary Spastic Paraplegia - paediatric v1.17 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy - paediatric v0.232 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Leukodystrophy - paediatric v0.232 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia - paediatric v1.17 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Hereditary Spastic Paraplegia - paediatric v1.17 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia - paediatric v1.16 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy - paediatric v0.232 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Leukodystrophy - paediatric v0.232 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4090 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Leukodystrophy - paediatric v0.231 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Leukodystrophy - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Repeat Disorders v0.113 OPDM1 Bryony Thompson Marked STR: OPDM1 as ready
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.113 OPDM1 Bryony Thompson Classified STR: OPDM1 as Green List (high evidence)
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.112 OPDM1 Bryony Thompson STR: OPDM1 was added
STR: OPDM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM1 were set to 31332380; 34047774
Phenotypes for STR: OPDM1 were set to Oculopharyngodistal myopathy 1 MIM#164310
Review for STR: OPDM1 was set to GREEN
STR: OPDM1 was marked as clinically relevant
Added comment: NM_013437.5:c.-102CGG[X]
RNA-mediated toxicity is thought to be the mechanism of disease. Sixty-five Japanese patients with oculopharyngodistal myopathy (OPDM) from 59 families with CGG repeat expansions in LRP12. This represents the most common OPDM subtype among all patients in Japan with genetically diagnosed OPDM.
Normal: 13 to 45 repeats.
Pathogenic: 85 to 289 repeats.
Sources: Expert list
Early-onset Dementia v0.145 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.145 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.144 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.143 Bryony Thompson removed STR:NIID from the panel
Hereditary Neuropathy - complex v0.117 NIID Bryony Thompson Marked STR: NIID as ready
Hereditary Neuropathy - complex v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v0.117 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Hereditary Neuropathy - complex v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v0.116 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Hereditary Neuropathy - complex. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Hereditary Neuropathy - complex v0.115 Bryony Thompson removed STR:NIID from the panel
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Marked STR: NIID as ready
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.89 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Leukodystrophy - adult onset v0.88 Bryony Thompson removed STR:NIID from the panel
Regression v0.361 NIID Bryony Thompson Marked STR: NIID as ready
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.361 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.360 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Regression. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Regression v0.359 Bryony Thompson removed STR:NIID from the panel
Mendeliome v0.8981 NIID Bryony Thompson Marked STR: NIID as ready
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8981 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8980 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Mendeliome v0.8979 Bryony Thompson removed STR:NIID from the panel
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.119 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Parkinson disease v0.118 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.111 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.111 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.110 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Expert list
Repeat Disorders v0.109 Bryony Thompson removed STR:NIID from the panel
Growth failure v0.359 PITX2 Zornitza Stark Marked gene: PITX2 as ready
Growth failure v0.359 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.359 PITX2 Zornitza Stark Phenotypes for gene: PITX2 were changed from AXENFELD-RIEGER SYNDROME to Axenfeld-Rieger syndrome, type 1, MIM# 180500
Growth failure v0.358 PITX2 Zornitza Stark Classified gene: PITX2 as Green List (high evidence)
Growth failure v0.358 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.357 PITX2 Zornitza Stark reviewed gene: PITX2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Axenfeld-Rieger syndrome, type 1, MIM# 180500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8978 SUCO Bryony Thompson Marked gene: SUCO as ready
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8978 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8977 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Literature
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Marked gene: SUCO as ready
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.62 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Classified gene: ANO5 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Gene: ano5 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.60 ANO5 Bryony Thompson gene: ANO5 was added
gene: ANO5 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: ANO5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANO5 were set to 30712070; 15124103; 30641283; 29175271
Phenotypes for gene: ANO5 were set to Gnathodiaphyseal dysplasia MIM#166260
Review for gene: ANO5 was set to GREEN
gene: ANO5 was marked as current diagnostic
Added comment: Bone fragility is a feature of the condition, which is an overlapping feature with OI and could be a differential diagnosis. >3 families/probands and a null mouse model reported.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Classified gene: XYLT2 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.58 XYLT2 Bryony Thompson gene: XYLT2 was added
gene: XYLT2 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: XYLT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: XYLT2 were set to 26027496; 26987875
Phenotypes for gene: XYLT2 were set to Spondyloocular syndrome MIM#605822
Review for gene: XYLT2 was set to GREEN
gene: XYLT2 was marked as current diagnostic
Added comment: Generalised osteoporosis and recurrent fractures are a feature of the condition, which overlaps with the OI phenotype. >3 families reported.
Sources: Expert list
Growth failure v0.357 OTX2 Zornitza Stark Marked gene: OTX2 as ready
Growth failure v0.357 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.357 OTX2 Zornitza Stark Phenotypes for gene: OTX2 were changed from Microcephaly, bilateral anopthalmia, developmental delay, cleft palate to Pituitary hormone deficiency, combined, 6, MIM# 613986; Microphthalmia, syndromic 5, MIM# 610125
Growth failure v0.356 OTX2 Zornitza Stark Publications for gene: OTX2 were set to 18728160
Growth failure v0.355 OTX2 Zornitza Stark Classified gene: OTX2 as Green List (high evidence)
Growth failure v0.355 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.354 OTX2 Zornitza Stark reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 18728160, 33950863, 15846561; Phenotypes: Pituitary hormone deficiency, combined, 6, MIM# 613986, Microphthalmia, syndromic 5, MIM# 610125; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.354 MCM5 Zornitza Stark Marked gene: MCM5 as ready
Growth failure v0.354 MCM5 Zornitza Stark Gene: mcm5 has been classified as Red List (Low Evidence).
Growth failure v0.354 MCM5 Zornitza Stark Phenotypes for gene: MCM5 were changed from ?Meier-Gorlin syndrome 8 to Meier-Gorlin syndrome 8 (MIM#617564)
Growth failure v0.353 MCM5 Zornitza Stark reviewed gene: MCM5: Rating: RED; Mode of pathogenicity: None; Publications: 28198391; Phenotypes: Meier-Gorlin syndrome 8 (MIM#617564); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.353 LIG1 Zornitza Stark Marked gene: LIG1 as ready
Growth failure v0.353 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.353 LIG1 Zornitza Stark Phenotypes for gene: LIG1 were changed from immunodeficiency, sun sensitivity, growth reatrdation to Combined immunodeficiency; Lymphopaenia; Hypogammaglobulinaemia; Recurrent bacterial and viral infections; Growth retardation; Sun sensitivity, radiation sensitivity; Macrocytosis
Growth failure v0.352 LIG1 Zornitza Stark Publications for gene: LIG1 were set to 1581963, 1351188
Growth failure v0.351 LIG1 Zornitza Stark Classified gene: LIG1 as Green List (high evidence)
Growth failure v0.351 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.350 LIG1 Zornitza Stark reviewed gene: LIG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30395541; Phenotypes: Combined immunodeficiency, Lymphopaenia, Hypogammaglobulinaemia, Recurrent bacterial and viral infections, Growth retardation, Sun sensitivity, radiation sensitivity, Macrocytosis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v0.57 WNT4 Bryony Thompson gene: WNT4 was added
gene: WNT4 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: WNT4 was set to Unknown
Publications for gene: WNT4 were set to 25108526; 26733379
Phenotypes for gene: WNT4 were set to Osteoporosis
Review for gene: WNT4 was set to RED
Added comment: Mouse model where recombinant Wnt4 alleviated bone loss and inflammation by inhibiting NF-κB in vivo in mouse models of bone disease. However, no reported association with Mendelian disease. A common SNP (rs10917157) has been associated with bone mineral density.
Sources: Expert list
Mirror movements v0.0 Bryony Thompson Panel deleted
Growth failure v0.350 LHX4 Zornitza Stark Marked gene: LHX4 as ready
Growth failure v0.350 LHX4 Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence).
Growth failure v0.350 LHX4 Zornitza Stark Phenotypes for gene: LHX4 were changed from hypopituitarism to Pituitary hormone deficiency, combined, 4, MIM# 262700
Growth failure v0.349 LHX4 Zornitza Stark Publications for gene: LHX4 were set to 11567216, 18073311
Growth failure v0.348 LHX4 Zornitza Stark Classified gene: LHX4 as Green List (high evidence)
Growth failure v0.348 LHX4 Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence).
Growth failure v0.347 LHX4 Zornitza Stark reviewed gene: LHX4: Rating: GREEN; Mode of pathogenicity: None; Publications: 11567216, 17527005, 18073311; Phenotypes: Pituitary hormone deficiency, combined, 4, MIM# 262700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.347 LHX3 Zornitza Stark Marked gene: LHX3 as ready
Growth failure v0.347 LHX3 Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence).
Growth failure v0.347 LHX3 Zornitza Stark Phenotypes for gene: LHX3 were changed from GH, TSH, LH, FSH, PRL deficiencies to Pituitary hormone deficiency, combined, 3, MIM# 221750
Growth failure v0.346 LHX3 Zornitza Stark Publications for gene: LHX3 were set to
Growth failure v0.345 LHX3 Zornitza Stark Classified gene: LHX3 as Green List (high evidence)
Growth failure v0.345 LHX3 Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence).
Growth failure v0.344 LHX3 Zornitza Stark reviewed gene: LHX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10835633, 16394081, 17327381, 18407919; Phenotypes: Pituitary hormone deficiency, combined, 3, MIM# 221750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.344 KHDC3L Zornitza Stark Marked gene: KHDC3L as ready
Growth failure v0.344 KHDC3L Zornitza Stark Gene: khdc3l has been classified as Red List (Low Evidence).
Growth failure v0.344 KHDC3L Zornitza Stark Phenotypes for gene: KHDC3L were changed from pregnancy loss; Hydatidiform mole, recurrent, 2 OMIM:614293; hydatidiform mole, recurrent, 2 MONDO:0013671; Failure to thrive; IUGR to Silver-Russell syndrome
Growth failure v0.343 KHDC3L Zornitza Stark Mode of inheritance for gene: KHDC3L was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.342 KHDC3L Zornitza Stark reviewed gene: KHDC3L: Rating: RED; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: Silver-Russell syndrome; Mode of inheritance: Other
Growth failure v0.342 Zornitza Stark removed gene:INTS8 from the panel
Growth failure v0.341 INSR Zornitza Stark Marked gene: INSR as ready
Growth failure v0.341 INSR Zornitza Stark Gene: insr has been classified as Green List (High Evidence).
Growth failure v0.341 INSR Zornitza Stark Phenotypes for gene: INSR were changed from Leprechaunism to Leprechaunism, MIM# 246200; Rabson-Mendenhall syndrome, MIM# 262190
Growth failure v0.340 INSR Zornitza Stark Publications for gene: INSR were set to
Growth failure v0.339 INSR Zornitza Stark Classified gene: INSR as Green List (high evidence)
Growth failure v0.339 INSR Zornitza Stark Gene: insr has been classified as Green List (High Evidence).
Growth failure v0.338 INSR Zornitza Stark reviewed gene: INSR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8105179, 7815442, 33995269, 33224016, 33048476, 2121734, 9449692; Phenotypes: Leprechaunism, MIM# 246200, Rabson-Mendenhall syndrome, MIM# 262190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Motor Neurone Disease v0.131 Bryony Thompson removed STR:NIID from the panel
Early-onset Dementia v0.142 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.142 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.141 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.140 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.108 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.108 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.107 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Marked STR: GDPAG as ready
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Classified STR: GDPAG as Green List (high evidence)
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.7 GDPAG Bryony Thompson STR: GDPAG was added
STR: GDPAG was added to Miscellaneous Metabolic Disorders. Sources: Literature
Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GDPAG were set to 30970188
Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GDPAG was set to GREEN
STR: GDPAG was marked as clinically relevant
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Literature
Repeat Disorders v0.106 GDPAG Bryony Thompson Marked STR: GDPAG as ready
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Repeat Disorders v0.106 GDPAG Bryony Thompson Classified STR: GDPAG as Green List (high evidence)
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.6 Bryony Thompson removed STR:GLS from the panel
Repeat Disorders v0.105 GDPAG Bryony Thompson STR: GDPAG was added
STR: GDPAG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GDPAG were set to 30970188
Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GDPAG was set to GREEN
STR: GDPAG was marked as clinically relevant
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Literature
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Marked STR: FAME1_TTTGA as ready
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Str: fame1_tttga has been classified as Red List (Low Evidence).
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson STR: FAME1_TTTGA was added
STR: FAME1_TTTGA was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME1_TTTGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME1_TTTGA were set to 31483537
Phenotypes for STR: FAME1_TTTGA were set to familial cortical myoclonic tremor with epilepsy
Review for STR: FAME1_TTTGA was set to RED
Added comment: A single family with 2 cases and 1 asymptomatic carrier with the repeat allele (TTTTA)114-123 (TTTGA)108-116, instead of the TTTCA FAME1 repeat.
Sources: Literature
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Classified STR: CANVAS_ACAGG as Amber List (moderate evidence)
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Added comment: Comment on list classification: Used the pathogenic cut-off of 400 repeats from original CANVAS repeat
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.102 CANVAS_ACAGG Bryony Thompson STR: CANVAS_ACAGG was added
STR: CANVAS_ACAGG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: CANVAS_ACAGG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS_ACAGG were set to 33237689; 32694621; 33103729
Phenotypes for STR: CANVAS_ACAGG were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome; fasciculations; elevated serum creatine kinase levels; denervation
Review for STR: CANVAS_ACAGG was set to AMBER
Added comment: A novel RFC1 repeat expansion motif, (ACAGG)exp, identified in three affected individuals from 2 families in an Asian-Pacific cohort and one Japanese individual for CANVAS. Southern blot was used to identify the repeat was ~1000kb in one of the cases, equivalent to ~1000 repeats.
Sources: Literature
Repeat Disorders v0.101 CANVAS Bryony Thompson Marked STR: CANVAS as ready
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.101 CANVAS Bryony Thompson Classified STR: CANVAS as Green List (high evidence)
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.100 CANVAS Bryony Thompson STR: CANVAS was added
STR: CANVAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS were set to 30926972; 32851396; 33237689; 31230722
Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575
Review for STR: CANVAS was set to GREEN
STR: CANVAS was marked as clinically relevant
Added comment: NM_001204747​.1:c.132+2923_2927AAAAG[X]
Simple tandem repeat (AAAAG)n replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Maori population-specific CANVAS configuration (AAAGG)10-25(AAGGG)exp. (AAAGG)n repeat alone is not pathogenic. Mechanism of disease is unknown.
Normal: AAAAG 11 repeats (allele frequency = 0.75); AAAAG 12-200 (allele frequency = 0.13); AAAGG 40-1000 (allele frequency = 0.08)
Pathogenic: AAGGG repeat expansion, most frequently ranging from 400 to more than 2000 repeats (allele frequency = 0.01-0.04)
Sources: Expert list
Mendeliome v0.8976 IGFALS Zornitza Stark Marked gene: IGFALS as ready
Mendeliome v0.8976 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Mendeliome v0.8976 IGFALS Zornitza Stark Phenotypes for gene: IGFALS were changed from to Acid-labile subunit, deficiency of, MIM# 615961
Mendeliome v0.8975 IGFALS Zornitza Stark Publications for gene: IGFALS were set to
Repeat Disorders v0.99 DBQD2 Bryony Thompson Marked STR: DBQD2 as ready
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.99 DBQD2 Bryony Thompson Classified STR: DBQD2 as Green List (high evidence)
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.98 DBQD2 Bryony Thompson STR: DBQD2 was added
STR: DBQD2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DBQD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: DBQD2 were set to 30554721
Phenotypes for STR: DBQD2 were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: DBQD2 was set to GREEN
STR: DBQD2 was marked as clinically relevant
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Expert list
Mendeliome v0.8974 IGFALS Zornitza Stark Mode of inheritance for gene: IGFALS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8973 IGFALS Zornitza Stark reviewed gene: IGFALS: Rating: GREEN; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.338 IGFALS Zornitza Stark Marked gene: IGFALS as ready
Growth failure v0.338 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Growth failure v0.338 IGFALS Zornitza Stark Phenotypes for gene: IGFALS were changed from very low IGF-I levels; Short stature; delayed puberty to Acid-labile subunit, deficiency of, MIM# 615961
Growth failure v0.337 IGFALS Zornitza Stark Publications for gene: IGFALS were set to 14762184
Growth failure v0.336 IGFALS Zornitza Stark Classified gene: IGFALS as Green List (high evidence)
Growth failure v0.336 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Growth failure v0.335 IGFALS Zornitza Stark edited their review of gene: IGFALS: Changed rating: GREEN
Growth failure v0.335 IGFALS Zornitza Stark reviewed gene: IGFALS: Rating: ; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.335 IFT172 Zornitza Stark Marked gene: IFT172 as ready
Growth failure v0.335 IFT172 Zornitza Stark Gene: ift172 has been classified as Red List (Low Evidence).
Growth failure v0.335 IFT172 Zornitza Stark reviewed gene: IFT172: Rating: RED; Mode of pathogenicity: None; Publications: 25664603; Phenotypes: GH deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.335 SAMD9 Zornitza Stark Marked gene: SAMD9 as ready
Growth failure v0.335 SAMD9 Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence).
Growth failure v0.335 SAMD9 Zornitza Stark Classified gene: SAMD9 as Green List (high evidence)
Growth failure v0.335 SAMD9 Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence).
Growth failure v0.334 SAMD9 Zornitza Stark reviewed gene: SAMD9: Rating: GREEN; Mode of pathogenicity: None; Publications: 27182967; Phenotypes: MIRAGE syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Repeat Disorders v0.97 FAME7 Bryony Thompson Marked STR: FAME7 as ready
Repeat Disorders v0.97 FAME7 Bryony Thompson Str: fame7 has been classified as Red List (Low Evidence).
Repeat Disorders v0.97 FAME7 Bryony Thompson STR: FAME7 was added
STR: FAME7 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME7 were set to 29507423
Phenotypes for STR: FAME7 were set to Epilepsy, familial adult myoclonic, 7 MIM#618075
Review for STR: FAME7 was set to RED
Added comment: The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Repeat Disorders v0.96 FAME6 Bryony Thompson Marked STR: FAME6 as ready
Repeat Disorders v0.96 FAME6 Bryony Thompson Str: fame6 has been classified as Red List (Low Evidence).
Repeat Disorders v0.96 FAME6 Bryony Thompson STR: FAME6 was added
STR: FAME6 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME6 were set to 29507423
Phenotypes for STR: FAME6 were set to Epilepsy, familial adult myoclonic, 6 MIM#618074
Review for STR: FAME6 was set to RED
Added comment: The expanded (TTTTA)22(TTTCA)exp(TTTTA)exp allele was identified 5 affected carriers in a single family. (TTTTA)18 is the reference repeats. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Incidentalome v0.78 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Incidentalome v0.78 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Incidentalome v0.78 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Incidentalome v0.78 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Incidentalome v0.77 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Incidentalome. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Incidentalome v0.76 C9orf72 Bryony Thompson Classified gene: C9orf72 as No list
Incidentalome v0.76 C9orf72 Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FTDALS
Incidentalome v0.76 C9orf72 Bryony Thompson Gene: c9orf72 has been removed from the panel.
Mendeliome v0.8973 FAME1 Bryony Thompson Marked STR: FAME1 as ready
Mendeliome v0.8973 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Mendeliome v0.8973 FAME1 Bryony Thompson Classified STR: FAME1 as Green List (high evidence)
Mendeliome v0.8973 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Mendeliome v0.8972 FAME1 Bryony Thompson STR: FAME1 was added
STR: FAME1 was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for STR: FAME1 were set to 30194086; 29507423
Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068
Review for STR: FAME1 was set to GREEN
STR: FAME1 was marked as clinically relevant
Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Mendeliome v0.8971 SAMD12 Bryony Thompson Classified gene: SAMD12 as No list
Mendeliome v0.8971 SAMD12 Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FAME1.
Mendeliome v0.8971 SAMD12 Bryony Thompson Gene: samd12 has been removed from the panel.
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Classified gene: SAMD12 as No list
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel.
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Gene: samd12 has been removed from the panel.
Repeat Disorders v0.95 FAME1 Bryony Thompson changed review comment from: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list; to: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Repeat Disorders v0.95 FAME1 Bryony Thompson Marked STR: FAME1 as ready
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.95 FAME1 Bryony Thompson Classified STR: FAME1 as Green List (high evidence)
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.94 FAME1 Bryony Thompson STR: FAME1 was added
STR: FAME1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for STR: FAME1 were set to 30194086; 29507423
Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068
Review for STR: FAME1 was set to GREEN
STR: FAME1 was marked as clinically relevant
Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Growth failure v0.334 HESX1 Zornitza Stark Marked gene: HESX1 as ready
Growth failure v0.334 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Growth failure v0.334 HESX1 Zornitza Stark Phenotypes for gene: HESX1 were changed from Septo-optic dysplasia; variable involvement of pituitary hormones to Septooptic dysplasia, MIM# 182230; Growth hormone deficiency with pituitary anomalies, MIM#182230
Growth failure v0.333 HESX1 Zornitza Stark Publications for gene: HESX1 were set to
Growth failure v0.332 HESX1 Zornitza Stark Classified gene: HESX1 as Green List (high evidence)
Growth failure v0.332 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Growth failure v0.331 HESX1 Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14561704, 26781211, 11136712, 16940453; Phenotypes: Septooptic dysplasia, MIM# 182230, Growth hormone deficiency with pituitary anomalies, MIM#182230; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.331 H19 Zornitza Stark Marked gene: H19 as ready
Growth failure v0.331 H19 Zornitza Stark Gene: h19 has been classified as Red List (Low Evidence).
Growth failure v0.331 H19 Zornitza Stark Phenotypes for gene: H19 were changed from Russell-Silver syndrome to Silver-Russell syndrome, MIM# 180860
Growth failure v0.330 H19 Zornitza Stark Mode of inheritance for gene: H19 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Growth failure v0.329 H19 Zornitza Stark reviewed gene: H19: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Silver-Russell syndrome, MIM# 180860; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Growth failure v0.329 GPR161 Zornitza Stark Marked gene: GPR161 as ready
Growth failure v0.329 GPR161 Zornitza Stark Gene: gpr161 has been classified as Red List (Low Evidence).
Growth failure v0.329 GPR161 Zornitza Stark Phenotypes for gene: GPR161 were changed from Short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk to Pituitary stalk interruption syndrome
Growth failure v0.328 GPR161 Zornitza Stark changed review comment from: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk.; to: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyly. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk.
Growth failure v0.328 GPR161 Zornitza Stark reviewed gene: GPR161: Rating: RED; Mode of pathogenicity: None; Publications: 25322266; Phenotypes: Pituitary stalk interruption syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.319 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Callosome v0.319 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Callosome v0.318 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Callosome v0.317 Bryony Thompson removed STR:DAB1 from the panel
Callosome v0.316 SCA10 Bryony Thompson Marked STR: SCA10 as ready
Callosome v0.316 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Callosome v0.316 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Callosome v0.316 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Callosome v0.315 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354; 11017075
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
Review for STR: SCA10 was set to GREEN
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Callosome v0.314 ATXN10 Bryony Thompson Classified gene: ATXN10 as No list
Callosome v0.314 ATXN10 Bryony Thompson Added comment: Comment on list classification: STR is the only reported cause of disease. Added as an STR to the panel.
Callosome v0.314 ATXN10 Bryony Thompson Gene: atxn10 has been removed from the panel.
Repeat Disorders v0.93 SPD1 Bryony Thompson Marked STR: SPD1 as ready
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.93 SPD1 Bryony Thompson Classified STR: SPD1 as Green List (high evidence)
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.92 SPD1 Bryony Thompson STR: SPD1 was added
STR: SPD1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SPD1 were set to 8817328; 33811808; 33533119
Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000
Review for STR: SPD1 was set to GREEN
STR: SPD1 was marked as clinically relevant
Added comment: NM_000523.4(HOXD13):c.212_213GCG[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
Normal repeat number: 15
Pathogenic repeat number: 24
Truncation of repeat also reported
Sources: Expert list
Repeat Disorders v0.91 Bryony Thompson removed STR:SPD1 from the panel
Callosome v0.313 DAB1 Bryony Thompson Marked STR: DAB1 as ready
Callosome v0.313 DAB1 Bryony Thompson Str: dab1 has been classified as Green List (High Evidence).
Callosome v0.313 DAB1 Bryony Thompson Classified STR: DAB1 as Green List (high evidence)
Callosome v0.313 DAB1 Bryony Thompson Str: dab1 has been classified as Green List (High Evidence).
Callosome v0.312 DAB1 Bryony Thompson STR: DAB1 was added
STR: DAB1 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: DAB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DAB1 were set to 28686858; 31145571
Phenotypes for STR: DAB1 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: DAB1 was set to GREEN
STR: DAB1 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Repeat Disorders v0.90 SCA37 Bryony Thompson Marked STR: SCA37 as ready
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.90 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.89 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Callosome v0.311 DAB1 Bryony Thompson Classified gene: DAB1 as No list
Callosome v0.311 DAB1 Bryony Thompson Added comment: Comment on list classification: STR expansion is the mechanism of disease for this gene. It has been added as an STR to this panel.
Callosome v0.311 DAB1 Bryony Thompson Gene: dab1 has been removed from the panel.
Repeat Disorders v0.88 XDP Bryony Thompson changed review comment from: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list; to: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within intron 32. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Dystonia - isolated/combined v1.8 TAF1 Bryony Thompson Mode of inheritance for gene: TAF1 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Dystonia - isolated/combined v1.7 TAF1 Bryony Thompson Classified gene: TAF1 as No list
Dystonia - isolated/combined v1.7 TAF1 Bryony Thompson Added comment: Comment on list classification: Added as an STR to the panel
Dystonia - isolated/combined v1.7 TAF1 Bryony Thompson Gene: taf1 has been removed from the panel.
Dystonia - isolated/combined v1.6 XDP Bryony Thompson Marked STR: XDP as ready
Dystonia - isolated/combined v1.6 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Dystonia - isolated/combined v1.6 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Dystonia - isolated/combined v1.6 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Dystonia - isolated/combined v1.5 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Dystonia - isolated/combined. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Repeat Disorders v0.88 XDP Bryony Thompson Marked STR: XDP as ready
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Classified gene: TAF1 as No list
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Added comment: Comment on list classification: Added as an STR to the panel
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Gene: taf1 has been removed from the panel.
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Marked STR: XDP as ready
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.115 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Early-onset Parkinson disease. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Growth failure v0.328 GLI3 Zornitza Stark Marked gene: GLI3 as ready
Growth failure v0.328 GLI3 Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence).
Growth failure v0.328 GLI3 Zornitza Stark Phenotypes for gene: GLI3 were changed from Pallister-Hall syndrome to Pallister-Hall syndrome, MIM# 146510
Growth failure v0.327 GLI3 Zornitza Stark Publications for gene: GLI3 were set to 9054938
Growth failure v0.326 GLI3 Zornitza Stark Classified gene: GLI3 as Green List (high evidence)
Growth failure v0.326 GLI3 Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence).
Growth failure v0.325 GLI3 Zornitza Stark reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9054938, 10945658, 11693785; Phenotypes: Pallister-Hall syndrome, MIM# 146510; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.325 TRIM37 Zornitza Stark Marked gene: TRIM37 as ready
Growth failure v0.325 TRIM37 Zornitza Stark Gene: trim37 has been classified as Green List (High Evidence).
Growth failure v0.325 TRIM37 Zornitza Stark Phenotypes for gene: TRIM37 were changed from Mulibrey nanism; Mulibery Nanism, 253250 to Mulibery nanism, MIM#253250
Growth failure v0.324 TRIM37 Zornitza Stark Publications for gene: TRIM37 were set to
Repeat Disorders v0.88 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Repeat Disorders v0.87 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Repeat Disorders. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Marked STR: FECD3 as ready
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Classified STR: FECD3 as Green List (high evidence)
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Corneal Dystrophy v1.4 FECD3 Bryony Thompson STR: FECD3 was added
STR: FECD3 was added to Corneal Dystrophy. Sources: Expert list
Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FECD3 were set to 25722209; 24255041
Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267
Review for STR: FECD3 was set to GREEN
STR: FECD3 was marked as clinically relevant
Added comment: NG_011716.2:g.54765TGC[X]
Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance.
Normal: 5-31 repeats
Pathogenic: >50 repeats
Sources: Expert list
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Classified gene: TCF4 as No list
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel.
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Gene: tcf4 has been removed from the panel.
Repeat Disorders v0.86 FECD3 Bryony Thompson Marked STR: FECD3 as ready
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.86 FECD3 Bryony Thompson Classified STR: FECD3 as Green List (high evidence)
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.85 FECD3 Bryony Thompson STR: FECD3 was added
STR: FECD3 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FECD3 were set to 25722209; 24255041
Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267
Review for STR: FECD3 was set to GREEN
STR: FECD3 was marked as clinically relevant
Added comment: NG_011716.2:g.54765TGC[X]
Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance.
Normal: 5-31 repeats
Pathogenic: >50 repeats
Sources: Expert list
Dystonia - complex v0.192 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Dystonia - complex v0.192 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Dystonia - complex v0.192 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Dystonia - complex v0.192 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Dystonia - complex v0.191 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 26166205; 24363131; 26187722; 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Dystonia - complex v0.190 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.113 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778; 31779815
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Parkinson disease v0.112 Bryony Thompson removed STR:C9orf72 from the panel
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.129 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Motor Neurone Disease. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.139 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.128 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Dementia v0.139 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Dementia v0.138 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.137 Bryony Thompson removed STR:C9orf72 from the panel
Repeat Disorders v0.84 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.84 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.83 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Repeat Disorders v0.82 SCA12 Bryony Thompson Publications for STR: SCA12 were set to 27864267; 33811808
Repeat Disorders v0.81 SCA12 Bryony Thompson edited their review of STR: SCA12: Changed publications: 27864267, 33811808, 10581021
Repeat Disorders v0.81 SCA8 Bryony Thompson Publications for STR: SCA8 were set to 20301445
Repeat Disorders v0.80 SCA8 Bryony Thompson edited their review of STR: SCA8: Changed publications: 20301445, 10192387
Repeat Disorders v0.80 FXPOI Bryony Thompson Publications for STR: FXPOI were set to 20301558
Repeat Disorders v0.79 FXPOI Bryony Thompson edited their review of STR: FXPOI: Changed publications: 20301558, 9647544
Repeat Disorders v0.79 EPM1 Bryony Thompson Publications for STR: EPM1 were set to 29325606; 20301321
Repeat Disorders v0.78 EPM1 Bryony Thompson edited their review of STR: EPM1: Changed publications: 29325606, 20301321, 9126745
Repeat Disorders v0.78 FRDA Bryony Thompson Publications for STR: FRDA were set to 20301458
Repeat Disorders v0.77 FRDA Bryony Thompson edited their review of STR: FRDA: Changed publications: 20301458, 8596916
Repeat Disorders v0.77 DM1 Bryony Thompson Publications for STR: DM1 were set to 20301344; 29325606
Repeat Disorders v0.76 DM1 Bryony Thompson edited their review of STR: DM1: Changed publications: 20301344, 29325606, 1546325
Repeat Disorders v0.76 FXS Bryony Thompson Publications for STR: FXS were set to 33795824; 25227148
Repeat Disorders v0.75 FXS Bryony Thompson edited their review of STR: FXS: Changed publications: 33795824, 25227148, 1710175, 2031184
Mendeliome v0.8970 SCA36 Bryony Thompson Publications for STR: SCA36 were set to 25101480
Mendeliome v0.8969 SCA36 Bryony Thompson edited their review of STR: SCA36: Changed publications: 21683323
Repeat Disorders v0.75 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.75 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.74 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Ataxia - adult onset v0.141 SCA36 Bryony Thompson Publications for STR: SCA36 were set to 25101480
Ataxia - adult onset v0.140 SCA36 Bryony Thompson edited their review of STR: SCA36: Changed publications: 21683323
Early-onset Parkinson disease v0.111 PSAP Zornitza Stark Phenotypes for gene: PSAP were changed from Parkinson Disease, AD to Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491
Early-onset Parkinson disease v0.110 PSAP Zornitza Stark reviewed gene: PSAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491; Mode of inheritance: None
Mirror movements v0.0 Bryony Thompson Added Panel Osteoporosis
Set panel types to: Royal Melbourne Hospital; Rare Disease
Mendeliome v0.8969 MYO1H Zornitza Stark Marked gene: MYO1H as ready
Mendeliome v0.8969 MYO1H Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence).
Mendeliome v0.8969 MYO1H Zornitza Stark gene: MYO1H was added
gene: MYO1H was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO1H were set to 28779001
Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482
Review for gene: MYO1H was set to RED
Added comment: Single family reported with three affected children, homozygous LoF variant.
Sources: Literature
Central Hypoventilation v1.1 MYO1H Zornitza Stark Marked gene: MYO1H as ready
Central Hypoventilation v1.1 MYO1H Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence).
Central Hypoventilation v1.1 MYO1H Zornitza Stark gene: MYO1H was added
gene: MYO1H was added to Central Hypoventilation. Sources: Literature
Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO1H were set to 28779001
Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482
Review for gene: MYO1H was set to RED
Added comment: Single family reported with three affected children, homozygous LoF variant.
Sources: Literature
Repeat Disorders v0.73 SCA31 Bryony Thompson Marked STR: SCA31 as ready
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.73 SCA31 Bryony Thompson Classified STR: SCA31 as Green List (high evidence)
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.72 SCA31 Bryony Thompson STR: SCA31 was added
STR: SCA31 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA31 were set to 19878914; 31755042
Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210
Review for STR: SCA31 was set to GREEN
STR: SCA31 was marked as clinically relevant
Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested.
2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease
Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042)
Sources: Expert list
Repeat Disorders v0.71 FXTAS Bryony Thompson Marked STR: FXTAS as ready
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.71 FXTAS Bryony Thompson Classified STR: FXTAS as Green List (high evidence)
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.70 FXTAS Bryony Thompson STR: FXTAS was added
STR: FXTAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXTAS were set to 23765048; 25227148; 11445641
Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623
Review for STR: FXTAS was set to GREEN
STR: FXTAS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Expert list
Repeat Disorders v0.69 DM2 Bryony Thompson Marked STR: DM2 as ready
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.69 DM2 Bryony Thompson Classified STR: DM2 as Green List (high evidence)
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.68 DM2 Bryony Thompson STR: DM2 was added
STR: DM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM2 were set to 20301639; 11486088
Phenotypes for STR: DM2 were set to Myotonic dystrophy 2 MIM#602668
Review for STR: DM2 was set to GREEN
STR: DM2 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X]
Toxic gain of function RNA expected mechanism of disease
Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions
Unknown significance (normal vs. mutable): 27-29 CCTG repeats
Mutable normal (premutation) alleles. ~30-~54 CCTG repeats
Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats
Pathogenic: ~75-11,000 CCTG repeats
Sources: Expert list
Repeat Disorders v0.67 SCA10 Bryony Thompson Marked STR: SCA10 as ready
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.67 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.66 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354; 11017075
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
Review for STR: SCA10 was set to GREEN
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Marked gene: FBXW7 as ready
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Phenotypes for gene: FBXW7 were changed from to Predisposition to cancer
Cancer Predisposition_Paediatric v0.109 FBXW7 Zornitza Stark Classified gene: FBXW7 as Green List (high evidence)
Cancer Predisposition_Paediatric v0.109 FBXW7 Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Marked gene: BLM as ready
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies
Cancer Predisposition_Paediatric v0.107 BLM Zornitza Stark Publications for gene: BLM were set to
Cancer Predisposition_Paediatric v0.106 BLM Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cancer Predisposition_Paediatric v0.105 BLM Zornitza Stark reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8968 BLM Zornitza Stark Marked gene: BLM as ready
Mendeliome v0.8968 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Mendeliome v0.8968 BLM Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies
Mendeliome v0.8967 BLM Zornitza Stark Publications for gene: BLM were set to
Mendeliome v0.8966 BLM Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency (absent T absent B cells) v1.1 Zornitza Stark Panel types changed to Melbourne Genomics; Victorian Clinical Genetics Services; Rare Disease
Severe Combined Immunodeficiency (absent T absent B cells) v1.0 Zornitza Stark promoted panel to version 1.0
Mendeliome v0.8965 PRKDC Zornitza Stark Marked gene: PRKDC as ready
Mendeliome v0.8965 PRKDC Zornitza Stark Gene: prkdc has been classified as Green List (High Evidence).
Mendeliome v0.8965 PRKDC Zornitza Stark Phenotypes for gene: PRKDC were changed from to Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966; Absent T and B cells; normal NK cells; SCID; recurrent respiratory infections; microcephaly; seizures; developmental delay
Mendeliome v0.8964 PRKDC Zornitza Stark Publications for gene: PRKDC were set to
Mendeliome v0.8963 PRKDC Zornitza Stark Mode of inheritance for gene: PRKDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8962 PRKDC Zornitza Stark reviewed gene: PRKDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 19075392, 23722905; Phenotypes: Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966, Absent T and B cells, normal NK cells, SCID, recurrent respiratory infections, microcephaly, seizures, developmental delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency (absent T absent B cells) v0.36 PRKDC Zornitza Stark Marked gene: PRKDC as ready
Severe Combined Immunodeficiency (absent T absent B cells) v0.36 PRKDC Zornitza Stark Gene: prkdc has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency (absent T absent B cells) v0.36 PRKDC Zornitza Stark Phenotypes for gene: PRKDC were changed from to Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966; Absent T and B cells; normal NK cells; SCID; recurrent respiratory infections; microcephaly; seizures; developmental delay
Severe Combined Immunodeficiency (absent T absent B cells) v0.35 PRKDC Zornitza Stark Publications for gene: PRKDC were set to
Severe Combined Immunodeficiency (absent T absent B cells) v0.34 PRKDC Zornitza Stark Mode of inheritance for gene: PRKDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency (absent T absent B cells) v0.33 LIG4 Zornitza Stark Marked gene: LIG4 as ready
Severe Combined Immunodeficiency (absent T absent B cells) v0.33 LIG4 Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency (absent T absent B cells) v0.33 LIG4 Zornitza Stark Phenotypes for gene: LIG4 were changed from to LIG4 syndrome MIM# 606593; T-/B-lymphocytopaenia; Normal NK, radiation sensitivity; Microcephaly; absent/low B and T cells; low Ig; raised IgM; failure to thrive; bacterial/viral/fungal infections; hypogammaglobulinaemia; neurodevelopmental delay; microcephaly; pancytopaenia
Severe Combined Immunodeficiency (absent T absent B cells) v0.32 LIG4 Zornitza Stark Publications for gene: LIG4 were set to
Severe Combined Immunodeficiency (absent T absent B cells) v0.31 LIG4 Zornitza Stark Mode of inheritance for gene: LIG4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency (absent T absent B cells) v0.30 DCLRE1C Zornitza Stark Marked gene: DCLRE1C as ready
Severe Combined Immunodeficiency (absent T absent B cells) v0.30 DCLRE1C Zornitza Stark Gene: dclre1c has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency (absent T absent B cells) v0.30 DCLRE1C Zornitza Stark Phenotypes for gene: DCLRE1C were changed from to Severe combined immunodeficiency, Athabascan type MIM# 602450; Absent/reduced T and B cells; decreased Ig levels; Normal NK cell number; increased risk of graft rejection possibly due to activated NK cells; radiation sensitivity; failure to thrive; recurrent respiratory infections; diarrhoea; fever; hypogammmaglobulinaemia
Severe Combined Immunodeficiency (absent T absent B cells) v0.29 DCLRE1C Zornitza Stark Publications for gene: DCLRE1C were set to
Severe Combined Immunodeficiency (absent T absent B cells) v0.28 DCLRE1C Zornitza Stark Mode of inheritance for gene: DCLRE1C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v1.0 Zornitza Stark promoted panel to version 1.0
Combined Immunodeficiency v0.394 WAS Zornitza Stark Marked gene: WAS as ready
Combined Immunodeficiency v0.394 WAS Zornitza Stark Gene: was has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.394 WAS Zornitza Stark Phenotypes for gene: WAS were changed from to Neutropaenia, severe congenital, X-linked MIM# 300299; Wiskott-Aldrich syndrome MIM# 301000; Thrombocytopaenia, X-linked MIM# 313900
Combined Immunodeficiency v0.393 WAS Zornitza Stark Publications for gene: WAS were set to
Combined Immunodeficiency v0.392 WAS Zornitza Stark Mode of pathogenicity for gene: WAS was changed from to Other
Combined Immunodeficiency v0.391 WAS Zornitza Stark Mode of inheritance for gene: WAS was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8962 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Mendeliome v0.8962 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Mendeliome v0.8962 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity
Mendeliome v0.8961 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Mendeliome v0.8960 TBX1 Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8959 TBX1 Zornitza Stark Tag SV/CNV tag was added to gene: TBX1.
Mendeliome v0.8959 TBX1 Zornitza Stark reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Tag SV/CNV tag was added to gene: TBX1.
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity
Combined Immunodeficiency v0.389 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Combined Immunodeficiency v0.388 TBX1 Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8959 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Mendeliome v0.8959 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Mendeliome v0.8959 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373
Mendeliome v0.8958 RTEL1 Zornitza Stark Publications for gene: RTEL1 were set to
Mendeliome v0.8957 RTEL1 Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8956 RTEL1 Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373
Combined Immunodeficiency v0.386 RTEL1 Zornitza Stark Publications for gene: RTEL1 were set to
Combined Immunodeficiency v0.385 RTEL1 Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8956 RMRP Zornitza Stark changed review comment from: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models

Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function.
*Founder variant g.70A>G (Amish and Finnish populations)

CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency.; to: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models

Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function.
*Founder variant g.70A>G (Amish and Finnish populations)

CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency.

Anauxetic dysplasia 1, MIM# 607095 is a more severe phenotype, whereas Metaphyseal dysplasia without hypotrichosis, MIM# 250460 is milder.
Mendeliome v0.8956 RMRP Zornitza Stark edited their review of gene: RMRP: Changed publications: 16244706, 21396580, 22420014, 11940090, 16252239
Mendeliome v0.8956 RMRP Zornitza Stark edited their review of gene: RMRP: Changed phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, Anauxetic dysplasia 1, MIM# 607095, Metaphyseal dysplasia without hypotrichosis, MIM# 250460
Mendeliome v0.8956 RMRP Zornitza Stark Marked gene: RMRP as ready
Mendeliome v0.8956 RMRP Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence).
Mendeliome v0.8956 RMRP Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage-hair hypoplasia MIM#250250
Mendeliome v0.8955 RMRP Zornitza Stark Publications for gene: RMRP were set to
Mendeliome v0.8954 RMRP Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8953 RMRP Zornitza Stark reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Marked gene: RMRP as ready
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage hair hypoplasia (CHH) MIM#250250; shortened limbs; short stature; metaphysical dysplasia; fine, sparse and/or light-coloured hair; hematologic abnormalities; CID; impaired lymphocyte proliferation; low Ig levels; antibodies variably decreased; bone marrow failure; autoimmunity; susceptibility to lymphoma and other cancers; impaired spermatogenesis; neuronal dysplasia of the intestine
Combined Immunodeficiency v0.383 RMRP Zornitza Stark Publications for gene: RMRP were set to
Combined Immunodeficiency v0.382 RMRP Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8953 BLM Danielle Ariti reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency (absent T present B cells) v0.28 IL7R Danielle Ariti reviewed gene: IL7R: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843216, 19890784, 26123418, 11023514, 7964471; Phenotypes: Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type MIM# 608971, low T-cell numbers, normal-high B and NK-cell numbers, fever, rash, failure to thrive, recurrent respiratory and gastric infections, Hepatomegaly, Splenomegaly, diarrhoea, lymphadenopathy, pneumonitis, Pancytopaenia, decreased immunoglobulins; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency (absent T absent B cells) v0.27 PRKDC Danielle Ariti reviewed gene: PRKDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 19075392, 23722905; Phenotypes: Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966, Absent T and B cells, normal NK cells, SCID, recurrent respiratory infections, microcephaly, seizures, developmental delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.381 LIG4 Danielle Ariti edited their review of gene: LIG4: Changed phenotypes: LIG4 syndrome MIM# 606593, T-/B- lymphocytopaenia, Normal NK, radiation sensitivity, Microcephaly, low/ absent B and T cells, low Ig, raised IgM, failure to thrive, bacterial/viral/fungal infections, hypogammaglobulinaemia, neurodevelopmental delay, microcephaly, pancytopaenia
Severe Combined Immunodeficiency (absent T absent B cells) v0.27 LIG4 Danielle Ariti reviewed gene: LIG4: Rating: GREEN; Mode of pathogenicity: None; Publications: 27717373, 10911993; Phenotypes: LIG4 syndrome MIM# 606593, T-/B-lymphocytopaenia, Normal NK, radiation sensitivity, Microcephaly, absent/low B and T cells, low Ig, raised IgM, failure to thrive, bacterial/viral/fungal infections, hypogammaglobulinaemia, neurodevelopmental delay, microcephaly, pancytopaenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency (absent T absent B cells) v0.27 DCLRE1C Danielle Ariti reviewed gene: DCLRE1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 19953608, 15699179, 12055248, 34220820; Phenotypes: Severe combined immunodeficiency, Athabascan type MIM# 602450, Absent/reduced T and B cells, decreased Ig levels, Normal NK cell number, increased risk of graft rejection possibly due to activated NK cells, radiation sensitivity, failure to thrive, recurrent respiratory infections, diarrhoea, fever, hypogammmaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 11242109, 11047757, 29855039, 15833888, 28993958, 15577852; Phenotypes: Ectodermal dysplasia and immunodeficiency 1 MIM# 300291, Immunodeficiency 33 MIM# 300636; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti Deleted their review
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti edited their review of gene: IKBKG: Added comment: Ectodermal dysplasia with immunodeficiency
Over 12 families have been identified with IKBKG variants
Individuals typically present within the first year of life with recurrent infections (pneumonia, bacterial infections of the bone and soft tissue), elevated IgM and ectodermal dysplasia features (sparse scalp and body hair, reduced ability to sweat, and conical teeth)
------
Immunodeficiency-33 and no ectodermal dysplasia
10 unrelated individuals been reported with IKBKG variants
Characterised by early-onset severe infections, hypogammaglobulinaemia, decreased IgG and impaired antibody response to multiple vaccinations.
-------
Multiple null IKBKG mouse models demonstrating both disease phenotypes AND
Hemizygous (insertion, slice site, deletion and missense) variants have been reported in association with both diseases, causing premature stop codons; most common variants are splice-site; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.381 CD40LG Danielle Ariti changed review comment from: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome.
Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119)

Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF.

Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections.; to: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome.
Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119)

Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF.

Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections.
Combined Immunodeficiency v0.381 WAS Danielle Ariti reviewed gene: WAS: Rating: GREEN; Mode of pathogenicity: Other; Publications: 11242115, 19006568, 16804117, 8069912, 10575547, 7579329, 7795648, 23807894; Phenotypes: Neutropenia, severe congenital, X-linked MIM# 300299, Wiskott-Aldrich syndrome MIM# 301000, Thrombocytopenia, X-linked MIM# 313900; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.8953 RFX5 Zornitza Stark Marked gene: RFX5 as ready
Mendeliome v0.8953 RFX5 Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence).
Mendeliome v0.8953 RFX5 Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920
Mendeliome v0.8952 RFX5 Zornitza Stark Publications for gene: RFX5 were set to
Mendeliome v0.8951 RFX5 Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8950 RFX5 Zornitza Stark reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Marked gene: RFX5 as ready
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920
Combined Immunodeficiency v0.380 RFX5 Zornitza Stark Publications for gene: RFX5 were set to
Combined Immunodeficiency v0.379 RFX5 Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 TBX1 Danielle Ariti changed review comment from: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models

Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc).

Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients.; to: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models

Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc).

Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients.
Combined Immunodeficiency v0.378 TBX1 Danielle Ariti reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.378 RTEL1 Danielle Ariti reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RMRP Danielle Ariti reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RFX5 Danielle Ariti reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Deafness_Isolated v1.13 ELMOD3 Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal dominant; Deafness, autosomal recessive 88, MIM# 615429 to Deafness, autosomal dominant 81, MIM# 619500; Deafness, autosomal recessive 88, MIM# 615429
Deafness_Isolated v1.12 ELMOD3 Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500
Deafness_IsolatedAndComplex v1.90 ELMOD3 Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500
Deafness_IsolatedAndComplex v1.89 ELMOD3 Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500
Mendeliome v0.8950 ELMOD3 Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500
Mendeliome v0.8949 ELMOD3 Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Marked gene: TYK2 as ready
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence).
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521
Defects of intrinsic and innate immunity v0.79 TYK2 Zornitza Stark Publications for gene: TYK2 were set to
Defects of intrinsic and innate immunity v0.78 TYK2 Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Defects of intrinsic and innate immunity v0.77 TYK2 Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8949 TYK2 Zornitza Stark Marked gene: TYK2 as ready
Mendeliome v0.8949 TYK2 Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence).
Mendeliome v0.8949 TYK2 Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521
Mendeliome v0.8948 TYK2 Zornitza Stark Publications for gene: TYK2 were set to
Mendeliome v0.8947 TYK2 Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8946 TYK2 Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8946 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Mendeliome v0.8946 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Mendeliome v0.8946 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Mendeliome v0.8945 RAG1 Zornitza Stark Publications for gene: RAG1 were set to
Mendeliome v0.8944 RAG1 Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8943 RAG2 Zornitza Stark Marked gene: RAG2 as ready
Mendeliome v0.8943 RAG2 Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence).
Mendeliome v0.8943 RAG2 Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650
Mendeliome v0.8942 RAG2 Zornitza Stark Publications for gene: RAG2 were set to
Mendeliome v0.8941 RAG2 Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4089 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Intellectual disability syndromic and non-syndromic v0.4088 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Mendeliome v0.8940 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Mendeliome v0.8939 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Congenital Disorders of Glycosylation v1.17 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Congenital Disorders of Glycosylation v1.16 EDEM3 Zornitza Stark edited their review of gene: EDEM3: Changed rating: GREEN
Congenital Disorders of Glycosylation v1.16 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Mendeliome v0.8939 RAG2 Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8939 RAC2 Zornitza Stark Marked gene: RAC2 as ready
Mendeliome v0.8939 RAC2 Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence).
Mendeliome v0.8939 RAC2 Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986
Mendeliome v0.8938 RAC2 Zornitza Stark Publications for gene: RAC2 were set to
Mendeliome v0.8937 RAG1 Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8937 RAC2 Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other
Mendeliome v0.8936 RAC2 Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Marked gene: RAG2 as ready
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650
Combined Immunodeficiency v0.377 RAG2 Zornitza Stark Publications for gene: RAG2 were set to
Combined Immunodeficiency v0.376 RAG2 Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Combined Immunodeficiency v0.374 RAG1 Zornitza Stark Publications for gene: RAG1 were set to
Combined Immunodeficiency v0.373 RAG1 Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8935 RAC2 Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Marked gene: RAC2 as ready
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Publications for gene: RAC2 were set to 21167572; 10758162; 10072071; 25512081; 32542921; 31919089
Combined Immunodeficiency v0.371 RAC2 Zornitza Stark Publications for gene: RAC2 were set to
Combined Immunodeficiency v0.370 RAC2 Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other
Combined Immunodeficiency v0.369 RAC2 Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Marked gene: MTHFD1 as ready
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Gene: mthfd1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Phenotypes for gene: MTHFD1 were changed from to Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780; Decreased Ig levels; poor antibody responses to conjugated polysaccharide antigens; low B/T/NK cells; Recurrent bacterial infection; megaloblastic anaemia; failure to thrive; neutropenia; seizures; intellectual disability; folate-responsive; Lymphopaenia
Mendeliome v0.8935 MTHFD1 Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Phenotypes: 32414565, 19033438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.367 MTHFD1 Zornitza Stark Publications for gene: MTHFD1 were set to
Combined Immunodeficiency v0.366 MTHFD1 Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.366 MTHFD1 Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8935 GLI2 Zornitza Stark Marked gene: GLI2 as ready
Mendeliome v0.8935 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Mendeliome v0.8935 GLI2 Zornitza Stark Phenotypes for gene: GLI2 were changed from to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082)
Mendeliome v0.8934 GLI2 Zornitza Stark Publications for gene: GLI2 were set to
Mendeliome v0.8933 GLI2 Zornitza Stark Mode of inheritance for gene: GLI2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8932 GLI2 Zornitza Stark changed review comment from: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported, short stature is a feature as a result of GH deficiency.

Variants in GLI2 are also associated with HPE, at least 5 families reported. Short stature is observed more rarely, as a result of midline defect.; to: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported.

Variants in GLI2 are also associated with HPE, at least 5 families reported.
Mendeliome v0.8932 GLI2 Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.323 GLI2 Zornitza Stark Marked gene: GLI2 as ready
Growth failure v0.323 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Growth failure v0.323 GLI2 Zornitza Stark Phenotypes for gene: GLI2 were changed from Holoprosencephaly, hypopituitarism to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082
Growth failure v0.322 GLI2 Zornitza Stark Publications for gene: GLI2 were set to
Growth failure v0.321 GLI2 Zornitza Stark Classified gene: GLI2 as Green List (high evidence)
Growth failure v0.321 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Growth failure v0.320 GLI2 Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Marked gene: GHSR as ready
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Publications for gene: GHSR were set to 19789204; 25557026
Pituitary hormone deficiency v0.14 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Pituitary hormone deficiency v0.14 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Pituitary hormone deficiency v0.13 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8932 GHSR Zornitza Stark Marked gene: GHSR as ready
Mendeliome v0.8932 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8932 GHSR Zornitza Stark Phenotypes for gene: GHSR were changed from to Growth hormone deficiency, isolated partial, MIM# 615925
Mendeliome v0.8931 GHSR Zornitza Stark Publications for gene: GHSR were set to
Mendeliome v0.8930 GHSR Zornitza Stark Mode of inheritance for gene: GHSR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8929 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Mendeliome v0.8929 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8928 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.320 GHSR Zornitza Stark edited their review of gene: GHSR: Changed publications: 25557026, 19789204, 16511605
Growth failure v0.320 GHSR Zornitza Stark Marked gene: GHSR as ready
Growth failure v0.320 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Growth failure v0.320 GHSR Zornitza Stark Phenotypes for gene: GHSR were changed from Idiopathic short stature, GH deficiency to Growth hormone deficiency, isolated partial, MIM# 615925
Growth failure v0.319 GHSR Zornitza Stark Publications for gene: GHSR were set to 16511605
Growth failure v0.318 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Growth failure v0.318 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Growth failure v0.317 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAG2 Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAC2 Danielle Ariti changed review comment from: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis
2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies

Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function.

Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia.
--------
Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia
Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model.

They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function.

Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism.

Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID.
---------
Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia
13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models

Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R)

These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia.
-----
Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (loss of function)
Amber- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (loss of function)
Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (gain of function); to: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis
2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies

Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function.

Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia.
--------
Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia
Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model.

They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function.

Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism.

Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID.
---------
Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia
13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models

Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R)

These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia.
-----
Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (Mono-allelic; loss of function)
Red- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (Bi-allelic; loss of function)
Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (Mono-allelic; gain of function)
Intellectual disability syndromic and non-syndromic v0.4088 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4088 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4087 PDE6D Zornitza Stark changed review comment from: Two families and functional data.; to: Two families and good functional data.
Intellectual disability syndromic and non-syndromic v0.4087 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Polydactyly v0.236 PDE6D Zornitza Stark changed review comment from: Comment on publications: Second family identified; to: Comment on publications: Second family identified.
Polydactyly v0.236 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: AMBER
Polydactyly v0.236 PDE6D Zornitza Stark Deleted their comment
Mendeliome v0.8928 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed publications: 30423442, 24166846
Mendeliome v0.8928 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Mendeliome v0.8928 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Mendeliome v0.8927 PDE6D Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified in the literature.; to: Comment when marking as ready: Second family identified in the literature. Good functional data.
Mendeliome v0.8927 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Ciliopathies v1.11 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Ciliopathies v1.11 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Ciliopathies v1.10 PDE6D Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified PMID 30423442; to: Comment when marking as ready: Second family identified PMID 30423442. Good functional data.
Ciliopathies v1.10 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Mendeliome v0.8927 GHRHR Zornitza Stark Marked gene: GHRHR as ready
Mendeliome v0.8927 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Mendeliome v0.8927 GHRHR Zornitza Stark Phenotypes for gene: GHRHR were changed from to Growth hormone deficiency, isolated, type IV, MIM# 618157
Mendeliome v0.8926 GHRHR Zornitza Stark Publications for gene: GHRHR were set to
Mendeliome v0.8925 GHRHR Zornitza Stark Mode of inheritance for gene: GHRHR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8924 GHRHR Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.317 GHRHR Zornitza Stark Marked gene: GHRHR as ready
Growth failure v0.317 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Growth failure v0.317 GHRHR Zornitza Stark Phenotypes for gene: GHRHR were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IV, MIM# 618157
Growth failure v0.316 GHRHR Zornitza Stark Publications for gene: GHRHR were set to
Growth failure v0.315 GHRHR Zornitza Stark Classified gene: GHRHR as Green List (high evidence)
Growth failure v0.315 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Growth failure v0.314 GHRHR Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8924 GHR Zornitza Stark Marked gene: GHR as ready
Mendeliome v0.8924 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Mendeliome v0.8924 GHR Zornitza Stark Phenotypes for gene: GHR were changed from to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500
Mendeliome v0.8923 GHR Zornitza Stark Publications for gene: GHR were set to
Mendeliome v0.8922 GHR Zornitza Stark Mode of inheritance for gene: GHR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8921 GHR Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.314 GHR Zornitza Stark Marked gene: GHR as ready
Growth failure v0.314 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Growth failure v0.314 GHR Zornitza Stark Phenotypes for gene: GHR were changed from Laron syndrome to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500
Growth failure v0.313 GHR Zornitza Stark Publications for gene: GHR were set to
Growth failure v0.312 GHR Zornitza Stark Mode of inheritance for gene: GHR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.311 GHR Zornitza Stark Classified gene: GHR as Green List (high evidence)
Growth failure v0.311 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Growth failure v0.310 GHR Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAG1 Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAC2 Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 MTHFD1 Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32414565, 19033438; Phenotypes: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Joubert syndrome and other neurological ciliopathies v1.12 PDE6D Chirag Patel Classified gene: PDE6D as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.12 PDE6D Chirag Patel Gene: pde6d has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.11 PDE6D Chirag Patel reviewed gene: PDE6D: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24166846; Phenotypes: Joubert syndrome 22, OMIM #615665; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8921 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Mendeliome v0.8921 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Mendeliome v0.8921 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Mendeliome v0.8921 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Mendeliome v0.8920 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Hereditary Spastic Paraplegia - paediatric v1.15 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Hereditary Spastic Paraplegia - paediatric v1.14 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Dystonia - complex v0.189 RNU7-1 Zornitza Stark Marked gene: RNU7-1 as ready
Dystonia - complex v0.189 RNU7-1 Zornitza Stark Gene: rnu7-1 has been classified as Green List (High Evidence).
Dystonia - complex v0.189 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Dystonia - complex v0.188 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4087 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Intellectual disability syndromic and non-syndromic v0.4086 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Regression v0.358 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Regression v0.357 RNU7-1 Zornitza Stark edited their review of gene: RNU7-1: Changed phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487
Mendeliome v0.8919 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Mendeliome v0.8918 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Brain Calcification v1.12 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Brain Calcification v1.11 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4086 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Intellectual disability syndromic and non-syndromic v0.4085 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Regression v0.357 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Regression v0.356 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Mendeliome v0.8918 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Mendeliome v0.8917 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Brain Calcification v1.11 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Brain Calcification v1.10 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Microcephaly v1.44 WDR11 Zornitza Stark Marked gene: WDR11 as ready
Microcephaly v1.44 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Microcephaly v1.44 WDR11 Zornitza Stark Classified gene: WDR11 as Green List (high evidence)
Microcephaly v1.44 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Microcephaly v1.43 WDR11 Zornitza Stark gene: WDR11 was added
gene: WDR11 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: WDR11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR11 were set to 34413497
Phenotypes for gene: WDR11 were set to Intellectual disability; Microcephaly; Short stature
Review for gene: WDR11 was set to GREEN
Added comment: Haag et al (2021 - PMID: 34413497) report on 6 individuals from 3 unrelated families, harboring biallelic LoF WDR11 variants.

Common features included microcephaly (6/6 - range: -2.43 SD to -4.93SD) and intellectual disability (6/6, in 5 cases mild, in 1 severe) with some individuals presenting also with mild short stature.

Homozygosity or compound heterozygosity for LoF variants in affected individuals was identified following exome sequencing (fam1: NM_018117.12:c.1255C>T/p.Q419* hmz, fam2:c.3033_3036del/D1011Efs*21 in trans with c.1439del/p.N480Tfs*32, fam3:c.2931+1G>A hmz).

Segregation studies supported carrier state of parents and unaffected sibs (or homozygosity for wt allele in the latter).

Variable previous investigations incl. standard karyotype and CMA were normal in several subjects (notably index cases from each family).
-----
As the authors comment WDR11 encodes for the WD repeat domain 11 protein and has broad expression in the developing mouse CNS. Mutations in other genes encoding for WD repeat proteins have been associated with neurological, endocrine or other disorders incl. ciliopathies.

Heterozygous missense WDR11 variants are associated with hypogonadotropic hypogonadism (HH) 14 with or without anosmia (MIM #614858). [Gene2Phenotype : monoallelic, all missense/in-frame].

The authors performed extensive hormonal studies and argue that the phenotype associated with biallelic variants differs significantly from the dominantly inherited variants (HH) suggesting that biallelic variants result in a clinically distinct entity. In addition, carrier parents of the individuals reported by Haag et al had no obvious signs of congenital HH. However, there was no endocrinological examination performed.
-----
Variant effect:
Immunofluorescence studies demonstrated strong juxtanuclear WDR11 staining in control fibroblasts , but only cell-ubiquitous background labeling in patient fibroblasts (for Q419*). There was also evidence for colocalization of wt WDR11 to the trans-Golgi network (TGN) with loss of this pattern in patient fibroblasts (Q419*).

Western blot in whole cell lysates of cultured patient fibroblasts (same variant) proved loss of WDR11 irrespectively of the antibody used (against N- or C-terminal epitopes of WDR11). There was no indication of a truncated protein.
-----
Animal models:
The authors discuss previous evidence from mice/zebrafish models suggesting abnormal Hedgehog signaling in the primary cilium and impaired ciliogenesis due to loss of WDR11.

Wdr11-null mice display features of holoprosencephaly incl. microcephaly, hypotelorism, micro/anophthalmia, abnormal pituitary gland, growth retardation, heart defects, hypoplasia of reproductive organs and infertility. There was evidence of reduced length of the ciliary axoneme and reduced frequency of ciliated cells.

Knockdown of wdr11 in zebrafish led to microcephaly, aberrant head cartilage formation, microphthalmia, curved body axis, motility defects.

Overall the authors consider that the phenotype of microcephaly, variable growth delay and/or some visual/skeletal anomalies are recapitulated to some degree in animal models, although a more severe phenotype is observed in mice.

In the cohort presented by Haag et al there was no evidence of congenital heart defects, brain malformations, abnormal sexual hormone profiles or pituitary (MRI) abnormalities based on the investigations performed.
-----
The authors discuss briefly on the previously proposed role for WDR11 in endosome to trans Golgi network vesicular trafficking which might also be supported by their colocalization experiments in patient fibroblasts.
Sources: Literature
Mendeliome v0.8917 WDR11 Zornitza Stark Marked gene: WDR11 as ready
Mendeliome v0.8917 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Mendeliome v0.8917 WDR11 Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858
Mendeliome v0.8916 WDR11 Zornitza Stark Publications for gene: WDR11 were set to
Mendeliome v0.8915 WDR11 Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8914 WDR11 Zornitza Stark reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4085 WDR11 Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Microcephaly; Short stature
Intellectual disability syndromic and non-syndromic v0.4084 WDR11 Zornitza Stark Publications for gene: WDR11 were set to
Intellectual disability syndromic and non-syndromic v0.4083 WDR11 Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4082 WDR11 Zornitza Stark Classified gene: WDR11 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4082 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Mendeliome v0.8914 Bryony Thompson removed STR:SCA12 from the panel
Ataxia - adult onset v0.140 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Ataxia - adult onset v0.140 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.140 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Ataxia - adult onset v0.140 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.139 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Ataxia - adult onset. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Ataxia - adult onset v0.138 Bryony Thompson removed STR:SCA12 from the panel
Repeat Disorders v0.65 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.65 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.64 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4081 WDR11 Konstantinos Varvagiannis reviewed gene: WDR11: Rating: AMBER; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Microcephaly, Short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8913 GH1 Zornitza Stark Marked gene: GH1 as ready
Mendeliome v0.8913 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Mendeliome v0.8913 GH1 Zornitza Stark Phenotypes for gene: GH1 were changed from to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650
Mendeliome v0.8912 GH1 Zornitza Stark Publications for gene: GH1 were set to
Mendeliome v0.8911 GH1 Zornitza Stark Mode of inheritance for gene: GH1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8910 GH1 Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.310 GH1 Zornitza Stark Marked gene: GH1 as ready
Growth failure v0.310 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Growth failure v0.310 GH1 Zornitza Stark Phenotypes for gene: GH1 were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650
Growth failure v0.309 GH1 Zornitza Stark Publications for gene: GH1 were set to
Growth failure v0.308 GH1 Zornitza Stark Classified gene: GH1 as Green List (high evidence)
Growth failure v0.308 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Growth failure v0.307 GH1 Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.307 Zornitza Stark removed gene:FGFR1 from the panel
Growth failure v0.306 Zornitza Stark removed gene:FGF8 from the panel
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Monogenic Diabetes v0.22 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Monogenic Diabetes. Sources: Literature
Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHX1 were set to 34342583
Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes
Review for gene: EPHX1 was set to AMBER
Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts.
Sources: Literature
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Growth failure v0.305 Zornitza Stark removed gene:EPHX1 from the panel
Mendeliome v0.8910 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Mendeliome v0.8910 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Lipodystrophy_Lipoatrophy v1.2 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Lipodystrophy_Lipoatrophy. Sources: Literature
Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHX1 were set to 34342583
Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes
Review for gene: EPHX1 was set to AMBER
Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts.
Sources: Literature
Mendeliome v0.8910 EPHX1 Zornitza Stark Phenotypes for gene: EPHX1 were changed from to Lipoatrophic diabetes
Mendeliome v0.8909 EPHX1 Zornitza Stark Publications for gene: EPHX1 were set to
Mendeliome v0.8908 EPHX1 Zornitza Stark Mode of inheritance for gene: EPHX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8907 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Mendeliome v0.8907 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8906 EPHX1 Zornitza Stark reviewed gene: EPHX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 34342583; Phenotypes: Lipoatrophic diabetes; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.304 EP300 Zornitza Stark Marked gene: EP300 as ready
Growth failure v0.304 EP300 Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence).
Growth failure v0.304 EP300 Zornitza Stark Phenotypes for gene: EP300 were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 2, MIM# 613684; Menke-Hennekam syndrome , MIM#2 618333
Growth failure v0.303 EP300 Zornitza Stark Publications for gene: EP300 were set to
Growth failure v0.302 EP300 Zornitza Stark Classified gene: EP300 as Green List (high evidence)
Growth failure v0.302 EP300 Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence).
Growth failure v0.301 EP300 Zornitza Stark reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: 29506490, 29460469; Phenotypes: Rubinstein-Taybi syndrome 2, MIM# 613684, Menke-Hennekam syndrome , MIM#2 618333; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.301 Zornitza Stark removed gene:COL1A1 from the panel
Growth failure v0.300 Zornitza Stark removed gene:DOK7 from the panel
Growth failure v0.299 DHCR7 Zornitza Stark Marked gene: DHCR7 as ready
Growth failure v0.299 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Growth failure v0.299 DHCR7 Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith Lemli Opitz to Smith-Lemli-Opitz syndrome, MIM#270400
Growth failure v0.298 DHCR7 Zornitza Stark Classified gene: DHCR7 as Green List (high evidence)
Growth failure v0.298 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Growth failure v0.297 DHCR7 Zornitza Stark reviewed gene: DHCR7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Smith-Lemli-Opitz syndrome, MIM#270400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.297 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Growth failure v0.297 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Growth failure v0.297 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Growth failure v0.296 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Growth failure v0.295 CREBBP Zornitza Stark Classified gene: CREBBP as Green List (high evidence)
Growth failure v0.295 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Growth failure v0.294 CREBBP Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8906 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Mendeliome v0.8906 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Mendeliome v0.8906 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Growth failure v0.294 ATRX Zornitza Stark Marked gene: ATRX as ready
Growth failure v0.294 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Growth failure v0.294 ATRX Zornitza Stark Phenotypes for gene: ATRX were changed from SGA, which is sometimes called intrauterine growth restriction (IUGR), to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580
Growth failure v0.293 ATRX Zornitza Stark Publications for gene: ATRX were set to
Growth failure v0.292 ATRX Zornitza Stark Mode of inheritance for gene: ATRX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.291 ATRX Zornitza Stark Classified gene: ATRX as Green List (high evidence)
Growth failure v0.291 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Growth failure v0.290 ATRX Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301622; Phenotypes: Alpha-thalassemia/mental retardation syndrome, MIM# 301040, Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.290 ZBTB24 Zornitza Stark Marked gene: ZBTB24 as ready
Growth failure v0.290 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Growth failure v0.290 ZBTB24 Zornitza Stark Classified gene: ZBTB24 as Green List (high evidence)
Growth failure v0.290 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Growth failure v0.289 ZBTB24 Zornitza Stark gene: ZBTB24 was added
gene: ZBTB24 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ZBTB24 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZBTB24 were set to 21596365; 21906047; 23486536
Phenotypes for gene: ZBTB24 were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 2, MIM# 614069; MONDO:0013553
Review for gene: ZBTB24 was set to GREEN
Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is characterized by facial dysmorphism, immunoglobulin deficiency resulting in recurrent infections, and intellectual disability. Laboratory studies of patient cells show hypomethylation of satellite regions of chromosomes 1, 9, and 16, as well as pericentromeric chromosomal instability in response to phytohaemagglutinin stimulation.

20 unrelated families reported. Short stature is a feature.
Sources: Expert Review
Growth failure v0.288 SPRTN Zornitza Stark Marked gene: SPRTN as ready
Growth failure v0.288 SPRTN Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence).
Growth failure v0.288 SPRTN Zornitza Stark Classified gene: SPRTN as Green List (high evidence)
Growth failure v0.288 SPRTN Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence).
Growth failure v0.287 SPRTN Zornitza Stark gene: SPRTN was added
gene: SPRTN was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: SPRTN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPRTN were set to 25261934
Phenotypes for gene: SPRTN were set to Ruijs-Aalfs syndrome, MIM# 616200; MONDO:0014527
Review for gene: SPRTN was set to GREEN
Added comment: Two families with functional evidence for a DNA repair disorder; progeroid features and hepatocellular carcinoma reported as key features, as is short stature.
Sources: Expert Review
Growth failure v0.286 RNF168 Zornitza Stark Marked gene: RNF168 as ready
Growth failure v0.286 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Growth failure v0.286 RNF168 Zornitza Stark Classified gene: RNF168 as Green List (high evidence)
Growth failure v0.286 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Growth failure v0.285 RNF168 Zornitza Stark gene: RNF168 was added
gene: RNF168 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RNF168 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF168 were set to 19203578; 21394101; 29255463; 21552324
Phenotypes for gene: RNF168 were set to RIDDLE syndrome MIM# 611943; Radiosensitivity; Immune Deficiency; Dysmorphic Features; Learning difficulties; Low IgG or IgA; Short stature; mild defect of motor control to ataxia; normal intelligence to learning difficulties; mild facial dysmorphism to microcephaly
Review for gene: RNF168 was set to GREEN
Added comment: 4 individuals from 3 unrelated families have been reported with RNF168 variants and display RIDDLE syndrome phenotype.

One mouse model; demonstrated RNF168 deficient mice are immunodeficient and exhibit increased radiosensitivity.

Homozygous and Compound heterozygous (duplications, deletions and nonsense) variants identified resulting in frameshift, aberrant protein and alteration of binding motifs.

Typically presents with increased radiosensitivity, immunodeficiency (decrease IgA), mild motor control and learning difficulties, facial dysmorphism, and short stature.
Sources: Expert Review
Growth failure v0.284 RECQL4 Zornitza Stark Marked gene: RECQL4 as ready
Growth failure v0.284 RECQL4 Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence).
Growth failure v0.284 RECQL4 Zornitza Stark Classified gene: RECQL4 as Green List (high evidence)
Growth failure v0.284 RECQL4 Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence).
Growth failure v0.283 RECQL4 Zornitza Stark gene: RECQL4 was added
gene: RECQL4 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RECQL4 were set to 10319867; 12952869; 15964893
Phenotypes for gene: RECQL4 were set to Rothmund-Thomson syndrome, type 2, MIM# 268400; RAPADILINO syndrome, MIM# 266280; Baller-Gerold syndrome, MIM# 218600
Review for gene: RECQL4 was set to GREEN
Added comment: Gene encodes DNA helicase involved in DNA repair. Bi-allelic variants associated with a range of phenotypes. Short stature is a feature of these disorders.
Sources: Expert Review
Growth failure v0.282 RAD51C Zornitza Stark Marked gene: RAD51C as ready
Growth failure v0.282 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Growth failure v0.282 RAD51C Zornitza Stark Classified gene: RAD51C as Green List (high evidence)
Growth failure v0.282 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Growth failure v0.281 RAD51C Zornitza Stark gene: RAD51C was added
gene: RAD51C was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD51C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAD51C were set to 20400963; 29278735
Phenotypes for gene: RAD51C were set to Fanconi anaemia, complementation group O, MIM# 613390
Review for gene: RAD51C was set to GREEN
Added comment: Two unrelated families reported, excellent biological candidate for FA.
Sources: Expert Review
Growth failure v0.280 RAD51 Zornitza Stark Marked gene: RAD51 as ready
Growth failure v0.280 RAD51 Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence).
Growth failure v0.280 RAD51 Zornitza Stark Classified gene: RAD51 as Green List (high evidence)
Growth failure v0.280 RAD51 Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence).
Growth failure v0.279 RAD51 Zornitza Stark gene: RAD51 was added
gene: RAD51 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAD51 were set to 26253028; 26681308; 30907510
Phenotypes for gene: RAD51 were set to Fanconi anaemia, complementation group R, MIM# 617244
Review for gene: RAD51 was set to GREEN
Added comment: Three unrelated individuals reported with de novo missense variants in this gene.
Sources: Expert Review
Growth failure v0.278 RAD50 Zornitza Stark Marked gene: RAD50 as ready
Growth failure v0.278 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Growth failure v0.278 RAD50 Zornitza Stark Classified gene: RAD50 as Green List (high evidence)
Growth failure v0.278 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Growth failure v0.277 RAD50 Zornitza Stark gene: RAD50 was added
gene: RAD50 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAD50 were set to 19409520; 32212377; 33378670
Phenotypes for gene: RAD50 were set to Nijmegen breakage syndrome-like disorder, MIM# 613078; MONDO:0013118
Review for gene: RAD50 was set to GREEN
Added comment: Three unrelated families reported, short stature is a key feature.
Sources: Expert Review
Growth failure v0.276 NHEJ1 Zornitza Stark Marked gene: NHEJ1 as ready
Growth failure v0.276 NHEJ1 Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence).
Growth failure v0.276 NHEJ1 Zornitza Stark Classified gene: NHEJ1 as Green List (high evidence)
Growth failure v0.276 NHEJ1 Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence).
Growth failure v0.275 NHEJ1 Zornitza Stark gene: NHEJ1 was added
gene: NHEJ1 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: NHEJ1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NHEJ1 were set to 16439204; 16439205
Phenotypes for gene: NHEJ1 were set to Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation, MIM# 611291; MONDO:0012650
Review for gene: NHEJ1 was set to GREEN
Added comment: More than 5 unrelated families reported, poor growth is a key feature.
Sources: Expert Review
Growth failure v0.274 MPLKIP Zornitza Stark Marked gene: MPLKIP as ready
Growth failure v0.274 MPLKIP Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence).
Growth failure v0.274 MPLKIP Zornitza Stark Classified gene: MPLKIP as Green List (high evidence)
Growth failure v0.274 MPLKIP Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence).
Growth failure v0.273 MPLKIP Zornitza Stark gene: MPLKIP was added
gene: MPLKIP was added to Growth failure in early childhood. Sources: Expert list
Mode of inheritance for gene: MPLKIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MPLKIP were set to 15645389; 16977596
Phenotypes for gene: MPLKIP were set to Trichothiodystrophy 4, nonphotosensitive, MIM# 234050; MONDO:0021013
Review for gene: MPLKIP was set to GREEN
Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections.

Gene previously known as c7orf11.

More than 5 unrelated families reported.
Sources: Expert list
Growth failure v0.272 GTF2H5 Zornitza Stark Marked gene: GTF2H5 as ready
Growth failure v0.272 GTF2H5 Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence).
Growth failure v0.272 GTF2H5 Zornitza Stark Classified gene: GTF2H5 as Green List (high evidence)
Growth failure v0.272 GTF2H5 Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence).
Growth failure v0.271 GTF2H5 Zornitza Stark gene: GTF2H5 was added
gene: GTF2H5 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: GTF2H5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF2H5 were set to 15220921; 30359777; 24986372
Phenotypes for gene: GTF2H5 were set to Trichothiodystrophy 3, photosensitive, MIM# 616395; MONDO:0014619
Review for gene: GTF2H5 was set to GREEN
Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections.

Established gene-disease association, at least 5 families reported.
Sources: Expert Review
Growth failure v0.270 ERCC5 Zornitza Stark Marked gene: ERCC5 as ready
Growth failure v0.270 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Growth failure v0.270 ERCC5 Zornitza Stark Classified gene: ERCC5 as Green List (high evidence)
Growth failure v0.270 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Growth failure v0.269 ERCC5 Zornitza Stark gene: ERCC5 was added
gene: ERCC5 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC5 were set to 7951246; 9096355; 9096355; 24700531; 33766032; 33219753
Phenotypes for gene: ERCC5 were set to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216
Review for gene: ERCC5 was set to GREEN
Added comment: Well established gene-disease association, spectrum of severity. Poor growth is a feature of COFS but is also present in some individuals with xeroderma pigmentosa.
Sources: Expert Review
Growth failure v0.268 ERCC3 Zornitza Stark Marked gene: ERCC3 as ready
Growth failure v0.268 ERCC3 Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence).
Growth failure v0.268 ERCC3 Zornitza Stark Classified gene: ERCC3 as Green List (high evidence)
Growth failure v0.268 ERCC3 Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence).
Growth failure v0.267 ERCC3 Zornitza Stark gene: ERCC3 was added
gene: ERCC3 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC3 were set to 2167179; 10447254; 16947863; 9012405; 32557569; 27004399
Phenotypes for gene: ERCC3 were set to Trichothiodystrophy 2, photosensitive, MIM# 616390; Xeroderma pigmentosum, group B 61, MIM#0651
Review for gene: ERCC3 was set to GREEN
Added comment: Nucleotide excision repair disorder, variable severity, short stature associated with both disorders.
Sources: Expert Review
Growth failure v0.266 ERCC2 Zornitza Stark Marked gene: ERCC2 as ready
Growth failure v0.266 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Growth failure v0.266 ERCC2 Zornitza Stark Classified gene: ERCC2 as Green List (high evidence)
Growth failure v0.266 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Growth failure v0.265 ERCC2 Zornitza Stark gene: ERCC2 was added
gene: ERCC2 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC2 were set to 7849702; 9758621; 11443545; 33733458
Phenotypes for gene: ERCC2 were set to Cerebrooculofacioskeletal syndrome 2, MIM# 610756; Trichothiodystrophy 1, photosensitive, MIM# 601675
Review for gene: ERCC2 was set to GREEN
Added comment: Bi-allelic inactivation of XPD protein, a nucleotide excision repair (NER) signaling pathway component encoded by ERCC2 gene, has been associated with several defective DNA repair phenotypes, of which photosensitive trichothiodystrophy and cerebro-oculo-facio-skeletal syndrome have short stature as a feature.
Sources: Expert Review
Growth failure v0.264 DNMT3B Zornitza Stark Marked gene: DNMT3B as ready
Growth failure v0.264 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Growth failure v0.264 DNMT3B Zornitza Stark Classified gene: DNMT3B as Green List (high evidence)
Growth failure v0.264 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Growth failure v0.263 DNMT3B Zornitza Stark gene: DNMT3B was added
gene: DNMT3B was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNMT3B were set to 10647011; 23486536
Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1, MIM# 242860
Review for gene: DNMT3B was set to GREEN
Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency, and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes.

More than 20 unrelated families reported.

Short stature is a feature.
Sources: Expert Review
Growth failure v0.262 DDX11 Zornitza Stark Marked gene: DDX11 as ready
Growth failure v0.262 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Growth failure v0.262 DDX11 Zornitza Stark Classified gene: DDX11 as Green List (high evidence)
Growth failure v0.262 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Growth failure v0.261 DDX11 Zornitza Stark gene: DDX11 was added
gene: DDX11 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: DDX11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX11 were set to 20137776; 23033317; 30216658
Phenotypes for gene: DDX11 were set to Warsaw breakage syndrome, MIM# 613398; MONDO:0013252
Review for gene: DDX11 was set to GREEN
Added comment: PMID 30216658 reviews 12 individuals reported to date: severe microcephaly with prenatal onset was identified in all patients, and severe pre- and postnatal growth restriction was observed in 11 of 11 patients. All 12 patients had sensorineural hearing loss, with 10 of 10 having cochlear hypoplasia or functional abnormalities; 1 patient had a posterior labyrinthine anomaly. In all 4 patients who had brain imaging, abnormalities were identified. Some patients had other structural anomalies, including cardiac defects (5/12), recurrent infections (4/9), and skin pigmentation changes (6/12). Craniofacial features included a depressed nasal bridge with a broad nasal tip and overhanging columella. Elevated induced chromosome breakage was observed in 6 of 8 reported patients. Cohesin defects (premature chromatid separation and premature centromere division) were consistent in most metaphases among the patients examined.
Sources: Expert Review
Growth failure v0.260 BRCA1 Zornitza Stark Marked gene: BRCA1 as ready
Growth failure v0.260 BRCA1 Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence).
Growth failure v0.260 BRCA1 Zornitza Stark Classified gene: BRCA1 as Green List (high evidence)
Growth failure v0.260 BRCA1 Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence).
Growth failure v0.259 BRCA1 Zornitza Stark gene: BRCA1 was added
gene: BRCA1 was added to Growth failure in early childhood. Sources: Expert list
Mode of inheritance for gene: BRCA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRCA1 were set to 23269703; 29133208; 25472942; 29712865
Phenotypes for gene: BRCA1 were set to Fanconi anaemia, complementation group S, MIM# 617883
Review for gene: BRCA1 was set to GREEN
Added comment: At least 5 unrelated families with bi-allelic variants reported and FA phenotype. Short stature is a feature.
Sources: Expert list
Mendeliome v0.8905 ATM Zornitza Stark Phenotypes for gene: ATM were changed from to Ataxia-telangiectasia, MIM# 208900
Mendeliome v0.8904 ATM Zornitza Stark Publications for gene: ATM were set to
Mendeliome v0.8903 ATM Zornitza Stark reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: 30137827; Phenotypes: Ataxia-telangiectasia, MIM# 208900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.258 ATM Zornitza Stark Marked gene: ATM as ready
Growth failure v0.258 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Growth failure v0.258 ATM Zornitza Stark Classified gene: ATM as Green List (high evidence)
Growth failure v0.258 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Growth failure v0.257 ATM Zornitza Stark gene: ATM was added
gene: ATM was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ATM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATM were set to 30137827
Phenotypes for gene: ATM were set to Ataxia-telangiectasia, MIM# 208900
Review for gene: ATM was set to GREEN
Added comment: Well established gene-disease association.

Ataxia-telangiectasia (AT) is a chromosome breakage disorder characterized by cerebellar ataxia, telangiectases, immune defects, and a predisposition to malignancy.

Short stature is a feature.
Sources: Expert Review
Growth failure v0.256 TRAIP Zornitza Stark Marked gene: TRAIP as ready
Growth failure v0.256 TRAIP Zornitza Stark Gene: traip has been classified as Green List (High Evidence).
Growth failure v0.256 TRAIP Zornitza Stark Classified gene: TRAIP as Green List (high evidence)
Growth failure v0.256 TRAIP Zornitza Stark Gene: traip has been classified as Green List (High Evidence).
Growth failure v0.255 TRAIP Zornitza Stark gene: TRAIP was added
gene: TRAIP was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: TRAIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAIP were set to 26595769
Phenotypes for gene: TRAIP were set to Seckel syndrome 9, MIM# 616777
Review for gene: TRAIP was set to GREEN
Added comment: Three families reported, though two distantly related (founder); functional data.
Sources: Expert Review
Growth failure v0.254 RNU4ATAC Zornitza Stark Marked gene: RNU4ATAC as ready
Growth failure v0.254 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Growth failure v0.254 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from MOPD I to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Growth failure v0.253 RNU4ATAC Zornitza Stark Publications for gene: RNU4ATAC were set to 21474760
Growth failure v0.252 RNU4ATAC Zornitza Stark Classified gene: RNU4ATAC as Green List (high evidence)
Growth failure v0.252 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Growth failure v0.251 RNU4ATAC Zornitza Stark reviewed gene: RNU4ATAC: Rating: GREEN; Mode of pathogenicity: None; Publications: 23794361, 26522830, 30455926, 29265708, 12605445; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710), Roifman syndrome (MIM# 616651), Lowry-Wood syndrome, MIM# 226960; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8903 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960 to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Mendeliome v0.8902 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651) to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Mendeliome v0.8901 RNU4ATAC Zornitza Stark Publications for gene: RNU4ATAC were set to 23794361; 26522830; 30455926
Mendeliome v0.8900 RNU4ATAC Zornitza Stark edited their review of gene: RNU4ATAC: Added comment: Lowry-Wood syndrome (LWS) is characterized by multiple epiphyseal dysplasia and microcephaly. Patients exhibit intrauterine growth retardation and short stature, as well as developmental delay and intellectual disability. Retinal degeneration has been reported in some patients.

Four unrelated families reported.

Note features between the three RNU4ATAC-related conditions overlap and they may not represent distinct disorders.; Changed rating: GREEN; Changed publications: 29265708, 12605445; Changed phenotypes: Lowry-Wood syndrome, MIM# 226960; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.251 RBBP8 Zornitza Stark Marked gene: RBBP8 as ready
Growth failure v0.251 RBBP8 Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence).
Growth failure v0.251 RBBP8 Zornitza Stark Phenotypes for gene: RBBP8 were changed from seckel syndrome but with proportionate head/height impairment, cafe au lair macules to Seckel syndrome 2, MIM# 606744
Growth failure v0.250 RBBP8 Zornitza Stark Publications for gene: RBBP8 were set to 24389050, 21998596
Growth failure v0.249 RBBP8 Zornitza Stark Classified gene: RBBP8 as Amber List (moderate evidence)
Growth failure v0.249 RBBP8 Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence).
Growth failure v0.248 RBBP8 Zornitza Stark reviewed gene: RBBP8: Rating: AMBER; Mode of pathogenicity: None; Publications: 21998596, 24389050; Phenotypes: Seckel syndrome 2, MIM# 606744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.248 POLE Zornitza Stark Marked gene: POLE as ready
Growth failure v0.248 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Growth failure v0.248 POLE Zornitza Stark Classified gene: POLE as Green List (high evidence)
Growth failure v0.248 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Growth failure v0.247 POLE Zornitza Stark Tag deep intronic tag was added to gene: POLE.
Growth failure v0.247 POLE Zornitza Stark gene: POLE was added
gene: POLE was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: POLE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLE were set to 30503519; 23230001; 25948378
Phenotypes for gene: POLE were set to FILS syndrome, MIM# 615139; IMAGE-I syndrome, MIM# 618336
Review for gene: POLE was set to GREEN
Added comment: Both the FILS and IMAGE-I phenotypes have short stature as a feature, although it is more severe in IMAGE-I. Note recurrent intronic variant, c.1686+32C-G (intron 15) in IMAGE-I, found in combination with multiple other variants.
Sources: Expert Review
Growth failure v0.246 PCNT Zornitza Stark Marked gene: PCNT as ready
Growth failure v0.246 PCNT Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence).
Growth failure v0.246 PCNT Zornitza Stark Phenotypes for gene: PCNT were changed from Seckel syndrome, MOPD type II - growth restrction, microcephaly, prominent nose, micrognathia, squeaky voice, insulin resistance, 210720; MOPDII to Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720; MONDO:0008872
Growth failure v0.245 PCNT Zornitza Stark Publications for gene: PCNT were set to 18157127; 18174396
Growth failure v0.244 PCNT Zornitza Stark Classified gene: PCNT as Green List (high evidence)
Growth failure v0.244 PCNT Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence).
Growth failure v0.243 PCNT Zornitza Stark reviewed gene: PCNT: Rating: GREEN; Mode of pathogenicity: None; Publications: 18174396, 12210304, 30922925, 33460028, 32557621, 32267100; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720, MONDO:0008872; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.243 LARP7 Zornitza Stark Marked gene: LARP7 as ready
Growth failure v0.243 LARP7 Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence).
Growth failure v0.243 LARP7 Zornitza Stark Classified gene: LARP7 as Green List (high evidence)
Growth failure v0.243 LARP7 Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence).
Growth failure v0.242 LARP7 Zornitza Stark gene: LARP7 was added
gene: LARP7 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: LARP7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LARP7 were set to 22865833; 21937992; 30006060; 33569879
Phenotypes for gene: LARP7 were set to Alazami syndrome, MIM# 615071; Microcephalic primordial dwarfism, Alazami type MONDO:0014031
Review for gene: LARP7 was set to GREEN
Added comment: Alazami syndrome is an autosomal recessive disorder characterized by severe growth restriction present at birth, severely impaired intellectual development, and distinctive facial features. Five unrelated families reported.
Sources: Expert Review
Growth failure v0.241 FAM111A Zornitza Stark Marked gene: FAM111A as ready
Growth failure v0.241 FAM111A Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence).
Growth failure v0.241 FAM111A Zornitza Stark Classified gene: FAM111A as Green List (high evidence)
Growth failure v0.241 FAM111A Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence).
Growth failure v0.240 FAM111A Zornitza Stark gene: FAM111A was added
gene: FAM111A was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: FAM111A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FAM111A were set to 32996714; 23684011
Phenotypes for gene: FAM111A were set to Kenny-Caffey syndrome, type 2, MIM@ 127000
Review for gene: FAM111A was set to GREEN
Added comment: Kenny-Caffey syndrome is characterized by severe proportionate short stature, cortical thickening and medullary stenosis of the tubular bones, delayed closure of the anterior fontanel, eye abnormalities including microphthalmia/nanophthalmos, and transient hypocalcemia.

Note monoallelic variants in this gene are also associated with gracile bone dysplasia, but this is generally perinatal lethal.
Sources: Expert Review
Growth failure v0.239 DNA2 Zornitza Stark Marked gene: DNA2 as ready
Growth failure v0.239 DNA2 Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence).
Growth failure v0.239 DNA2 Zornitza Stark Phenotypes for gene: DNA2 were changed from Seckel syndrome 8, OMIM:615807 to Seckel syndrome 8, MIM:615807
Growth failure v0.238 DNA2 Zornitza Stark Classified gene: DNA2 as Green List (high evidence)
Growth failure v0.238 DNA2 Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence).
Growth failure v0.237 DNA2 Zornitza Stark reviewed gene: DNA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24389050, 31045292; Phenotypes: Seckel syndrome 8, MIM#615807; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8900 TRPS1 Zornitza Stark Marked gene: TRPS1 as ready
Mendeliome v0.8900 TRPS1 Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence).
Mendeliome v0.8900 TRPS1 Zornitza Stark Phenotypes for gene: TRPS1 were changed from to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351
Mendeliome v0.8899 TRPS1 Zornitza Stark Publications for gene: TRPS1 were set to
Mendeliome v0.8898 TRPS1 Zornitza Stark Mode of inheritance for gene: TRPS1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8897 TRPS1 Zornitza Stark reviewed gene: TRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11112658, 10615131; Phenotypes: Trichorhinophalangeal syndrome, type I, OMIM # 190350, Trichorhinophalangeal syndrome, type III, OMIM # 190351; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.237 TRPS1 Zornitza Stark Marked gene: TRPS1 as ready
Growth failure v0.237 TRPS1 Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence).
Growth failure v0.237 TRPS1 Zornitza Stark Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131
Growth failure v0.236 PUF60 Zornitza Stark Marked gene: PUF60 as ready
Growth failure v0.236 PUF60 Zornitza Stark Gene: puf60 has been classified as Green List (High Evidence).
Growth failure v0.236 PUF60 Zornitza Stark Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400
Intellectual disability syndromic and non-syndromic v0.4080 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Intellectual disability syndromic and non-syndromic v0.4079 FGD1 Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4078 FGD1 Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8897 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Mendeliome v0.8897 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Mendeliome v0.8897 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400
Mendeliome v0.8896 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Mendeliome v0.8895 FGD1 Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8894 FGD1 Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.235 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Growth failure v0.235 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Growth failure v0.235 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from Aarskog to Aarskog-Scott syndrome, MIM # 305400
Growth failure v0.234 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia de Lange syndrome 4, MIM # 614701 to Cornelia de Lange syndrome 4, MIM # 614701
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701
Intellectual disability syndromic and non-syndromic v0.4077 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Intellectual disability syndromic and non-syndromic v0.4076 RAD21 Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4075 RAD21 Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701
Hypertrichosis syndromes v0.32 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Hypertrichosis syndromes v0.31 RAD21 Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.30 RAD21 Zornitza Stark commented on gene: RAD21: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in RAD21 gene.

Deardorff et al. (2012) reported 6 patients with CdLS phenotype with heterozygous variants (4 microdeletions incl RAD21, and 2 missense variants), showing functional evidence for the missense variants.

Krab et al. (2020) reported the clinical and molecular data in 29 patients from 22 families with CDLS4 and RAD21 variants

Many other case reports.
Hypertrichosis syndromes v0.30 RAD21 Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.233 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Growth failure v0.233 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Growth failure v0.233 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia De Lange to Cornelia de Lange syndrome 4, MIM # 614701
Growth failure v0.232 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Intellectual disability syndromic and non-syndromic v0.4074 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Intellectual disability syndromic and non-syndromic v0.4073 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4072 BRD4 Zornitza Stark Classified gene: BRD4 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4072 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4071 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v1.42 BRD4 Zornitza Stark Publications for gene: BRD4 were set to 29379197; 30302754
Microcephaly v1.41 BRD4 Zornitza Stark Classified gene: BRD4 as Green List (high evidence)
Microcephaly v1.41 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Microcephaly v1.40 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8894 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Mendeliome v0.8894 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Mendeliome v0.8894 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Mendeliome v0.8893 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Mendeliome v0.8892 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8891 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Hypertrichosis syndromes v0.29 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Hypertrichosis syndromes v0.28 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.27 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.231 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Growth failure v0.231 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Growth failure v0.231 BRD4 Zornitza Stark Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299
Growth failure v0.230 TRPS1 Chirag Patel Classified gene: TRPS1 as Green List (high evidence)
Growth failure v0.230 TRPS1 Chirag Patel Gene: trps1 has been classified as Green List (High Evidence).
Growth failure v0.229 TRPS1 Chirag Patel gene: TRPS1 was added
gene: TRPS1 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: TRPS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131
Phenotypes for gene: TRPS1 were set to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351
Review for gene: TRPS1 was set to GREEN
Added comment: Trichorhinophalangeal syndrome (TRPS) is characterised by sparse, slowly growing scalp hair, laterally sparse eyebrows, bulbous tip of the nose, protruding ears, long flat philtrum, thin upper vermillion border, cone-shaped epiphyses (middle phalanges), and hip malformations (coxa plana, coxa magna, or coxa vara, degenerative arthrosis). TRPS3 differs from TRPS1 by the presence of severe brachydactyly, due to short metacarpals, and severe short stature.

Momeni et al. (2000) identified 6 different nonsense mutations in the TRPS1 gene in 10 unrelated patients. Ludecke et al. (2001) found 35 different mutations in TRPS1 in 44 unrelated patients with TRPS I or TRPS III. The detection rate (86%) indicated that TRPS1 is the major locus for both type I and type III TRPS. They found no mutation in the parents of sporadic patients or in apparently healthy relatives of familial patients, indicating complete penetrance of TRPS1 mutations.
Sources: Literature
Growth failure v0.228 PUF60 Chirag Patel Classified gene: PUF60 as Green List (high evidence)
Growth failure v0.228 PUF60 Chirag Patel Gene: puf60 has been classified as Green List (High Evidence).
Growth failure v0.227 PUF60 Chirag Patel gene: PUF60 was added
gene: PUF60 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: PUF60 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958
Phenotypes for gene: PUF60 were set to Verheij syndrome, OMIM # 615583
Review for gene: PUF60 was set to GREEN
Added comment: Verheij syndrome is characterised by growth retardation, delayed psychomotor development, dysmorphic facial features, skeletal/vertebral abnormalities, coloboma, renal defects, and cardiac defects. Over 25 patients reported in literature with deletions and SNVs involving PUF60.
Sources: Literature
Growth failure v0.226 FGD1 Chirag Patel Classified gene: FGD1 as Green List (high evidence)
Growth failure v0.226 FGD1 Chirag Patel Gene: fgd1 has been classified as Green List (High Evidence).
Growth failure v0.225 FGD1 Chirag Patel reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, OMIM # 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.225 RAD21 Chirag Patel Classified gene: RAD21 as Green List (high evidence)
Growth failure v0.225 RAD21 Chirag Patel Gene: rad21 has been classified as Green List (High Evidence).
Growth failure v0.224 RAD21 Chirag Patel reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, OMIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.224 BRD4 Chirag Patel Classified gene: BRD4 as Green List (high evidence)
Growth failure v0.224 BRD4 Chirag Patel Gene: brd4 has been classified as Green List (High Evidence).
Growth failure v0.223 BRD4 Chirag Patel gene: BRD4 was added
gene: BRD4 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: BRD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299
Phenotypes for gene: BRD4 were set to Cornelia de Lange syndrome (no OMIM# yet)
Review for gene: BRD4 was set to GREEN
Added comment: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in the BRD4 gene.

Olley et al. (2018) report 4 patients with CdLS phenotype with 4 different variants (1 deletion incl BRD4, 1 missense, and 2 frameshift). Alesi et al. (2019) reported a patient with 19p13.12p13.11 deletion including BRD4 with CdLS phenotype.

Olley et al (2021) provided further functional evidence for the previous missense variant, showing it reduces BRD4-occupancy at enhancers it does not affect transcription of the pluripotency network in mouse embryonic stem cells. Rather, it delays the cell cycle, increases DNA damage signalling, and perturbs regulation of DNA repair in mutant cells.

Houzelstein et al. (2002) showed that mice with heterozygous LOF mutations in Brd4 have marked early postnatal mortality, severe prenatal onset growth failure, abnormalities of the craniofacial skeleton and reduced body fat19; all features common in CdLS.
Sources: Literature
Cardiomyopathy_Paediatric v0.106 JPH2 Zornitza Stark Phenotypes for gene: JPH2 were changed from Cardiomyopathy, hypertrophic, MIM#613873 to Cardiomyopathy, hypertrophic, MIM#613873; Cardiomyopathy, dilated, 2E, MIM# 619492
Cardiomyopathy_Paediatric v0.105 JPH2 Zornitza Stark Publications for gene: JPH2 were set to 30681346; 17509612; 23973696; 26869393; 28393127; 30235249
Cardiomyopathy_Paediatric v0.104 JPH2 Zornitza Stark Mode of inheritance for gene: JPH2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Cardiomyopathy_Paediatric v0.103 JPH2 Zornitza Stark changed review comment from: MODERATE evidence by ClinGen working group.

Via ClinGen: Associated with hypertrophic cardiomyopathy in 16 probands in 5 publications with some functional evidence in support (expression studies, in vitro assays, animal models).

Conflicting evidence for missense variants in particular: one of the variants p.Gly505Ser is present in >500 individuals in gnomad, including 7 homozygotes, and another novel missense variant was observed in an 86-year-old man, diagnosed with hypertrophic cardiomyopathy, in whom echocardiography and cardiac magnetic resonance imaging strongly suggested amyloidosis to be the underlying cause.; to: Association with HCM: MODERATE evidence by ClinGen working group.

Via ClinGen: Associated with hypertrophic cardiomyopathy in 16 probands in 5 publications with some functional evidence in support (expression studies, in vitro assays, animal models).

Conflicting evidence for missense variants in particular: one of the variants p.Gly505Ser is present in >500 individuals in gnomad, including 7 homozygotes, and another novel missense variant was observed in an 86-year-old man, diagnosed with hypertrophic cardiomyopathy, in whom echocardiography and cardiac magnetic resonance imaging strongly suggested amyloidosis to be the underlying cause.
Cardiomyopathy_Paediatric v0.103 JPH2 Zornitza Stark edited their review of gene: JPH2: Added comment: Association with DCM: Several families with DCM and variants in this gene, plus more severe bi-allelic disease reported, animal models. Onset in infancy reported.

MODERATE by ClinGen.; Changed publications: 30681346, 17509612, 23973696, 26869393, 28393127, 30235249, 29540472, 31227780, 29165669, 27471098, 30384889, 31227780, 10949023, 23715556; Changed phenotypes: Cardiomyopathy, hypertrophic, MIM#613873, Cardiomyopathy, dilated, 2E, MIM# 619492; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8891 JPH2 Zornitza Stark Phenotypes for gene: JPH2 were changed from Cardiomyopathy, hypertrophic, MIM#613873; dilated cardiomyopathy to Cardiomyopathy, hypertrophic, MIM#613873; Cardiomyopathy, dilated, 2E, MIM# 619492
Mendeliome v0.8890 JPH2 Zornitza Stark edited their review of gene: JPH2: Changed phenotypes: Cardiomyopathy, hypertrophic, MIM#613873, Cardiomyopathy, dilated, 2E, MIM# 619492
Dilated Cardiomyopathy v1.4 JPH2 Zornitza Stark Phenotypes for gene: JPH2 were changed from dilated cardiomyopathy to Cardiomyopathy, dilated, 2E, MIM# 619492
Dilated Cardiomyopathy v1.3 JPH2 Zornitza Stark edited their review of gene: JPH2: Changed phenotypes: Cardiomyopathy, dilated, 2E, MIM# 619492
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.126 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Growth failure v0.222 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Growth failure v0.222 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Growth failure v0.222 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Growth failure v0.222 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Growth failure v0.221 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Mendeliome v0.8890 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Mendeliome v0.8890 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Mendeliome v0.8890 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Mendeliome v0.8890 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Mendeliome v0.8889 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4070 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Combined Immunodeficiency v0.365 POLD2 Zornitza Stark Marked gene: POLD2 as ready
Combined Immunodeficiency v0.365 POLD2 Zornitza Stark Gene: pold2 has been classified as Red List (Low Evidence).
Combined Immunodeficiency v0.365 PARN Zornitza Stark Marked gene: PARN as ready
Combined Immunodeficiency v0.365 PARN Zornitza Stark Gene: parn has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.365 PARN Zornitza Stark Phenotypes for gene: PARN were changed from to Dyskeratosis congenita, autosomal recessive 6, MIM# 616353
Combined Immunodeficiency v0.364 PARN Zornitza Stark Publications for gene: PARN were set to
Combined Immunodeficiency v0.363 PARN Zornitza Stark Mode of inheritance for gene: PARN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.362 PARN Zornitza Stark edited their review of gene: PARN: Changed publications: 25893599, 26342108, 25848748, 32452087
Combined Immunodeficiency v0.362 PARN Zornitza Stark reviewed gene: PARN: Rating: GREEN; Mode of pathogenicity: None; Publications: 25893599, 26342108, 25848748; Phenotypes: Dyskeratosis congenita, autosomal recessive 6, MIM# 616353; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.362 NFE2L2 Zornitza Stark Marked gene: NFE2L2 as ready
Combined Immunodeficiency v0.362 NFE2L2 Zornitza Stark Gene: nfe2l2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 MYSM1 Zornitza Stark Marked gene: MYSM1 as ready
Combined Immunodeficiency v0.362 MYSM1 Zornitza Stark Gene: mysm1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 LIG1 Zornitza Stark Marked gene: LIG1 as ready
Combined Immunodeficiency v0.362 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 KDM6A Zornitza Stark Marked gene: KDM6A as ready
Combined Immunodeficiency v0.362 KDM6A Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 FOXN1 Zornitza Stark Marked gene: FOXN1 as ready
Combined Immunodeficiency v0.362 FOXN1 Zornitza Stark Gene: foxn1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 FOXN1 Zornitza Stark Phenotypes for gene: FOXN1 were changed from to T-cell immunodeficiency, congenital alopecia, and nail dystrophy, autosomal recessive MIM# 601705; T-cell lymphopenia, infantile, with or without nail dystrophy, autosomal dominan, MIM#t 618806
Combined Immunodeficiency v0.361 MAGT1 Zornitza Stark Marked gene: MAGT1 as ready
Combined Immunodeficiency v0.361 MAGT1 Zornitza Stark Gene: magt1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.361 MAGT1 Zornitza Stark Phenotypes for gene: MAGT1 were changed from to Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia MIM# 300853; XMEN; Low CD4; inverted CD4/CD8 ratio; reduced MAIT cells; poor proliferation to CD3; decreased memory B cells; progressive hypogammaglobulinaemia; reduced NK cell; EBV infection; lymphoma; viral infections; respiratory and GI infections; Glycosylation defects
Combined Immunodeficiency v0.360 MAGT1 Zornitza Stark Publications for gene: MAGT1 were set to
Combined Immunodeficiency v0.359 MAGT1 Zornitza Stark Mode of inheritance for gene: MAGT1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.358 IKBKG Zornitza Stark Marked gene: IKBKG as ready
Combined Immunodeficiency v0.358 IKBKG Zornitza Stark Gene: ikbkg has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.358 IKBKG Zornitza Stark Phenotypes for gene: IKBKG were changed from to Ectodermal dysplasia and immunodeficiency 1 MIM# 300291; Immunodeficiency 33 MIM# 300636
Combined Immunodeficiency v0.357 IKBKG Zornitza Stark Publications for gene: IKBKG were set to
Combined Immunodeficiency v0.356 IKBKG Zornitza Stark Mode of inheritance for gene: IKBKG was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4069 NIPBL Zornitza Stark Marked gene: NIPBL as ready
Intellectual disability syndromic and non-syndromic v0.4069 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4069 NIPBL Zornitza Stark Phenotypes for gene: NIPBL were changed from to Cornelia de Lange syndrome 1, MIM # 122470
Intellectual disability syndromic and non-syndromic v0.4068 NIPBL Zornitza Stark Publications for gene: NIPBL were set to
Intellectual disability syndromic and non-syndromic v0.4067 NIPBL Zornitza Stark Mode of inheritance for gene: NIPBL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4066 NIPBL Zornitza Stark reviewed gene: NIPBL: Rating: GREEN; Mode of pathogenicity: None; Publications: 16604071, 20358602, 16236812, 17661813; Phenotypes: Cornelia de Lange syndrome 1, MIM # 122470; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.220 NIPBL Zornitza Stark Marked gene: NIPBL as ready
Growth failure v0.220 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Growth failure v0.220 NIPBL Zornitza Stark Phenotypes for gene: NIPBL were changed from Cornelia De Lange to Cornelia de Lange syndrome 1, MIM # 122470
Growth failure v0.219 NIPBL Zornitza Stark Publications for gene: NIPBL were set to
Mendeliome v0.8888 SMC1A Zornitza Stark Phenotypes for gene: SMC1A were changed from Cornelia de Lange syndrome 2, MIM# 300590 to Cornelia de Lange syndrome 2, MIM# 300590; Epileptic encephalopathy, early infantile, 85, with or without midline brain defects, MIM# 301044
Mendeliome v0.8887 SMC1A Zornitza Stark Publications for gene: SMC1A were set to 17273969; 22106055; 19701948; 26752331; 28166369
Mendeliome v0.8886 SMC1A Zornitza Stark reviewed gene: SMC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 29023665, 31409060, 31334757, 28166369; Phenotypes: Cornelia de Lange syndrome 2, MIM# 300590, Epileptic encephalopathy, early infantile, 85, with or without midline brain defects, MIM# 301044; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.218 SMC1A Zornitza Stark Marked gene: SMC1A as ready
Growth failure v0.218 SMC1A Zornitza Stark Gene: smc1a has been classified as Green List (High Evidence).
Growth failure v0.218 SMC1A Zornitza Stark Phenotypes for gene: SMC1A were changed from Developmental and epileptic encephalopathy, 85, with or without midline brain defects, MONDO:0026771; Cornelia de Lange syndrome 2, MONDO:0010370; Cornelia de Lange syndrome 2, OMIM:300590; Developmental and epileptic encephalopathy 85, with or without midline brain defects, OMIM:301044 to Cornelia de Lange syndrome 2, OMIM # 300590, MONDO:0010370
Growth failure v0.217 SMC1A Zornitza Stark Publications for gene: SMC1A were set to
Combined Immunodeficiency v0.355 MAGT1 Danielle Ariti reviewed gene: MAGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24550228, 31036665, 32451662; Phenotypes: Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia MIM# 300853, XMEN, Low CD4, inverted CD4/CD8 ratio, reduced MAIT cells, poor proliferation to CD3, decreased memory B cells, progressive hypogammaglobulinaemia, reduced NK cell, EBV infection, lymphoma, viral infections, respiratory and GI infections, Glycosylation defects; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Combined Immunodeficiency v0.355 IKBKG Danielle Ariti reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 11242109, 11047757, 29855039, 15833888, 28993958, 15577852; Phenotypes: Ectodermal dysplasia and immunodeficiency 1 MIM# 300291, Immunodeficiency 33 MIM# 300636; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.216 NIPBL Chirag Patel Classified gene: NIPBL as Green List (high evidence)
Growth failure v0.216 NIPBL Chirag Patel Gene: nipbl has been classified as Green List (High Evidence).
Growth failure v0.215 NIPBL Chirag Patel reviewed gene: NIPBL: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 16604071, 20358602, 16236812, 17661813; Phenotypes: Cornelia de Lange syndrome 1, OMIM # 122470; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.215 SMC1A Chirag Patel Classified gene: SMC1A as Green List (high evidence)
Growth failure v0.215 SMC1A Chirag Patel Gene: smc1a has been classified as Green List (High Evidence).
Growth failure v0.214 SMC1A Chirag Patel reviewed gene: SMC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 16604071, 20358602, 19842212, 24124034; Phenotypes: Cornelia de Lange syndrome 2, OMIM # 300590; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Combined Immunodeficiency v0.355 DCLRE1C Zornitza Stark Publications for gene: DCLRE1C were set to 15731174; 19953608; 15699179 12055248; 34220820
Combined Immunodeficiency v0.354 DCLRE1C Zornitza Stark Marked gene: DCLRE1C as ready
Combined Immunodeficiency v0.354 DCLRE1C Zornitza Stark Gene: dclre1c has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.354 DCLRE1C Zornitza Stark Phenotypes for gene: DCLRE1C were changed from to Severe combined immunodeficiency, Athabascan type MIM# 602450; Omenn syndrome MIM# 603554
Combined Immunodeficiency v0.353 DCLRE1C Zornitza Stark Publications for gene: DCLRE1C were set to
Combined Immunodeficiency v0.352 DCLRE1C Zornitza Stark Mode of inheritance for gene: DCLRE1C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8886 DCLRE1B Zornitza Stark Marked gene: DCLRE1B as ready
Mendeliome v0.8886 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Mendeliome v0.8886 DCLRE1B Zornitza Stark Phenotypes for gene: DCLRE1B were changed from to Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome
Mendeliome v0.8885 DCLRE1B Zornitza Stark Publications for gene: DCLRE1B were set to
Mendeliome v0.8884 DCLRE1B Zornitza Stark Classified gene: DCLRE1B as Red List (low evidence)
Mendeliome v0.8884 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Mendeliome v0.8883 DCLRE1B Zornitza Stark reviewed gene: DCLRE1B: Rating: RED; Mode of pathogenicity: None; Publications: 20479256, 21647296; Phenotypes: Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome; Mode of inheritance: Unknown
Combined Immunodeficiency v0.351 DCLRE1B Zornitza Stark Marked gene: DCLRE1B as ready
Combined Immunodeficiency v0.351 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Combined Immunodeficiency v0.351 DCLRE1B Zornitza Stark Phenotypes for gene: DCLRE1B were changed from to Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome
Combined Immunodeficiency v0.350 DCLRE1B Zornitza Stark Publications for gene: DCLRE1B were set to
Combined Immunodeficiency v0.349 DCLRE1B Zornitza Stark Classified gene: DCLRE1B as Red List (low evidence)
Combined Immunodeficiency v0.349 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Combined Immunodeficiency v0.348 ATM Zornitza Stark Marked gene: ATM as ready
Combined Immunodeficiency v0.348 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.348 ATM Zornitza Stark Phenotypes for gene: ATM were changed from to Ataxia-telangiectasia MIM# 208900; Progressive T cell decrease, poor T-cell proliferation to mitogens; low IgA, IgE and IgG; increased IgM monomers; antibodies variably decreased; Ataxia; telangiectasia especially of sclerae; pulmonary infections; lymphoreticular and other malignancies; increased alpha fetoprotein; increased radiosensitivity, chromosomal instability and chromosomal translocations
Combined Immunodeficiency v0.347 ATM Zornitza Stark Publications for gene: ATM were set to
Combined Immunodeficiency v0.346 ATM Zornitza Stark Mode of inheritance for gene: ATM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8883 TOR1AIP1 Zornitza Stark Phenotypes for gene: TOR1AIP1 were changed from Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072; Progeroid appearance; Cataracts; Microcephaly; Deafness; Contractures to Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072; Congenital myasthenic syndrome
Mendeliome v0.8882 TOR1AIP1 Zornitza Stark Publications for gene: TOR1AIP1 were set to 24856141; 31299614; 30723199; 27342937; 32055997
Mendeliome v0.8881 TOR1AIP1 Zornitza Stark edited their review of gene: TOR1AIP1: Added comment: Gene is associated with multiple muscle phenotypes as already noted. Single family myasthenic syndrome and supportive mouse model data.; Changed rating: GREEN; Changed publications: 33215087; Changed phenotypes: Congenital myasthenic syndrome; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark changed review comment from: Single family plus mouse model.; to: Single family plus mouse model. Variants in this gene also cause a range of other muscle disorders.
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark Marked gene: TOR1AIP1 as ready
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark Gene: tor1aip1 has been classified as Amber List (Moderate Evidence).
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark Phenotypes for gene: TOR1AIP1 were changed from to Congenital myasthenic syndrome
Congenital Myasthenia v1.4 TOR1AIP1 Zornitza Stark Classified gene: TOR1AIP1 as Amber List (moderate evidence)
Congenital Myasthenia v1.4 TOR1AIP1 Zornitza Stark Gene: tor1aip1 has been classified as Amber List (Moderate Evidence).
Congenital Myasthenia v1.3 TOR1AIP1 Zornitza Stark reviewed gene: TOR1AIP1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Progressive Neurological Conditions v7.82 Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Congenital Disorders of Glycosylation; Hereditary Spastic Paraplegia - paediatric; Brain Calcification; Hereditary Neuropathy_CMT - isolated; Miscellaneous Metabolic Disorders; Dystonia - isolated/combined; Hereditary Spastic Paraplegia - adult onset; Glycogen Storage Diseases; Neurotransmitter Defects; Fatty Acid Oxidation Defects; Brain Channelopathies; Lysosomal Storage Disorder; Genetic Epilepsy; Mitochondrial disease; Ataxia - paediatric; Leukodystrophy - paediatric; Dystonia - complex; Ataxia - adult onset; Early-onset Dementia; Motor Neurone Disease; Hereditary Neuropathy - complex; Myopathy - adult onset; Early-onset Parkinson disease; Leukodystrophy - adult onset; Rhabdomyolysis; Limb Girdle Muscular Dystrophy; Pain syndromes; Peroxisomal Disorders; Iron metabolism disorders; Cerebral vascular malformations; Neuroferritinopathies
Congenital Myasthenia v1.3 TOR1AIP1 Gina Ravenscroft reviewed gene: TOR1AIP1: Rating: ; Mode of pathogenicity: None; Publications: PMID: 33215087; Phenotypes: Congenital myasthenic syndrome; Mode of inheritance: None
Progressive Neurological Conditions v7.81 Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Hereditary Spastic Paraplegia - paediatric; Brain Calcification; Hereditary Neuropathy_CMT - isolated; Miscellaneous Metabolic Disorders; Dystonia - isolated/combined; Hereditary Spastic Paraplegia - adult onset; Brain Channelopathies; Genetic Epilepsy; Mitochondrial disease; Ataxia - paediatric; Leukodystrophy - paediatric; Dystonia - complex; Ataxia - adult onset; Early-onset Dementia; Motor Neurone Disease; Hereditary Neuropathy - complex; Early-onset Parkinson disease; Myopathy - adult onset; Leukodystrophy - adult onset; Limb Girdle Muscular Dystrophy; Pain syndromes; Cerebral vascular malformations
Congenital Myasthenia v1.3 TOR1AIP1 Gina Ravenscroft gene: TOR1AIP1 was added
gene: TOR1AIP1 was added to Congenital Myasthenia. Sources: Expert Review
Mode of inheritance for gene: TOR1AIP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOR1AIP1 were set to PMID: 34164833
Penetrance for gene: TOR1AIP1 were set to Complete
Combined Immunodeficiency v0.345 DCLRE1C Danielle Ariti reviewed gene: DCLRE1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 15731174, 19953608, 15699179 12055248, 34220820; Phenotypes: Severe combined immunodeficiency, Athabascan type MIM# 602450, Omenn syndrome MIM# 603554; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.345 DCLRE1C Danielle Ariti Deleted their review
Combined Immunodeficiency v0.345 DCLRE1C Danielle Ariti reviewed gene: DCLRE1C: Rating: AMBER; Mode of pathogenicity: None; Publications: 15731174, 19953608; Phenotypes: Omenn syndrome MIM# 603554, Absent B cells, normal-elevated T-cells, normal-elevated NK cells, severe combined immunodeficiency (SCID), erythrodermia, hepatosplenomegaly, lymphadenopathy, alopecia, radiosensitivity, elevated IgE, elevated eosinophilia, dermatitis, failure to thrive, recurrent respiratory infections; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.345 DCLRE1B Danielle Ariti reviewed gene: DCLRE1B: Rating: RED; Mode of pathogenicity: None; Publications: 20479256, 21647296; Phenotypes: Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome MIM# 616353; Mode of inheritance: Unknown
Combined Immunodeficiency v0.345 ATM Danielle Ariti reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301790, 27884168, 8689683; Phenotypes: Ataxia-telangiectasia MIM# 208900, Progressive T cell decrease, poor T-cell proliferation to mitogens, low IgA, IgE and IgG, increased IgM monomers, antibodies variably decreased, Ataxia, telangiectasia especially of sclerae, pulmonary infections, lymphoreticular and other malignancies, increased alpha fetoprotein, increased radiosensitivity, chromosomal instability and chromosomal translocations; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8881 PAPPA2 Zornitza Stark Marked gene: PAPPA2 as ready
Mendeliome v0.8881 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Mendeliome v0.8881 PAPPA2 Zornitza Stark Classified gene: PAPPA2 as Green List (high evidence)
Mendeliome v0.8881 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Progressive Neurological Conditions v7.80 Bryony Thompson Panel status changed from internal to public
Mendeliome v0.8880 PAPPA2 Zornitza Stark gene: PAPPA2 was added
gene: PAPPA2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: PAPPA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PAPPA2 were set to 26902202; 34272725; 32739295
Phenotypes for gene: PAPPA2 were set to Short stature, Dauber-Argente type, MIM#619489
Review for gene: PAPPA2 was set to GREEN
Added comment: Short stature of the Dauber-Argente type (SSDA) is characterized by progressive postnatal growth failure, moderate microcephaly, thin long bones, and mildly decreased bone density. Patients have elevated circulating levels of total IGF1 due to impaired proteolysis of IGFBP3 and IGFBP5, resulting in reduced free IGF1.

7 individuals from 3 unrelated families reported, mouse model.
Sources: Literature
Growth failure v0.214 PAPPA2 Zornitza Stark Marked gene: PAPPA2 as ready
Growth failure v0.214 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Growth failure v0.214 PAPPA2 Zornitza Stark Phenotypes for gene: PAPPA2 were changed from Proportionate Short Stature, High Circulating IGF-I, IGFBP-3, and ALS, Mild Microcephaly, thin Long Bones and Decreased Bone Mineral Density to Short stature, Dauber-Argente type, MIM#619489
Growth failure v0.213 PAPPA2 Zornitza Stark Publications for gene: PAPPA2 were set to 26902202
Growth failure v0.212 PAPPA2 Zornitza Stark Classified gene: PAPPA2 as Green List (high evidence)
Growth failure v0.212 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Growth failure v0.211 PAPPA2 Zornitza Stark reviewed gene: PAPPA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26902202, 34272725, 32739295; Phenotypes: Short stature, Dauber-Argente type, MIM#619489; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.19 CRIPT Zornitza Stark Marked gene: CRIPT as ready
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.19 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.19 CRIPT Zornitza Stark Phenotypes for gene: CRIPT were changed from SHORT STATURE WITH MICROCEPHALY AND DISTINCTIVE FACIES to Short stature with microcephaly and distinctive facies (MIM#615789)
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.18 CRIPT Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence)
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.18 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Growth failure v0.211 CRIPT Zornitza Stark Marked gene: CRIPT as ready
Growth failure v0.211 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Growth failure v0.211 CRIPT Zornitza Stark Phenotypes for gene: CRIPT were changed from frontal bossing, high forehead, sparse hair and eyebrows, telecanthus, mild proptosis (staring look), upturned nostrils, and hypoplastic terminal phalanges with brachydactyly to Short stature with microcephaly and distinctive facies (MIM#615789)
Growth failure v0.210 CRIPT Zornitza Stark Publications for gene: CRIPT were set to PMC3912419
Growth failure v0.209 CRIPT Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence)
Growth failure v0.209 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Growth failure v0.208 CRIPT Zornitza Stark reviewed gene: CRIPT: Rating: AMBER; Mode of pathogenicity: None; Publications: 24389050, 27250922; Phenotypes: Short stature with microcephaly and distinctive facies (MIM#615789); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.208 CEP152 Zornitza Stark Marked gene: CEP152 as ready
Growth failure v0.208 CEP152 Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence).
Growth failure v0.208 CEP152 Zornitza Stark Classified gene: CEP152 as Green List (high evidence)
Growth failure v0.208 CEP152 Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence).
Growth failure v0.207 CEP152 Zornitza Stark gene: CEP152 was added
gene: CEP152 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: CEP152 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP152 were set to 21131973
Phenotypes for gene: CEP152 were set to Seckel syndrome 5, MIM# 613823
Review for gene: CEP152 was set to GREEN
Added comment: At least three unrelated families reported. Note bi-allelic variants in this gene also cause isolated microcephaly.
Sources: Expert Review
Mendeliome v0.8879 ATR Zornitza Stark Marked gene: ATR as ready
Mendeliome v0.8879 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Mendeliome v0.8879 ATR Zornitza Stark Phenotypes for gene: ATR were changed from to Seckel syndrome 1, MIM# 210600
Mendeliome v0.8878 ATR Zornitza Stark Publications for gene: ATR were set to
Mendeliome v0.8877 ATR Zornitza Stark Mode of inheritance for gene: ATR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.206 ATR Zornitza Stark Marked gene: ATR as ready
Growth failure v0.206 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Mendeliome v0.8876 ATR Zornitza Stark reviewed gene: ATR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12640452, 19620979, 30199583, 23111928; Phenotypes: Seckel syndrome 1, MIM# 210600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.206 ATR Zornitza Stark Classified gene: ATR as Green List (high evidence)
Growth failure v0.206 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Growth failure v0.205 ATR Zornitza Stark gene: ATR was added
gene: ATR was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ATR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATR were set to 12640452; 19620979; 30199583; 23111928
Phenotypes for gene: ATR were set to Seckel syndrome 1, MIM# 210600
Review for gene: ATR was set to GREEN
Added comment: At least three unrelated families reported.
Sources: Expert Review
Growth failure v0.204 KDM6A Zornitza Stark Marked gene: KDM6A as ready
Growth failure v0.204 KDM6A Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence).
Growth failure v0.204 KDM6A Zornitza Stark Phenotypes for gene: KDM6A were changed from Kabuki to Kabuki syndrome 2, MIM# 300867
Growth failure v0.203 KDM6A Zornitza Stark Publications for gene: KDM6A were set to
Growth failure v0.202 KDM6A Zornitza Stark Classified gene: KDM6A as Green List (high evidence)
Growth failure v0.202 KDM6A Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence).
Growth failure v0.201 KDM6A Zornitza Stark reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22197486, 23076834, 24633898, 25972376; Phenotypes: Kabuki syndrome 2, MIM# 300867; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.201 MAPK1 Zornitza Stark Marked gene: MAPK1 as ready
Growth failure v0.201 MAPK1 Zornitza Stark Gene: mapk1 has been classified as Green List (High Evidence).
Growth failure v0.201 MAPK1 Zornitza Stark Classified gene: MAPK1 as Green List (high evidence)
Growth failure v0.201 MAPK1 Zornitza Stark Gene: mapk1 has been classified as Green List (High Evidence).
Growth failure v0.200 MAPK1 Zornitza Stark gene: MAPK1 was added
gene: MAPK1 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: MAPK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAPK1 were set to 32721402
Phenotypes for gene: MAPK1 were set to Noonan syndrome 13, MIM#619087
Mode of pathogenicity for gene: MAPK1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: MAPK1 was set to GREEN
Added comment: Motta et al (2020 - PMID: 32721402) report on 7 unrelated individuals harboring de novo missense MAPK1 pathogenic variants.

The phenotype corresponded to a neurodevelopmental disorder and - as the authors comment - consistently included DD, ID , behavioral problems. Postnatal growth delay was observed in approximately half. Hypertelorism, ptosis, downslant of palpebral fissures, wide nasal bridge as low-set/posteriorly rotated ears were among the facial features observed (each in 3 or more subjects within this cohort). Together with short/webbed neck and abnormalities of skin (lentigines / CAL spots) and growth delay these led to clinical suspicion of Noonan s. or disorder of the same pathway in some. Congenital heart defects (ASD, mitral valve insufficiency, though not cardiomyopathy) occurred in 4/7. Bleeding diathesis and lymphedema were reported only once.

MAPK1 encodes the mitogen-activated protein kinase 1 (also known as ERK2) a serine/threonine kinase of the RAS-RAF-MEK-(MAPK/)ERK pathway.

MAPK1 de novo variants were identified in all individuals following trio exome sequencing (and extensive previous genetic investigations which were non-diagnostic).

The distribution of variants, as well as in silico/vitro/vivo studies suggest a GoF effect (boosted signal through the MAPK cascade. MAPK signaling also upregulated in Noonan syndrome).
Sources: Expert Review
Growth failure v0.199 RRAS2 Zornitza Stark Marked gene: RRAS2 as ready
Growth failure v0.199 RRAS2 Zornitza Stark Gene: rras2 has been classified as Green List (High Evidence).
Growth failure v0.199 RRAS2 Zornitza Stark Classified gene: RRAS2 as Green List (high evidence)
Growth failure v0.199 RRAS2 Zornitza Stark Gene: rras2 has been classified as Green List (High Evidence).
Growth failure v0.198 RRAS2 Zornitza Stark gene: RRAS2 was added
gene: RRAS2 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RRAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RRAS2 were set to 31130282
Phenotypes for gene: RRAS2 were set to Noonan syndrome 12, MIM #618624
Mode of pathogenicity for gene: RRAS2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: RRAS2 was set to GREEN
Added comment: Six unrelated families reported, GoF variants.
Sources: Expert Review
Mendeliome v0.8876 SHOX Zornitza Stark Marked gene: SHOX as ready
Mendeliome v0.8876 SHOX Zornitza Stark Gene: shox has been classified as Green List (High Evidence).
Mendeliome v0.8876 SHOX Zornitza Stark Phenotypes for gene: SHOX were changed from to Langer mesomelic dysplasia, MIM# 249700; Leri-Weill dyschondrosteosis, MIM# 127300
Mendeliome v0.8875 SHOX Zornitza Stark Mode of inheritance for gene: SHOX was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8874 SHOX Zornitza Stark Tag SV/CNV tag was added to gene: SHOX.
Mendeliome v0.8874 SHOX Zornitza Stark reviewed gene: SHOX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Langer mesomelic dysplasia, MIM# 249700, Leri-Weill dyschondrosteosis, MIM# 127300; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.197 SHOX Zornitza Stark Marked gene: SHOX as ready
Growth failure v0.197 SHOX Zornitza Stark Gene: shox has been classified as Green List (High Evidence).
Growth failure v0.197 SHOX Zornitza Stark changed review comment from: Deletions common.; to: Deletions common. Pseudoautosomal region of X chromosome.
Growth failure v0.197 SHOX Zornitza Stark edited their review of gene: SHOX: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.197 SHOX Zornitza Stark Phenotypes for gene: SHOX were changed from to Langer mesomelic dysplasia, MIM# 249700; Leri-Weill dyschondrosteosis, MIM# 127300
Growth failure v0.196 SHOX Zornitza Stark Classified gene: SHOX as Green List (high evidence)
Growth failure v0.196 SHOX Zornitza Stark Gene: shox has been classified as Green List (High Evidence).
Growth failure v0.195 SHOX Zornitza Stark Tag SV/CNV tag was added to gene: SHOX.
Growth failure v0.195 SHOX Zornitza Stark reviewed gene: SHOX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Langer mesomelic dysplasia, MIM# 249700, Leri-Weill dyschondrosteosis, MIM# 127300; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.195 CENPJ Zornitza Stark Marked gene: CENPJ as ready
Growth failure v0.195 CENPJ Zornitza Stark Gene: cenpj has been classified as Red List (Low Evidence).
Growth failure v0.195 CENPJ Zornitza Stark Phenotypes for gene: CENPJ were changed from seckel syndrome to Seckel syndrome 4, MIM# 613676
Growth failure v0.194 CENPJ Zornitza Stark Publications for gene: CENPJ were set to 20522431
Growth failure v0.193 CENPJ Zornitza Stark changed review comment from: Single family reported with Seckel phenotype and supportive mouse model. However, bi-allelic variants in this gene are typically associated with microcephaly.; to: Single family reported with Seckel phenotype and supportive mouse model. However, bi-allelic variants in this gene are typically associated with microcephaly without short stature.
Growth failure v0.193 CENPJ Zornitza Stark reviewed gene: CENPJ: Rating: RED; Mode of pathogenicity: None; Publications: 20522431, 23166506; Phenotypes: Seckel syndrome 4, MIM# 613676; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8874 ORC4 Zornitza Stark Marked gene: ORC4 as ready
Mendeliome v0.8874 ORC4 Zornitza Stark Gene: orc4 has been classified as Green List (High Evidence).
Mendeliome v0.8874 ORC4 Zornitza Stark Phenotypes for gene: ORC4 were changed from to Meier-Gorlin syndrome 2, MIM# 613800
Mendeliome v0.8873 ORC4 Zornitza Stark Publications for gene: ORC4 were set to
Mendeliome v0.8872 ORC4 Zornitza Stark Mode of inheritance for gene: ORC4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8871 ORC4 Zornitza Stark reviewed gene: ORC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 21358631, 23023959, 22333897; Phenotypes: Meier-Gorlin syndrome 2, MIM# 613800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.193 ORC4 Zornitza Stark Marked gene: ORC4 as ready
Growth failure v0.193 ORC4 Zornitza Stark Gene: orc4 has been classified as Green List (High Evidence).
Growth failure v0.193 ORC4 Zornitza Stark Phenotypes for gene: ORC4 were changed from Meier-Gorlin syndrome 2, 613800; micrognathia, patellar aplasia/hypoplasia, microtia, mammary hypoplasia; Meier-Gorlin to Meier-Gorlin syndrome 2, MIM# 613800
Growth failure v0.192 ORC4 Zornitza Stark Publications for gene: ORC4 were set to 21358632
Growth failure v0.191 ORC4 Zornitza Stark Classified gene: ORC4 as Green List (high evidence)
Growth failure v0.191 ORC4 Zornitza Stark Gene: orc4 has been classified as Green List (High Evidence).
Growth failure v0.190 ORC4 Zornitza Stark reviewed gene: ORC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 21358631, 23023959, 22333897; Phenotypes: Meier-Gorlin syndrome 2, MIM# 613800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8871 ORC1 Zornitza Stark Marked gene: ORC1 as ready
Mendeliome v0.8871 ORC1 Zornitza Stark Gene: orc1 has been classified as Green List (High Evidence).
Mendeliome v0.8871 ORC1 Zornitza Stark Phenotypes for gene: ORC1 were changed from to Meier-Gorlin syndrome 1, MIM# 224690; MONDO:0009143
Mendeliome v0.8870 ORC1 Zornitza Stark Publications for gene: ORC1 were set to
Mendeliome v0.8869 ORC1 Zornitza Stark Mode of inheritance for gene: ORC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8868 ORC1 Zornitza Stark reviewed gene: ORC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358633, 21358632, 21358631, 23023959; Phenotypes: Meier-Gorlin syndrome 1, MIM# 224690, MONDO:0009143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.190 ORC1 Zornitza Stark Marked gene: ORC1 as ready
Growth failure v0.190 ORC1 Zornitza Stark Gene: orc1 has been classified as Green List (High Evidence).
Growth failure v0.190 ORC1 Zornitza Stark Phenotypes for gene: ORC1 were changed from Meier-Gorlin syndrome 1, 224690; microtia, beaked nose, patellar aplasia/hypoplasia, mammary hypoplasia, micrognathia; Meier-Gorlin to Meier-Gorlin syndrome 1, MIM# 224690; MONDO:0009143
Growth failure v0.189 ORC1 Zornitza Stark Publications for gene: ORC1 were set to 21358632
Growth failure v0.188 ORC1 Zornitza Stark Classified gene: ORC1 as Green List (high evidence)
Growth failure v0.188 ORC1 Zornitza Stark Gene: orc1 has been classified as Green List (High Evidence).
Growth failure v0.187 ORC1 Zornitza Stark reviewed gene: ORC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358633, 21358632, 21358631, 23023959; Phenotypes: Meier-Gorlin syndrome 1, MIM# 224690, MONDO:0009143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8868 ORC6 Zornitza Stark Marked gene: ORC6 as ready
Mendeliome v0.8868 ORC6 Zornitza Stark Gene: orc6 has been classified as Green List (High Evidence).
Mendeliome v0.8868 ORC6 Zornitza Stark Phenotypes for gene: ORC6 were changed from to Meier-Gorlin syndrome 3, MIM# 613803
Mendeliome v0.8867 ORC6 Zornitza Stark Publications for gene: ORC6 were set to
Mendeliome v0.8866 ORC6 Zornitza Stark Mode of inheritance for gene: ORC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8865 ORC6 Zornitza Stark reviewed gene: ORC6: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 22333897, 25691413, 26139588; Phenotypes: Meier-Gorlin syndrome 3, MIM# 613803; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.187 ORC6 Zornitza Stark Marked gene: ORC6 as ready
Growth failure v0.187 ORC6 Zornitza Stark Gene: orc6 has been classified as Green List (High Evidence).
Growth failure v0.187 ORC6 Zornitza Stark Phenotypes for gene: ORC6 were changed from Meier-Gorlin; micrognathia, patellar aplasia/hypoplasia, microtia, mammary hypoplasia; Meier-Gorlin syndrome 3, 613803 to Meier-Gorlin syndrome 3, MIM# 613803
Growth failure v0.186 ORC6 Zornitza Stark Publications for gene: ORC6 were set to 21358632
Growth failure v0.185 ORC6 Zornitza Stark Classified gene: ORC6 as Green List (high evidence)
Growth failure v0.185 ORC6 Zornitza Stark Gene: orc6 has been classified as Green List (High Evidence).
Growth failure v0.184 ORC6 Zornitza Stark reviewed gene: ORC6: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 22333897, 25691413, 26139588; Phenotypes: Meier-Gorlin syndrome 3, MIM# 613803; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.184 IGF1R Zornitza Stark Marked gene: IGF1R as ready
Growth failure v0.184 IGF1R Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence).
Growth failure v0.184 IGF1R Zornitza Stark Phenotypes for gene: IGF1R were changed from 15q-Del; Insulin likegrowthfactorI,resistanceto,270450; Insulin-Like Growth Factor I Resistance to Insulin-like growth factor I, resistance to, MIM # 270450
Growth failure v0.183 IGF1R Zornitza Stark Publications for gene: IGF1R were set to
Intellectual disability syndromic and non-syndromic v0.4066 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Intellectual disability syndromic and non-syndromic v0.4066 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4066 IGF1 Zornitza Stark Phenotypes for gene: IGF1 were changed from to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747
Intellectual disability syndromic and non-syndromic v0.4065 IGF1 Zornitza Stark Publications for gene: IGF1 were set to
Intellectual disability syndromic and non-syndromic v0.4064 IGF1 Zornitza Stark Mode of inheritance for gene: IGF1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4063 IGF1 Zornitza Stark reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8865 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Mendeliome v0.8865 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Mendeliome v0.8865 IGF1 Zornitza Stark Phenotypes for gene: IGF1 were changed from to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747
Mendeliome v0.8864 IGF1 Zornitza Stark Publications for gene: IGF1 were set to
Mendeliome v0.8863 IGF1 Zornitza Stark Mode of inheritance for gene: IGF1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8862 IGF1 Zornitza Stark reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.182 IGF1 Zornitza Stark Publications for gene: IGF1 were set to 8857020; 15769976; 14684690; 31539878; 28768959; 34125705; 22832530
Growth failure v0.181 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Growth failure v0.181 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Growth failure v0.181 IGF1 Zornitza Stark Phenotypes for gene: IGF1 were changed from Insulin-Like Growth Factor I Deficiency; Growth retardation with deafness and mental retardation due to IGF1 deficiency, 608747; IGF1 to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747
Growth failure v0.180 IGF1 Zornitza Stark Publications for gene: IGF1 were set to
Growth failure v0.179 IGF1 Zornitza Stark Mode of inheritance for gene: IGF1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Imprinting disorders v0.3 IGF2 Zornitza Stark Marked gene: IGF2 as ready
Imprinting disorders v0.3 IGF2 Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 IGF2 Zornitza Stark Phenotypes for gene: IGF2 were changed from Affected tissue: all; Phenotypes resulting from gene over expression: Beckwith-Wiedemann Syndrome (proven effects of dosage alteration rather than gene muation). Phenotype resulting from under expression: Silver-Russell Syndrome to Affected tissue: all; Phenotypes resulting from gene over expression: Beckwith-Wiedemann Syndrome (proven effects of dosage alteration rather than gene muation). Phenotype resulting from under expression: Silver-Russell syndrome 3, MIM #616489
Imprinting disorders v0.2 IGF2 Zornitza Stark Publications for gene: IGF2 were set to http://igc.otago.ac.nz/home.html; PMID: 26154720; 30794780
Imprinting disorders v0.1 IGF2 Zornitza Stark reviewed gene: IGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26154720, 31544945; Phenotypes: Silver-Russell syndrome 3, MIM #616489; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.8862 IGF2 Zornitza Stark Mode of inheritance for gene: IGF2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.8861 IGF2 Zornitza Stark changed review comment from: RSS phenotype.; to: Silver-Russell syndrome-3 (SRS3) is characterized by intrauterine growth retardation with relative macrocephaly, followed by feeding difficulties and postnatal growth restriction. Dysmorphic facial features include triangular face, prominent forehead, and low-set ears. Other variable features include limb defects, genitourinary and cardiovascular anomalies, hearing impairment, and developmental delay. Disruption of any gene in the HMGA2-PLAG1-IGF2 pathway results in a decrease in IGF2 expression and produces an SRS phenotype similar to that of patients carrying 11p15.5 epigenetic defects.

Begemann et al. (2015) performed exome sequencing in 4 affected people with severe growth restriction in one family, and identified a heterozygous nonsense mutation in the IGF2 gene that segregated fully with the disorder. Affected individuals inherited the mutation from their healthy fathers, and it originated from the healthy paternal grandmother. Clinical features occurred only in those who inherited the variant allele through paternal transmission, consistent with maternal imprinting of IGF2.

Many other cases reported since with de novo mutations in IGF2 present on the paternal allele.
Mendeliome v0.8861 IGF2 Zornitza Stark edited their review of gene: IGF2: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Growth failure v0.178 IGF2 Zornitza Stark Marked gene: IGF2 as ready
Growth failure v0.178 IGF2 Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence).
Growth failure v0.178 IGF2 Zornitza Stark Phenotypes for gene: IGF2 were changed from Pre- and post-natal growth failure; SRS; ?Growth restriction, severe, with distinctive facies, 616489; Silver-Russell phenptype; IUGR to Silver-Russell syndrome 3, MIM #616489
Growth failure v0.177 IGF2 Zornitza Stark Publications for gene: IGF2 were set to 26154720
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.17 OBSL1 Zornitza Stark Marked gene: OBSL1 as ready
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.17 OBSL1 Zornitza Stark Gene: obsl1 has been classified as Green List (High Evidence).
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.17 OBSL1 Zornitza Stark Phenotypes for gene: OBSL1 were changed from 3-M syndrome 2 612921 to 3-M syndrome 2, MIM #612921
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.16 OBSL1 Zornitza Stark Publications for gene: OBSL1 were set to
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.15 OBSL1 Zornitza Stark reviewed gene: OBSL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21737058, 19481195, 23018678, 19877176; Phenotypes: 3-M syndrome 2, MIM #612921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8861 OBSL1 Zornitza Stark Marked gene: OBSL1 as ready
Mendeliome v0.8861 OBSL1 Zornitza Stark Gene: obsl1 has been classified as Green List (High Evidence).
Mendeliome v0.8861 OBSL1 Zornitza Stark Phenotypes for gene: OBSL1 were changed from to 3-M syndrome 2, MIM #612921
Mendeliome v0.8860 OBSL1 Zornitza Stark Publications for gene: OBSL1 were set to
Mendeliome v0.8859 OBSL1 Zornitza Stark Mode of inheritance for gene: OBSL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8858 OBSL1 Zornitza Stark reviewed gene: OBSL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21737058, 19481195, 23018678, 19877176; Phenotypes: 3-M syndrome 2, MIM #612921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.176 OBSL1 Zornitza Stark Marked gene: OBSL1 as ready
Growth failure v0.176 OBSL1 Zornitza Stark Gene: obsl1 has been classified as Green List (High Evidence).
Growth failure v0.176 OBSL1 Zornitza Stark Phenotypes for gene: OBSL1 were changed from 3M; 3-M syndrome 2, 612921 to 3-M syndrome 2, MIM #612921
Growth failure v0.175 OBSL1 Zornitza Stark Publications for gene: OBSL1 were set to 21737058
Mendeliome v0.8858 PIK3R1 Zornitza Stark Marked gene: PIK3R1 as ready
Mendeliome v0.8858 PIK3R1 Zornitza Stark Gene: pik3r1 has been classified as Green List (High Evidence).
Mendeliome v0.8858 PIK3R1 Zornitza Stark Phenotypes for gene: PIK3R1 were changed from to SHORT syndrome, MIM # 269880; Immunodeficiency 36, MIM#616005
Mendeliome v0.8857 PIK3R1 Zornitza Stark Publications for gene: PIK3R1 were set to
Mendeliome v0.8856 PIK3R1 Zornitza Stark Mode of inheritance for gene: PIK3R1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8855 PIK3R1 Zornitza Stark reviewed gene: PIK3R1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23810378, 23810379, 23810382; Phenotypes: SHORT syndrome, MIM # 269880; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.174 PIK3R1 Zornitza Stark Marked gene: PIK3R1 as ready
Growth failure v0.174 PIK3R1 Zornitza Stark Gene: pik3r1 has been classified as Green List (High Evidence).
Growth failure v0.174 PIK3R1 Zornitza Stark Phenotypes for gene: PIK3R1 were changed from SHORT syndrome, 269880; SHORT to SHORT syndrome, OMIM # 269880
Growth failure v0.173 PIK3R1 Zornitza Stark Publications for gene: PIK3R1 were set to
Mendeliome v0.8855 PLAG1 Zornitza Stark Publications for gene: PLAG1 were set to 28796236; 29913240
Mendeliome v0.8854 PLAG1 Zornitza Stark Classified gene: PLAG1 as Green List (high evidence)
Mendeliome v0.8854 PLAG1 Zornitza Stark Gene: plag1 has been classified as Green List (High Evidence).
Mendeliome v0.8853 PLAG1 Zornitza Stark edited their review of gene: PLAG1: Added comment: Additional families reported, upgrade to Green.

Silver-Russell syndrome-4 (SRS4) is characterised by intrauterine growth retardation followed by feeding difficulties and postnatal growth restriction. Dysmorphic facial features include triangular face and prominent forehead, and relative macrocephaly at birth may be observed. So far 4 families have been reported with some functional studies of the role of the gene in the growth pathway.

Abi Habib et al. (2018) reported 1 family (child, sister and mother) patient with Silver-Russell syndrome (with normal methylation on chromosomes 7, 11, and 14, and exclusion of maternal UPD and chromosomal rearrangements). Using WES they identified a heterozygous 1-bp deletion in the PLAG1 gene. The variant segregated with disease, and was not present in polymorphism databases or ExAC. They also reported another patient with a different heterozygous 1-bp deletion in the PLAG1 gene. This was not found in her unaffected twin brother, older brother, or parents. Experiments in Hep3b cells demonstrated that PLAG1 positively regulates expression of the IGF2 promoter P3, independently and via the HMGA2-PLAG1-IGF2 pathway. Disruption of any gene in the pathway results in a decrease in IGF2 expression and produces an SRS phenotype similar to that of patients carrying 11p15.5 epigenetic defects (SRS1; 180860), except for body asymmetry, which is not expected to occur since the molecular defects are present in all cells of the body, unlike the mosaic epigenetic changes at the 11p15.5 locus.

Inoue et al. (2020) reported 1 family with 2 affected people with Silver-Russell syndrome with a nonsense variant in the PLAG1 gene, which segregated with disease.

Vado et al. (2020) reported 1 family with multiple affected people with Silver-Russell syndrome with a frameshift variant in the PLAG1 gene, which segregated with disease.; Changed rating: GREEN; Changed publications: 28796236, 29913240, 33291420, 32546215
Growth failure v0.172 PLAG1 Zornitza Stark Marked gene: PLAG1 as ready
Growth failure v0.172 PLAG1 Zornitza Stark Gene: plag1 has been classified as Green List (High Evidence).
Growth failure v0.172 PLAG1 Zornitza Stark Phenotypes for gene: PLAG1 were changed from SRS; Silver-Russell syndrome to Silver-Russell syndrome 4, MIM # 618907
Growth failure v0.171 PLAG1 Zornitza Stark Publications for gene: PLAG1 were set to 28796236
Growth failure v0.170 SRCAP Zornitza Stark Marked gene: SRCAP as ready
Growth failure v0.170 SRCAP Zornitza Stark Gene: srcap has been classified as Green List (High Evidence).
Growth failure v0.170 SRCAP Zornitza Stark Phenotypes for gene: SRCAP were changed from Floating-Harbor syndrome, 136140; Floating Harbor to Floating-Harbor syndrome, OMIM # 136140
Growth failure v0.169 SRCAP Zornitza Stark Publications for gene: SRCAP were set to
Growth failure v0.168 IGF1R Chirag Patel reviewed gene: IGF1R: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 14657428, 22130793, 23045302, 26252249, 17264177, 31586944; Phenotypes: Insulin-like growth factor I, resistance to, OMIM # 270450; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.168 IGF1 Chirag Patel reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, OMIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.168 IGF2 Chirag Patel reviewed gene: IGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26154720, 31544945; Phenotypes: Silver-Russell syndrome 3, OMIM #616489; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Growth failure v0.168 OBSL1 Chirag Patel reviewed gene: OBSL1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19481195, 23018678, 19877176; Phenotypes: 3-M syndrome 2, OMIM #612921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.168 PIK3R1 Chirag Patel reviewed gene: PIK3R1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23810378, 23810379, 23810382; Phenotypes: SHORT syndrome, OMIM # 269880; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.168 PLAG1 Chirag Patel reviewed gene: PLAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 28796236, 33291420, 32546215; Phenotypes: Silver-Russell syndrome 4,OMIM # 618907; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.168 SRCAP Chirag Patel reviewed gene: SRCAP: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22265015, 22965468, 22965468; Phenotypes: Floating-Harbor syndrome, OMIM # 136140; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8853 PACRG Zornitza Stark Marked gene: PACRG as ready
Mendeliome v0.8853 PACRG Zornitza Stark Gene: pacrg has been classified as Red List (Low Evidence).
Mendeliome v0.8853 PACRG Zornitza Stark Publications for gene: PACRG were set to
Mendeliome v0.8852 PACRG Zornitza Stark Classified gene: PACRG as Red List (low evidence)
Mendeliome v0.8852 PACRG Zornitza Stark Gene: pacrg has been classified as Red List (Low Evidence).
Mendeliome v0.8851 PACRG Zornitza Stark reviewed gene: PACRG: Rating: RED; Mode of pathogenicity: None; Publications: 31116684, 31182890, 14737177, 27193298; Phenotypes: ; Mode of inheritance: None
Combined Immunodeficiency v0.345 ZBTB24 Zornitza Stark Marked gene: ZBTB24 as ready
Combined Immunodeficiency v0.345 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.345 ZBTB24 Zornitza Stark Publications for gene: ZBTB24 were set to 21596365; 21906047; 27626380 32061411
Combined Immunodeficiency v0.344 ZBTB24 Zornitza Stark Phenotypes for gene: ZBTB24 were changed from to Immunodeficiency-centromeric instability-facial anomalies syndrome 2 MIM# 614069; Facial dysmorphic features; developmental delay; macroglossia; bacterial/opportunistic infections; malabsorption; cytopaenia; malignancies; multiradial configurations of chromosomes 1, 9, 16; Hypogammaglobulinaemia or agammaglobulinaemia; variable antibody deficiency
Combined Immunodeficiency v0.343 ZBTB24 Zornitza Stark Publications for gene: ZBTB24 were set to
Combined Immunodeficiency v0.342 ZBTB24 Zornitza Stark Mode of inheritance for gene: ZBTB24 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.92 WIPF1 Zornitza Stark Marked gene: WIPF1 as ready
Predominantly Antibody Deficiency v0.92 WIPF1 Zornitza Stark Gene: wipf1 has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.92 WIPF1 Zornitza Stark Phenotypes for gene: WIPF1 were changed from to Wiskott-Aldrich syndrome 2 MIM# 614493; Reduced T cells; defective lymphocyte responses to anti-CD3; high IgE; Thrombocytopenia with or without small platelets; recurrent bacterial and viral Infections; eczema; bloody diarrhoea; gastrointestinal bleeding; WAS protein absent
Predominantly Antibody Deficiency v0.91 WIPF1 Zornitza Stark Publications for gene: WIPF1 were set to
Predominantly Antibody Deficiency v0.90 WIPF1 Zornitza Stark Mode of inheritance for gene: WIPF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.89 WIPF1 Zornitza Stark reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, gastrointestinal bleeding, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8851 WIPF1 Zornitza Stark Marked gene: WIPF1 as ready
Mendeliome v0.8851 WIPF1 Zornitza Stark Gene: wipf1 has been classified as Green List (High Evidence).
Mendeliome v0.8851 WIPF1 Zornitza Stark Phenotypes for gene: WIPF1 were changed from to Wiskott-Aldrich syndrome 2 MIM# 614493; Reduced T cells; defective lymphocyte responses to anti-CD3; high IgE; Thrombocytopenia with or without small platelets; recurrent bacterial and viral Infections; eczema; bloody diarrhoea; gastrointestinal bleeding; WAS protein absent
Mendeliome v0.8850 WIPF1 Zornitza Stark Publications for gene: WIPF1 were set to
Mendeliome v0.8849 WIPF1 Zornitza Stark Mode of inheritance for gene: WIPF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4063 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Intellectual disability syndromic and non-syndromic v0.4063 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4063 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from to Transcobalamin II deficiency, 275350
Intellectual disability syndromic and non-syndromic v0.4062 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Intellectual disability syndromic and non-syndromic v0.4061 TCN2 Zornitza Stark Mode of inheritance for gene: TCN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8848 TCN2 Zornitza Stark changed review comment from: Well established gene-disease association.

26 pathogenic TCN2 variants have been reported in over 40 individuals; multiple mouse models

Homologous and Compound Heterozygous TCN2 variants (deletions or insertions, nonsense mutations, and point mutations) have been reported; deletions or insertions are the most common, causing frameshifts that result in protein truncation.

Individuals usually present within the first year of life with failure to thrive, diarrhoea, anaemia, pallor and agammaglobulinaemia.
Sources: Expert list; to: Well established gene-disease association.

26 pathogenic TCN2 variants have been reported in over 40 individuals; multiple mouse models

Homozygous and Compound Heterozygous TCN2 variants (deletions or insertions, nonsense mutations, and point mutations) have been reported; deletions or insertions are the most common, causing frameshifts that result in protein truncation.

Individuals usually present within the first year of life with failure to thrive, diarrhoea, anaemia, pallor and agammaglobulinaemia.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4060 TCN2 Zornitza Stark reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 19373259, 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency, 275350; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8848 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Mendeliome v0.8848 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Mendeliome v0.8848 TCN2 Zornitza Stark Publications for gene: TCN2 were set to 19373259
Mendeliome v0.8847 TCN2 Zornitza Stark edited their review of gene: TCN2: Changed publications: 19373259, 32841161, 33023511, 30124850
Mendeliome v0.8847 TCN2 Zornitza Stark changed review comment from: Well established gene-disease association.
Sources: Expert list; to: Well established gene-disease association.

26 pathogenic TCN2 variants have been reported in over 40 individuals; multiple mouse models

Homologous and Compound Heterozygous TCN2 variants (deletions or insertions, nonsense mutations, and point mutations) have been reported; deletions or insertions are the most common, causing frameshifts that result in protein truncation.

Individuals usually present within the first year of life with failure to thrive, diarrhoea, anaemia, pallor and agammaglobulinaemia.
Sources: Expert list
Mendeliome v0.8847 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from to Transcobalamin II deficiency, 275350
Mendeliome v0.8846 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Mendeliome v0.8845 TCN2 Zornitza Stark Mode of inheritance for gene: TCN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Vasculitis v0.35 TAP2 Zornitza Stark Marked gene: TAP2 as ready
Vasculitis v0.35 TAP2 Zornitza Stark Gene: tap2 has been classified as Green List (High Evidence).
Vasculitis v0.35 TAP2 Zornitza Stark Classified gene: TAP2 as Green List (high evidence)
Vasculitis v0.35 TAP2 Zornitza Stark Gene: tap2 has been classified as Green List (High Evidence).
Vasculitis v0.34 TAP2 Zornitza Stark gene: TAP2 was added
gene: TAP2 was added to Vasculitis. Sources: Expert Review
Mode of inheritance for gene: TAP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TAP2 were set to 7517574; 9232449; 10560675; 27861817
Phenotypes for gene: TAP2 were set to Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571; Low CD8; absent MHC I on lymphocytes; Vasculitis; pyoderma gangrenosum; recurrent bacterial/viral respiratory infections; bronchiectasis
Review for gene: TAP2 was set to GREEN
Added comment: 5 individuals from 4 unrelated families reported with TAP2 variants resulting in BLS type 1; two mouse models

Homozygous missense variants resulting in premature stop codons were identified.

Individuals typically presented with recurrent respiratory bacterial infections and reduced CD8+ cells with granulomatous lesions and/or skin vasculitis.
Sources: Expert Review
Mendeliome v0.8844 TAP2 Zornitza Stark Marked gene: TAP2 as ready
Mendeliome v0.8844 TAP2 Zornitza Stark Gene: tap2 has been classified as Green List (High Evidence).
Mendeliome v0.8844 TAP2 Zornitza Stark Phenotypes for gene: TAP2 were changed from to Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571; Low CD8; absent MHC I on lymphocytes; Vasculitis; pyoderma gangrenosum; recurrent bacterial/viral respiratory infections; bronchiectasis
Mendeliome v0.8843 TAP2 Zornitza Stark Publications for gene: TAP2 were set to
Mendeliome v0.8842 TAP2 Zornitza Stark Mode of inheritance for gene: TAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8841 TAP1 Zornitza Stark Marked gene: TAP1 as ready
Mendeliome v0.8841 TAP1 Zornitza Stark Gene: tap1 has been classified as Green List (High Evidence).
Mendeliome v0.8841 TAP1 Zornitza Stark Phenotypes for gene: TAP1 were changed from to Bare lymphocyte syndrome, type I MIM#604571; Low CD8; absent MHC I on lymphocytes; vasculitis; pyoderma gangrenosum; skin lesions; recurrent respiratory tract infections; bronchiectasis
Mendeliome v0.8840 TAP1 Zornitza Stark Publications for gene: TAP1 were set to
Mendeliome v0.8839 TAP1 Zornitza Stark Mode of inheritance for gene: TAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8838 PGRMC1 Bryony Thompson Phenotypes for gene: PGRMC1 were changed from Premature ovarian failure to Premature ovarian failure; Isolated paediatric cataract
Mendeliome v0.8837 PGRMC1 Bryony Thompson Tag SV/CNV tag was added to gene: PGRMC1.
Mendeliome v0.8837 PGRMC1 Bryony Thompson Publications for gene: PGRMC1 were set to 25246111; 18782852
Mendeliome v0.8836 WIPF1 Danielle Ariti reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, gastrointestinal bleeding, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8836 PGRMC1 Bryony Thompson Classified gene: PGRMC1 as Amber List (moderate evidence)
Mendeliome v0.8836 PGRMC1 Bryony Thompson Gene: pgrmc1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8835 PGRMC1 Bryony Thompson reviewed gene: PGRMC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 33867527, 23783460; Phenotypes: Isolated paediatric cataract; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Cataract v0.286 PGRMC1 Bryony Thompson Marked gene: PGRMC1 as ready
Cataract v0.286 PGRMC1 Bryony Thompson Gene: pgrmc1 has been classified as Amber List (Moderate Evidence).
Cataract v0.286 PGRMC1 Bryony Thompson changed review comment from: A single large family with X-linked isolated paediatric cataract segregating a large 127 kb deletion truncating PGRMC1. A supporting knockout zebrafish model with cataract. Also, two unrelated probands with non-syndromic ID and cataract with a large deletion encompassing PGRMC1 and SLC25A5.
Sources: Literature; to: A single large family with X-linked isolated paediatric cataract in males segregating a large 127 kb deletion truncating PGRMC1. A supporting knockout zebrafish model with cataract. Also, two unrelated male probands with non-syndromic ID and cataract with a large deletion encompassing PGRMC1 and SLC25A5.
Sources: Literature
Cataract v0.286 PGRMC1 Bryony Thompson Classified gene: PGRMC1 as Amber List (moderate evidence)
Cataract v0.286 PGRMC1 Bryony Thompson Gene: pgrmc1 has been classified as Amber List (Moderate Evidence).
Cataract v0.285 PGRMC1 Bryony Thompson gene: PGRMC1 was added
gene: PGRMC1 was added to Cataract. Sources: Literature
SV/CNV tags were added to gene: PGRMC1.
Mode of inheritance for gene: PGRMC1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PGRMC1 were set to 33867527; 23783460
Phenotypes for gene: PGRMC1 were set to Isolated paediatric cataract
Review for gene: PGRMC1 was set to AMBER
Added comment: A single large family with X-linked isolated paediatric cataract segregating a large 127 kb deletion truncating PGRMC1. A supporting knockout zebrafish model with cataract. Also, two unrelated probands with non-syndromic ID and cataract with a large deletion encompassing PGRMC1 and SLC25A5.
Sources: Literature
Combined Immunodeficiency v0.341 WIPF1 Zornitza Stark Marked gene: WIPF1 as ready
Combined Immunodeficiency v0.341 WIPF1 Zornitza Stark Gene: wipf1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.341 WIPF1 Zornitza Stark Phenotypes for gene: WIPF1 were changed from to Wiskott-Aldrich syndrome 2 MIM# 614493; Reduced T cells; defective lymphocyte responses to anti-CD3; high IgE; Thrombocytopenia with or without small platelets; recurrent bacterial and viral Infections; eczema; bloody diarrhoea; gastrointestinal bleeding; WAS protein absent
Combined Immunodeficiency v0.340 WIPF1 Zornitza Stark Publications for gene: WIPF1 were set to
Combined Immunodeficiency v0.339 WIPF1 Zornitza Stark Mode of inheritance for gene: WIPF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.338 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Combined Immunodeficiency v0.338 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.338 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from to Transcobalamin II deficiency MIM# 275350; Decreased Ig levels; Megaloblastic anaemia; pancytopaenia; if untreated (B12) for prolonged periods results in intellectual disability; failure to thrive; diarrhoea; hypogammaglobulinaemia; pallor; hypotonia; respiratory infection
Growth failure v0.168 TRIM37 Chirag Patel reviewed gene: TRIM37: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10888877, 12754710, 15108285, 14757854, 27044324; Phenotypes: Mulibrey nanism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.337 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Combined Immunodeficiency v0.336 TCN2 Zornitza Stark Mode of inheritance for gene: TCN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.335 TAP2 Zornitza Stark Marked gene: TAP2 as ready
Combined Immunodeficiency v0.335 TAP2 Zornitza Stark Gene: tap2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.335 TAP2 Zornitza Stark Phenotypes for gene: TAP2 were changed from to Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571; Low CD8; absent MHC I on lymphocytes; Vasculitis; pyoderma gangrenosum; recurrent bacterial/viral respiratory infections; bronchiectasis
Mendeliome v0.8835 TAP2 Danielle Ariti reviewed gene: TAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 7517574, 9232449, 10560675, 27861817; Phenotypes: Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571, Low CD8, absent MHC I on lymphocytes, Vasculitis, pyoderma gangrenosum, recurrent bacterial/viral respiratory infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.334 TAP2 Zornitza Stark Publications for gene: TAP2 were set to
Combined Immunodeficiency v0.333 TAP2 Zornitza Stark Mode of inheritance for gene: TAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8835 TAP1 Danielle Ariti reviewed gene: TAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28161407, 10074494, 1473153; Phenotypes: Bare lymphocyte syndrome, type I MIM#604571, Low CD8, absent MHC I on lymphocytes, vasculitis, pyoderma gangrenosum, skin lesions, recurrent respiratory tract infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.332 TAP1 Zornitza Stark Marked gene: TAP1 as ready
Combined Immunodeficiency v0.332 TAP1 Zornitza Stark Gene: tap1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.332 TAP1 Zornitza Stark Phenotypes for gene: TAP1 were changed from to Bare lymphocyte syndrome, type I MIM#604571; Low CD8; absent MHC I on lymphocytes; vasculitis; pyoderma gangrenosum; skin lesions; recurrent respiratory tract infections; bronchiectasis
Combined Immunodeficiency v0.331 TAP1 Zornitza Stark Publications for gene: TAP1 were set to 28161407; 10074494; 1473153
Combined Immunodeficiency v0.330 TAP1 Zornitza Stark Publications for gene: TAP1 were set to
Combined Immunodeficiency v0.330 TAP1 Zornitza Stark Mode of inheritance for gene: TAP1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.329 TAP1 Zornitza Stark Mode of inheritance for gene: TAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 ZBTB24 Danielle Ariti reviewed gene: ZBTB24: Rating: GREEN; Mode of pathogenicity: None; Publications: 21596365, 21906047, 27626380 32061411; Phenotypes: Immunodeficiency-centromeric instability-facial anomalies syndrome 2 MIM# 614069, Facial dysmorphic features, developmental delay, macroglossia, bacterial/opportunistic infections, malabsorption, cytopaenia, malignancies, multiradial configurations of chromosomes 1, 9, 16, Hypogammaglobulinaemia or agammaglobulinaemia, variable antibody deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 WIPF1 Danielle Ariti reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, gastrointestinal bleeding, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 WIPF1 Danielle Ariti Deleted their review
Combined Immunodeficiency v0.328 WIPF1 Danielle Ariti reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8835 ALS2 Teresa Zhao gene: ALS2 was added
gene: ALS2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALS2 were set to PMID: 30128655; 33409823
Phenotypes for gene: ALS2 were set to Infantile onset ascending spastic paralysis (MIM#607225); Juvenile amyotrophic lateral sclerosis 2 (MIM#205100); Juvenile primary lateral sclerosis (MIM#606353)
Review for gene: ALS2 was set to GREEN
Added comment: >50 variants reported in multiple individuals with Infantile onset ascending spastic paralysis, mostly originated from the Middle East and Mediterranean countries.
Sources: Literature
Combined Immunodeficiency v0.328 TCN2 Danielle Ariti reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency MIM# 275350, Decreased Ig levels, Megaloblastic anaemia, pancytopaenia, if untreated (B12) for prolonged periods results in intellectual disability, failure to thrive, diarrhoea, hypogammaglobulinaemia, pallor, hypotonia, respiratory infection; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 TAP2 Danielle Ariti reviewed gene: TAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 7517574, 9232449, 10560675, 27861817; Phenotypes: Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571, Low CD8, absent MHC I on lymphocytes, Vasculitis, pyoderma gangrenosum, recurrent bacterial/viral respiratory infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.63 HMNMYO Bryony Thompson Marked STR: HMNMYO as ready
Repeat Disorders v0.63 HMNMYO Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence).
Repeat Disorders v0.63 HMNMYO Bryony Thompson Classified STR: HMNMYO as Green List (high evidence)
Repeat Disorders v0.63 HMNMYO Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence).
Repeat Disorders v0.62 HMNMYO Bryony Thompson STR: HMNMYO was added
STR: HMNMYO was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: HMNMYO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: HMNMYO were set to 33559681; 33459760
Phenotypes for STR: HMNMYO were set to Neuropathy, hereditary motor, with myopathic features MIM#619216
Review for STR: HMNMYO was set to GREEN
STR: HMNMYO was marked as clinically relevant
Added comment: NM_022834.5(VWA1):c.62_71GCGCGGAGCG[X]
10-bp repeat expansion leading to a loss of function allele, was observed in 14/15 families and was homozygous in 10/15 with a recessive hereditary motor neuropathy.
Normal: 2 repeats
Pathogenic: >=3 repeats (currently only 3 repeats reported)
Sources: Literature
Combined Immunodeficiency v0.328 TAP1 Danielle Ariti reviewed gene: TAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28161407, 10074494, 1473153; Phenotypes: Bare lymphocyte syndrome, type I MIM#604571, Low CD8, absent MHC I on lymphocytes, vasculitis, pyoderma gangrenosum, skin lesions, recurrent respiratory tract infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.102 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Cardiomyopathy_Paediatric. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.88 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Deafness_IsolatedAndComplex. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Ataxia - paediatric v0.291 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Ataxia - paediatric v0.291 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Ataxia - paediatric v0.291 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Ataxia - paediatric v0.291 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Ataxia - paediatric v0.290 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Ataxia - paediatric. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Leukodystrophy - paediatric v0.230 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Leukodystrophy - paediatric v0.230 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Leukodystrophy - paediatric v0.230 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Leukodystrophy - paediatric v0.230 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Mendeliome v0.8835 RNF220 Zornitza Stark Tag founder tag was added to gene: RNF220.
Leukodystrophy - paediatric v0.229 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Leukodystrophy - paediatric. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Mendeliome v0.8835 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Mendeliome v0.8835 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Mendeliome v0.8835 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Mendeliome v0.8835 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Mendeliome v0.8834 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis changed review comment from: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other; to: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.

Consider inclusion in panels for leukodystrophies, childhood onset ataxia, sensorineural hearing loss, corpus callosum anomalies, cardiomyopathies, hepatopathies, etc in all cases with green rating.

Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis gene: RNF220 was added
gene: RNF220 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Penetrance for gene: RNF220 were set to Complete
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other
Growth failure v0.167 KMT2D Zornitza Stark changed review comment from: Association with Kabuki syndrome: failure to thrive in infancy and short stature are key features.

Note new association between missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.
~10 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability.; to: Association with Kabuki syndrome: failure to thrive in infancy and short stature are key features.

Note new association between missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.
~10 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability. Extreme short stature reported.
Growth failure v0.167 KMT2D Zornitza Stark Phenotypes for gene: KMT2D were changed from Kabuki syndrome 1, MIM# 147920 to Kabuki syndrome 1, MIM# 147920; KMT2D-associated neurodevelopmental syndrome
Growth failure v0.166 KMT2D Zornitza Stark Publications for gene: KMT2D were set to 21882399
Growth failure v0.165 KMT2D Zornitza Stark changed review comment from: Failure to thrive in infancy and short stature are key features.; to: Association with Kabuki syndrome: failure to thrive in infancy and short stature are key features.

Note new association between missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.
~10 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability.
Growth failure v0.165 KMT2D Zornitza Stark edited their review of gene: KMT2D: Changed publications: 31949313, 32083401, 21882399; Changed phenotypes: Kabuki syndrome 1, MIM# 147920, KMT2D-associated neurodevelopmental syndrome
Growth failure v0.165 KMT2D Zornitza Stark Publications for gene: KMT2D were set to
Growth failure v0.164 KMT2D Zornitza Stark edited their review of gene: KMT2D: Changed publications: 21882399
Growth failure v0.164 KMT2D Zornitza Stark Marked gene: KMT2D as ready
Growth failure v0.164 KMT2D Zornitza Stark Gene: kmt2d has been classified as Green List (High Evidence).
Growth failure v0.164 KMT2D Zornitza Stark Phenotypes for gene: KMT2D were changed from Kabuki to Kabuki syndrome 1, MIM# 147920
Growth failure v0.163 KMT2D Zornitza Stark Classified gene: KMT2D as Green List (high evidence)
Growth failure v0.163 KMT2D Zornitza Stark Gene: kmt2d has been classified as Green List (High Evidence).
Growth failure v0.162 KMT2D Zornitza Stark reviewed gene: KMT2D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kabuki syndrome 1, MIM# 147920; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.162 CDT1 Zornitza Stark Marked gene: CDT1 as ready
Growth failure v0.162 CDT1 Zornitza Stark Gene: cdt1 has been classified as Green List (High Evidence).
Growth failure v0.162 CDT1 Zornitza Stark Phenotypes for gene: CDT1 were changed from Meier-Gorlin syndrome 4, 613804; micrognathia, microtia, patellar hypoplasia/aplasia, mammary hypoplasia; Meier-Gorlin to Meier-Gorlin syndrome 4, MIM# 613804; MONDO:0013431
Growth failure v0.161 CDT1 Zornitza Stark Publications for gene: CDT1 were set to 21358632
Growth failure v0.160 CDT1 Zornitza Stark Classified gene: CDT1 as Green List (high evidence)
Growth failure v0.160 CDT1 Zornitza Stark Gene: cdt1 has been classified as Green List (High Evidence).
Growth failure v0.159 CDT1 Zornitza Stark reviewed gene: CDT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 21358631, 33338304, 22333897; Phenotypes: Meier-Gorlin syndrome 4, MIM# 613804, MONDO:0013431; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.159 CHD7 Zornitza Stark Marked gene: CHD7 as ready
Growth failure v0.159 CHD7 Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence).
Growth failure v0.159 CHD7 Zornitza Stark Phenotypes for gene: CHD7 were changed from CHARGE syndrome, 214800; CHARGE syndrome - ocular coloboma, choanal atresia, cranial nerve defects, distinctive external and inner ear abnormalities, hearing loss, cardiovascular malformations, urogenital anomalies, and growth retardation to CHARGE syndrome, MIM# 214800
Growth failure v0.158 CHD7 Zornitza Stark Classified gene: CHD7 as Green List (high evidence)
Growth failure v0.158 CHD7 Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence).
Growth failure v0.157 CHD7 Zornitza Stark reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: CHARGE syndrome, MIM# 214800; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.157 ATRIP Zornitza Stark Marked gene: ATRIP as ready
Growth failure v0.157 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Growth failure v0.157 ATRIP Zornitza Stark Phenotypes for gene: ATRIP were changed from microcephaly, micrognathia, small ear lobes, dental crowding to Seckel-like syndrome
Growth failure v0.156 ATRIP Zornitza Stark reviewed gene: ATRIP: Rating: RED; Mode of pathogenicity: None; Publications: 23144622; Phenotypes: Seckel syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.156 PLK4 Zornitza Stark Marked gene: PLK4 as ready
Growth failure v0.156 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Growth failure v0.156 PLK4 Zornitza Stark Phenotypes for gene: PLK4 were changed from microcephaly and chorioretinopathy 2, MONDO:0014516; Microcephaly and chorioretinopathy, autosomal recessive, 2, OMIM:616171 to Microcephaly and chorioretinopathy 2, MONDO:0014516; Microcephaly and chorioretinopathy, autosomal recessive, 2, #MIM:616171
Growth failure v0.155 PLK4 Zornitza Stark Classified gene: PLK4 as Green List (high evidence)
Growth failure v0.155 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Growth failure v0.154 PLK4 Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.154 Zornitza Stark Panel types changed to Rare Disease
Growth failure v0.153 RNPC3 Zornitza Stark Marked gene: RNPC3 as ready
Growth failure v0.153 RNPC3 Zornitza Stark Gene: rnpc3 has been classified as Amber List (Moderate Evidence).
Growth failure v0.153 RNPC3 Zornitza Stark Phenotypes for gene: RNPC3 were changed from ?Growth hormone deficiency, isolated, type V, 618160; isolated growth hormone deficiency to Growth hormone deficiency
Growth failure v0.152 RNPC3 Zornitza Stark reviewed gene: RNPC3: Rating: AMBER; Mode of pathogenicity: None; Publications: 29866761, 32462814; Phenotypes: Growth hormone deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.152 RAP1B Zornitza Stark edited their review of gene: RAP1B: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.152 RAP1B Zornitza Stark Marked gene: RAP1B as ready
Growth failure v0.152 RAP1B Zornitza Stark Gene: rap1b has been classified as Amber List (Moderate Evidence).
Growth failure v0.152 RAP1B Zornitza Stark Phenotypes for gene: RAP1B were changed from short stature; Syndromic intellectual disability to Syndromic intellectual disability; short stature
Growth failure v0.151 RAP1B Zornitza Stark reviewed gene: RAP1B: Rating: AMBER; Mode of pathogenicity: None; Publications: 32627184, 26280580; Phenotypes: Syndromic intellectual disability, short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.151 CDC6 Zornitza Stark Marked gene: CDC6 as ready
Growth failure v0.151 CDC6 Zornitza Stark Gene: cdc6 has been classified as Red List (Low Evidence).
Growth failure v0.151 CDC6 Zornitza Stark Phenotypes for gene: CDC6 were changed from patellar hypoplasia/aplasia, microtia, meier-gorlin syndrome, mammary hypoplasia; ?Meier-Gorlin syndrome 5, 613805 to Meier-Gorlin syndrome 5 (MIM#613805)
Growth failure v0.150 CDC6 Zornitza Stark reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.149 HDAC8 Zornitza Stark Marked gene: HDAC8 as ready
Growth failure v0.149 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Growth failure v0.149 HDAC8 Zornitza Stark Phenotypes for gene: HDAC8 were changed from Cornelia De Lange to Cornelia de Lange syndrome 5, MIM# 300882
Growth failure v0.148 HDAC8 Zornitza Stark Publications for gene: HDAC8 were set to
Growth failure v0.147 HDAC8 Zornitza Stark Classified gene: HDAC8 as Green List (high evidence)
Growth failure v0.147 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Growth failure v0.146 HDAC8 Zornitza Stark reviewed gene: HDAC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 30614194, 24403048; Phenotypes: Cornelia de Lange syndrome 5, MIM# 300882; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.146 NLRP2 Zornitza Stark edited their review of gene: NLRP2: Changed publications: 30877238, 33090377, 29574422, 26323243, 19300480
Growth failure v0.146 NLRP2 Zornitza Stark Marked gene: NLRP2 as ready
Growth failure v0.146 NLRP2 Zornitza Stark Gene: nlrp2 has been classified as Amber List (Moderate Evidence).
Growth failure v0.146 NLRP2 Zornitza Stark Mode of inheritance for gene: NLRP2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.145 NLRP2 Zornitza Stark reviewed gene: NLRP2: Rating: AMBER; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.145 NHLRC2 Zornitza Stark Marked gene: NHLRC2 as ready
Growth failure v0.145 NHLRC2 Zornitza Stark Gene: nhlrc2 has been classified as Green List (High Evidence).
Growth failure v0.145 NHLRC2 Zornitza Stark Phenotypes for gene: NHLRC2 were changed from FINCA syndrome OMIM:618278 to Fibrosis, neurodegeneration, and cerebral angiomatosis (FINCA) syndrome MIM#618278
Growth failure v0.144 NHLRC2 Zornitza Stark Classified gene: NHLRC2 as Green List (high evidence)
Growth failure v0.144 NHLRC2 Zornitza Stark Gene: nhlrc2 has been classified as Green List (High Evidence).
Growth failure v0.143 NHLRC2 Zornitza Stark reviewed gene: NHLRC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29423877, 32435055; Phenotypes: Fibrosis, neurodegeneration, and cerebral angiomatosis (FINCA) syndrome MIM#618278; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.143 NBAS Zornitza Stark Marked gene: NBAS as ready
Growth failure v0.143 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Mendeliome v0.8833 NBAS Zornitza Stark Marked gene: NBAS as ready
Mendeliome v0.8833 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Mendeliome v0.8833 NBAS Zornitza Stark Phenotypes for gene: NBAS were changed from to Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800; Infantile liver failure syndrome 2, MIM# 616483
Mendeliome v0.8832 NBAS Zornitza Stark Publications for gene: NBAS were set to
Mendeliome v0.8831 NBAS Zornitza Stark Mode of inheritance for gene: NBAS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8830 NBAS Zornitza Stark reviewed gene: NBAS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31761904; Phenotypes: Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800, Infantile liver failure syndrome 2, MIM# 616483; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.143 NBAS Zornitza Stark Marked gene: NBAS as ready
Growth failure v0.143 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Growth failure v0.143 NBAS Zornitza Stark Phenotypes for gene: NBAS were changed from Short stature, optic nerve atrophy, and Pelger-Huet anomaly, 614800 to Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800
Growth failure v0.142 NBAS Zornitza Stark Publications for gene: NBAS were set to 31761904
Growth failure v0.141 NBAS Zornitza Stark changed review comment from: Founder mutation in Yakut population but also reported in other ethnicities. Short stature is a feature.

Note bi-allelic variants in this gene also cause infantile liver failure syndrome, MIM#616483.; to: Founder mutation in Yakut population but also reported in other ethnicities. Short stature is a feature.

Note bi-allelic variants in this gene also cause infantile liver failure syndrome, MIM#616483. Clinical features are directly related to the affected region of the NBAS protein: β-propeller (combined phenotype), Sec39 (infantile liver failure syndrome type 2/ILFS2), and C-terminal (short stature, optic atrophy, and Pelger-Huët anomaly/SOPH)
Growth failure v0.141 NBAS Zornitza Stark Classified gene: NBAS as Green List (high evidence)
Growth failure v0.141 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Growth failure v0.140 NBAS Zornitza Stark reviewed gene: NBAS: Rating: GREEN; Mode of pathogenicity: None; Publications: 20577004, 26286438; Phenotypes: Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.140 MTX2 Zornitza Stark Marked gene: MTX2 as ready
Growth failure v0.140 MTX2 Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence).
Growth failure v0.140 MTX2 Zornitza Stark Classified gene: MTX2 as Green List (high evidence)
Growth failure v0.140 MTX2 Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence).
Growth failure v0.139 MTX2 Zornitza Stark reviewed gene: MTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32917887; Phenotypes: Mandibuloacral dysplasia progeroid syndrome, MIM# 619127, Mandibuloacral dysplasia, lipodystrophy, arterial calcification; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.61 SCA8 Bryony Thompson Marked STR: SCA8 as ready
Repeat Disorders v0.61 SCA8 Bryony Thompson Str: sca8 has been classified as Green List (High Evidence).
Repeat Disorders v0.61 SCA8 Bryony Thompson Classified STR: SCA8 as Green List (high evidence)
Repeat Disorders v0.61 SCA8 Bryony Thompson Str: sca8 has been classified as Green List (High Evidence).
Repeat Disorders v0.60 SCA8 Bryony Thompson STR: SCA8 was added
STR: SCA8 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA8 were set to 20301445
Phenotypes for STR: SCA8 were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: SCA8 was set to GREEN
STR: SCA8 was marked as clinically relevant
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Expert list
Repeat Disorders v0.59 FXPOI Bryony Thompson Marked STR: FXPOI as ready
Repeat Disorders v0.59 FXPOI Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence).
Repeat Disorders v0.59 FXPOI Bryony Thompson Classified STR: FXPOI as Green List (high evidence)
Repeat Disorders v0.59 FXPOI Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence).
Repeat Disorders v0.58 FXPOI Bryony Thompson STR: FXPOI was added
STR: FXPOI was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXPOI was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXPOI were set to 20301558
Phenotypes for STR: FXPOI were set to Premature ovarian failure 1 MIM#311360
Review for STR: FXPOI was set to GREEN
STR: FXPOI was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the POI phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXPOI: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
It is estimated that 21% of women who carry a premutation develop FXPOI. The association between repeat size of the premutation allele and FXPOI is nonlinear; women with 80-99 repeats are at greatest risk for FXPOI.
Sources: Expert list
Repeat Disorders v0.57 EPM1 Bryony Thompson Marked STR: EPM1 as ready
Repeat Disorders v0.57 EPM1 Bryony Thompson Str: epm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.57 EPM1 Bryony Thompson Classified STR: EPM1 as Green List (high evidence)
Repeat Disorders v0.57 EPM1 Bryony Thompson Str: epm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.56 EPM1 Bryony Thompson STR: EPM1 was added
STR: EPM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: EPM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EPM1 were set to 29325606; 20301321
Phenotypes for STR: EPM1 were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: EPM1 was set to GREEN
STR: EPM1 was marked as clinically relevant
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Repeat Disorders v0.55 FRDA Bryony Thompson Marked STR: FRDA as ready
Repeat Disorders v0.55 FRDA Bryony Thompson Str: frda has been classified as Green List (High Evidence).
Repeat Disorders v0.55 FRDA Bryony Thompson Classified STR: FRDA as Green List (high evidence)
Repeat Disorders v0.55 FRDA Bryony Thompson Str: frda has been classified as Green List (High Evidence).
Repeat Disorders v0.54 FRDA Bryony Thompson STR: FRDA was added
STR: FRDA was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FRDA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FRDA were set to 20301458
Phenotypes for STR: FRDA were set to Friedreich ataxia MIM#229300
Review for STR: FRDA was set to GREEN
STR: FRDA was marked as clinically relevant
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Repeat Disorders v0.53 FRAXE Bryony Thompson Marked STR: FRAXE as ready
Repeat Disorders v0.53 FRAXE Bryony Thompson Str: fraxe has been classified as Green List (High Evidence).
Repeat Disorders v0.53 FRAXE Bryony Thompson Classified STR: FRAXE as Green List (high evidence)
Repeat Disorders v0.53 FRAXE Bryony Thompson Str: fraxe has been classified as Green List (High Evidence).
Repeat Disorders v0.52 FRAXE Bryony Thompson STR: FRAXE was added
STR: FRAXE was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FRAXE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXE were set to 8334699; 8673085; 11388762
Phenotypes for STR: FRAXE were set to Intellectual developmental disorder, X-linked 109 MIM#309548
Review for STR: FRAXE was set to GREEN
STR: FRAXE was marked as clinically relevant
Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)
Loss of function through methylation silencing is the mechanism of disease
Normal - 5-44 repeats
Inconclusive - 45-54 repeats
Premutation - 55-200 repeats
Abnormal - >200 or >230 repeats
Sources: Expert list
Mendeliome v0.8830 ARF3 Zornitza Stark Marked gene: ARF3 as ready
Mendeliome v0.8830 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8830 ARF3 Zornitza Stark Classified gene: ARF3 as Amber List (moderate evidence)
Mendeliome v0.8830 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8829 ARF3 Zornitza Stark gene: ARF3 was added
gene: ARF3 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Review for gene: ARF3 was set to AMBER
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Marked gene: ARF3 as ready
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Classified gene: ARF3 as Amber List (moderate evidence)
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4059 ARF3 Zornitza Stark Classified gene: ARF3 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4059 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4058 ARF3 Zornitza Stark reviewed gene: ARF3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Genetic Epilepsy v0.1169 ARF3 Konstantinos Varvagiannis gene: ARF3 was added
gene: ARF3 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Penetrance for gene: ARF3 were set to unknown
Review for gene: ARF3 was set to AMBER
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4058 ARF3 Konstantinos Varvagiannis gene: ARF3 was added
gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Penetrance for gene: ARF3 were set to unknown
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Repeat Disorders v0.51 DM1 Bryony Thompson Marked STR: DM1 as ready
Repeat Disorders v0.51 DM1 Bryony Thompson Str: dm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.51 DM1 Bryony Thompson Classified STR: DM1 as Green List (high evidence)
Repeat Disorders v0.51 DM1 Bryony Thompson Str: dm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.50 DM1 Bryony Thompson STR: DM1 was added
STR: DM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM1 were set to 20301344; 29325606
Phenotypes for STR: DM1 were set to Myotonic dystrophy 1 MIM#160900
Review for STR: DM1 was set to GREEN
STR: DM1 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_001081560.2:c.*224_*226CTG[X]
RNA toxic gain of function is mechanism of disease
Premutation: 35-49 repeats, no clinical signs
Mild: 50-~150 repeats, age of onset 20-70 yrs, clinical signs - cataracts, mild myotonia
Classic: ~100-~1,000 repeats, age of onset 10-30 yrs, clinical signs - weakness, myotonia, cataracts, balding, cardiac arrhythmia
Congenital: >1,000 repeats, age of onset birth-10 yrs , clinical signs - infantile hypotonia, respiratory deficits, intellectual disability, classic signs in adults
Sources: Expert list
Repeat Disorders v0.49 FXS Bryony Thompson Marked STR: FXS as ready
Repeat Disorders v0.49 FXS Bryony Thompson Str: fxs has been classified as Green List (High Evidence).
Repeat Disorders v0.49 FXS Bryony Thompson Classified STR: FXS as Green List (high evidence)
Repeat Disorders v0.49 FXS Bryony Thompson Str: fxs has been classified as Green List (High Evidence).
Repeat Disorders v0.48 FXS Bryony Thompson STR: FXS was added
STR: FXS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXS were set to 33795824; 25227148
Phenotypes for STR: FXS were set to Fragile X syndrome MIM#300624
Review for STR: FXS was set to GREEN
STR: FXS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Growth failure v0.139 KDM3B Zornitza Stark Phenotypes for gene: KDM3B were changed from Intellectual disability; short stature to Diets-Jongmans syndrome, MIM# 618846; Intellectual disability; short stature; deafness
Growth failure v0.138 KDM3B Zornitza Stark edited their review of gene: KDM3B: Changed phenotypes: Diets-Jongmans syndrome, MIM# 618846, Intellectual disability, short stature, deafness
Growth failure v0.138 KDM3B Zornitza Stark Marked gene: KDM3B as ready
Growth failure v0.138 KDM3B Zornitza Stark Gene: kdm3b has been classified as Green List (High Evidence).
Growth failure v0.138 KDM3B Zornitza Stark Phenotypes for gene: KDM3B were changed from Behavioral abnormality; Seizures; Global developmental delay; Short stature; Intellectual disability to Intellectual disability; short stature
Growth failure v0.137 KDM3B Zornitza Stark Mode of inheritance for gene: KDM3B was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.136 KDM3B Zornitza Stark Classified gene: KDM3B as Green List (high evidence)
Growth failure v0.136 KDM3B Zornitza Stark Gene: kdm3b has been classified as Green List (High Evidence).
Growth failure v0.135 KDM3B Zornitza Stark reviewed gene: KDM3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 30929739; Phenotypes: Intellectual disability, short stature; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.135 INTS1 Zornitza Stark Marked gene: INTS1 as ready
Growth failure v0.135 INTS1 Zornitza Stark Gene: ints1 has been classified as Green List (High Evidence).
Growth failure v0.135 INTS1 Zornitza Stark Classified gene: INTS1 as Green List (high evidence)
Growth failure v0.135 INTS1 Zornitza Stark Gene: ints1 has been classified as Green List (High Evidence).
Growth failure v0.134 INTS1 Zornitza Stark reviewed gene: INTS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28542170, 30622326, 31428919; Phenotypes: Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies, #MIM:618571, MONDO:0032817; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.134 FOXP4 Zornitza Stark Marked gene: FOXP4 as ready
Growth failure v0.134 FOXP4 Zornitza Stark Gene: foxp4 has been classified as Green List (High Evidence).
Growth failure v0.134 FOXP4 Zornitza Stark Phenotypes for gene: FOXP4 were changed from Neurodevelopmental disorder; multiple congenital abnormalities to Neurodevelopmental disorder; multiple congenital abnormalities; short stature
Growth failure v0.133 FOXP4 Zornitza Stark Mode of inheritance for gene: FOXP4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.132 FOXP4 Zornitza Stark Classified gene: FOXP4 as Green List (high evidence)
Growth failure v0.132 FOXP4 Zornitza Stark Gene: foxp4 has been classified as Green List (High Evidence).
Growth failure v0.131 FOXP4 Zornitza Stark reviewed gene: FOXP4: Rating: GREEN; Mode of pathogenicity: None; Publications: 33110267; Phenotypes: Neurodevelopmental disorder, multiple congenital abnormalities, short stature; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.15 COG4 Zornitza Stark Marked gene: COG4 as ready
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.15 COG4 Zornitza Stark Gene: cog4 has been classified as Green List (High Evidence).
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.15 COG4 Zornitza Stark Classified gene: COG4 as Green List (high evidence)
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.15 COG4 Zornitza Stark Gene: cog4 has been classified as Green List (High Evidence).
Microcephalic Primordial Dwarfism and Slender bone dysplasias v0.14 COG4 Zornitza Stark gene: COG4 was added
gene: COG4 was added to Microcephalic Primordial Dwarfism and Slender bone dysplasias. Sources: Expert Review
Mode of inheritance for gene: COG4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COG4 were set to 30290151
Phenotypes for gene: COG4 were set to Saul-Wilson syndrome, OMIM:618150; Microcephalic osteodysplastic dysplasia, Saul-Wilson type, MONDO:0019407
Mode of pathogenicity for gene: COG4 was set to Other
Review for gene: COG4 was set to GREEN
Added comment: 14 individuals reported with DD, skeletal changes, cataracts, and growth retardation (progeriod like). All have a recurrent de novo heterozygous missense variant (p.Gly516Arg). GoF suggested.

Please note bi-allelic variants cause CDG.
Sources: Expert Review
Growth failure v0.131 COG4 Zornitza Stark Marked gene: COG4 as ready
Growth failure v0.131 COG4 Zornitza Stark Gene: cog4 has been classified as Green List (High Evidence).
Growth failure v0.131 COG4 Zornitza Stark Phenotypes for gene: COG4 were changed from microcephalic osteodysplastic dysplasia, Saul-Wilson type, MONDO:0019407; Saul-Wilson syndrome, OMIM:618150 to Saul-Wilson syndrome, OMIM:618150; Microcephalic osteodysplastic dysplasia, Saul-Wilson type, MONDO:0019407
Growth failure v0.130 COG4 Zornitza Stark Classified gene: COG4 as Green List (high evidence)
Growth failure v0.130 COG4 Zornitza Stark Gene: cog4 has been classified as Green List (High Evidence).
Growth failure v0.129 COG4 Zornitza Stark edited their review of gene: COG4: Changed mode of pathogenicity: Other
Growth failure v0.129 COG4 Zornitza Stark changed review comment from: 14 individuals reported with DD, skeletal changes, cataracts, and growth retardation (progeriod like). All have a recurrent de novo heterozygous missense variant (p.Gly516Arg).

Please note bi-allelic variants cause CDG.; to: 14 individuals reported with DD, skeletal changes, cataracts, and growth retardation (progeriod like). All have a recurrent de novo heterozygous missense variant (p.Gly516Arg). GoF suggested.

Please note bi-allelic variants cause CDG.
Growth failure v0.129 COG4 Zornitza Stark reviewed gene: COG4: Rating: GREEN; Mode of pathogenicity: None; Publications: 30290151; Phenotypes: Saul-Wilson syndrome, OMIM:618150, Microcephalic osteodysplastic dysplasia, Saul-Wilson type, MONDO:0019407; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.129 TRIP13 Zornitza Stark Marked gene: TRIP13 as ready
Growth failure v0.129 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Growth failure v0.129 TRIP13 Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence)
Growth failure v0.129 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Growth failure v0.128 TRIP13 Zornitza Stark gene: TRIP13 was added
gene: TRIP13 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: TRIP13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRIP13 were set to 28553959
Phenotypes for gene: TRIP13 were set to Mosaic variegated aneuploidy syndrome 3, MIM# 617598
Review for gene: TRIP13 was set to AMBER
Added comment: Autosomal recessive disorder resulting from errors in chromosome segregation. Most affected individuals develop early-onset Wilms tumor and show either aneuploidy or premature chromatid separation in cells. Some patients may have additional developmental features, such as microcephaly, growth retardation, or developmental delay.

6 unrelated families reported, but 5 shared the same homozygous stop variant, p.Arg354X, suggestive of founder effect.
Sources: Expert Review
Growth failure v0.127 BUB1B Zornitza Stark Marked gene: BUB1B as ready
Growth failure v0.127 BUB1B Zornitza Stark Gene: bub1b has been classified as Green List (High Evidence).
Growth failure v0.127 BUB1B Zornitza Stark Classified gene: BUB1B as Green List (high evidence)
Growth failure v0.127 BUB1B Zornitza Stark Gene: bub1b has been classified as Green List (High Evidence).
Growth failure v0.126 BUB1B Zornitza Stark gene: BUB1B was added
gene: BUB1B was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: BUB1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BUB1B were set to 18548531
Phenotypes for gene: BUB1B were set to Mosaic variegated aneuploidy syndrome 1, MIM#257300
Review for gene: BUB1B was set to GREEN
Added comment: Mosaic Variegated Aneuploidy Syndrome (MVA) is a rare autosomal recessive disorder characterized by mosaic aneuploidies involving multiple chromosomes and tissues. Affected individuals typically present with severe intrauterine and postnatal growth retardation, microcephaly, facial dysmorphism, developmental delay and predisposition to cancer and epilepsy.

More than 10 families reported.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4058 CEP57 Zornitza Stark Marked gene: CEP57 as ready
Intellectual disability syndromic and non-syndromic v0.4058 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4058 CEP57 Zornitza Stark Phenotypes for gene: CEP57 were changed from to Mosaic variegated aneuploidy syndrome 2, #MIM 614114
Intellectual disability syndromic and non-syndromic v0.4057 CEP57 Zornitza Stark Publications for gene: CEP57 were set to
Intellectual disability syndromic and non-syndromic v0.4056 CEP57 Zornitza Stark Mode of inheritance for gene: CEP57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4055 CEP57 Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266, 32861809, 30147898; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8828 CEP57 Zornitza Stark Marked gene: CEP57 as ready
Mendeliome v0.8828 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Mendeliome v0.8828 CEP57 Zornitza Stark Phenotypes for gene: CEP57 were changed from to Mosaic variegated aneuploidy syndrome 2, #MIM 614114
Mendeliome v0.8827 CEP57 Zornitza Stark Publications for gene: CEP57 were set to
Mendeliome v0.8826 CEP57 Zornitza Stark Mode of inheritance for gene: CEP57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8825 CEP57 Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266, 32861809, 30147898; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.125 CEP57 Zornitza Stark edited their review of gene: CEP57: Changed publications: 24259107, 21552266, 32861809, 30147898
Growth failure v0.125 CEP57 Zornitza Stark Marked gene: CEP57 as ready
Growth failure v0.125 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Growth failure v0.125 CEP57 Zornitza Stark Classified gene: CEP57 as Green List (high evidence)
Growth failure v0.125 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Growth failure v0.124 CEP57 Zornitza Stark Phenotypes for gene: CEP57 were changed from Mosaic variegated aneuploidy syndrome 2, 614114 to Mosaic variegated aneuploidy syndrome 2, MIM#614114
Growth failure v0.123 CEP57 Zornitza Stark Publications for gene: CEP57 were set to 24259107; 21552266
Growth failure v0.122 CEP57 Zornitza Stark Deleted their comment
Growth failure v0.122 CEP57 Zornitza Stark edited their review of gene: CEP57: Added comment: Mosaic Variegated Aneuploidy Syndrome (MVA) is a rare autosomal recessive disorder characterized by mosaic aneuploidies involving multiple chromosomes and tissues. Affected individuals typically present with severe intrauterine and postnatal growth retardation, microcephaly, facial dysmorphism, developmental delay and predisposition to cancer and epilepsy.; Changed publications: 24259107, 21552266, 32861809
Growth failure v0.122 CEP57 Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.122 Zornitza Stark removed gene:CCDC186 from the panel
Growth failure v0.121 ANAPC1 Zornitza Stark Marked gene: ANAPC1 as ready
Growth failure v0.121 ANAPC1 Zornitza Stark Gene: anapc1 has been classified as Green List (High Evidence).
Ectodermal Dysplasia v0.55 ANAPC1 Zornitza Stark Phenotypes for gene: ANAPC1 were changed from Rothmund-Thomson syndrome, type 1 MIM#618625 to Rothmund-Thomson syndrome, type 1 MIM#618625; MONDO:0016368
Ectodermal Dysplasia v0.54 ANAPC1 Zornitza Stark Tag deep intronic tag was added to gene: ANAPC1.
Ectodermal Dysplasia v0.54 ANAPC1 Zornitza Stark reviewed gene: ANAPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31303264; Phenotypes: Rothmund Thomson syndrome type 1, #MIM:618625, MONDO:0016368; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.121 ANAPC1 Zornitza Stark Tag deep intronic tag was added to gene: ANAPC1.
Growth failure v0.121 ANAPC1 Zornitza Stark Classified gene: ANAPC1 as Green List (high evidence)
Growth failure v0.121 ANAPC1 Zornitza Stark Gene: anapc1 has been classified as Green List (High Evidence).
Growth failure v0.120 ANAPC1 Zornitza Stark reviewed gene: ANAPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31303264; Phenotypes: Rothmund-Thomson syndrome, type 1, MIM# 618625; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.120 FANCM Zornitza Stark Marked gene: FANCM as ready
Growth failure v0.120 FANCM Zornitza Stark Gene: fancm has been classified as Red List (Low Evidence).
Growth failure v0.120 FANCM Zornitza Stark Phenotypes for gene: FANCM were changed from Fanconi anemia, complementation group M, 614087; Fanconi anemia; Fanconi Anemia to Fanconi anaemia
Growth failure v0.119 SMC3 Zornitza Stark Marked gene: SMC3 as ready
Growth failure v0.119 SMC3 Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence).
Growth failure v0.119 SMC3 Zornitza Stark Phenotypes for gene: SMC3 were changed from Cornelia De Lange to Cornelia de Lange syndrome 3, MIM# 610759
Growth failure v0.118 SMC3 Zornitza Stark Publications for gene: SMC3 were set to
Growth failure v0.117 SMC3 Zornitza Stark Classified gene: SMC3 as Green List (high evidence)
Growth failure v0.117 SMC3 Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence).
Growth failure v0.116 SMC3 Zornitza Stark reviewed gene: SMC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 25125236, 25655089; Phenotypes: Cornelia de Lange syndrome 3, MIM# 610759; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.116 SOX3 Zornitza Stark Marked gene: SOX3 as ready
Growth failure v0.116 SOX3 Zornitza Stark Gene: sox3 has been classified as Red List (Low Evidence).
Growth failure v0.116 SOX3 Zornitza Stark Phenotypes for gene: SOX3 were changed from Panhypopituitarism, X-linked, OMIM:312000; Mental retardation, X-linked, with isolated growth hormone deficiency, OMIM:300123; Panhypopituitarism, X-linked, MONDO:0010712; Intellectual disability, X-linked, with panhypopituitarism, MONDO:0010252 to Mental retardation, X-linked, with isolated growth hormone deficiency, MIM#300123; Panhypopituitarism, X-linked, MIM#312000
Growth failure v0.115 SOX3 Zornitza Stark Publications for gene: SOX3 were set to 15800844
Growth failure v0.114 SOX3 Zornitza Stark Mode of inheritance for gene: SOX3 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.113 SOX3 Zornitza Stark Tag SV/CNV tag was added to gene: SOX3.
Growth failure v0.113 SOX3 Zornitza Stark reviewed gene: SOX3: Rating: RED; Mode of pathogenicity: None; Publications: 29175558, 30125608, 12428212, 15800844; Phenotypes: Mental retardation, X-linked, with isolated growth hormone deficiency, MIM#300123, Panhypopituitarism, X-linked, MIM#312000; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.113 SOX2 Zornitza Stark Marked gene: SOX2 as ready
Growth failure v0.113 SOX2 Zornitza Stark Gene: sox2 has been classified as Green List (High Evidence).
Growth failure v0.113 SOX2 Zornitza Stark Phenotypes for gene: SOX2 were changed from to Microphthalmia, syndromic 3, MIM# 206900
Growth failure v0.112 SOX2 Zornitza Stark Publications for gene: SOX2 were set to
Growth failure v0.111 SOX2 Zornitza Stark Classified gene: SOX2 as Green List (high evidence)
Growth failure v0.111 SOX2 Zornitza Stark Gene: sox2 has been classified as Green List (High Evidence).
Growth failure v0.110 SOX2 Zornitza Stark reviewed gene: SOX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15812812, 16543359, 16932809,; Phenotypes: Microphthalmia, syndromic 3, MIM# 206900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.110 ERCC8 Zornitza Stark edited their review of gene: ERCC8: Changed phenotypes: Cockayne syndrome, type A, MIM# 216400, MONDO:0019569
Growth failure v0.110 ERCC8 Zornitza Stark Marked gene: ERCC8 as ready
Growth failure v0.110 ERCC8 Zornitza Stark Gene: ercc8 has been classified as Green List (High Evidence).
Growth failure v0.110 ERCC8 Zornitza Stark Phenotypes for gene: ERCC8 were changed from cockayne to Cockayne syndrome, type A, MIM# 216400; MONDO:0019569
Growth failure v0.109 ERCC8 Zornitza Stark Publications for gene: ERCC8 were set to
Growth failure v0.108 ERCC8 Zornitza Stark Classified gene: ERCC8 as Green List (high evidence)
Growth failure v0.108 ERCC8 Zornitza Stark Gene: ercc8 has been classified as Green List (High Evidence).
Growth failure v0.107 ERCC6 Zornitza Stark Marked gene: ERCC6 as ready
Growth failure v0.107 ERCC6 Zornitza Stark Gene: ercc6 has been classified as Green List (High Evidence).
Growth failure v0.107 ERCC6 Zornitza Stark Phenotypes for gene: ERCC6 were changed from Cockayne syndrome, type B, 133540 to Cerebrooculofacioskeletal syndrome 1, MIM# 214150; MONDO:0008955; Cockayne syndrome, type B, MIM# 133540; MONDO:0019570
Growth failure v0.106 ERCC6 Zornitza Stark changed review comment from: Well established gene-disease association, spectrum of severity.; to: Well established gene-disease association, spectrum of severity. Marked short stature is a feature.
Growth failure v0.106 ERCC6 Zornitza Stark edited their review of gene: ERCC6: Changed phenotypes: Cerebrooculofacioskeletal syndrome 1, MIM# 214150, MONDO:0008955, Cockayne syndrome, type B, MIM# 133540, MONDO:0019570
Growth failure v0.106 ERCC6 Zornitza Stark Classified gene: ERCC6 as Green List (high evidence)
Growth failure v0.106 ERCC6 Zornitza Stark Gene: ercc6 has been classified as Green List (High Evidence).
Growth failure v0.105 LIG4 Zornitza Stark Marked gene: LIG4 as ready
Growth failure v0.105 LIG4 Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence).
Growth failure v0.105 LIG4 Zornitza Stark Phenotypes for gene: LIG4 were changed from microcephaly, growth retardation, immunodeficiency, developmental delay to LIG4 syndrome, MIM# 606593; microcephaly, growth retardation, immunodeficiency, developmental delay
Growth failure v0.104 LIG4 Zornitza Stark Publications for gene: LIG4 were set to 11779494, 16088910,
Growth failure v0.103 LIG4 Zornitza Stark Classified gene: LIG4 as Green List (high evidence)
Growth failure v0.103 LIG4 Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence).
Growth failure v0.102 STAT5B Zornitza Stark Marked gene: STAT5B as ready
Growth failure v0.102 STAT5B Zornitza Stark Gene: stat5b has been classified as Green List (High Evidence).
Growth failure v0.102 STAT5B Zornitza Stark Phenotypes for gene: STAT5B were changed from to Growth hormone insensitivity with immune dysregulation 1, autosomal recessive, MIM# 245590; Growth hormone insensitivity with immune dysregulation 2, autosomal dominant, MIM# 618985
Growth failure v0.101 STAT5B Zornitza Stark Publications for gene: STAT5B were set to
Growth failure v0.100 STAT5B Zornitza Stark Classified gene: STAT5B as Green List (high evidence)
Growth failure v0.100 STAT5B Zornitza Stark Gene: stat5b has been classified as Green List (High Evidence).
Growth failure v0.99 STAT5B Zornitza Stark reviewed gene: STAT5B: Rating: GREEN; Mode of pathogenicity: None; Publications: 13679528, 15827093, 16787985, 17389811, 29844444; Phenotypes: Growth hormone insensitivity with immune dysregulation 1, autosomal recessive, MIM# 245590, Growth hormone insensitivity with immune dysregulation 2, autosomal dominant, MIM# 618985; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.99 TBCE Zornitza Stark Marked gene: TBCE as ready
Growth failure v0.99 TBCE Zornitza Stark Gene: tbce has been classified as Green List (High Evidence).
Growth failure v0.99 TBCE Zornitza Stark Phenotypes for gene: TBCE were changed from to Kenny-Caffey syndrome, type 1, MIM# 244460; Hypoparathyroidism-retardation-dysmorphism syndrome, MIM# 241410, Sanjad-Sakati syndrome
Growth failure v0.98 TBCE Zornitza Stark Publications for gene: TBCE were set to
Growth failure v0.97 TBCE Zornitza Stark Classified gene: TBCE as Green List (high evidence)
Growth failure v0.97 TBCE Zornitza Stark Gene: tbce has been classified as Green List (High Evidence).
Growth failure v0.96 TBCE Zornitza Stark reviewed gene: TBCE: Rating: GREEN; Mode of pathogenicity: None; Publications: 12389028, 26029652, 33010201, 30638765; Phenotypes: Kenny-Caffey syndrome, type 1, MIM# 244460, Hypoparathyroidism-retardation-dysmorphism syndrome, MIM# 241410, Sanjad-Sakati syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8825 PLXNA2 Zornitza Stark Marked gene: PLXNA2 as ready
Mendeliome v0.8825 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8825 PLXNA2 Zornitza Stark Classified gene: PLXNA2 as Amber List (moderate evidence)
Mendeliome v0.8825 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8824 PLXNA2 Zornitza Stark gene: PLXNA2 was added
gene: PLXNA2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNA2 were set to 34327814
Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology
Review for gene: PLXNA2 was set to AMBER
Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants.

The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members.

Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)).

Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed).

The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed).

Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved.

Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele.

As the authors discuss:
*PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration.
*Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch.
*Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD.
*Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus.

Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg:
- Cyanotic heart disease explaining discordance in cognitive outcome among sibs
- Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or
- Additional pathogenic variants possibly explaining the CHD in the first subject.

There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Marked gene: PLXNA2 as ready
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Classified gene: PLXNA2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.7 SLC51A Zornitza Stark Marked gene: SLC51A as ready
Congenital Diarrhoea v1.7 SLC51A Zornitza Stark Gene: slc51a has been classified as Red List (Low Evidence).
Congenital Diarrhoea v1.7 SLC51A Zornitza Stark gene: SLC51A was added
gene: SLC51A was added to Congenital Diarrhoea. Sources: Literature
Mode of inheritance for gene: SLC51A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51A were set to 31863603
Phenotypes for gene: SLC51A were set to Cholestasis, progressive familial intrahepatic, 6, MIM# 619484
Review for gene: SLC51A was set to RED
Added comment: Single individual reported with homozygous LoF variant, who presented with chronic malabsorptive diarrhoea, easy bruising, episodes of prolonged bleeding that required blood transfusions, and failure to thrive. Laboratory testing at age 2.5 years showed elevated liver transaminases and alkaline phosphatase. Liver biopsy demonstrated portal and periportal fibrosis and hepatocytes with foci of hepatocytic cholestasis. Analysis of bile acids in a blood spot were normal. Treatment with ursodiol and cholestyramine was started at 5 years of age. The coagulopathy resolved and his growth was adequate, but his liver transaminases, direct bilirubin, and GGT levels remained elevated.
Sources: Literature
Mendeliome v0.8823 SLC51A Zornitza Stark Marked gene: SLC51A as ready
Mendeliome v0.8823 SLC51A Zornitza Stark Gene: slc51a has been classified as Red List (Low Evidence).
Mendeliome v0.8823 SLC51A Zornitza Stark gene: SLC51A was added
gene: SLC51A was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SLC51A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51A were set to 31863603
Phenotypes for gene: SLC51A were set to Cholestasis, progressive familial intrahepatic, 6, MIM# 619484
Review for gene: SLC51A was set to RED
Added comment: Single individual reported with homozygous LoF variant, who presented with chronic malabsorptive diarrhoea, easy bruising, episodes of prolonged bleeding that required blood transfusions, and failure to thrive. Laboratory testing at age 2.5 years showed elevated liver transaminases and alkaline phosphatase. Liver biopsy demonstrated portal and periportal fibrosis and hepatocytes with foci of hepatocytic cholestasis. Analysis of bile acids in a blood spot were normal. Treatment with ursodiol and cholestyramine was started at 5 years of age. The coagulopathy resolved and his growth was adequate, but his liver transaminases, direct bilirubin, and GGT levels remained elevated.
Sources: Literature
Cholestasis v0.203 SLC51A Zornitza Stark Marked gene: SLC51A as ready
Cholestasis v0.203 SLC51A Zornitza Stark Gene: slc51a has been classified as Red List (Low Evidence).
Cholestasis v0.203 SLC51A Zornitza Stark gene: SLC51A was added
gene: SLC51A was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: SLC51A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51A were set to 31863603
Phenotypes for gene: SLC51A were set to Cholestasis, progressive familial intrahepatic, 6, MIM# 619484
Review for gene: SLC51A was set to RED
Added comment: Single individual reported with homozygous LoF variant, who presented with chronic malabsorptive diarrhoea, easy bruising, episodes of prolonged bleeding that required blood transfusions, and failure to thrive. Laboratory testing at age 2.5 years showed elevated liver transaminases and alkaline phosphatase. Liver biopsy demonstrated portal and periportal fibrosis and hepatocytes with foci of hepatocytic cholestasis. Analysis of bile acids in a blood spot were normal. Treatment with ursodiol and cholestyramine was started at 5 years of age. The coagulopathy resolved and his growth was adequate, but his liver transaminases, direct bilirubin, and GGT levels remained elevated.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4054 SUPT16H Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum
Intellectual disability syndromic and non-syndromic v0.4053 SUPT16H Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum
Callosome v0.310 SUPT16H Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum
Callosome v0.309 SUPT16H Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum
Mendeliome v0.8822 SUPT16H Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum
Mendeliome v0.8821 SUPT16H Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum
Early-onset Parkinson disease v0.110 FMR1 Bryony Thompson Phenotypes for gene: FMR1 were changed from to Fragile X tremor/ataxia syndrome MIM#300623; Fragile X syndrome MIM#300624
Early-onset Parkinson disease v0.109 FMR1 Bryony Thompson Publications for gene: FMR1 were set to
Early-onset Parkinson disease v0.108 FMR1 Bryony Thompson Mode of inheritance for gene: FMR1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4053 PLXNA2 Konstantinos Varvagiannis gene: PLXNA2 was added
gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNA2 were set to 34327814
Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology
Penetrance for gene: PLXNA2 were set to Incomplete
Review for gene: PLXNA2 was set to AMBER
Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants.

The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members.

Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)).

Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed).

The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed).

Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved.

Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele.

As the authors discuss:
*PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration.
*Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch.
*Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD.
*Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus.

Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg:
- Cyanotic heart disease explaining discordance in cognitive outcome among sibs
- Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or
- Additional pathogenic variants possibly explaining the CHD in the first subject.

There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes.
Sources: Literature, Other
Growth failure v0.96 Zornitza Stark removed gene:THRB from the panel
Growth failure v0.95 Zornitza Stark removed gene:IGFBP3 from the panel
Growth failure v0.94 Zornitza Stark removed gene:IGFBP1 from the panel
Growth failure v0.93 MRAS Zornitza Stark Marked gene: MRAS as ready
Growth failure v0.93 MRAS Zornitza Stark Gene: mras has been classified as Green List (High Evidence).
Growth failure v0.93 MRAS Zornitza Stark Mode of pathogenicity for gene: MRAS was changed from None to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Growth failure v0.92 MRAS Zornitza Stark Classified gene: MRAS as Green List (high evidence)
Growth failure v0.92 MRAS Zornitza Stark Gene: mras has been classified as Green List (High Evidence).
Growth failure v0.91 MRAS Zornitza Stark gene: MRAS was added
gene: MRAS was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: MRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MRAS were set to 28289718; 31173466; 31108500; 31173466
Phenotypes for gene: MRAS were set to Noonan syndrome 11, MIM#618499
Review for gene: MRAS was set to GREEN
Added comment: At least 6 unrelated individuals reported.
Sources: Expert Review
Pituitary hormone deficiency v0.13 BTK Zornitza Stark Marked gene: BTK as ready
Pituitary hormone deficiency v0.13 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Pituitary hormone deficiency v0.13 BTK Zornitza Stark reviewed gene: BTK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8013627, 7849697, 9554752; Phenotypes: Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.90 BTK Zornitza Stark Publications for gene: BTK were set to 8013627; 7849697
Growth failure v0.89 BTK Zornitza Stark changed review comment from: At least 3 families reported with GH deficiency plus agammaglobulinaemia.; to: At least 4 families reported with GH deficiency plus agammaglobulinaemia.
Growth failure v0.89 BTK Zornitza Stark edited their review of gene: BTK: Changed publications: 8013627, 7849697, 9554752
Growth failure v0.89 BTK Zornitza Stark Marked gene: BTK as ready
Growth failure v0.89 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Growth failure v0.89 BTK Zornitza Stark Phenotypes for gene: BTK were changed from to Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200
Growth failure v0.88 BTK Zornitza Stark Publications for gene: BTK were set to
Growth failure v0.87 BTK Zornitza Stark Mode of inheritance for gene: BTK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.86 BTK Zornitza Stark Classified gene: BTK as Green List (high evidence)
Growth failure v0.86 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Growth failure v0.85 BTK Zornitza Stark reviewed gene: BTK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8013627, 7849697; Phenotypes: Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Predominantly Antibody Deficiency v0.89 BTK Zornitza Stark Marked gene: BTK as ready
Predominantly Antibody Deficiency v0.89 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.89 BTK Zornitza Stark Phenotypes for gene: BTK were changed from to Agammaglobulinaemia, X-linked 1, MIM# 300755; Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200
Predominantly Antibody Deficiency v0.88 BTK Zornitza Stark Publications for gene: BTK were set to
Predominantly Antibody Deficiency v0.87 BTK Zornitza Stark Mode of inheritance for gene: BTK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Predominantly Antibody Deficiency v0.86 BTK Zornitza Stark reviewed gene: BTK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8013627, 7849697; Phenotypes: Agammaglobulinaemia, X-linked 1, MIM# 300755, Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8821 MOCOS Zornitza Stark Marked gene: MOCOS as ready
Mendeliome v0.8821 MOCOS Zornitza Stark Gene: mocos has been classified as Green List (High Evidence).
Mendeliome v0.8821 MOCOS Zornitza Stark Phenotypes for gene: MOCOS were changed from to Xanthinuria type II, MIM#603592
Mendeliome v0.8820 MOCOS Zornitza Stark Publications for gene: MOCOS were set to
Mendeliome v0.8819 MOCOS Zornitza Stark Mode of inheritance for gene: MOCOS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8818 MOCOS Zornitza Stark reviewed gene: MOCOS: Rating: GREEN; Mode of pathogenicity: None; Publications: 11302742, 17368066, 14624414, 25967871, 34356852, 32073534, 30758870, 27919260; Phenotypes: Xanthinuria type II, MIM#603592; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8818 HNMT Zornitza Stark Marked gene: HNMT as ready
Mendeliome v0.8818 HNMT Zornitza Stark Gene: hnmt has been classified as Green List (High Evidence).
Mendeliome v0.8818 HNMT Zornitza Stark Phenotypes for gene: HNMT were changed from to Mental retardation, autosomal recessive 51, MIM#616739
Mendeliome v0.8817 HNMT Zornitza Stark Publications for gene: HNMT were set to
Mendeliome v0.8816 HNMT Zornitza Stark Mode of inheritance for gene: HNMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8815 HNMT Zornitza Stark reviewed gene: HNMT: Rating: GREEN; Mode of pathogenicity: None; Publications: 26206890, 30744146, 33310825, 33739554; Phenotypes: Mental retardation, autosomal recessive 51, MIM#616739; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4053 HNMT Zornitza Stark Publications for gene: HNMT were set to 26206890; 30744146
Intellectual disability syndromic and non-syndromic v0.4052 HNMT Zornitza Stark edited their review of gene: HNMT: Added comment: Verhoeven et al. 2020 (PMID: 33310825) report an adult male patient with severe intellectual disability and autism, born to second cousins, with a homozygous nonsense variant (c.88C>T; p.Gln30*). Treatment with antihistaminergic medication and a histamine-restricted diet resulted in significant general improvement, supporting an etiological role for HNMT deficiency. Taskiran et al. 2021 (PMID: 33739554) report an adult male patient with severe intellectual disability, pervasive developmental disorder and ADHD, born to consanguineous parents, with a homozygous nonsense variant (c.100G>T; p.Glu34*).; Changed publications: 26206890, 30744146, 33310825, 33739554
Predominantly Antibody Deficiency v0.86 BLNK Zornitza Stark Marked gene: BLNK as ready
Predominantly Antibody Deficiency v0.86 BLNK Zornitza Stark Gene: blnk has been classified as Green List (High Evidence).
Mendeliome v0.8815 BLNK Zornitza Stark Marked gene: BLNK as ready
Mendeliome v0.8815 BLNK Zornitza Stark Gene: blnk has been classified as Green List (High Evidence).
Mendeliome v0.8815 BLNK Zornitza Stark Phenotypes for gene: BLNK were changed from to Agammaglobulinaemia 4, MIM# 613502
Mendeliome v0.8814 BLNK Zornitza Stark Publications for gene: BLNK were set to
Mendeliome v0.8813 BLNK Zornitza Stark Mode of inheritance for gene: BLNK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.86 BLNK Zornitza Stark Phenotypes for gene: BLNK were changed from to Agammaglobulinaemia 4, MIM# 613502
Mendeliome v0.8812 BLNK Zornitza Stark reviewed gene: BLNK: Rating: GREEN; Mode of pathogenicity: None; Publications: 10583958, 32194234, 25893637; Phenotypes: Agammaglobulinaemia 4, MIM# 613502; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.85 BLNK Zornitza Stark Publications for gene: BLNK were set to
Predominantly Antibody Deficiency v0.84 BLNK Zornitza Stark Mode of inheritance for gene: BLNK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.83 BLNK Zornitza Stark edited their review of gene: BLNK: Changed phenotypes: Agammaglobulinaemia 4, MIM# 613502
Predominantly Antibody Deficiency v0.83 BLNK Zornitza Stark edited their review of gene: BLNK: Changed rating: GREEN
Predominantly Antibody Deficiency v0.83 BLNK Zornitza Stark reviewed gene: BLNK: Rating: ; Mode of pathogenicity: None; Publications: 10583958, 32194234, 25893637; Phenotypes: Agammaglobulinemia 4, MIM# 613502; Mode of inheritance: None
Mendeliome v0.8812 AICDA Zornitza Stark Marked gene: AICDA as ready
Mendeliome v0.8812 AICDA Zornitza Stark Gene: aicda has been classified as Green List (High Evidence).
Mendeliome v0.8812 AICDA Zornitza Stark Phenotypes for gene: AICDA were changed from to Immunodeficiency with hyper-IgM, type 2, MIM# 605258
Mendeliome v0.8811 AICDA Zornitza Stark Publications for gene: AICDA were set to
Mendeliome v0.8810 AICDA Zornitza Stark Mode of inheritance for gene: AICDA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8809 AICDA Zornitza Stark reviewed gene: AICDA: Rating: GREEN; Mode of pathogenicity: None; Publications: 11007475; Phenotypes: Immunodeficiency with hyper-IgM, type 2, MIM# 605258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.83 AICDA Zornitza Stark Marked gene: AICDA as ready
Predominantly Antibody Deficiency v0.83 AICDA Zornitza Stark Gene: aicda has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.83 AICDA Zornitza Stark Phenotypes for gene: AICDA were changed from to Immunodeficiency with hyper-IgM, type 2, MIM# 605258
Predominantly Antibody Deficiency v0.82 AICDA Zornitza Stark Publications for gene: AICDA were set to
Predominantly Antibody Deficiency v0.81 AICDA Zornitza Stark Mode of inheritance for gene: AICDA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.80 AICDA Zornitza Stark reviewed gene: AICDA: Rating: GREEN; Mode of pathogenicity: None; Publications: 11007475; Phenotypes: Immunodeficiency with hyper-IgM, type 2, MIM# 605258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cholestasis v0.202 SLC51B Zornitza Stark Marked gene: SLC51B as ready
Cholestasis v0.202 SLC51B Zornitza Stark Gene: slc51b has been classified as Red List (Low Evidence).
Cholestasis v0.202 SLC51B Zornitza Stark gene: SLC51B was added
gene: SLC51B was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: SLC51B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51B were set to 28898457
Phenotypes for gene: SLC51B were set to Bile acid malabsorption, primary, 2, MIM# 619481; Congenital diarrhoea; Cholestasis
Review for gene: SLC51B was set to RED
Added comment: Two siblings reported with homozygous LOF variant in this gene and congenital diarrhoea/cholestasis.
Sources: Literature
Mendeliome v0.8809 SLC51B Zornitza Stark Phenotypes for gene: SLC51B were changed from Congenital diarrhoea; Cholestasis to Bile acid malabsorption, primary, 2, MIM# 619481; Congenital diarrhoea; Cholestasis
Mendeliome v0.8808 SLC51B Zornitza Stark edited their review of gene: SLC51B: Changed phenotypes: Bile acid malabsorption, primary, 2, MIM# 619481, Congenital diarrhoea, Cholestasis
Congenital Diarrhoea v1.6 SLC51B Zornitza Stark Phenotypes for gene: SLC51B were changed from Congenital diarrhoea; Cholestasis to Bile acid malabsorption, primary, 2, MIM# 619481; Congenital diarrhoea; Cholestasis
Congenital Diarrhoea v1.5 SLC51B Zornitza Stark edited their review of gene: SLC51B: Changed phenotypes: Bile acid malabsorption, primary, 2, MIM# 619481, Congenital diarrhoea, Cholestasis
Microcephaly v1.40 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Microcephaly v1.40 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.40 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Microcephaly v1.40 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.39 VPS50 Zornitza Stark gene: VPS50 was added
gene: VPS50 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.
Sources: Literature
Cholestasis v0.201 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Cholestasis v0.201 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Cholestasis v0.201 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Cholestasis v0.201 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Cholestasis v0.200 VPS50 Zornitza Stark gene: VPS50 was added
gene: VPS50 was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.
Sources: Literature
Mendeliome v0.8808 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Mendeliome v0.8808 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8808 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Mendeliome v0.8808 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8807 VPS50 Zornitza Stark gene: VPS50 was added
gene: VPS50 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.
Sources: Literature
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1168 VPS50 Konstantinos Varvagiannis gene: VPS50 was added
gene: VPS50 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Penetrance for gene: VPS50 were set to Complete
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.

Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4051 VPS50 Konstantinos Varvagiannis gene: VPS50 was added
gene: VPS50 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Penetrance for gene: VPS50 were set to Complete
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.

Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports.
Sources: Literature
Amelogenesis imperfecta v1.0 Zornitza Stark promoted panel to version 1.0
Amelogenesis imperfecta v0.72 SMARCD2 Zornitza Stark Marked gene: SMARCD2 as ready
Amelogenesis imperfecta v0.72 SMARCD2 Zornitza Stark Gene: smarcd2 has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.72 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Amelogenesis imperfecta v0.71 Zornitza Stark removed gene:TUFT1 from the panel
Amelogenesis imperfecta v0.70 TP63 Zornitza Stark Marked gene: TP63 as ready
Amelogenesis imperfecta v0.70 TP63 Zornitza Stark Gene: tp63 has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.70 TP63 Zornitza Stark Phenotypes for gene: TP63 were changed from Split hand-split foot-ectodermal dysplasia and amelogenesis imperfecta to Split-hand/foot malformation 4, MIM# 605289
Amelogenesis imperfecta v0.69 TP63 Zornitza Stark Publications for gene: TP63 were set to
Amelogenesis imperfecta v0.68 TP63 Zornitza Stark reviewed gene: TP63: Rating: RED; Mode of pathogenicity: None; Publications: 22065540; Phenotypes: Split-hand/foot malformation 4, MIM# 605289; Mode of inheritance: None
Amelogenesis imperfecta v0.68 TMEM165 Zornitza Stark Marked gene: TMEM165 as ready
Amelogenesis imperfecta v0.68 TMEM165 Zornitza Stark Gene: tmem165 has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.68 TMEM165 Zornitza Stark Phenotypes for gene: TMEM165 were changed from amelogenesis imperfecta to Congenital disorder of glycosylation, type IIk, MIM# 614727; amelogenesis imperfecta
Amelogenesis imperfecta v0.67 TMEM165 Zornitza Stark reviewed gene: TMEM165: Rating: RED; Mode of pathogenicity: None; Publications: 22683087; Phenotypes: Congenital disorder of glycosylation, type IIk, MIM# 614727; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.67 SMARCD2 Zornitza Stark reviewed gene: SMARCD2: Rating: RED; Mode of pathogenicity: None; Publications: 28369036; Phenotypes: Specific granule deficiency 2, MIM# 617475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.67 KCNJ1 Zornitza Stark Marked gene: KCNJ1 as ready
Amelogenesis imperfecta v0.67 KCNJ1 Zornitza Stark Gene: kcnj1 has been classified as Red List (Low Evidence).
Mendeliome v0.8806 SP6 Zornitza Stark Publications for gene: SP6 were set to 32167558; 18156176; 18297738; 22676574
Mendeliome v0.8805 SP6 Zornitza Stark Mode of inheritance for gene: SP6 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8804 SP6 Zornitza Stark Classified gene: SP6 as Green List (high evidence)
Mendeliome v0.8804 SP6 Zornitza Stark Gene: sp6 has been classified as Green List (High Evidence).
Mendeliome v0.8803 SP6 Zornitza Stark reviewed gene: SP6: Rating: GREEN; Mode of pathogenicity: None; Publications: 33652941; Phenotypes: Hypoplastic amelogenesis imperfecta; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Amelogenesis imperfecta v0.67 SP6 Zornitza Stark Marked gene: SP6 as ready
Amelogenesis imperfecta v0.67 SP6 Zornitza Stark Gene: sp6 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.67 SP6 Zornitza Stark Publications for gene: SP6 were set to 18297738; 32167558; 18156176; 22676574
Amelogenesis imperfecta v0.66 SP6 Zornitza Stark Classified gene: SP6 as Green List (high evidence)
Amelogenesis imperfecta v0.66 SP6 Zornitza Stark Gene: sp6 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.65 SP6 Zornitza Stark edited their review of gene: SP6: Changed rating: GREEN
Amelogenesis imperfecta v0.65 SP6 Zornitza Stark reviewed gene: SP6: Rating: ; Mode of pathogenicity: None; Publications: 18297738, 32167558, 18156176, 22676574, 33652941; Phenotypes: Amelogenesis imperfecta; Mode of inheritance: None
Amelogenesis imperfecta v0.65 LAMC2 Zornitza Stark Classified gene: LAMC2 as Green List (high evidence)
Amelogenesis imperfecta v0.65 LAMC2 Zornitza Stark Gene: lamc2 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.64 LAMC2 Zornitza Stark Marked gene: LAMC2 as ready
Amelogenesis imperfecta v0.64 LAMC2 Zornitza Stark Gene: lamc2 has been classified as Amber List (Moderate Evidence).
Amelogenesis imperfecta v0.64 LAMC2 Zornitza Stark Phenotypes for gene: LAMC2 were changed from Amelogenesis Imperfecta; Epidermolysis bullosa, junctional, non-Herlitz type, 226650; Epidermolysis bullosa, junctional, Herlitz type, 226700 to Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700; Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650
Amelogenesis imperfecta v0.63 LAMC2 Zornitza Stark Mode of inheritance for gene: LAMC2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.62 LAMC2 Zornitza Stark edited their review of gene: LAMC2: Changed publications: 26956061
Amelogenesis imperfecta v0.62 LAMC2 Zornitza Stark reviewed gene: LAMC2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700, Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Usher Syndrome v1.4 PEX26 Zornitza Stark Marked gene: PEX26 as ready
Usher Syndrome v1.4 PEX26 Zornitza Stark Gene: pex26 has been classified as Green List (High Evidence).
Usher Syndrome v1.4 PEX26 Zornitza Stark Classified gene: PEX26 as Green List (high evidence)
Usher Syndrome v1.4 PEX26 Zornitza Stark Gene: pex26 has been classified as Green List (High Evidence).
Usher Syndrome v1.3 PEX26 Zornitza Stark gene: PEX26 was added
gene: PEX26 was added to Usher Syndrome. Sources: Expert Review
Mode of inheritance for gene: PEX26 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX26 were set to 28944237; 33926089; 28944237
Phenotypes for gene: PEX26 were set to Heimler syndrome
Review for gene: PEX26 was set to GREEN
Added comment: 5 families reported with Heimler syndrome phenotype.
Sources: Expert Review
Amelogenesis imperfecta v0.62 PEX26 Zornitza Stark Marked gene: PEX26 as ready
Amelogenesis imperfecta v0.62 PEX26 Zornitza Stark Gene: pex26 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.62 PEX26 Zornitza Stark Phenotypes for gene: PEX26 were changed from Peroxisome biogenesis disorder 7B, 614873; Peroxisome biogenesis disorder 7A (Zellweger), 614872; enamel dysplasia; Heimler syndrome; Amelogenesis imperfecta to Heimler syndrome; Amelogenesis imperfecta
Amelogenesis imperfecta v0.61 PEX26 Zornitza Stark Publications for gene: PEX26 were set to 28944237
Amelogenesis imperfecta v0.60 PEX26 Zornitza Stark Classified gene: PEX26 as Green List (high evidence)
Amelogenesis imperfecta v0.60 PEX26 Zornitza Stark Gene: pex26 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.59 PEX26 Zornitza Stark reviewed gene: PEX26: Rating: GREEN; Mode of pathogenicity: None; Publications: 28944237, 33926089; Phenotypes: Heimler syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.59 ITGB4 Zornitza Stark Marked gene: ITGB4 as ready
Amelogenesis imperfecta v0.59 ITGB4 Zornitza Stark Gene: itgb4 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.59 ITGB4 Zornitza Stark Phenotypes for gene: ITGB4 were changed from Epidermolysis bullosa, junctional, non-Herlitz type, 226650 (includes enamel pitting); Amelogenesis Imperfecta; Epidermolysis bullosa, junctional, with pyloric atresia, 226730 (includes Enamel hypoplasia) to Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650; Epidermolysis bullosa, junctional, with pyloric atresia, MIM# 226730
Amelogenesis imperfecta v0.58 ITGB4 Zornitza Stark Mode of inheritance for gene: ITGB4 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.57 ITGB4 Zornitza Stark Classified gene: ITGB4 as Green List (high evidence)
Amelogenesis imperfecta v0.57 ITGB4 Zornitza Stark Gene: itgb4 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.56 ITGB4 Zornitza Stark reviewed gene: ITGB4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650, Epidermolysis bullosa, junctional, with pyloric atresia, MIM# 226730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.56 CLDN19 Zornitza Stark Marked gene: CLDN19 as ready
Amelogenesis imperfecta v0.56 CLDN19 Zornitza Stark Gene: cldn19 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.56 CLDN19 Zornitza Stark Phenotypes for gene: CLDN19 were changed from Amelogenesis imperfecta in familial hypomagnesaemia and hypercalciuria with nephrocalcinosis (FHHNC) to Hypomagnesaemia 5, renal, with ocular involvement, MIM# 248190; Amelogenesis imperfecta
Amelogenesis imperfecta v0.55 CLDN19 Zornitza Stark Classified gene: CLDN19 as Green List (high evidence)
Amelogenesis imperfecta v0.55 CLDN19 Zornitza Stark Gene: cldn19 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.54 CLDN19 Zornitza Stark reviewed gene: CLDN19: Rating: GREEN; Mode of pathogenicity: None; Publications: 27530400; Phenotypes: Hypomagnesaemia 5, renal, with ocular involvement, MIM# 248190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.54 CLDN16 Zornitza Stark Phenotypes for gene: CLDN16 were changed from Hypomagnesemia 3, renal, MIM# 248250; Amelogenesis imperfecta to Hypomagnesaemia 3, renal, MIM# 248250; Amelogenesis imperfecta
Amelogenesis imperfecta v0.53 CLDN16 Zornitza Stark edited their review of gene: CLDN16: Changed phenotypes: Hypomagnesaemia 3, renal, MIM# 248250; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.53 CLDN16 Zornitza Stark Marked gene: CLDN16 as ready
Amelogenesis imperfecta v0.53 CLDN16 Zornitza Stark Gene: cldn16 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.53 CLDN16 Zornitza Stark Phenotypes for gene: CLDN16 were changed from Amelogenesis imperfecta in familial hypomagnesaemia and hypercalciuria with nephrocalcinosis (FHHNC) to Hypomagnesemia 3, renal, MIM# 248250; Amelogenesis imperfecta
Amelogenesis imperfecta v0.52 CLDN16 Zornitza Stark Classified gene: CLDN16 as Green List (high evidence)
Amelogenesis imperfecta v0.52 CLDN16 Zornitza Stark Gene: cldn16 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.51 CLDN16 Zornitza Stark reviewed gene: CLDN16: Rating: GREEN; Mode of pathogenicity: None; Publications: 26426912; Phenotypes: Hypomagnesemia 3, renal, MIM# 248250; Mode of inheritance: None
Amelogenesis imperfecta v0.51 C4orf26 Zornitza Stark Marked gene: C4orf26 as ready
Amelogenesis imperfecta v0.51 C4orf26 Zornitza Stark Added comment: Comment when marking as ready: New HGNC approved name: ODAPH
Amelogenesis imperfecta v0.51 C4orf26 Zornitza Stark Gene: c4orf26 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.51 C4orf26 Zornitza Stark Tag new gene name tag was added to gene: C4orf26.
Mendeliome v0.8803 AMTN Zornitza Stark Marked gene: AMTN as ready
Mendeliome v0.8803 AMTN Zornitza Stark Gene: amtn has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.51 AMTN Zornitza Stark Mode of pathogenicity for gene: AMTN was changed from None to Other
Mendeliome v0.8803 AMTN Zornitza Stark gene: AMTN was added
gene: AMTN was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: AMTN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AMTN were set to 27412008; 25715379; 26620968
Phenotypes for gene: AMTN were set to Amelogenesis imperfecta, type IIIB
Mode of pathogenicity for gene: AMTN was set to Other
Review for gene: AMTN was set to RED
Added comment: In a Costa Rican family segregating autosomal dominant hypomineralized amelogenesis imperfecta, Smith et al. (2016) identified a heterozygous deletion/insertion mutation in the amelotin gene that segregated with the phenotype in the family. The mutation was predicted to result in an in-frame deletion of 92 amino acids, shortening the protein from 209 to 117 amino acids. Mode of pathogenicity not established. Toxic gain of function proposed as Atmn KO and +/- mice did not recapitulate the human phenotype.
Sources: Expert Review
Amelogenesis imperfecta v0.50 AMTN Zornitza Stark Mode of pathogenicity for gene: AMTN was changed from to None
Amelogenesis imperfecta v0.49 AMTN Zornitza Stark Marked gene: AMTN as ready
Amelogenesis imperfecta v0.49 AMTN Zornitza Stark Gene: amtn has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.49 AMTN Zornitza Stark Phenotypes for gene: AMTN were changed from dominant hypomineralised AI; Amelogenesis imperfecta; ?Amelogenesis imperfecta, type IIIB, 617607; Amelogenesis imperfecta, hypomaturation type to Amelogenesis imperfecta, type IIIB
Amelogenesis imperfecta v0.48 AMTN Zornitza Stark Publications for gene: AMTN were set to 27412008
Amelogenesis imperfecta v0.47 AMTN Zornitza Stark Classified gene: AMTN as Red List (low evidence)
Amelogenesis imperfecta v0.47 AMTN Zornitza Stark Gene: amtn has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.46 AMTN Zornitza Stark reviewed gene: AMTN: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.8802 WDR72 Zornitza Stark Marked gene: WDR72 as ready
Mendeliome v0.8802 WDR72 Zornitza Stark Gene: wdr72 has been classified as Green List (High Evidence).
Mendeliome v0.8802 WDR72 Zornitza Stark Phenotypes for gene: WDR72 were changed from to Amelogenesis imperfecta, type IIA3, MIM# 613211
Mendeliome v0.8801 WDR72 Zornitza Stark Publications for gene: WDR72 were set to
Mendeliome v0.8800 WDR72 Zornitza Stark Mode of inheritance for gene: WDR72 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8799 WDR72 Zornitza Stark reviewed gene: WDR72: Rating: GREEN; Mode of pathogenicity: None; Publications: 21196691, 27259663, 20938048, 26502894, 23293580, 25008349, 19853237; Phenotypes: Amelogenesis imperfecta, type IIA3, MIM# 613211; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.46 WDR72 Zornitza Stark Marked gene: WDR72 as ready
Amelogenesis imperfecta v0.46 WDR72 Zornitza Stark Gene: wdr72 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.46 WDR72 Zornitza Stark Phenotypes for gene: WDR72 were changed from Amelogenesis Imperfecta, Type IIA3, 613211; Amelogenesis imperfecta, type IIA3, 613211; Amelogenesis Imperfecta, Recessive; Hypomaturation AI to Amelogenesis imperfecta, type IIA3, MIM# 613211
Amelogenesis imperfecta v0.45 WDR72 Zornitza Stark reviewed gene: WDR72: Rating: GREEN; Mode of pathogenicity: None; Publications: 21196691, 27259663, 20938048, 26502894, 23293580, 25008349, 19853237; Phenotypes: Amelogenesis imperfecta, type IIA3, MIM# 613211; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.45 STIM1 Zornitza Stark Marked gene: STIM1 as ready
Amelogenesis imperfecta v0.45 STIM1 Zornitza Stark Gene: stim1 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.45 STIM1 Zornitza Stark Phenotypes for gene: STIM1 were changed from Immunodeficiency 10, 612783 to Immunodeficiency 10, MIM# 612783; Hypomineralised amelogenesis imperfecta
Amelogenesis imperfecta v0.44 STIM1 Zornitza Stark Publications for gene: STIM1 were set to 19420366; 26560041; 24621671; 22190180; 28732182
Amelogenesis imperfecta v0.43 STIM1 Zornitza Stark reviewed gene: STIM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31448844; Phenotypes: Immunodeficiency 10, MIM# 612783; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8799 SLC24A4 Zornitza Stark Marked gene: SLC24A4 as ready
Mendeliome v0.8799 SLC24A4 Zornitza Stark Gene: slc24a4 has been classified as Green List (High Evidence).
Mendeliome v0.8799 SLC24A4 Zornitza Stark Phenotypes for gene: SLC24A4 were changed from to Amelogenesis imperfecta, type IIA5, MIM# 615887
Mendeliome v0.8798 SLC24A4 Zornitza Stark Publications for gene: SLC24A4 were set to
Mendeliome v0.8797 SLC24A4 Zornitza Stark Mode of inheritance for gene: SLC24A4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8796 SLC24A4 Zornitza Stark reviewed gene: SLC24A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 23375655, 24621671, 25442250, 24532815, 26502894, 27129268; Phenotypes: Amelogenesis imperfecta, type IIA5, MIM# 615887; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.43 SLC24A4 Zornitza Stark Marked gene: SLC24A4 as ready
Amelogenesis imperfecta v0.43 SLC24A4 Zornitza Stark Gene: slc24a4 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.43 SLC24A4 Zornitza Stark Phenotypes for gene: SLC24A4 were changed from Amelogenesis imperfecta, type IIA5, 615887; amelogenesis imperfecta (non-syndromic form); hypomaturation/hypomineralised amelogenesis imperfecta to Amelogenesis imperfecta, type IIA5, MIM# 615887
Amelogenesis imperfecta v0.42 SLC24A4 Zornitza Stark changed review comment from: At least 3 families and a mouse model.; to: Multiple families and a mouse model.
Amelogenesis imperfecta v0.42 SLC24A4 Zornitza Stark edited their review of gene: SLC24A4: Changed publications: 23375655, 24621671, 25442250, 24532815, 26502894, 27129268
Amelogenesis imperfecta v0.42 SLC24A4 Zornitza Stark reviewed gene: SLC24A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 23375655, 24621671; Phenotypes: Amelogenesis imperfecta, type IIA5, MIM# 615887; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.42 SLC13A5 Zornitza Stark Marked gene: SLC13A5 as ready
Amelogenesis imperfecta v0.42 SLC13A5 Zornitza Stark Gene: slc13a5 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.42 SLC13A5 Zornitza Stark Phenotypes for gene: SLC13A5 were changed from Kohlsch tter-T nz syndrome(KTZS); Epileptic encephalopathy, early infantile, 25 615905; hypoplastic amelogenesis imperfecta to Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905
Amelogenesis imperfecta v0.41 SLC10A7 Zornitza Stark Marked gene: SLC10A7 as ready
Amelogenesis imperfecta v0.41 SLC10A7 Zornitza Stark Gene: slc10a7 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.41 SLC10A7 Zornitza Stark Phenotypes for gene: SLC10A7 were changed from short stature; amelogenesis imperfect hypo mineralised; skeletal dysplasia; Short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis (SSASKS) 618363; skeletal dysplasia and amelogenesis imperfecta; scoliosis to Short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis (MIM#618363)
Intellectual disability syndromic and non-syndromic v0.4051 ROGDI Zornitza Stark Marked gene: ROGDI as ready
Intellectual disability syndromic and non-syndromic v0.4051 ROGDI Zornitza Stark Gene: rogdi has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4051 ROGDI Zornitza Stark Phenotypes for gene: ROGDI were changed from to Kohlschutter-Tonz syndrome, MIM# 226750
Intellectual disability syndromic and non-syndromic v0.4050 ROGDI Zornitza Stark Publications for gene: ROGDI were set to
Intellectual disability syndromic and non-syndromic v0.4049 ROGDI Zornitza Stark Mode of inheritance for gene: ROGDI was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4048 ROGDI Zornitza Stark reviewed gene: ROGDI: Rating: GREEN; Mode of pathogenicity: None; Publications: 22424600, 23086778, 33866847; Phenotypes: Kohlschutter-Tonz syndrome, MIM# 226750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1168 ROGDI Zornitza Stark Marked gene: ROGDI as ready
Genetic Epilepsy v0.1168 ROGDI Zornitza Stark Gene: rogdi has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1168 ROGDI Zornitza Stark Phenotypes for gene: ROGDI were changed from to Kohlschutter-Tonz syndrome, MIM# 226750
Genetic Epilepsy v0.1168 ROGDI Zornitza Stark Publications for gene: ROGDI were set to
Genetic Epilepsy v0.1167 ROGDI Zornitza Stark Mode of inheritance for gene: ROGDI was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1166 ROGDI Zornitza Stark reviewed gene: ROGDI: Rating: GREEN; Mode of pathogenicity: None; Publications: 22424600, 23086778, 33866847; Phenotypes: Kohlschutter-Tonz syndrome, MIM# 226750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8796 ROGDI Zornitza Stark Marked gene: ROGDI as ready
Mendeliome v0.8796 ROGDI Zornitza Stark Gene: rogdi has been classified as Green List (High Evidence).
Mendeliome v0.8796 ROGDI Zornitza Stark Phenotypes for gene: ROGDI were changed from to Kohlschutter-Tonz syndrome, MIM# 226750
Mendeliome v0.8795 ROGDI Zornitza Stark Publications for gene: ROGDI were set to
Mendeliome v0.8794 ROGDI Zornitza Stark Mode of inheritance for gene: ROGDI was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8793 ROGDI Zornitza Stark reviewed gene: ROGDI: Rating: GREEN; Mode of pathogenicity: None; Publications: 22424600, 23086778, 33866847; Phenotypes: Kohlschutter-Tonz syndrome, MIM# 226750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.40 ROGDI Zornitza Stark Marked gene: ROGDI as ready
Amelogenesis imperfecta v0.40 ROGDI Zornitza Stark Gene: rogdi has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.40 ROGDI Zornitza Stark Phenotypes for gene: ROGDI were changed from Amelogenesis imperfecta, hypocalcified type (primary and secondary teeth); Kohlschutter-Tonz syndrome, 226750 to Kohlschutter-Tonz syndrome MIM #226750; Amelogenesis imperfecta, hypocalcified type (primary and secondary teeth)
Mendeliome v0.8793 RELT Zornitza Stark Marked gene: RELT as ready
Mendeliome v0.8793 RELT Zornitza Stark Gene: relt has been classified as Green List (High Evidence).
Mendeliome v0.8793 RELT Zornitza Stark Classified gene: RELT as Green List (high evidence)
Mendeliome v0.8793 RELT Zornitza Stark Gene: relt has been classified as Green List (High Evidence).
Mendeliome v0.8792 RELT Zornitza Stark gene: RELT was added
gene: RELT was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: RELT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RELT were set to 30506946
Phenotypes for gene: RELT were set to Amelogenesis imperfecta, type IIIC, MIM# 618386
Review for gene: RELT was set to GREEN
Added comment: Amelogenesis imperfecta type IIIC is characterized by hypocalcified enamel in both the primary and secondary dentition. The enamel is rough and yellow-brown; under normal use, the enamel disintegrates from occlusal surfaces of the molars, leaving a ring of intact enamel remaining on the sides. At least 3 families and a mouse model.
Sources: Expert Review
Amelogenesis imperfecta v0.39 RELT Zornitza Stark Marked gene: RELT as ready
Amelogenesis imperfecta v0.39 RELT Zornitza Stark Gene: relt has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.39 RELT Zornitza Stark Phenotypes for gene: RELT were changed from amelogenesis imperfecta (hypoplastic); Amelogenesis imperfecta, type IIIC, 618386 to Amelogenesis imperfecta, type IIIC, MIM# 618386
Amelogenesis imperfecta v0.38 RELT Zornitza Stark reviewed gene: RELT: Rating: GREEN; Mode of pathogenicity: None; Publications: 30506946; Phenotypes: Amelogenesis imperfecta, type IIIC, MIM# 618386; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.38 PEX6 Zornitza Stark Marked gene: PEX6 as ready
Amelogenesis imperfecta v0.38 PEX6 Zornitza Stark Gene: pex6 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.38 PEX6 Zornitza Stark Phenotypes for gene: PEX6 were changed from Peroxisome biogenesis disorder 4A (Zellweger), 614862; Heimler Syndrome 2, 616617 (includes amelogenesis imperfecta); Peroxisome biogenesis disorder 4B, 614863 to Heimler syndrome 2, MIM# 616617
Amelogenesis imperfecta v0.37 PEX6 Zornitza Stark Publications for gene: PEX6 were set to 26387595; 27302843; 16530715
Amelogenesis imperfecta v0.36 PEX6 Zornitza Stark reviewed gene: PEX6: Rating: GREEN; Mode of pathogenicity: None; Publications: 26387595, 27633571, 27302843; Phenotypes: Heimler syndrome 2, MIM# 616617; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.36 PEX1 Zornitza Stark edited their review of gene: PEX1: Changed publications: 26387595, 27633571, 27302843
Amelogenesis imperfecta v0.36 PEX1 Zornitza Stark Marked gene: PEX1 as ready
Amelogenesis imperfecta v0.36 PEX1 Zornitza Stark Gene: pex1 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.36 PEX1 Zornitza Stark Phenotypes for gene: PEX1 were changed from Peroxisome biogenesis disorder 1A (Zellweger), 214100; Heimler Syndrome 1, 234580 (includes amelogenesis imperfecta); Peroxisomal Biogenesis Disorder 1A (NALD / IRD) 601539; hypomineralized amelogenesis imperfecta; amelogenesis imperfecta to Heimler syndrome 1, MIM# 234580
Amelogenesis imperfecta v0.35 PEX1 Zornitza Stark reviewed gene: PEX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Heimler syndrome 1, MIM# 234580; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.35 ORAI1 Zornitza Stark Marked gene: ORAI1 as ready
Amelogenesis imperfecta v0.35 ORAI1 Zornitza Stark Gene: orai1 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.35 ORAI1 Zornitza Stark Phenotypes for gene: ORAI1 were changed from Immunodeficiency 9, 612782 to Immunodeficiency 9, MIM# 612782; Hypocalcified amelogenesis imperfecta
Amelogenesis imperfecta v0.34 ORAI1 Zornitza Stark reviewed gene: ORAI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26469693, 16582901, 20004786; Phenotypes: Immunodeficiency 9, MIM# 612782; Mode of inheritance: None
Amelogenesis imperfecta v0.34 MMP20 Zornitza Stark Marked gene: MMP20 as ready
Amelogenesis imperfecta v0.34 MMP20 Zornitza Stark Gene: mmp20 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.34 MMP20 Zornitza Stark Phenotypes for gene: MMP20 were changed from Amelogenesis Imperfecta, Hypomaturation Type, IIA2, 612529; Amelogenesis imperfecta, type IIA2, 612529; Amelogenesis Imperfecta, Recessive to Amelogenesis imperfecta, type IIA2, MIM# 612529
Amelogenesis imperfecta v0.33 MMP20 Zornitza Stark reviewed gene: MMP20: Rating: GREEN; Mode of pathogenicity: None; Publications: 23625376, 26124219, 28659819, 19966041, 26502894, 28473773, 23355523, 18096894, 16246936, 15744043; Phenotypes: Amelogenesis imperfecta, type IIA2, MIM# 612529; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8791 LAMB3 Zornitza Stark Phenotypes for gene: LAMB3 were changed from Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700; Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650 to Amelogenesis imperfecta, type IA, MIM# 104530; Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700; Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650
Mendeliome v0.8790 LAMB3 Zornitza Stark Publications for gene: LAMB3 were set to 11023379; 7706760
Mendeliome v0.8789 LAMB3 Zornitza Stark Mode of inheritance for gene: LAMB3 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.8788 LAMB3 Zornitza Stark edited their review of gene: LAMB3: Changed publications: 11023379, 7706760, 23958762, 7706760, 23632796, 26502894, 27220909, 25769099, 24494736; Changed phenotypes: Amelogenesis imperfecta, type IA, MIM# 104530, Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700, Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650; Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Amelogenesis imperfecta v0.33 LAMB3 Zornitza Stark Marked gene: LAMB3 as ready
Amelogenesis imperfecta v0.33 LAMB3 Zornitza Stark Gene: lamb3 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.33 LAMB3 Zornitza Stark Phenotypes for gene: LAMB3 were changed from Amelogenesis Imperfecta, Type IA, 104530; Epidermolysis bullosa, junctional, Herlitz type, 26700; Amelogenesis imperfecta, type IA, 104530; Epidermolysis bullosa, junctional, non-Herlitz type, 226650 to Amelogenesis imperfecta, type IA, MIM# 104530; Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700; Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650
Amelogenesis imperfecta v0.32 LAMB3 Zornitza Stark edited their review of gene: LAMB3: Changed publications: 23958762, 7706760, 23632796, 26502894, 27220909, 25769099, 24494736
Amelogenesis imperfecta v0.32 LAMB3 Zornitza Stark reviewed gene: LAMB3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Amelogenesis imperfecta, type IA, MIM# 104530, Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700, Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Short Rib Polydactyly_Jeune Asphyxiating Thoracic Dystrophy_Skeletal Ciliopathy v1.5 KIAA0753 Zornitza Stark Phenotypes for gene: KIAA0753 were changed from Short-rib skeletal dysplasia to Short-rib thoracic dysplasia 21 without polydactyly, MIM# 619479
Short Rib Polydactyly_Jeune Asphyxiating Thoracic Dystrophy_Skeletal Ciliopathy v1.4 KIAA0753 Zornitza Stark Publications for gene: KIAA0753 were set to 29138412
Short Rib Polydactyly_Jeune Asphyxiating Thoracic Dystrophy_Skeletal Ciliopathy v1.3 KIAA0753 Zornitza Stark edited their review of gene: KIAA0753: Added comment: Additional families reported.; Changed publications: 29138412, 31816441, 33875766, 34016807; Changed phenotypes: Short-rib thoracic dysplasia 21 without polydactyly, MIM# 619479
Mendeliome v0.8788 KIAA0753 Zornitza Stark Phenotypes for gene: KIAA0753 were changed from Orofaciodigital syndrome XV, MIM# 617127; Joubert syndrome 38, MIM# 619476 to Orofaciodigital syndrome XV, MIM# 617127; Joubert syndrome 38, MIM# 619476; Short-rib thoracic dysplasia 21 without polydactyly, MIM# 619479
Mendeliome v0.8787 KIAA0753 Zornitza Stark Publications for gene: KIAA0753 were set to 31816441; 28220259; 29138412; 26643951
Mendeliome v0.8786 KIAA0753 Zornitza Stark edited their review of gene: KIAA0753: Added comment: At least 5 families reported with a skeletal ciliopathy.; Changed publications: 29138412, 31816441, 33875766, 34016807; Changed phenotypes: Orofaciodigital syndrome XV 617127, Joubert syndrome, Short-rib thoracic dysplasia 21 without polydactyly, MIM# 619479
Ciliopathies v1.10 KIAA0753 Zornitza Stark Phenotypes for gene: KIAA0753 were changed from Orofaciodigital syndrome XV 617127; Joubert syndrome 38, MIM# 619476 to Orofaciodigital syndrome XV 617127; Joubert syndrome 38, MIM# 619476; Short-rib thoracic dysplasia 21 without polydactyly, MIM# 619479
Ciliopathies v1.9 KIAA0753 Zornitza Stark Publications for gene: KIAA0753 were set to 31816441; 28220259; 29138412; 26643951
Ciliopathies v1.8 KIAA0753 Zornitza Stark edited their review of gene: KIAA0753: Added comment: At least 5 families reported with a skeletal ciliopathy.; Changed rating: GREEN; Changed publications: 29138412, 31816441, 33875766, 34016807; Changed phenotypes: Short-rib thoracic dysplasia 21 without polydactyly, MIM# 619479; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4048 SPTBN1 Zornitza Stark Phenotypes for gene: SPTBN1 were changed from Neurodevelopmental Syndrome to Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475
Genetic Epilepsy v0.1166 SPTBN1 Zornitza Stark Phenotypes for gene: SPTBN1 were changed from Neurodevelopmental Syndrome to Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475
Genetic Epilepsy v0.1165 SPTBN1 Zornitza Stark reviewed gene: SPTBN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475; Mode of inheritance: None
Mendeliome v0.8786 SPTBN1 Zornitza Stark Phenotypes for gene: SPTBN1 were changed from Neurodevelopmental Syndrome; Intellectual disability; Seizures to Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475; Neurodevelopmental Syndrome; Intellectual disability; Seizures
Mendeliome v0.8785 SPTBN1 Zornitza Stark reviewed gene: SPTBN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475; Mode of inheritance: None
Mendeliome v0.8785 NIID Zornitza Stark Phenotypes for STR: NIID were changed from Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866 to Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866; Oculopharyngodistal myopathy 3, MIM# 619473
Mendeliome v0.8784 NIID Zornitza Stark reviewed STR: NIID: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Oculopharyngodistal myopathy 3, MIM# 619473; Mode of inheritance: None
Motor Neurone Disease v0.127 NIID Zornitza Stark Phenotypes for STR: NIID were changed from Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866 to Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866; Oculopharyngodistal myopathy 3, MIM# 619473
Motor Neurone Disease v0.126 NIID Zornitza Stark reviewed STR: NIID: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Oculopharyngodistal myopathy 3, MIM# 619473; Mode of inheritance: None
Amelogenesis imperfecta v0.32 LAMA3 Zornitza Stark Marked gene: LAMA3 as ready
Amelogenesis imperfecta v0.32 LAMA3 Zornitza Stark Gene: lama3 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.32 LAMA3 Zornitza Stark Phenotypes for gene: LAMA3 were changed from Laryngoonychocutaneous syndrome 245660; Epidermolysis bullosa, junctional, Herlitz type 226700; Epidermolysis bullosa, generalized atrophic benign 226650; Amelogenesis imperfecta, hypoplastic type to Epidermolysis bullosa, generalized atrophic benign, MIM# 226650; Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700; Laryngoonychocutaneous syndrome, MIM# 245660
Amelogenesis imperfecta v0.31 LAMA3 Zornitza Stark Mode of inheritance for gene: LAMA3 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.30 LAMA3 Zornitza Stark reviewed gene: LAMA3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Epidermolysis bullosa, generalized atrophic benign, MIM# 226650, Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700, Laryngoonychocutaneous syndrome, MIM# 245660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8784 KLK4 Zornitza Stark Marked gene: KLK4 as ready
Mendeliome v0.8784 KLK4 Zornitza Stark Gene: klk4 has been classified as Green List (High Evidence).
Mendeliome v0.8784 KLK4 Zornitza Stark Phenotypes for gene: KLK4 were changed from to Amelogenesis imperfecta, type IIA1, MIM# 204700
Mendeliome v0.8783 KLK4 Zornitza Stark Publications for gene: KLK4 were set to
Mendeliome v0.8782 KLK4 Zornitza Stark Mode of inheritance for gene: KLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8781 KLK4 Zornitza Stark reviewed gene: KLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 15235027, 23355523, 28611678, 27066511; Phenotypes: Amelogenesis imperfecta, type IIA1, MIM# 204700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Disorders of immune dysregulation v0.96 STAT3 Zornitza Stark Marked gene: STAT3 as ready
Disorders of immune dysregulation v0.96 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Disorders of immune dysregulation v0.96 STAT3 Zornitza Stark Phenotypes for gene: STAT3 were changed from to Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Lymphoproliferation; solid organ autoimmunity; recurrent infections; short stature; eczema; delayed puberty; dental abnormalities; autoimmune interstitial lung disease; juvenile-onset arthritis; primary hypothyroidism
Amelogenesis imperfecta v0.30 KLK4 Zornitza Stark Marked gene: KLK4 as ready
Amelogenesis imperfecta v0.30 KLK4 Zornitza Stark Gene: klk4 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.30 KLK4 Zornitza Stark Phenotypes for gene: KLK4 were changed from Amelogenesis Imperfecta, Hypomaturation Type, IIA1, 204700; Amelogenesis imperfecta, type IIA1, 204700 to Amelogenesis imperfecta, type IIA1, MIM# 204700
Amelogenesis imperfecta v0.29 KLK4 Zornitza Stark Publications for gene: KLK4 were set to 15235027; 23355523; 26124219; 28611678
Amelogenesis imperfecta v0.28 KLK4 Zornitza Stark reviewed gene: KLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 15235027, 23355523, 28611678, 27066511; Phenotypes: Amelogenesis imperfecta, type IIA1, MIM# 204700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8781 ITGB6 Zornitza Stark Marked gene: ITGB6 as ready
Mendeliome v0.8781 ITGB6 Zornitza Stark Gene: itgb6 has been classified as Green List (High Evidence).
Mendeliome v0.8781 ITGB6 Zornitza Stark Classified gene: ITGB6 as Green List (high evidence)
Mendeliome v0.8781 ITGB6 Zornitza Stark Gene: itgb6 has been classified as Green List (High Evidence).
Mendeliome v0.8780 ITGB6 Zornitza Stark gene: ITGB6 was added
gene: ITGB6 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: ITGB6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ITGB6 were set to 25431241; 26695873; 24305999; 24319098
Phenotypes for gene: ITGB6 were set to Amelogenesis imperfecta, type IH, MIM# 616221
Review for gene: ITGB6 was set to GREEN
Added comment: At least 3 unrelated families reported.
Sources: Expert Review
Amelogenesis imperfecta v0.28 ITGB6 Zornitza Stark Publications for gene: ITGB6 were set to 25431241; 26695873; 24305999; 24319098
Amelogenesis imperfecta v0.27 ITGB6 Zornitza Stark Marked gene: ITGB6 as ready
Amelogenesis imperfecta v0.27 ITGB6 Zornitza Stark Gene: itgb6 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.27 ITGB6 Zornitza Stark Phenotypes for gene: ITGB6 were changed from Amelogenesis imperfecta, type IH, 616221; amelogenesis imperfecta (non-syndromic form); Amelogenesis imperfecta, type IH, 616221 to Amelogenesis imperfecta, type IH, MIM# 616221
Amelogenesis imperfecta v0.26 ITGB6 Zornitza Stark reviewed gene: ITGB6: Rating: GREEN; Mode of pathogenicity: None; Publications: 24305999, 24319098; Phenotypes: Amelogenesis imperfecta, type IH, MIM# 616221; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8779 STAT3 Zornitza Stark Marked gene: STAT3 as ready
Mendeliome v0.8779 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Mendeliome v0.8779 STAT3 Zornitza Stark Phenotypes for gene: STAT3 were changed from to Hyper-IgE recurrent infection syndrome MIM# 147060; Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952
Mendeliome v0.8778 STAT3 Zornitza Stark Publications for gene: STAT3 were set to
Mendeliome v0.8777 STAT3 Zornitza Stark Mode of inheritance for gene: STAT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8776 STAT3 Zornitza Stark reviewed gene: STAT3: Rating: GREEN; Mode of pathogenicity: None; Publications: 17881745, 14566054, 25349174, 25038750, 25359994; Phenotypes: Hyper-IgE recurrent infection syndrome MIM# 147060, Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Disorders of immune dysregulation v0.95 STAT3 Zornitza Stark Publications for gene: STAT3 were set to
Disorders of immune dysregulation v0.94 STAT3 Zornitza Stark Mode of pathogenicity for gene: STAT3 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Disorders of immune dysregulation v0.93 STAT3 Zornitza Stark Mode of inheritance for gene: STAT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Disorders of immune dysregulation v0.92 STAT3 Danielle Ariti reviewed gene: STAT3: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 25349174, 25038750, 25359994, 16783372; Phenotypes: Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952, Lymphoproliferation, solid organ autoimmunity, recurrent infections, short stature, eczema, delayed puberty, dental abnormalities, autoimmune interstitial lung disease, juvenile-onset arthritis, primary hypothyroidism; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Congenital Heart Defect v0.125 STK4 Zornitza Stark Marked gene: STK4 as ready
Congenital Heart Defect v0.125 STK4 Zornitza Stark Gene: stk4 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.125 STK4 Zornitza Stark Classified gene: STK4 as Green List (high evidence)
Congenital Heart Defect v0.125 STK4 Zornitza Stark Gene: stk4 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.328 STAT3 Zornitza Stark Marked gene: STAT3 as ready
Combined Immunodeficiency v0.328 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.328 STAT3 Zornitza Stark Phenotypes for gene: STAT3 were changed from to Hyper-IgE recurrent infection syndrome MIM# 147060; Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952
Combined Immunodeficiency v0.327 STAT3 Zornitza Stark Publications for gene: STAT3 were set to
Combined Immunodeficiency v0.326 STAT3 Zornitza Stark Mode of pathogenicity for gene: STAT3 was changed from to Other
Combined Immunodeficiency v0.325 STAT3 Zornitza Stark Mode of inheritance for gene: STAT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.324 STK4 Zornitza Stark Marked gene: STK4 as ready
Combined Immunodeficiency v0.324 STK4 Zornitza Stark Gene: stk4 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.324 STK4 Zornitza Stark Phenotypes for gene: STK4 were changed from to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations MIM# 614868; CD4/CD8 lymphopaenia; cardiac malformations; reduced naïve T cells; increased TEM and TEMRA cells; poor T cell Proliferation; Reduced memory B cells; Reduced IgM, increased IgG, IgA, IgE; impaired antibody responses; intermittent neutropaenia; bacterial/ viral/ fungal infections; autoimmune cytopaenias; mucocutaneous candidiasis; cutaneous warts
Congenital Heart Defect v0.124 STK4 Danielle Ariti gene: STK4 was added
gene: STK4 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: STK4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: STK4 were set to 22294732; 26117625; 22174160; 22952854
Phenotypes for gene: STK4 were set to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations MIM# 614868; CD4/CD8 lymphopaenia; cardiac malformations; reduced naïve T cells; increased TEM and TEMRA cells; poor T cell Proliferation; Reduced memory B cells; Reduced IgM, increased IgG, IgA, IgE; impaired antibody responses; intermittent neutropaenia; bacterial/ viral/ fungal infections; autoimmune cytopaenias; mucocutaneous candidiasis; cutaneous warts
Review for gene: STK4 was set to GREEN
Added comment: 12 individuals from 5 unrelated families have been reported with STK4 deficiency; two mouse model.

Homozygous and compound heterozygous (deletion, missense and nonsense) variants have been identified, resulting in premature stop codons and reduced protein.

All individuals displayed a similar immunological phenotype, characterised by naive CD4+ and CD8+ T-cell lymphopaenia in particular. Other typical features included cardiac malformations, recurrent bacterial/viral infections, mucocutaneous candidiasis and cutaneous warts.
Sources: Literature
Combined Immunodeficiency v0.323 STK4 Zornitza Stark Publications for gene: STK4 were set to
Mendeliome v0.8776 STK4 Zornitza Stark Marked gene: STK4 as ready
Mendeliome v0.8776 STK4 Zornitza Stark Gene: stk4 has been classified as Green List (High Evidence).
Mendeliome v0.8776 STK4 Zornitza Stark Phenotypes for gene: STK4 were changed from to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations MIM# 614868; CD4/CD8 lymphopaenia; cardiac malformations; reduced naïve T cells; increased TEM and TEMRA cells; poor T cell Proliferation; Reduced memory B cells; Reduced IgM, increased IgG, IgA, IgE; impaired antibody responses; intermittent neutropaenia; bacterial/ viral/ fungal infections; autoimmune cytopaenias; mucocutaneous candidiasis; cutaneous warts
Mendeliome v0.8775 STK4 Zornitza Stark Publications for gene: STK4 were set to
Combined Immunodeficiency v0.322 STK4 Zornitza Stark Mode of inheritance for gene: STK4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8774 STK4 Zornitza Stark Mode of inheritance for gene: STK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.322 STK4 Zornitza Stark Mode of inheritance for gene: STK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8773 SP110 Zornitza Stark Marked gene: SP110 as ready
Mendeliome v0.8773 SP110 Zornitza Stark Gene: sp110 has been classified as Green List (High Evidence).
Mendeliome v0.8773 SP110 Zornitza Stark Tag founder tag was added to gene: SP110.
Mendeliome v0.8773 SP110 Zornitza Stark Phenotypes for gene: SP110 were changed from to Hepatic veno-occlusive disease with immunodeficiency MIM#235550; Hepatic veno-occlusive disease; susceptibility to Pneumocystis jirovecii pneumonia; cytomegalovirus; thrombocytopaenia; hepatosplenomegaly; cerebrospinal leukodystrophy; memory T/B cell deficiency; low Ig levels; absent tissue plasma cells; absent lymph node germinal centers; hypogammaglobulinaemia
Mendeliome v0.8772 SP110 Zornitza Stark Publications for gene: SP110 were set to
Combined Immunodeficiency v0.321 SPINK5 Zornitza Stark Marked gene: SPINK5 as ready
Combined Immunodeficiency v0.321 SPINK5 Zornitza Stark Gene: spink5 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.321 SPINK5 Zornitza Stark Phenotypes for gene: SPINK5 were changed from to Netherton syndrome MIM# 256500; Low switched and non-switched B cells; High IgE and IgA; Antibody variably decreased; Congenital ichthyosis; bamboo hair; atopic diathesis; increased bacterial infections; failure to thrive; food allergies
Combined Immunodeficiency v0.320 SPINK5 Zornitza Stark Publications for gene: SPINK5 were set to
Combined Immunodeficiency v0.319 SPINK5 Zornitza Stark Mode of inheritance for gene: SPINK5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8771 SP110 Zornitza Stark Mode of inheritance for gene: SP110 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8770 SMARCAL1 Zornitza Stark Marked gene: SMARCAL1 as ready
Mendeliome v0.8770 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.318 SP110 Zornitza Stark Marked gene: SP110 as ready
Combined Immunodeficiency v0.318 SP110 Zornitza Stark Gene: sp110 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.318 SP110 Zornitza Stark Phenotypes for gene: SP110 were changed from to Hepatic veno-occlusive disease with immunodeficiency MIM#235550; Hepatic veno-occlusive disease; susceptibility to Pneumocystis jirovecii pneumonia; cytomegalovirus; thrombocytopaenia; hepatosplenomegaly; cerebrospinal leukodystrophy; memory T/B cell deficiency; low Ig levels; absent tissue plasma cells; absent lymph node germinal centers; hypogammaglobulinaemia
Combined Immunodeficiency v0.317 SP110 Zornitza Stark Tag founder tag was added to gene: SP110.
Combined Immunodeficiency v0.317 SP110 Zornitza Stark Publications for gene: SP110 were set to
Combined Immunodeficiency v0.316 SP110 Zornitza Stark Mode of inheritance for gene: SP110 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.315 SMARCAL1 Zornitza Stark Marked gene: SMARCAL1 as ready
Combined Immunodeficiency v0.315 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.315 SMARCAL1 Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from to Schimke immune-osseous dysplasia MIM# 242900; T cell deficiency; Short stature; spondyloepiphyseal dysplasia; renal dysfunction; lymphocytopaenia; nephropathy; bacterial/viral/fungal infections; may present as SCID; bone marrow failure
Mendeliome v0.8770 SMARCAL1 Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from to Schimke immune-osseous dysplasia MIM# 242900; T cell deficiency; Short stature; spondyloepiphyseal dysplasia; renal dysfunction; lymphocytopaenia; nephropathy; bacterial/viral/fungal infections; may present as SCID; bone marrow failure
Mendeliome v0.8769 SMARCAL1 Zornitza Stark Publications for gene: SMARCAL1 were set to
Combined Immunodeficiency v0.314 SMARCAL1 Zornitza Stark Publications for gene: SMARCAL1 were set to
Genetic Epilepsy v0.1165 SLC46A1 Danielle Ariti gene: SLC46A1 was added
gene: SLC46A1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: SLC46A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC46A1 were set to 20301716
Phenotypes for gene: SLC46A1 were set to Folate malabsorption, hereditary MIM# 229050; Decreased Ig levels; megaloblastic anaemia; failure to thrive; Immunodeficiency; if untreated for prolonged periods results in intellectual disability; oral mucositis; hypoimmunoglobulinaemia; recurrent infections; seizures; motor impairment; leukopaenia; thrombocytopaenia
Review for gene: SLC46A1 was set to GREEN
Added comment: ver 30 unrelated individuals reported with variants in SLC46A1 presenting with hereditary folate malabsorption; two mouse model.

In-frame deletion variant has been commonly reported among individuals of Puerto Rican heritage: c.1082-1G>A;
Other variants include homozygous and compound heterozygous deletions, insertion, missense and nonsense report in individuals of other origins (Chinese, Moroccan, Turkish, African American).

Clinically presents in infancy with failure to thrive, recurrent diarrhoea, anaemia, recurrent infections and, frequently, seizures.
Sources: Literature
Mendeliome v0.8768 SMARCAL1 Zornitza Stark Mode of inheritance for gene: SMARCAL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.313 SMARCAL1 Zornitza Stark Mode of inheritance for gene: SMARCAL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.312 SLC46A1 Zornitza Stark Marked gene: SLC46A1 as ready
Combined Immunodeficiency v0.312 SLC46A1 Zornitza Stark Gene: slc46a1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.312 SLC46A1 Zornitza Stark Phenotypes for gene: SLC46A1 were changed from to Folate malabsorption, hereditary MIM# 229050; Decreased Ig levels; megaloblastic anaemia; failure to thrive; Immunodeficiency; if untreated for prolonged periods results in intellectual disability; oral mucositis; hypoimmunoglobulinaemia; recurrent infections; seizures; motor impairment; leukopaenia; thrombocytopaenia
Combined Immunodeficiency v0.311 SLC46A1 Zornitza Stark Publications for gene: SLC46A1 were set to
Combined Immunodeficiency v0.310 SLC46A1 Zornitza Stark Mode of inheritance for gene: SLC46A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.309 SLC46A1 Zornitza Stark Tag founder tag was added to gene: SLC46A1.
Mendeliome v0.8767 STK4 Danielle Ariti reviewed gene: STK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22294732, 26117625, 22174160, 22952854; Phenotypes: T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations MIM# 614868, CD4/CD8 lymphopaenia, cardiac malformations, reduced naïve T cells, increased TEM and TEMRA cells, poor T cell Proliferation, Reduced memory B cells, Reduced IgM, increased IgG, IgA, IgE, impaired antibody responses, intermittent neutropaenia, bacterial/ viral/ fungal infections, autoimmune cytopaenias, mucocutaneous candidiasis, cutaneous warts; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8767 SPINK5 Danielle Ariti reviewed gene: SPINK5: Rating: ; Mode of pathogenicity: None; Publications: 33534181, 20657595; Phenotypes: Netherton syndrome MIM# 256500, Low switched and non-switched B cells, High IgE and IgA, Antibody variably decreased, Congenital ichthyosis, bamboo hair, atopic diathesis, increased bacterial infections, failure to thrive, food allergies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8767 SP110 Danielle Ariti reviewed gene: SP110: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301448, 31721003; Phenotypes: Hepatic veno-occlusive disease with immunodeficiency MIM#235550, Hepatic veno-occlusive disease, susceptibility to Pneumocystis jirovecii pneumonia, cytomegalovirus, thrombocytopaenia, hepatosplenomegaly, cerebrospinal leukodystrophy, memory T/B cell deficiency, low Ig levels, absent tissue plasma cells, absent lymph node germinal centers, hypogammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8767 SMARCAL1 Danielle Ariti reviewed gene: SMARCAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301550, 17089404, 20036229; Phenotypes: Schimke immune-osseous dysplasia MIM# 242900, T cell deficiency, Short stature, spondyloepiphyseal dysplasia, renal dysfunction, lymphocytopaenia, nephropathy, bacterial/viral/fungal infections, may present as SCID, bone marrow failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.309 STAT3 Danielle Ariti changed review comment from: Well-established disease-gene association for hyper-IgE syndrome; identified heterozygous STAT3 variants in over 50 familial and sporadic cases; dominant-negative loss of function; multiple mouse models

Hyper IgE individuals presented with the triad of staphylococcal abscesses, pneumonia with pneumatocele formation, and extremely elevated IgE.


15 unrelated families with Autoimmune disease, multisystem, infantile-onset, 1; 13 STAT3 variants identified (5 were de novo); gain of function; multiple mouse models

Autoimmune disease, multisystem, infantile-onset, 1 individuals exhibited various clinical features, with most presenting with lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, infections, and short stature.

STAT3 monoallelic variants were missense and in-frame deletions in both diseases.

(Hyper IgE- Loss of Function AND Autoimmune disease- Gain of function); to: Well-established disease-gene association for hyper-IgE syndrome; identified heterozygous STAT3 variants in over 50 familial and sporadic cases; dominant-negative loss of function; multiple mouse models

Hyper IgE individuals presented with the triad of staphylococcal abscesses, pneumonia with pneumatocele formation, and extremely elevated IgE.

15 unrelated families with Autoimmune disease, multisystem, infantile-onset, 1; 13 STAT3 variants identified (5 were de novo); gain of function; multiple mouse models

Autoimmune disease, multisystem, infantile-onset, 1 individuals exhibited various clinical features, with most presenting with lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, infections, and short stature.

STAT3 monoallelic variants were missense and in-frame deletions in both diseases.

(Hyper IgE- Loss of Function AND Autoimmune disease- Gain of function)
Combined Immunodeficiency v0.309 STAT3 Danielle Ariti reviewed gene: STAT3: Rating: GREEN; Mode of pathogenicity: Other; Publications: 17881745, 14566054, 25349174, 25038750, 25359994; Phenotypes: Hyper-IgE recurrent infection syndrome MIM# 147060, Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.309 STAT3 Danielle Ariti Deleted their review
Combined Immunodeficiency v0.309 STAT3 Danielle Ariti edited their review of gene: STAT3: Added comment: 18 individuals from 15 unrelated families; Multiple mouse models

All 13 heterozygous variants reported have been missense or in-frame deletions that result in a gain of function; 5 of these de novo

Individuals exhibited various clinical features, with most presenting with lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, infections, and short stature.; Changed mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Changed publications: 25349174, 25038750, 25359994, 16783372; Changed phenotypes: Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952, Lymphoproliferation, solid organ autoimmunity, recurrent infections, short stature, eczema, delayed puberty, dental abnormalities, autoimmune cytopaenias, juvenile-onset arthritis, primary hypothyroidism
Combined Immunodeficiency v0.309 STAT3 Danielle Ariti reviewed gene: STAT3: Rating: GREEN; Mode of pathogenicity: None; Publications: 17881745, 14566054, 15194489; Phenotypes: Hyper-IgE recurrent infection syndrome MIM# 147060, NKT cells decreased, Very high IgE, specific antibody production decreased, Distinctive facial features (broad nasal bridge), bacterial infections, staphylococcal abscesses, eczema, mucocutaneous candidiasis, hyperextensible joints, osteoporosis and bone fractures, scoliosis, retained primary teeth, coronary and cerebral aneurysms; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8767 GPR68 Zornitza Stark Marked gene: GPR68 as ready
Mendeliome v0.8767 GPR68 Zornitza Stark Gene: gpr68 has been classified as Green List (High Evidence).
Mendeliome v0.8767 GPR68 Zornitza Stark Phenotypes for gene: GPR68 were changed from to Amelogenesis imperfecta, hypomaturation type, IIA6 MIM#617217
Mendeliome v0.8766 GPR68 Zornitza Stark Publications for gene: GPR68 were set to
Mendeliome v0.8765 GPR68 Zornitza Stark Mode of inheritance for gene: GPR68 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8764 GPR68 Zornitza Stark reviewed gene: GPR68: Rating: GREEN; Mode of pathogenicity: None; Publications: 27693231, 32279993; Phenotypes: Amelogenesis imperfecta, hypomaturation type, IIA6 MIM#617217; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.26 GPR68 Zornitza Stark Marked gene: GPR68 as ready
Amelogenesis imperfecta v0.26 GPR68 Zornitza Stark Gene: gpr68 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.26 GPR68 Zornitza Stark Phenotypes for gene: GPR68 were changed from Amelogenesis imperfecta, hypomaturation type, IIA6, 617217 to Amelogenesis imperfecta, hypomaturation type, IIA6 MIM#617217
Amelogenesis imperfecta v0.25 GPR68 Zornitza Stark Publications for gene: GPR68 were set to 27693231
Mendeliome v0.8764 FAM83H Zornitza Stark Marked gene: FAM83H as ready
Mendeliome v0.8764 FAM83H Zornitza Stark Gene: fam83h has been classified as Green List (High Evidence).
Mendeliome v0.8764 FAM83H Zornitza Stark Phenotypes for gene: FAM83H were changed from to Amelogenesis imperfecta, type IIIA MIM#130900
Mendeliome v0.8763 FAM83H Zornitza Stark Publications for gene: FAM83H were set to
Mendeliome v0.8762 FAM83H Zornitza Stark Mode of inheritance for gene: FAM83H was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8761 FAM83H Zornitza Stark reviewed gene: FAM83H: Rating: GREEN; Mode of pathogenicity: None; Publications: 18484629, 19407157, 19825039, 26481691, 21702852, 20160442, 26142250, 22414746, 19828885, 19220331, 26502894, 18252228, 21597265, 21118793, 26788537, 26171361; Phenotypes: Amelogenesis imperfecta, type IIIA MIM#130900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Amelogenesis imperfecta v0.24 FAM83H Zornitza Stark Publications for gene: FAM83H were set to 18484629; 19407157; 19825039; 26481691; 21702852; 20160442; 26142250; 22414746; 19828885; 19220331; 26502894; 18252228; 21597265; 21118793; 26788537; 26171361
Amelogenesis imperfecta v0.23 FAM83H Zornitza Stark Marked gene: FAM83H as ready
Amelogenesis imperfecta v0.23 FAM83H Zornitza Stark Gene: fam83h has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.23 FAM83H Zornitza Stark Phenotypes for gene: FAM83H were changed from Amelogenesis imperfecta, type III, 130900; Amelogenesis Imperfecta, Type III, 130900; Hypocalcified AI to Amelogenesis imperfecta, type IIIA MIM#130900
Amelogenesis imperfecta v0.22 FAM20C Zornitza Stark Marked gene: FAM20C as ready
Amelogenesis imperfecta v0.22 FAM20C Zornitza Stark Gene: fam20c has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.22 FAM20C Zornitza Stark Phenotypes for gene: FAM20C were changed from hypoplastic Amelogenesis Imperfecta; Raine Syndrome, 259775 to Raine syndrome MIM#259775; hypoplastic Amelogenesis Imperfecta
Mendeliome v0.8761 ENAM Zornitza Stark Marked gene: ENAM as ready
Mendeliome v0.8761 ENAM Zornitza Stark Gene: enam has been classified as Green List (High Evidence).
Mendeliome v0.8761 ENAM Zornitza Stark Phenotypes for gene: ENAM were changed from to Amelogenesis imperfecta, type IB, MIM# 104500; Amelogenesis imperfecta, type IC, MIM# 204650
Mendeliome v0.8760 ENAM Zornitza Stark Publications for gene: ENAM were set to
Mendeliome v0.8759 ENAM Zornitza Stark Mode of inheritance for gene: ENAM was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8758 ENAM Zornitza Stark reviewed gene: ENAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 11487571, 28334996, 14684688, 33864320; Phenotypes: Amelogenesis imperfecta, type IB, MIM# 104500, Amelogenesis imperfecta, type IC, MIM# 204650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Calcium and Phosphate disorders v0.34 FAM20A Zornitza Stark Marked gene: FAM20A as ready
Calcium and Phosphate disorders v0.34 FAM20A Zornitza Stark Gene: fam20a has been classified as Green List (High Evidence).
Calcium and Phosphate disorders v0.34 FAM20A Zornitza Stark Phenotypes for gene: FAM20A were changed from to Amelogenesis imperfecta, type IG (enamel-renal syndrome) MIM#204690
Calcium and Phosphate disorders v0.33 FAM20A Zornitza Stark Publications for gene: FAM20A were set to
Calcium and Phosphate disorders v0.32 FAM20A Zornitza Stark Mode of inheritance for gene: FAM20A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Calcium and Phosphate disorders v0.31 FAM20A Zornitza Stark reviewed gene: FAM20A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23434854, 23697977, 23468644, 24756937, 21549343, 24259279, 24196488, 26502894, 25827751, 21990045; Phenotypes: Amelogenesis imperfecta, type IG (enamel-renal syndrome) MIM#204690; Mode of inheritance: None
Mendeliome v0.8758 FAM20A Zornitza Stark Marked gene: FAM20A as ready
Mendeliome v0.8758 FAM20A Zornitza Stark Gene: fam20a has been classified as Green List (High Evidence).
Mendeliome v0.8758 FAM20A Zornitza Stark Phenotypes for gene: FAM20A were changed from to Amelogenesis imperfecta, type IG (enamel-renal syndrome) MIM#204690
Mendeliome v0.8757 FAM20A Zornitza Stark Publications for gene: FAM20A were set to
Mendeliome v0.8756 FAM20A Zornitza Stark Mode of inheritance for gene: FAM20A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8755 FAM20A Zornitza Stark reviewed gene: FAM20A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23434854, 23697977, 23468644, 24756937, 21549343, 24259279, 24196488, 26502894, 25827751, 21990045; Phenotypes: Amelogenesis imperfecta, type IG (enamel-renal syndrome) MIM#204690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.21 FAM20A Zornitza Stark Publications for gene: FAM20A were set to 23434854; 23697977; 23468644; 24756937; 21549343; 24259279; 24196488; 26502894; 25827751; 21990045
Amelogenesis imperfecta v0.20 FAM20A Zornitza Stark Marked gene: FAM20A as ready
Amelogenesis imperfecta v0.20 FAM20A Zornitza Stark Gene: fam20a has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.20 FAM20A Zornitza Stark Phenotypes for gene: FAM20A were changed from Amelogenesis Imperfecta, Type IG, 204690; Hypomieralised AI; Amelogenesis imperfecta, type IG (enamel-renal syndrome), 204690 to Amelogenesis imperfecta, type IG (enamel-renal syndrome) MIM#204690
Combined Immunodeficiency v0.309 STK4 Danielle Ariti reviewed gene: STK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22294732, 26117625, 22174160, 22952854; Phenotypes: T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations MIM# 614868, CD4/CD8 lymphopaenia, cardiac malformations, reduced naïve T cells, increased TEM and TEMRA cells, poor T cell Proliferation, Reduced memory B cells, Reduced IgM, increased IgG, IgA, IgE, impaired antibody responses, intermittent neutropaenia, bacterial/ viral/ fungal infections, autoimmune cytopaenias, mucocutaneous candidiasis, cutaneous warts; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.19 ENAM Zornitza Stark Marked gene: ENAM as ready
Amelogenesis imperfecta v0.19 ENAM Zornitza Stark Gene: enam has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.19 ENAM Zornitza Stark Phenotypes for gene: ENAM were changed from Amelogenesis imperfecta, type IB, 104500; Amelogenesis imperfecta, type IC, 204650; autosomal recessive amelogenesis imperfecta; Amelogenesis Imperfecta, Dominant to Amelogenesis imperfecta, type IB, MIM# 104500; Amelogenesis imperfecta, type IC, MIM# 204650
Amelogenesis imperfecta v0.18 ENAM Zornitza Stark Publications for gene: ENAM were set to 14684688; 11978766; 12407086; 20439930; 25769099; 22540999; 25143514; 22029166; 19329462; 28334996; 26502894; 17316551; 21597265; 16246937; 15723871; 11487571
Amelogenesis imperfecta v0.17 ENAM Zornitza Stark reviewed gene: ENAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 11487571, 28334996, 14684688, 33864320; Phenotypes: Amelogenesis imperfecta, type IB, MIM# 104500, Amelogenesis imperfecta, type IC, MIM# 204650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.309 SPINK5 Danielle Ariti reviewed gene: SPINK5: Rating: GREEN; Mode of pathogenicity: None; Publications: 33534181, 20657595; Phenotypes: Netherton syndrome MIM# 256500, Low switched and non-switched B cells, High IgE and IgA, Antibody variably decreased, Congenital ichthyosis, bamboo hair, atopic diathesis, increased bacterial infections, failure to thrive, food allergies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.309 SP110 Danielle Ariti reviewed gene: SP110: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301448, 31721003; Phenotypes: Hepatic veno-occlusive disease with immunodeficiency MIM#235550, Hepatic veno-occlusive disease, susceptibility to Pneumocystis jirovecii pneumonia, cytomegalovirus, thrombocytopaenia, hepatosplenomegaly, cerebrospinal leukodystrophy, memory T/B cell deficiency, low Ig levels, absent tissue plasma cells, absent lymph node germinal centers, hypogammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.17 DLX3 Zornitza Stark Marked gene: DLX3 as ready
Amelogenesis imperfecta v0.17 DLX3 Zornitza Stark Gene: dlx3 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.17 DLX3 Zornitza Stark Phenotypes for gene: DLX3 were changed from amelogenesis imperfecta with taurodontism; hypoplastic AI, taurodontism and kinky hair; Tricho-dento-osseous syndrome (TDO) (includes enamel hypoplasia); Amelogenesis Imperfecta, Dominant; Tricho-Dento-Osseous syndrome , Amelogenesis Imperfecta, hypoplastic; Trichodontoosseous syndrome, 190320; Amelogenesis imperfecta, type IV, 104510; Amelogenesis Imperfecta, Type IV, 104510 to Amelogenesis imperfecta, type IV, MIM# 104510; Trichodontoosseous syndrome, MIM# 190320
Amelogenesis imperfecta v0.16 DLX3 Zornitza Stark Publications for gene: DLX3 were set to 15666299; 23949819; 26104267; 21252474; 20151948; 9467018
Amelogenesis imperfecta v0.15 DLX3 Zornitza Stark reviewed gene: DLX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9467018, 15666299, 18203197; Phenotypes: Amelogenesis imperfecta, type IV, MIM# 104510, Trichodontoosseous syndrome, MIM# 190320; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Amelogenesis imperfecta v0.15 COL17A1 Zornitza Stark Marked gene: COL17A1 as ready
Amelogenesis imperfecta v0.15 COL17A1 Zornitza Stark Gene: col17a1 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.15 COL17A1 Zornitza Stark Phenotypes for gene: COL17A1 were changed from Epidermolysis bullosa, junctional, non-Herlitz type, MIM#226650 (includes enamel pitting); Amelogenesis Imperfecta; hypoplastic amelogenesis imperfecta to Epidermolysis bullosa, junctional, non-Herlitz type, MIM#226650 (includes enamel pitting); hypoplastic amelogenesis imperfecta
Amelogenesis imperfecta v0.14 COL17A1 Zornitza Stark Phenotypes for gene: COL17A1 were changed from non-Herlitz junctional epidermolysis bullosa (nH-JEB) and amelogenesis imperfecta; Epidermolysis bullosa, junctional, non-Herlitz type, 226650 (includes enamel pitting); Amelogenesis Imperfecta; hypoplastic amelogenesis imperfecta to Epidermolysis bullosa, junctional, non-Herlitz type, MIM#226650 (includes enamel pitting); Amelogenesis Imperfecta; hypoplastic amelogenesis imperfecta
Amelogenesis imperfecta v0.13 COL17A1 Zornitza Stark Mode of inheritance for gene: COL17A1 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.12 COL17A1 Zornitza Stark commented on gene: COL17A1: This type of EB has prominent dental involvement, including enamel pitting.
Amelogenesis imperfecta v0.12 COL17A1 Zornitza Stark reviewed gene: COL17A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.309 SMARCAL1 Danielle Ariti reviewed gene: SMARCAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301550, 17089404, 20036229; Phenotypes: Schimke immune-osseous dysplasia MIM# 242900, T cell deficiency, Short stature, spondyloepiphyseal dysplasia, renal dysfunction, lymphocytopaenia, nephropathy, bacterial/viral/fungal infections, may present as SCID, bone marrow failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.12 CNNM4 Zornitza Stark Publications for gene: CNNM4 were set to 19200527; 19200525
Amelogenesis imperfecta v0.11 CNNM4 Zornitza Stark changed review comment from: Jalili syndrome is an autosomal recessive disorder consisting of cone-rod dystrophy and amelogenesis imperfecta. Significant visual impairment with nystagmus and photophobia is present from infancy or early childhood and progresses with age. Enamel of primary and secondary dentitions is grossly abnormal and prone to rapid posteruptive failure, in part reflecting hypomineralization.

At least 8 unrelated families reported.; to: Jalili syndrome is an autosomal recessive disorder consisting of cone-rod dystrophy and amelogenesis imperfecta. Significant visual impairment with nystagmus and photophobia is present from infancy or early childhood and progresses with age. Enamel of primary and secondary dentitions is grossly abnormal and prone to rapid posteruptive failure, in part reflecting hypomineralization.

>100 affected individuals reported.
Amelogenesis imperfecta v0.11 CNNM4 Zornitza Stark edited their review of gene: CNNM4: Changed publications: 19200527, 19200525, 30705057
Amelogenesis imperfecta v0.11 CNNM4 Zornitza Stark Marked gene: CNNM4 as ready
Amelogenesis imperfecta v0.11 CNNM4 Zornitza Stark Gene: cnnm4 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.11 CNNM4 Zornitza Stark Phenotypes for gene: CNNM4 were changed from cone-rod dystrophy and amelogenesis imperfecta; Jalili syndrome, 217080 (includes amelogenesis imperfecta) to Jalili syndrome, MIM#217080; cone-rod dystrophy and amelogenesis imperfecta
Amelogenesis imperfecta v0.10 CNNM4 Zornitza Stark Publications for gene: CNNM4 were set to
Amelogenesis imperfecta v0.9 CNNM4 Zornitza Stark reviewed gene: CNNM4: Rating: GREEN; Mode of pathogenicity: None; Publications: 19200527, 19200525; Phenotypes: Jalili syndrome, MIM# 217080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8755 C4orf26 Zornitza Stark Marked gene: C4orf26 as ready
Mendeliome v0.8755 C4orf26 Zornitza Stark Gene: c4orf26 has been classified as Green List (High Evidence).
Mendeliome v0.8755 C4orf26 Zornitza Stark Phenotypes for gene: C4orf26 were changed from to Amelogenesis imperfecta, type IIA4, MIM# 614832
Mendeliome v0.8754 C4orf26 Zornitza Stark Publications for gene: C4orf26 were set to
Mendeliome v0.8753 C4orf26 Zornitza Stark Mode of inheritance for gene: C4orf26 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8752 C4orf26 Zornitza Stark reviewed gene: C4orf26: Rating: GREEN; Mode of pathogenicity: None; Publications: 22901946, 27558265; Phenotypes: Amelogenesis imperfecta, type IIA4, MIM# 614832; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.9 C4orf26 Zornitza Stark Marked gene: C4orf26 as ready
Amelogenesis imperfecta v0.9 C4orf26 Zornitza Stark Gene: c4orf26 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.9 C4orf26 Zornitza Stark Phenotypes for gene: C4orf26 were changed from Amelogenesis imperfecta, type IIA4, 614832; Amelogenesis Imperfecta, Type IIA4, 614832; hypomineralized amelogenesis imperfecta to Amelogenesis Imperfecta, Type IIA4, MIM#614832; hypomineralized amelogenesis imperfecta
Amelogenesis imperfecta v0.8 C4orf26 Zornitza Stark reviewed gene: C4orf26: Rating: GREEN; Mode of pathogenicity: None; Publications: 22901946, 27558265; Phenotypes: Amelogenesis imperfecta, type IIA4, MIM# 614832; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8752 AMELX Zornitza Stark Marked gene: AMELX as ready
Mendeliome v0.8752 AMELX Zornitza Stark Gene: amelx has been classified as Green List (High Evidence).
Mendeliome v0.8752 AMELX Zornitza Stark Phenotypes for gene: AMELX were changed from Amelogenesis imperfecta, type 1E, MIM# 301200 to Amelogenesis imperfecta, type 1E, MIM# 301200
Mendeliome v0.8752 AMELX Zornitza Stark Phenotypes for gene: AMELX were changed from to Amelogenesis imperfecta, type 1E, MIM# 301200
Mendeliome v0.8751 AMELX Zornitza Stark Publications for gene: AMELX were set to
Mendeliome v0.8750 AMELX Zornitza Stark Mode of inheritance for gene: AMELX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.8749 AMELX Zornitza Stark Tag SV/CNV tag was added to gene: AMELX.
Mendeliome v0.8749 AMELX Zornitza Stark reviewed gene: AMELX: Rating: GREEN; Mode of pathogenicity: None; Publications: 17189466, 22243263, 7599636, 23251683, 1483698 1916828, 9188994, 15111628, 11201048, 26502894, 7782077, 11922869, 28130977, 8406474, 11839357, 25117480, 19610109; Phenotypes: Amelogenesis imperfecta, type 1E, MIM# 301200; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.8749 AMBN Zornitza Stark Marked gene: AMBN as ready
Mendeliome v0.8749 AMBN Zornitza Stark Gene: ambn has been classified as Green List (High Evidence).
Mendeliome v0.8749 AMBN Zornitza Stark Phenotypes for gene: AMBN were changed from to Amelogenesis imperfecta, type IF MIM#616270
Amelogenesis imperfecta v0.8 AMELX Zornitza Stark Marked gene: AMELX as ready
Amelogenesis imperfecta v0.8 AMELX Zornitza Stark Gene: amelx has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.8 AMELX Zornitza Stark Phenotypes for gene: AMELX were changed from Amelogenesis imperfecta, type 1E, 301200; hypomaturation AI with variable hypoplastic foci; smooth hypoplastic AI; iX-linked hypoplastic amelogenesis imperfecta to Amelogenesis imperfecta, type 1E, 301200; hypomaturation AI with variable hypoplastic foci; smooth hypoplastic AI
Amelogenesis imperfecta v0.7 AMELX Zornitza Stark Tag SV/CNV tag was added to gene: AMELX.
Amelogenesis imperfecta v0.7 AMELX Zornitza Stark reviewed gene: AMELX: Rating: GREEN; Mode of pathogenicity: None; Publications: 1916828, 15111628, 23251683; Phenotypes: Amelogenesis imperfecta, type 1E, MIM# 301200; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Combined Immunodeficiency v0.309 SLC46A1 Danielle Ariti reviewed gene: SLC46A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301716; Phenotypes: Folate malabsorption, hereditary MIM# 229050, Decreased Ig levels, megaloblastic anaemia, failure to thrive, Immunodeficiency, if untreated for prolonged periods results in intellectual disability, oral mucositis, hypoimmunoglobulinaemia, recurrent infections, seizures, motor impairment, leukopaenia, thrombocytopaenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8748 AMBN Zornitza Stark Publications for gene: AMBN were set to
Mendeliome v0.8747 AMBN Zornitza Stark Mode of inheritance for gene: AMBN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8746 AMBN Zornitza Stark reviewed gene: AMBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 24858907, 26502894, 31402633, 30174330; Phenotypes: Amelogenesis imperfecta, type IF MIM#616270; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.7 AMBN Zornitza Stark Marked gene: AMBN as ready
Amelogenesis imperfecta v0.7 AMBN Zornitza Stark Gene: ambn has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.7 AMBN Zornitza Stark Phenotypes for gene: AMBN were changed from Amelogenesis imperfecta, type IF, 616270 to Amelogenesis imperfecta, type IF, MIM#616270
Amelogenesis imperfecta v0.6 AMBN Zornitza Stark Publications for gene: AMBN were set to 24858907; 26502894
Amelogenesis imperfecta v0.5 AMBN Zornitza Stark Mode of inheritance for gene: AMBN was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.4 AMBN Zornitza Stark reviewed gene: AMBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 31402633, 30174330; Phenotypes: Amelogenesis imperfecta, type IF MIM#616270; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8746 ACP4 Zornitza Stark reviewed gene: ACP4: Rating: GREEN; Mode of pathogenicity: None; Publications: 28513613, 27843125, 33552707; Phenotypes: Amelogenesis imperfecta, type IJ MIM#617297; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Skeletal dysplasia v0.113 KIAA0753 Zornitza Stark Marked gene: KIAA0753 as ready
Skeletal dysplasia v0.113 KIAA0753 Zornitza Stark Gene: kiaa0753 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.4 ACP4 Zornitza Stark Marked gene: ACP4 as ready
Amelogenesis imperfecta v0.4 ACP4 Zornitza Stark Gene: acp4 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.4 ACP4 Zornitza Stark Phenotypes for gene: ACP4 were changed from Amelogenesis imperfecta, type IJ, 617297; hypoplastic amelogenesis imperfecta to Amelogenesis imperfecta, type IJ, MIM#617297; hypoplastic amelogenesis imperfecta
Amelogenesis imperfecta v0.3 ACP4 Zornitza Stark Publications for gene: ACP4 were set to 28513613; 27843125
Skeletal dysplasia v0.113 KIAA0753 Zornitza Stark Phenotypes for gene: KIAA0753 were changed from ?Orofaciodigital syndrome XV 617127; Joubert syndrome; Short-rib skeletal dysplasia to ?Orofaciodigital syndrome XV 617127; Joubert syndrome 38, MIM# 619476; Short-rib skeletal dysplasia
Mendeliome v0.8746 KIAA0753 Zornitza Stark Phenotypes for gene: KIAA0753 were changed from Orofaciodigital syndrome XV, MIM# 617127; Joubert syndrome to Orofaciodigital syndrome XV, MIM# 617127; Joubert syndrome 38, MIM# 619476
Joubert syndrome and other neurological ciliopathies v1.11 KIAA0753 Zornitza Stark Phenotypes for gene: KIAA0753 were changed from ?Orofaciodigital syndrome XV 617127; Joubert syndrome to ?Orofaciodigital syndrome XV 617127; Joubert syndrome 38, MIM# 619476
Ciliopathies v1.8 KIAA0753 Zornitza Stark Phenotypes for gene: KIAA0753 were changed from Orofaciodigital syndrome XV 617127; Joubert syndrome to Orofaciodigital syndrome XV 617127; Joubert syndrome 38, MIM# 619476
Intellectual disability syndromic and non-syndromic v0.4047 TMEM222 Zornitza Stark Marked gene: TMEM222 as ready
Intellectual disability syndromic and non-syndromic v0.4047 TMEM222 Zornitza Stark Gene: tmem222 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4047 TMEM222 Zornitza Stark Phenotypes for gene: TMEM222 were changed from Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality to Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality
Intellectual disability syndromic and non-syndromic v0.4046 TMEM222 Zornitza Stark reviewed gene: TMEM222: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1165 TMEM222 Zornitza Stark Phenotypes for gene: TMEM222 were changed from Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality to Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality
Genetic Epilepsy v0.1164 TMEM222 Zornitza Stark reviewed gene: TMEM222: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v1.38 TMEM222 Zornitza Stark Phenotypes for gene: TMEM222 were changed from Intellectual disability; Epilepsy; Microcephaly to Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Intellectual disability; Epilepsy; Microcephaly
Microcephaly v1.37 TMEM222 Zornitza Stark edited their review of gene: TMEM222: Changed phenotypes: Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470, Intellectual disability, Epilepsy, Microcephaly
Mendeliome v0.8745 TMEM222 Zornitza Stark Phenotypes for gene: TMEM222 were changed from Intellectual disability; Epilepsy; Microcephaly to Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Intellectual disability; Epilepsy; Microcephaly
Mendeliome v0.8744 TMEM222 Zornitza Stark edited their review of gene: TMEM222: Changed phenotypes: Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470, Intellectual disability, Epilepsy, Microcephaly
Mendeliome v0.8744 TCF7L2 Zornitza Stark Phenotypes for gene: TCF7L2 were changed from Developmental disorders to Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Myopia; Abnormality of skeletal system
Mendeliome v0.8743 TCF7L2 Zornitza Stark Publications for gene: TCF7L2 were set to 33057194
Mendeliome v0.8742 TCF7L2 Zornitza Stark Classified gene: TCF7L2 as Green List (high evidence)
Mendeliome v0.8742 TCF7L2 Zornitza Stark Gene: tcf7l2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4046 TCF7L2 Zornitza Stark Marked gene: TCF7L2 as ready
Intellectual disability syndromic and non-syndromic v0.4046 TCF7L2 Zornitza Stark Added comment: Comment when marking as ready: Sufficient cases/detail to upgrade to Green.
Intellectual disability syndromic and non-syndromic v0.4046 TCF7L2 Zornitza Stark Gene: tcf7l2 has been classified as Green List (High Evidence).
Mendeliome v0.8741 TCF7L2 Zornitza Stark changed review comment from: 2 reviews
Konstantinos Varvagiannis (Other)
I don't know

Dias et al (2021 - PMID: 34003604) describe the phenotype of 11 unrelated individuals harboring de novo missense/truncating TCF7L2 variants.

Features included DD in childhood (motor delay in 8/11, speech delay in 11/11), intellectual abilities ranging from average cognitive functioning to mild/moderate ID (the latter observed in 5/11), myopia (6/11) , dysmorphic features, variable orthopedic findings, and neuropsychiatric comorbidities incl. ASD (4/11) / ADHD (4/11).

One additional (12th) individual was excluded from this summary due to concurrent diagnosis of hypoxic-ischemic injury.

TCF7L2 on 10q25 encodes transcription factor 7-like 2, a high mobility group (HMG) box-containing transcription factor. As the authors discuss, the protein mediates canonical Wnt signaling. Secreted Wnt proteins lead to release of beta-catenin (CTNNB1) which after translocation to the nucleus acts with DNA-binding factors incl. TCF7L2 to turn on Wnt-responsive target genes. As a result TCF7L2 acts with beta-catenin as a switch for transcriptional regulation. Multiple alternative spliced TCF7L2 transcripts mediate it's function and specificity of transcriptional repertoire in a variety of tissues and contexts.

Dias et al provide references for its role in nervous system development incl. neurogenesis and thalamic development.

Variants in all cases occurred as de novo events with pLoF (stopgain, frameshift, splicing) ones predicted to lead to NMD. Missense variants occurred in all cases in or adjacent to the HMG box domain [aa 350-417]. 5 different missense variants affecting 3 residues were reported incl. c.1142A>C, c.1143C>G (leading to Asn381Thr/Lys respectively), c.1250G>T (Trp417Leu), c.1267T>C, c.1268A>G (leading to Tyr423His/Cys) [NM_001146274.1].

The gene has a pLI of 0.99-1 gnomAD/ExAC while there is a region of missense constraint encompassing the HMG box domain (the latter is an evolutionary conserved region mediating interactions with DNA).

No phenotypic differences were observed among individuals with pLoF and missense SNVs, and haploinsufficiency is presumed to be the underlying mechanism.

There are no variant or other studies performed, nor any animal models discussed.

In supplementary table 2, the authors provide several references to previous large scale sequencing studies with brief/incomplete descriptions of individuals de novo TCF7L2 variants and neurodevelopmental disorder (ID/ASD - Iossifov, De Rubeis, Lelieveld, McRae/DDD study and many other Refs).

Heterozygous TCF7L2 variants are thought to confer susceptibility to type diabetes mellitus (MIM 125853). Individuals reported by Dias et al did not have endocrine abnormalities including DM. A study by Roychowdhury et al (2021 - PMID: 34265237) suggests that regulatory variants in TCF7L2 are associated with thoracic aneurysm.

There is no other associated phenotype (notably NDD) in OMIM.
G2P includes TCF7L2 in its DD panel (Disease : TC7L2-related DD, Confidence:confirmed, Monoallelic, LoF).
SysID includes this gene within the autism candidate genes and current primary ID genes.; to: Dias et al (2021 - PMID: 34003604) describe the phenotype of 11 unrelated individuals harboring de novo missense/truncating TCF7L2 variants.

Features included DD in childhood (motor delay in 8/11, speech delay in 11/11), intellectual abilities ranging from average cognitive functioning to mild/moderate ID (the latter observed in 5/11), myopia (6/11) , dysmorphic features, variable orthopedic findings, and neuropsychiatric comorbidities incl. ASD (4/11) / ADHD (4/11).

One additional (12th) individual was excluded from this summary due to concurrent diagnosis of hypoxic-ischemic injury.

TCF7L2 on 10q25 encodes transcription factor 7-like 2, a high mobility group (HMG) box-containing transcription factor. As the authors discuss, the protein mediates canonical Wnt signaling. Secreted Wnt proteins lead to release of beta-catenin (CTNNB1) which after translocation to the nucleus acts with DNA-binding factors incl. TCF7L2 to turn on Wnt-responsive target genes. As a result TCF7L2 acts with beta-catenin as a switch for transcriptional regulation. Multiple alternative spliced TCF7L2 transcripts mediate it's function and specificity of transcriptional repertoire in a variety of tissues and contexts.

Dias et al provide references for its role in nervous system development incl. neurogenesis and thalamic development.

Variants in all cases occurred as de novo events with pLoF (stopgain, frameshift, splicing) ones predicted to lead to NMD. Missense variants occurred in all cases in or adjacent to the HMG box domain [aa 350-417]. 5 different missense variants affecting 3 residues were reported incl. c.1142A>C, c.1143C>G (leading to Asn381Thr/Lys respectively), c.1250G>T (Trp417Leu), c.1267T>C, c.1268A>G (leading to Tyr423His/Cys) [NM_001146274.1].

The gene has a pLI of 0.99-1 gnomAD/ExAC while there is a region of missense constraint encompassing the HMG box domain (the latter is an evolutionary conserved region mediating interactions with DNA).

No phenotypic differences were observed among individuals with pLoF and missense SNVs, and haploinsufficiency is presumed to be the underlying mechanism.

There are no variant or other studies performed, nor any animal models discussed.

In supplementary table 2, the authors provide several references to previous large scale sequencing studies with brief/incomplete descriptions of individuals de novo TCF7L2 variants and neurodevelopmental disorder (ID/ASD - Iossifov, De Rubeis, Lelieveld, McRae/DDD study and many other Refs).

Heterozygous TCF7L2 variants are thought to confer susceptibility to type diabetes mellitus (MIM 125853). Individuals reported by Dias et al did not have endocrine abnormalities including DM. A study by Roychowdhury et al (2021 - PMID: 34265237) suggests that regulatory variants in TCF7L2 are associated with thoracic aneurysm.

There is no other associated phenotype (notably NDD) in OMIM.
G2P includes TCF7L2 in its DD panel (Disease : TC7L2-related DD, Confidence:confirmed, Monoallelic, LoF).
SysID includes this gene within the autism candidate genes and current primary ID genes.
Mendeliome v0.8741 TCF7L2 Zornitza Stark reviewed gene: TCF7L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34003604; Phenotypes: Global developmental delay, Intellectual disability, Autism, Attention deficit hyperactivity disorder, Myopia, Abnormality of skeletal system; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4046 TCF7L2 Zornitza Stark Phenotypes for gene: TCF7L2 were changed from Developmental disorders to Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Myopia; Abnormality of skeletal system
Intellectual disability syndromic and non-syndromic v0.4045 TCF7L2 Zornitza Stark Publications for gene: TCF7L2 were set to 33057194
Intellectual disability syndromic and non-syndromic v0.4044 TCF7L2 Zornitza Stark Classified gene: TCF7L2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4044 TCF7L2 Zornitza Stark Gene: tcf7l2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4043 TCF7L2 Konstantinos Varvagiannis reviewed gene: TCF7L2: Rating: AMBER; Mode of pathogenicity: None; Publications: 34003604; Phenotypes: Global developmental delay, Intellectual disability, Autism, Attention deficit hyperactivity disorder, Myopia, Abnormality of skeletal system; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Amelogenesis imperfecta v0.2 LTBP3 Zornitza Stark Marked gene: LTBP3 as ready
Amelogenesis imperfecta v0.2 LTBP3 Zornitza Stark Gene: ltbp3 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.2 LTBP3 Zornitza Stark Publications for gene: LTBP3 were set to 28084688; 25669657
Amelogenesis imperfecta v0.1 LTBP3 Zornitza Stark reviewed gene: LTBP3: Rating: GREEN; Mode of pathogenicity: None; Publications: 19344874, 25899461, 25669657, 29625025; Phenotypes: Dental anomalies and short stature, MIM# 601216; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8741 LTBP3 Zornitza Stark Marked gene: LTBP3 as ready
Mendeliome v0.8741 LTBP3 Zornitza Stark Gene: ltbp3 has been classified as Green List (High Evidence).
Mendeliome v0.8741 LTBP3 Zornitza Stark Phenotypes for gene: LTBP3 were changed from to Dental anomalies and short stature, MIM# 601216; Geleophysic dysplasia 3, MIM# 617809; Thoracic aneurysm
Mendeliome v0.8740 LTBP3 Zornitza Stark Publications for gene: LTBP3 were set to
Mendeliome v0.8739 LTBP3 Zornitza Stark Mode of inheritance for gene: LTBP3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8738 LTBP3 Zornitza Stark reviewed gene: LTBP3: Rating: GREEN; Mode of pathogenicity: None; Publications: 19344874, 25899461, 25669657, 29625025, 27068007, 34150014; Phenotypes: Dental anomalies and short stature, MIM# 601216, Geleophysic dysplasia 3, MIM# 617809, Thoracic aneurysm; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mackenzie's Mission_Reproductive Carrier Screening v0.102 LTBP3 Zornitza Stark changed review comment from: Consider changing the listed disease association relevant to this panel.; to: Consider changing the listed disease association relevant to this panel: currently set to 'tooth agenesis'.
Mackenzie's Mission_Reproductive Carrier Screening v0.102 LTBP3 Zornitza Stark reviewed gene: LTBP3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Dental anomalies and short stature, MIM# 601216; Mode of inheritance: None
Aortopathy_Connective Tissue Disorders v1.54 LTBP3 Zornitza Stark Marked gene: LTBP3 as ready
Aortopathy_Connective Tissue Disorders v1.54 LTBP3 Zornitza Stark Gene: ltbp3 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8738 ARIH1 Zornitza Stark reviewed gene: ARIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8738 ARIH1 Zornitza Stark Mode of inheritance for gene: ARIH1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v1.6 PIDD1 Zornitza Stark Marked gene: PIDD1 as ready
Lissencephaly and Band Heterotopia v1.6 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v1.6 PIDD1 Zornitza Stark Classified gene: PIDD1 as Green List (high evidence)
Lissencephaly and Band Heterotopia v1.6 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v1.5 PIDD1 Zornitza Stark gene: PIDD1 was added
gene: PIDD1 was added to Lissencephaly and Band Heterotopia. Sources: Expert Review
Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010
Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum
Review for gene: PIDD1 was set to GREEN
Added comment: There is enough evidence to include this gene in the current panel with green rating.

Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested.

The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families].

Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants.

Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder.

PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage.

There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation.

Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants.

Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26

Evidence so far provided includes:
- Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern.
- Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability.
- Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp]
- Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain.
- Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD.

Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects.
Sources: Expert Review
Mendeliome v0.8737 PIDD1 Zornitza Stark Marked gene: PIDD1 as ready
Mendeliome v0.8737 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Mendeliome v0.8737 PIDD1 Zornitza Stark Classified gene: PIDD1 as Green List (high evidence)
Mendeliome v0.8737 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Mendeliome v0.8736 PIDD1 Zornitza Stark gene: PIDD1 was added
gene: PIDD1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010
Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum
Review for gene: PIDD1 was set to GREEN
Added comment: There is enough evidence to include this gene in the current panel with green rating.

Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested.

The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families].

Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants.

Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder.

PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage.

There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation.

Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants.

Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26

Evidence so far provided includes:
- Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern.
- Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability.
- Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp]
- Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain.
- Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD.

Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects.

There is currently no associated phenotype in OMIM. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes.
Sources: Expert Review
Genetic Epilepsy v0.1164 PIDD1 Zornitza Stark Marked gene: PIDD1 as ready
Genetic Epilepsy v0.1164 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1164 PIDD1 Zornitza Stark Classified gene: PIDD1 as Green List (high evidence)
Genetic Epilepsy v0.1164 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4043 PIDD1 Zornitza Stark Marked gene: PIDD1 as ready
Intellectual disability syndromic and non-syndromic v0.4043 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4043 PIDD1 Zornitza Stark Classified gene: PIDD1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4043 PIDD1 Zornitza Stark Gene: pidd1 has been classified as Green List (High Evidence).
Leukodystrophy - paediatric v0.228 COLGALT1 Bryony Thompson Marked gene: COLGALT1 as ready
Leukodystrophy - paediatric v0.228 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Leukodystrophy - paediatric v0.228 COLGALT1 Bryony Thompson Classified gene: COLGALT1 as Green List (high evidence)
Leukodystrophy - paediatric v0.228 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Leukodystrophy - paediatric v0.227 COLGALT1 Bryony Thompson gene: COLGALT1 was added
gene: COLGALT1 was added to Leukodystrophy - paediatric. Sources: Literature
Mode of inheritance for gene: COLGALT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COLGALT1 were set to 30412317; 33709034; 31759980
Phenotypes for gene: COLGALT1 were set to Brain small vessel disease 3 MIM#618360
Review for gene: COLGALT1 was set to GREEN
Added comment: 3 unrelated cases with biallelic variants, and supporting functional assays. The main features of the cases were porencephalic cysts, leukoencephalopathy (paediatric onset), lacunar infarcts, cerebral microbleeds/haemorrhages and calcifications.
Sources: Literature
Stroke v1.6 COLGALT1 Bryony Thompson Marked gene: COLGALT1 as ready
Stroke v1.6 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Stroke v1.6 COLGALT1 Bryony Thompson Classified gene: COLGALT1 as Green List (high evidence)
Stroke v1.6 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Stroke v1.5 COLGALT1 Bryony Thompson gene: COLGALT1 was added
gene: COLGALT1 was added to Stroke. Sources: Literature
Mode of inheritance for gene: COLGALT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COLGALT1 were set to 30412317; 33709034; 31759980
Phenotypes for gene: COLGALT1 were set to Brain small vessel disease 3 MIM#618360
Review for gene: COLGALT1 was set to GREEN
Added comment: 3 unrelated cases with biallelic variants, and supporting functional assays. The main features of the cases were porencephalic cysts, leukoencephalopathy, lacunar infarcts, cerebral microbleeds/haemorrhages and calcifications. A null mouse model was embryonic lethal, but had defects in the vascular networks of the embryos
Sources: Literature
Brain Calcification v1.10 COLGALT1 Bryony Thompson Marked gene: COLGALT1 as ready
Brain Calcification v1.10 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Brain Calcification v1.10 COLGALT1 Bryony Thompson Classified gene: COLGALT1 as Green List (high evidence)
Brain Calcification v1.10 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Brain Calcification v1.9 COLGALT1 Bryony Thompson gene: COLGALT1 was added
gene: COLGALT1 was added to Brain Calcification. Sources: Literature
Mode of inheritance for gene: COLGALT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COLGALT1 were set to 30412317; 33709034; 31759980
Phenotypes for gene: COLGALT1 were set to Brain small vessel disease 3 MIM#618360
Review for gene: COLGALT1 was set to GREEN
Added comment: 3 unrelated cases with biallelic variants, and supporting functional assays. The main features of the cases were porencephalic cysts, leukoencephalopathy, lacunar infarcts, cerebral microbleeds/haemorrhages and calcifications. A null mouse model was embryonic lethal, but had defects in the vascular networks of the embryos
Sources: Literature
Mendeliome v0.8735 COLGALT1 Bryony Thompson Marked gene: COLGALT1 as ready
Mendeliome v0.8735 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Mendeliome v0.8735 COLGALT1 Bryony Thompson Classified gene: COLGALT1 as Green List (high evidence)
Mendeliome v0.8735 COLGALT1 Bryony Thompson Gene: colgalt1 has been classified as Green List (High Evidence).
Mendeliome v0.8734 COLGALT1 Bryony Thompson gene: COLGALT1 was added
gene: COLGALT1 was added to Mendeliome. Sources: Other
Mode of inheritance for gene: COLGALT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COLGALT1 were set to 30412317; 33709034; 31759980
Phenotypes for gene: COLGALT1 were set to Brain small vessel disease 3 MIM#618360
Review for gene: COLGALT1 was set to GREEN
Added comment: 3 unrelated cases with biallelic variants, and supporting functional assays. The main features of the cases were porencephalic cysts, leukoencephalopathy, lacunar infarcts, cerebral microbleeds/haemorrhages and calcifications. A null mouse model was embryonic lethal, but had defects in the vascular networks of the embryos.
Sources: Other
Aortopathy_Connective Tissue Disorders v1.54 COL11A1 Bryony Thompson Classified gene: COL11A1 as Green List (high evidence)
Aortopathy_Connective Tissue Disorders v1.54 COL11A1 Bryony Thompson Gene: col11a1 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.53 COL11A1 Bryony Thompson gene: COL11A1 was added
gene: COL11A1 was added to Aortopathy_Connective Tissue Disorders. Sources: Literature
Mode of inheritance for gene: COL11A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL11A1 were set to 8872475; 20301479
Phenotypes for gene: COL11A1 were set to Stickler syndrome, type II MIM#604841
Review for gene: COL11A1 was set to GREEN
gene: COL11A1 was marked as current diagnostic
Added comment: Stickler syndrome is a multi-system connective tissue disorder. Monoallelic loss of function variants in COL11A1 are a well-established cause of Stickler syndrome.
Sources: Literature
Aortopathy_Connective Tissue Disorders v1.52 COL2A1 Bryony Thompson Marked gene: COL2A1 as ready
Aortopathy_Connective Tissue Disorders v1.52 COL2A1 Bryony Thompson Gene: col2a1 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.52 COL2A1 Bryony Thompson Classified gene: COL2A1 as Green List (high evidence)
Aortopathy_Connective Tissue Disorders v1.52 COL2A1 Bryony Thompson Gene: col2a1 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.51 COL2A1 Bryony Thompson gene: COL2A1 was added
gene: COL2A1 was added to Aortopathy_Connective Tissue Disorders. Sources: Other
Mode of inheritance for gene: COL2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL2A1 were set to 1677770; 20301479
Phenotypes for gene: COL2A1 were set to Stickler syndrome, type I MIM#108300
Review for gene: COL2A1 was set to GREEN
gene: COL2A1 was marked as current diagnostic
Added comment: Stickler syndrome is a multi-system connective tissue disorder. Monoallelic loss of function variants in COL2A1 are the most common cause of Stickler syndrome.
Sources: Other
Aortopathy_Connective Tissue Disorders v1.50 LTBP3 Bryony Thompson Classified gene: LTBP3 as Amber List (moderate evidence)
Aortopathy_Connective Tissue Disorders v1.50 LTBP3 Bryony Thompson Gene: ltbp3 has been classified as Amber List (Moderate Evidence).
Aortopathy_Connective Tissue Disorders v1.49 LTBP3 Bryony Thompson gene: LTBP3 was added
gene: LTBP3 was added to Aortopathy_Connective Tissue Disorders. Sources: Other
Mode of inheritance for gene: LTBP3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: LTBP3 were set to 29625025; 34150014
Phenotypes for gene: LTBP3 were set to Thoracic aortic aneurysms and dissections
Review for gene: LTBP3 was set to AMBER
Added comment: 2 families with biallelic variants with thoracic aortic aneurysms and dissections and other arterial aneurysms, along with skeletal and dental defects. TAA hasn't been reported in other dental anomalies and short stature cases with biallelic LTBP3 variants. Individuals with heterozygous mutations in LTBP3 may also be at increased risk for later-onset thoracic aortic disease, 9/338 isolated TAD individuals had rare heterozygous variants. Null mouse model had thoracic aortic aneurysms
Sources: Other
Intellectual disability syndromic and non-syndromic v0.4042 JAKMIP1 Seb Lunke Marked gene: JAKMIP1 as ready
Intellectual disability syndromic and non-syndromic v0.4042 JAKMIP1 Seb Lunke Gene: jakmip1 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1163 JAKMIP1 Seb Lunke Marked gene: JAKMIP1 as ready
Genetic Epilepsy v0.1163 JAKMIP1 Seb Lunke Gene: jakmip1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4042 JAKMIP1 Seb Lunke Classified gene: JAKMIP1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4042 JAKMIP1 Seb Lunke Gene: jakmip1 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1163 JAKMIP1 Seb Lunke Classified gene: JAKMIP1 as Amber List (moderate evidence)
Genetic Epilepsy v0.1163 JAKMIP1 Seb Lunke Gene: jakmip1 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1162 JAKMIP1 Seb Lunke gene: JAKMIP1 was added
gene: JAKMIP1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: JAKMIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: JAKMIP1 were set to 29158550; 26627310; 27799067
Phenotypes for gene: JAKMIP1 were set to Intellectual disability; Seizures
Review for gene: JAKMIP1 was set to AMBER
Added comment: Identified in two independent patients in the literature with a mouse model. Patient 1 (27799067) with developmental delay, speech delay, and cognitive impairment; self-injurious and aggressive behaviour, seizures, dysmorphic features. De-novo missense JAKMIP1 (p.D586H). Patient 2 (29158550) with feeding difficulties, hypotonia, epilepsy, severe ID, no active speech, kyphoscoliosis, constipation, autism, short stature. Splice variant c.1432-2A>G, no segregation or RNA data available. KO mouse model (27799067) displays social deficits, stereotyped activity, abnormal postnatal vocalisations, and other autistic-like behaviours.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4041 JAKMIP1 Seb Lunke gene: JAKMIP1 was added
gene: JAKMIP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JAKMIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: JAKMIP1 were set to 29158550; 26627310; 27799067
Phenotypes for gene: JAKMIP1 were set to Intellectual disability; Seizures
Review for gene: JAKMIP1 was set to AMBER
Added comment: Identified in two independent patients in the literature with a mouse model. Patient 1 (27799067) with developmental delay, speech delay, and cognitive impairment; self-injurious and aggressive behaviour, seizures, dysmorphic features. De-novo missense JAKMIP1 (p.D586H). Patient 2 (29158550) with feeding difficulties, hypotonia, epilepsy, severe ID, no active speech, kyphoscoliosis, constipation, autism, short stature. Splice variant c.1432-2A>G, no segregation or RNA data available. KO mouse model (27799067) displays social deficits, stereotyped activity, abnormal postnatal vocalizations, and other autistic-like behaviors.
Sources: Literature
Mendeliome v0.8733 JAKMIP1 Seb Lunke Marked gene: JAKMIP1 as ready
Mendeliome v0.8733 JAKMIP1 Seb Lunke Gene: jakmip1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8733 JAKMIP1 Seb Lunke Classified gene: JAKMIP1 as Amber List (moderate evidence)
Mendeliome v0.8733 JAKMIP1 Seb Lunke Gene: jakmip1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8732 JAKMIP1 Seb Lunke gene: JAKMIP1 was added
gene: JAKMIP1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: JAKMIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: JAKMIP1 were set to 29158550; 26627310; 27799067
Phenotypes for gene: JAKMIP1 were set to Intellectual disability; Seizures
Review for gene: JAKMIP1 was set to AMBER
Added comment: Identified in two independent patients in the literature with a mouse model.

Patient 1 (27799067) with developmental delay, speech delay, and cognitive impairment; self-injurious and aggressive behaviour, seizures, dysmorphic features. De-novo missense JAKMIP1 (p.D586H).

Patient 2 (29158550) with feeding difficulties, hypotonia, epilepsy, severe ID, no active speech, kyphoscoliosis, constipation, autism, short stature. Splice variant c.1432-2A>G, no segregation or RNA data available.

KO mouse model (27799067) displays social deficits, stereotyped activity, abnormal postnatal vocalizations, and other autistic-like behaviors.
Sources: Literature
Mendeliome v0.8731 ARIH1 Bryony Thompson Marked gene: ARIH1 as ready
Mendeliome v0.8731 ARIH1 Bryony Thompson Gene: arih1 has been classified as Green List (High Evidence).
Mendeliome v0.8731 ARIH1 Bryony Thompson Classified gene: ARIH1 as Green List (high evidence)
Mendeliome v0.8731 ARIH1 Bryony Thompson Gene: arih1 has been classified as Green List (High Evidence).
Mendeliome v0.8730 ARIH1 Bryony Thompson gene: ARIH1 was added
gene: ARIH1 was added to Mendeliome. Sources: Other
Mode of inheritance for gene: ARIH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARIH1 were set to 29689197; 32102558
Phenotypes for gene: ARIH1 were set to Thoracic aortic aneurysm
Review for gene: ARIH1 was set to GREEN
Added comment: 3 unrelated families: A de novo case (R171*) with thoracic aortic aneurysm (TAA), and 2 siblings with TAA and a missense (E15Q). Another proband with cerebrovascular aneurysm (family history of TAA) and a missense variant (E44G). Supporting functional assays of the variants and a drosophila model.
Sources: Other
Aortopathy_Connective Tissue Disorders v1.48 ARIH1 Bryony Thompson Marked gene: ARIH1 as ready
Aortopathy_Connective Tissue Disorders v1.48 ARIH1 Bryony Thompson Gene: arih1 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.48 ARIH1 Bryony Thompson Classified gene: ARIH1 as Green List (high evidence)
Aortopathy_Connective Tissue Disorders v1.48 ARIH1 Bryony Thompson Gene: arih1 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.47 ARIH1 Bryony Thompson gene: ARIH1 was added
gene: ARIH1 was added to Aortopathy_Connective Tissue Disorders. Sources: Other
Mode of inheritance for gene: ARIH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARIH1 were set to 29689197; 32102558
Phenotypes for gene: ARIH1 were set to Thoracic aortic aneurysm
Review for gene: ARIH1 was set to GREEN
Added comment: 3 unrelated families: A de novo case (R171*) with thoracic aortic aneurysm (TAA), and 2 siblings with TAA and a missense (E15Q). Another proband with cerebrovascular aneurysm (family history of TAA) and a missense variant (E44G). Supporting functional assays of the variants and a drosophila model.
Sources: Other
Aortopathy_Connective Tissue Disorders v1.46 ADAMTS17 Bryony Thompson Marked gene: ADAMTS17 as ready
Aortopathy_Connective Tissue Disorders v1.46 ADAMTS17 Bryony Thompson Gene: adamts17 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.46 ADAMTS17 Bryony Thompson Classified gene: ADAMTS17 as Green List (high evidence)
Aortopathy_Connective Tissue Disorders v1.46 ADAMTS17 Bryony Thompson Gene: adamts17 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.45 ADAMTS17 Bryony Thompson gene: ADAMTS17 was added
gene: ADAMTS17 was added to Aortopathy_Connective Tissue Disorders. Sources: Other
Mode of inheritance for gene: ADAMTS17 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAMTS17 were set to 19836009; 20301293
Phenotypes for gene: ADAMTS17 were set to Weill-Marchesani 4 syndrome, recessive MIM#613195
Review for gene: ADAMTS17 was set to GREEN
gene: ADAMTS17 was marked as current diagnostic
Added comment: Weill-Marchesani syndrome is a multi-system connective tissue disorder. Biallelic variants in ADAMTS17 have been reported in at least 6 families.
Sources: Other
Aortopathy_Connective Tissue Disorders v1.44 ADAMTS10 Bryony Thompson Marked gene: ADAMTS10 as ready
Aortopathy_Connective Tissue Disorders v1.44 ADAMTS10 Bryony Thompson Gene: adamts10 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.44 ADAMTS10 Bryony Thompson Classified gene: ADAMTS10 as Green List (high evidence)
Aortopathy_Connective Tissue Disorders v1.44 ADAMTS10 Bryony Thompson Gene: adamts10 has been classified as Green List (High Evidence).
Aortopathy_Connective Tissue Disorders v1.43 ADAMTS10 Bryony Thompson gene: ADAMTS10 was added
gene: ADAMTS10 was added to Aortopathy_Connective Tissue Disorders. Sources: Other
Mode of inheritance for gene: ADAMTS10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAMTS10 were set to 15368195; 20301293
Phenotypes for gene: ADAMTS10 were set to Weill-Marchesani syndrome 1, recessive MIM#277600
Review for gene: ADAMTS10 was set to GREEN
gene: ADAMTS10 was marked as current diagnostic
Added comment: Weill-Marchesani syndrome is a multi-system connective tissue disorder. Biallelic variants in ADAMTS10 have been reported in >10 families.
Sources: Other
Genetic Epilepsy v0.1161 PIDD1 Konstantinos Varvagiannis gene: PIDD1 was added
gene: PIDD1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010
Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum
Penetrance for gene: PIDD1 were set to Complete
Review for gene: PIDD1 was set to GREEN
Added comment: There is enough evidence to include this gene in the current panel with green rating.

Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested.

The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families].

Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants.

Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder.

PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage.

There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation.

Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants.

Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26

Evidence so far provided includes:
- Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern.
- Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability.
- Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp]
- Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain.
- Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD.

Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects.

There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes.

Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4040 PIDD1 Konstantinos Varvagiannis gene: PIDD1 was added
gene: PIDD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010
Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum
Penetrance for gene: PIDD1 were set to Complete
Review for gene: PIDD1 was set to GREEN
Added comment: There is enough evidence to include this gene in the current panel with green rating.

Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested.

The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families].

Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants.

Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder.

PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage.

There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation.

Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants.

Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26

Evidence so far provided includes:
- Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern.
- Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability.
- Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp]
- Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain.
- Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD.

Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects.

There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes.

Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc.
Sources: Literature
Growth failure v0.85 UBE2T Zornitza Stark Marked gene: UBE2T as ready
Growth failure v0.85 UBE2T Zornitza Stark Gene: ube2t has been classified as Green List (High Evidence).
Growth failure v0.85 UBE2T Zornitza Stark Phenotypes for gene: UBE2T were changed from Falcon anemia; 616435 Fanconi anemia, complementation group T; Fanconi anemia, complementation group T, 616435 to Fanconi anemia, complementation group T, MIM# 616435
Growth failure v0.84 UBE2T Zornitza Stark Publications for gene: UBE2T were set to 26046368
Growth failure v0.83 UBE2T Zornitza Stark commented on gene: UBE2T: Poor growth is an early feature of FA.
Growth failure v0.83 TOP3A Zornitza Stark Marked gene: TOP3A as ready
Growth failure v0.83 TOP3A Zornitza Stark Gene: top3a has been classified as Green List (High Evidence).
Growth failure v0.83 TOP3A Zornitza Stark Phenotypes for gene: TOP3A were changed from Microcephaly, growth restriction, and increased sister chromatid exchange 2; MGRISCE2 (Bloom-like syndrome) 618097; 618097 MGRISCE2 (Bloom-like syndrome) to Microcephaly, growth restriction, and increased sister chromatid exchange 2, MIM# 618097
Growth failure v0.82 TOP3A Zornitza Stark Publications for gene: TOP3A were set to
Growth failure v0.81 SOS2 Zornitza Stark Marked gene: SOS2 as ready
Growth failure v0.81 SOS2 Zornitza Stark Gene: sos2 has been classified as Green List (High Evidence).
Growth failure v0.81 SOS2 Zornitza Stark Phenotypes for gene: SOS2 were changed from Noonan syndrome 9 to Noonan syndrome 9, MIM# 616559
Growth failure v0.80 SOS2 Zornitza Stark Publications for gene: SOS2 were set to 25795793; 26173643
Growth failure v0.79 SOS2 Zornitza Stark Mode of pathogenicity for gene: SOS2 was changed from Other - please provide details in the comments to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Growth failure v0.78 SOS2 Zornitza Stark Mode of inheritance for gene: SOS2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.77 SOS1 Zornitza Stark Marked gene: SOS1 as ready
Growth failure v0.77 SOS1 Zornitza Stark Gene: sos1 has been classified as Green List (High Evidence).
Growth failure v0.77 SOS1 Zornitza Stark Phenotypes for gene: SOS1 were changed from Noonan syndrome; Rasopathy; Noonan syndrome 4 to Noonan syndrome 4, MIM# 610733
Growth failure v0.76 SLX4 Zornitza Stark Marked gene: SLX4 as ready
Growth failure v0.76 SLX4 Zornitza Stark Gene: slx4 has been classified as Green List (High Evidence).
Growth failure v0.76 SLX4 Zornitza Stark Phenotypes for gene: SLX4 were changed from 613951 Fanconi Anemia Fanconi anemia, complementation group P; Fanconi anemia, complementation group P, 613951; Fanconi Anemia to Fanconi anemia, complementation group P, MIM# 613951
Growth failure v0.75 SLX4 Zornitza Stark commented on gene: SLX4: Poor growth is an early feature.
Intellectual disability syndromic and non-syndromic v0.4040 SHOC2 Zornitza Stark Marked gene: SHOC2 as ready
Intellectual disability syndromic and non-syndromic v0.4040 SHOC2 Zornitza Stark Gene: shoc2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4040 SHOC2 Zornitza Stark Phenotypes for gene: SHOC2 were changed from to Noonan syndrome-like with loose anagen hair 1, MIM# 607721
Intellectual disability syndromic and non-syndromic v0.4039 SHOC2 Zornitza Stark Publications for gene: SHOC2 were set to
Intellectual disability syndromic and non-syndromic v0.4038 SHOC2 Zornitza Stark Mode of pathogenicity for gene: SHOC2 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v0.4037 SHOC2 Zornitza Stark Mode of inheritance for gene: SHOC2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4036 SHOC2 Zornitza Stark reviewed gene: SHOC2: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 19684605, 23918763, 20882035; Phenotypes: Noonan syndrome-like with loose anagen hair 1, MIM# 607721; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.75 SHOC2 Zornitza Stark Marked gene: SHOC2 as ready
Growth failure v0.75 SHOC2 Zornitza Stark Gene: shoc2 has been classified as Green List (High Evidence).
Growth failure v0.75 SHOC2 Zornitza Stark Phenotypes for gene: SHOC2 were changed from Noonan with loss of anagen hair; Noonan-like syndrome with loose anagen hair to Noonan syndrome-like with loose anagen hair 1, MIM# 607721
Additional findings_Paediatric v0.256 SLC41A1 Zornitza Stark Marked gene: SLC41A1 as ready
Additional findings_Paediatric v0.256 SLC41A1 Zornitza Stark Gene: slc41a1 has been classified as Red List (Low Evidence).
Additional findings_Paediatric v0.256 SLC41A1 Zornitza Stark Phenotypes for gene: SLC41A1 were changed from Parkinson disease, idiopathic to Nephronophthisis-like nephropathy 2, MIM# 619468
Additional findings_Paediatric v0.255 SLC41A1 Zornitza Stark Publications for gene: SLC41A1 were set to
Additional findings_Paediatric v0.254 SLC41A1 Zornitza Stark Mode of inheritance for gene: SLC41A1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Additional findings_Paediatric v0.253 SLC41A1 Zornitza Stark reviewed gene: SLC41A1: Rating: RED; Mode of pathogenicity: None; Publications: 23661805; Phenotypes: Nephronophthisis-like nephropathy 2, MIM# 619468; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8729 SLC41A1 Zornitza Stark Phenotypes for gene: SLC41A1 were changed from Nephronophthisis to Nephronophthisis-like nephropathy 2, MIM# 619468
Mendeliome v0.8728 SLC41A1 Zornitza Stark edited their review of gene: SLC41A1: Changed phenotypes: Nephronophthisis-like nephropathy 2, MIM# 619468
Renal Ciliopathies and Nephronophthisis v1.2 SLC41A1 Zornitza Stark Phenotypes for gene: SLC41A1 were changed from Nephronophthisis; no OMIM number to Nephronophthisis-like nephropathy 2, MIM# 619468
Renal Ciliopathies and Nephronophthisis v1.1 SLC41A1 Zornitza Stark reviewed gene: SLC41A1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Nephronophthisis-like nephropathy 2, MIM# 619468; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Autoinflammatory Disorders v0.118 RBCK1 Zornitza Stark Marked gene: RBCK1 as ready
Autoinflammatory Disorders v0.118 RBCK1 Zornitza Stark Gene: rbck1 has been classified as Green List (High Evidence).
Autoinflammatory Disorders v0.118 RBCK1 Zornitza Stark Phenotypes for gene: RBCK1 were changed from to Polyglucosan body myopathy 1 with or without immunodeficiency MIM# 615895; muscular weakness; cardiomyopathy; recurrent bacterial/viral infections; autoinflammation; immunodeficiency; Poor antibody responses to polysaccharides; failure to thrive; fever; pneumonia
Autoinflammatory Disorders v0.117 RBCK1 Zornitza Stark Publications for gene: RBCK1 were set to
Autoinflammatory Disorders v0.116 RBCK1 Zornitza Stark Mode of inheritance for gene: RBCK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Congenital Heart Defect v0.124 MYH7 Zornitza Stark Marked gene: MYH7 as ready
Congenital Heart Defect v0.124 MYH7 Zornitza Stark Gene: myh7 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.124 MYH7 Zornitza Stark Phenotypes for gene: MYH7 were changed from to Ebstein anomaly
Congenital Heart Defect v0.123 MYH7 Zornitza Stark Publications for gene: MYH7 were set to
Congenital Heart Defect v0.122 MYH7 Zornitza Stark Mode of pathogenicity for gene: MYH7 was changed from to Other
Congenital Heart Defect v0.121 MYH7 Zornitza Stark Mode of inheritance for gene: MYH7 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8728 PRPF31 Zornitza Stark Marked gene: PRPF31 as ready
Mendeliome v0.8728 PRPF31 Zornitza Stark Gene: prpf31 has been classified as Green List (High Evidence).
Mendeliome v0.8728 PRPF31 Zornitza Stark Phenotypes for gene: PRPF31 were changed from to Retinitis pigmentosa 11, MIM#600138
Mendeliome v0.8727 PRPF31 Zornitza Stark Publications for gene: PRPF31 were set to
Mendeliome v0.8726 PRPF31 Zornitza Stark Mode of inheritance for gene: PRPF31 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8725 PRPF31 Zornitza Stark Tag SV/CNV tag was added to gene: PRPF31.
Mendeliome v0.8725 PRPF31 Zornitza Stark reviewed gene: PRPF31: Rating: GREEN; Mode of pathogenicity: None; Publications: 32014492; Phenotypes: Retinitis pigmentosa 11, MIM#600138; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8725 RNF168 Zornitza Stark Marked gene: RNF168 as ready
Mendeliome v0.8725 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Mendeliome v0.8725 RNF168 Zornitza Stark Phenotypes for gene: RNF168 were changed from to RIDDLE syndrome MIM# 611943; Radiosensitivity; Immune Deficiency; Dysmorphic Features; Learning difficulties; Low IgG or IgA; Short stature; mild defect of motor control to ataxia; normal intelligence to learning difficulties; mild facial dysmorphism to microcephaly
Retinitis pigmentosa_Autosomal Dominant v0.31 PRPF31 Zornitza Stark Marked gene: PRPF31 as ready
Retinitis pigmentosa_Autosomal Dominant v0.31 PRPF31 Zornitza Stark Gene: prpf31 has been classified as Green List (High Evidence).
Retinitis pigmentosa_Autosomal Dominant v0.31 PRPF31 Zornitza Stark Publications for gene: PRPF31 were set to
Retinitis pigmentosa_Autosomal Dominant v0.30 PRPF31 Zornitza Stark Mode of inheritance for gene: PRPF31 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Retinitis pigmentosa_Autosomal Dominant v0.29 PRPF31 Zornitza Stark Tag SV/CNV tag was added to gene: PRPF31.
Chromosome Breakage Disorders v1.3 RNF168 Zornitza Stark Marked gene: RNF168 as ready
Chromosome Breakage Disorders v1.3 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Chromosome Breakage Disorders v1.3 RNF168 Zornitza Stark Classified gene: RNF168 as Green List (high evidence)
Chromosome Breakage Disorders v1.3 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Mendeliome v0.8724 RNF168 Zornitza Stark Publications for gene: RNF168 were set to
Chromosome Breakage Disorders v1.2 RNF168 Danielle Ariti gene: RNF168 was added
gene: RNF168 was added to Chromosome Breakage Disorders. Sources: Literature
Mode of inheritance for gene: RNF168 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF168 were set to 19203578; 21394101; 29255463; 21552324
Phenotypes for gene: RNF168 were set to RIDDLE syndrome MIM# 611943; Radiosensitivity; Immune Deficiency; Dysmorphic Features; Learning difficulties; Low IgG or IgA; Short stature; mild defect of motor control to ataxia; normal intelligence to learning difficulties; mild facial dysmorphism to microcephaly
Review for gene: RNF168 was set to GREEN
Added comment: 4 individuals from 3 unrelated families have been reported with RNF168 variants and display RIDDLE syndrome phenotype.

One mouse model; demonstrated RNF168 deficient mice are immunodeficient and exhibit increased radiosensitivity.

Homozygous and Compound heterozygous (duplications, deletions and nonsense) variants identified resulting in frameshift, aberrant protein and alteration of binding motifs.

Typically presents with increased radiosensitivity, immunodeficiency (decrease IgA), mild motor control and learning difficulties, facial dysmorphism, and short stature.
Sources: Literature
Mendeliome v0.8723 RNF168 Zornitza Stark Mode of inheritance for gene: RNF168 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.309 RNF168 Zornitza Stark Marked gene: RNF168 as ready
Combined Immunodeficiency v0.309 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Mendeliome v0.8722 RFXAP Zornitza Stark Marked gene: RFXAP as ready
Mendeliome v0.8722 RFXAP Zornitza Stark Gene: rfxap has been classified as Green List (High Evidence).
Mendeliome v0.8722 RFXAP Zornitza Stark Phenotypes for gene: RFXAP were changed from to Bare lymphocyte syndrome, type II, complementation group D MIM# 209920; Low CD4+ T cells; reduced MHC II expression on lymphocytes; Normal-low Ig levels; Failure to thrive; respiratory/gastrointestinal infections; liver/biliary tract disease; diarrhoea; Severe autoimmune cytopaenia; agammaglobulinaemia
Combined Immunodeficiency v0.309 RNF168 Zornitza Stark Phenotypes for gene: RNF168 were changed from to RIDDLE syndrome MIM# 611943; Radiosensitivity; Immune Deficiency; Dysmorphic Features; Learning difficulties; Low IgG or IgA; Short stature; mild defect of motor control to ataxia; normal intelligence to learning difficulties; mild facial dysmorphism to microcephaly
Mendeliome v0.8721 RFXAP Zornitza Stark Publications for gene: RFXAP were set to
Combined Immunodeficiency v0.308 RNF168 Zornitza Stark Publications for gene: RNF168 were set to
Combined Immunodeficiency v0.307 RNF168 Zornitza Stark Mode of inheritance for gene: RNF168 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8720 RFXAP Zornitza Stark Mode of inheritance for gene: RFXAP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8719 RFXAP Zornitza Stark Tag founder tag was added to gene: RFXAP.
Mendeliome v0.8719 RFXANK Zornitza Stark Marked gene: RFXANK as ready
Mendeliome v0.8719 RFXANK Zornitza Stark Gene: rfxank has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.306 RFXAP Zornitza Stark Marked gene: RFXAP as ready
Combined Immunodeficiency v0.306 RFXAP Zornitza Stark Gene: rfxap has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.306 RFXAP Zornitza Stark Phenotypes for gene: RFXAP were changed from to Bare lymphocyte syndrome, type II, complementation group D MIM# 209920; Low CD4+ T cells; reduced MHC II expression on lymphocytes; Normal-low Ig levels; Failure to thrive; respiratory/gastrointestinal infections; liver/biliary tract disease; diarrhoea; Severe autoimmune cytopaenia; agammaglobulinaemia
Mendeliome v0.8719 RFXANK Zornitza Stark Phenotypes for gene: RFXANK were changed from to MHC class II deficiency, complementation group B MIM# 209920; Bare Lymphocyte Syndrome, type II, complementation group B; Low CD4+ T cells; reduced MHC II expression on lymphocytes; Normal-low Ig levels; Failure to thrive; respiratory/gastrointestinal infections; liver/biliary tract disease; diarrhoea; Severe autoimmune cytopaenia; agammaglobulinaemia
Combined Immunodeficiency v0.305 RFXAP Zornitza Stark Publications for gene: RFXAP were set to
Mendeliome v0.8718 RFXANK Zornitza Stark Publications for gene: RFXANK were set to
Combined Immunodeficiency v0.304 RFXAP Zornitza Stark Mode of inheritance for gene: RFXAP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8717 RFXANK Zornitza Stark Tag founder tag was added to gene: RFXANK.
Autoinflammatory Disorders v0.115 RBCK1 Danielle Ariti reviewed gene: RBCK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29260357, 29695863; Phenotypes: Polyglucosan body myopathy 1 with or without immunodeficiency MIM# 615895, muscular weakness, cardiomyopathy, recurrent bacterial/viral infections, autoinflammation, immunodeficiency, Poor antibody responses to polysaccharides, failure to thrive, fever, pneumonia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8717 RFXANK Zornitza Stark Mode of inheritance for gene: RFXANK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.303 RFXANK Zornitza Stark Marked gene: RFXANK as ready
Combined Immunodeficiency v0.303 RFXANK Zornitza Stark Gene: rfxank has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.303 RFXANK Zornitza Stark Phenotypes for gene: RFXANK were changed from to MHC class II deficiency, complementation group B MIM# 209920; Bare Lymphocyte Syndrome, type II, complementation group B; Low CD4+ T cells; reduced MHC II expression on lymphocytes; Normal-low Ig levels; Failure to thrive; respiratory/gastrointestinal infections; liver/biliary tract disease; diarrhoea; Severe autoimmune cytopaenia; agammaglobulinaemia
Combined Immunodeficiency v0.302 RFXANK Zornitza Stark Publications for gene: RFXANK were set to
Mendeliome v0.8716 RBCK1 Zornitza Stark Marked gene: RBCK1 as ready
Mendeliome v0.8716 RBCK1 Zornitza Stark Gene: rbck1 has been classified as Green List (High Evidence).
Mendeliome v0.8716 RBCK1 Zornitza Stark Phenotypes for gene: RBCK1 were changed from to Polyglucosan body myopathy 1 with or without immunodeficiency MIM# 615895; muscular weakness; cardiomyopathy; recurrent bacterial/viral infections; autoinflammation; immunodeficiency; Poor antibody responses to polysaccharides; failure to thrive; fever; pneumonia
Combined Immunodeficiency v0.301 RFXANK Zornitza Stark Mode of inheritance for gene: RFXANK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.300 RFXANK Zornitza Stark Tag founder tag was added to gene: RFXANK.
Combined Immunodeficiency v0.300 RBCK1 Zornitza Stark Marked gene: RBCK1 as ready
Combined Immunodeficiency v0.300 RBCK1 Zornitza Stark Gene: rbck1 has been classified as Green List (High Evidence).
Mendeliome v0.8715 RBCK1 Zornitza Stark Publications for gene: RBCK1 were set to
Combined Immunodeficiency v0.300 RBCK1 Zornitza Stark Phenotypes for gene: RBCK1 were changed from to Polyglucosan body myopathy 1 with or without immunodeficiency MIM# 615895; muscular weakness; cardiomyopathy; recurrent bacterial/viral infections; autoinflammation; immunodeficiency; Poor antibody responses to polysaccharides; failure to thrive; fever; pneumonia
Mendeliome v0.8714 RBCK1 Zornitza Stark Mode of inheritance for gene: RBCK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.299 RBCK1 Zornitza Stark Publications for gene: RBCK1 were set to
Combined Immunodeficiency v0.298 RBCK1 Zornitza Stark Mode of inheritance for gene: RBCK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.297 PNP Zornitza Stark Marked gene: PNP as ready
Combined Immunodeficiency v0.297 PNP Zornitza Stark Gene: pnp has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.297 PNP Zornitza Stark Phenotypes for gene: PNP were changed from to Immunodeficiency due to purine nucleoside phosphorylase deficiency MIM# 613179; Autoimmune hemolytic anaemia; neurological impairment; SCID; CID; hypouricaemia; failure to thrive; chronic diarrhoea; recurrent respiratory/ gastrointestinal infections; normal-low Ig levels; spastic paresis; tremor; ataxia; DD
Combined Immunodeficiency v0.296 PNP Zornitza Stark Publications for gene: PNP were set to
Combined Immunodeficiency v0.295 PNP Zornitza Stark Mode of inheritance for gene: PNP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.294 NHP2 Zornitza Stark Marked gene: NHP2 as ready
Combined Immunodeficiency v0.294 NHP2 Zornitza Stark Gene: nhp2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.294 NHP2 Zornitza Stark Phenotypes for gene: NHP2 were changed from to Dyskeratosis congenita, autosomal recessive 2 MIM# 613987; Shortened telomeres; Leukoplakia; Nail dystrophy; Bone marrow failure; Pancytopaenia; reticulate skin pigmentation; Thrombocytopaenia; recurrent opportunistic infections
Combined Immunodeficiency v0.293 NHP2 Zornitza Stark Publications for gene: NHP2 were set to
Combined Immunodeficiency v0.292 NHP2 Zornitza Stark Mode of inheritance for gene: NHP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.291 NHP2 Zornitza Stark changed review comment from: Third family reported with extreme end of the spectrum of DKC,; to: Third family reported with extreme end of the spectrum of DKC, Høyeraal-Hreidarsson syndrome.
Combined Immunodeficiency v0.291 NHP2 Zornitza Stark reviewed gene: NHP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31985013; Phenotypes: Dyskeratosis congenita, autosomal recessive 2 MIM# 613987, Shortened telomeres, Leukoplakia, Nail dystrophy, Bone marrow failure, Pancytopaenia, reticulate skin pigmentation, Thrombocytopaenia, recurrent opportunistic infections; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8713 RFXANK Danielle Ariti reviewed gene: RFXANK: Rating: GREEN; Mode of pathogenicity: None; Publications: 12618906; Phenotypes: MHC class II deficiency, complementation group B MIM# 209920, Bare Lymphocyte Syndrome, type II, complementation group B, Low CD4+ T cells, reduced MHC II expression on lymphocytes, Normal-low Ig levels, Failure to thrive, respiratory/gastrointestinal infections, liver/biliary tract disease, diarrhoea, Severe autoimmune cytopaenia, agammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8713 RFXAP Danielle Ariti reviewed gene: RFXAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 9118943, 32875002, 11258423; Phenotypes: Bare lymphocyte syndrome, type II, complementation group D MIM# 209920, Low CD4+ T cells, reduced MHC II expression on lymphocytes, Normal-low Ig levels, Failure to thrive, respiratory/gastrointestinal infections, liver/biliary tract disease, diarrhoea, Severe autoimmune cytopaenia, agammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8713 RNF168 Danielle Ariti reviewed gene: RNF168: Rating: GREEN; Mode of pathogenicity: None; Publications: 19203578, 21394101, 29255463, 21552324; Phenotypes: RIDDLE syndrome MIM# 611943, Radiosensitivity, Immune Deficiency, Dysmorphic Features, Learning difficulties, Low IgG or IgA, Short stature, mild defect of motor control to ataxia, normal intelligence to learning difficulties, mild facial dysmorphism to microcephaly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.291 RNF168 Danielle Ariti reviewed gene: RNF168: Rating: GREEN; Mode of pathogenicity: None; Publications: 19203578, 21394101, 29255463, 21552324; Phenotypes: RIDDLE syndrome MIM# 611943, Radiosensitivity, Immune Deficiency, Dysmorphic Features, Learning difficulties, Low IgG or IgA, Short stature, mild defect of motor control to ataxia, normal intelligence to learning difficulties, mild facial dysmorphism to microcephaly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.291 RFXAP Danielle Ariti reviewed gene: RFXAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 9118943, 32875002, 11258423; Phenotypes: Bare lymphocyte syndrome, type II, complementation group D MIM# 209920, Low CD4+ T cells, reduced MHC II expression on lymphocytes, Normal-low Ig levels, Failure to thrive, respiratory/gastrointestinal infections, liver/biliary tract disease, diarrhoea, Severe autoimmune cytopaenia, agammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Heart Defect v0.120 MYH7 Teresa Zhao reviewed gene: MYH7: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 21127202; Phenotypes: Ebstein anomaly; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Combined Immunodeficiency v0.291 RFXANK Danielle Ariti reviewed gene: RFXANK: Rating: GREEN; Mode of pathogenicity: None; Publications: 12618906; Phenotypes: MHC class II deficiency, complementation group B MIM# 209920, Bare Lymphocyte Syndrome, type II, complementation group B, Low CD4+ T cells, reduced MHC II expression on lymphocytes, Normal-low Ig levels, Failure to thrive, respiratory/gastrointestinal infections, liver/biliary tract disease, diarrhoea, Severe autoimmune cytopaenia, agammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8713 RBCK1 Danielle Ariti reviewed gene: RBCK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29260357, 29695863; Phenotypes: Polyglucosan body myopathy 1 with or without immunodeficiency MIM# 615895, muscular weakness, cardiomyopathy, recurrent bacterial/viral infections, autoinflammation, immunodeficiency, Poor antibody responses to polysaccharides, failure to thrive, fever, pneumonia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.291 RBCK1 Danielle Ariti reviewed gene: RBCK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29260357, 29695863; Phenotypes: Polyglucosan body myopathy 1 with or without immunodeficiency MIM# 615895, muscular weakness, cardiomyopathy, recurrent bacterial/viral infections, autoinflammation, immunodeficiency, Poor antibody responses to polysaccharides, failure to thrive, fever, pneumonia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.291 PNP Danielle Ariti reviewed gene: PNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 22132981, 9122228, 10859343; Phenotypes: Immunodeficiency due to purine nucleoside phosphorylase deficiency MIM# 613179, Autoimmune hemolytic anaemia, neurological impairment, SCID, CID, hypouricaemia, failure to thrive, chronic diarrhoea, recurrent respiratory/ gastrointestinal infections, normal-low Ig levels, spastic paresis, tremor, ataxia, DD; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Retinitis pigmentosa_Autosomal Dominant v0.29 PRPF31 Ain Roesley reviewed gene: PRPF31: Rating: GREEN; Mode of pathogenicity: None; Publications: 32014492; Phenotypes: Retinitis pigmentosa 11, (MIM#600138),; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.291 NHP2 Danielle Ariti reviewed gene: NHP2: Rating: AMBER; Mode of pathogenicity: None; Publications: 20301779, 18523010; Phenotypes: Dyskeratosis congenita, autosomal recessive 2 MIM# 613987, Shortened telomeres, Leukoplakia, Nail dystrophy, Bone marrow failure, Pancytopaenia, reticulate skin pigmentation, Thrombocytopaenia, recurrent opportunistic infections; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8713 ABCC2 Zornitza Stark Marked gene: ABCC2 as ready
Mendeliome v0.8713 ABCC2 Zornitza Stark Gene: abcc2 has been classified as Green List (High Evidence).
Mendeliome v0.8713 ABCC2 Zornitza Stark Phenotypes for gene: ABCC2 were changed from to Dubin-Johnson syndrome, MIM# 237500
Mendeliome v0.8712 ABCC2 Zornitza Stark Mode of inheritance for gene: ABCC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8711 ABCC2 Zornitza Stark reviewed gene: ABCC2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dubin-Johnson syndrome, MIM# 237500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cholestasis v0.199 ABCC2 Zornitza Stark Marked gene: ABCC2 as ready
Cholestasis v0.199 ABCC2 Zornitza Stark Gene: abcc2 has been classified as Green List (High Evidence).
Cholestasis v0.199 ABCC2 Zornitza Stark Phenotypes for gene: ABCC2 were changed from to Dubin-Johnson syndrome, MIM# 237500
Cholestasis v0.198 ABCC2 Zornitza Stark Mode of inheritance for gene: ABCC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cholestasis v0.197 ABCC2 Zornitza Stark reviewed gene: ABCC2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dubin-Johnson syndrome, MIM# 237500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hereditary Neuropathy_CMT - isolated v1.7 VCP Zornitza Stark Publications for gene: VCP were set to
Hereditary Neuropathy_CMT - isolated v1.6 VCP Zornitza Stark Phenotypes for gene: VCP were changed from Amyotrophic lateral sclerosis 14, with or without frontotemporal dementia; HMSN; Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1; Charcot-Marie-Tooth disease, type 2Y to Charcot-Marie-Tooth disease, type 2Y, MIM# 616687
Hereditary Neuropathy_CMT - isolated v1.5 VCP Zornitza Stark Mode of pathogenicity for gene: VCP was changed from to Other
Hereditary Neuropathy_CMT - isolated v1.4 VCP Zornitza Stark Classified gene: VCP as Green List (high evidence)
Hereditary Neuropathy_CMT - isolated v1.4 VCP Zornitza Stark Gene: vcp has been classified as Green List (High Evidence).
Deafness_Isolated v1.12 CLDN9 Bryony Thompson Classified gene: CLDN9 as Green List (high evidence)
Deafness_Isolated v1.12 CLDN9 Bryony Thompson Gene: cldn9 has been classified as Green List (High Evidence).
Deafness_Isolated v1.11 CLDN9 Bryony Thompson reviewed gene: CLDN9: Rating: GREEN; Mode of pathogenicity: None; Publications: 19696885, 31175426, 34265170; Phenotypes: Deafness, autosomal recessive 116, MIM#619093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Deafness_IsolatedAndComplex v1.87 CLDN9 Bryony Thompson Publications for gene: CLDN9 were set to 31175426; 19696885
Deafness_IsolatedAndComplex v1.86 CLDN9 Bryony Thompson Classified gene: CLDN9 as Green List (high evidence)
Deafness_IsolatedAndComplex v1.86 CLDN9 Bryony Thompson Gene: cldn9 has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.85 CLDN9 Bryony Thompson reviewed gene: CLDN9: Rating: GREEN; Mode of pathogenicity: None; Publications: 19696885, 31175426, 34265170; Phenotypes: Deafness, autosomal recessive 116, MIM#619093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8711 CLDN9 Bryony Thompson Publications for gene: CLDN9 were set to 31175426; 19696885
Mendeliome v0.8710 CLDN9 Bryony Thompson Classified gene: CLDN9 as Green List (high evidence)
Mendeliome v0.8710 CLDN9 Bryony Thompson Gene: cldn9 has been classified as Green List (High Evidence).
Mendeliome v0.8709 CLDN9 Bryony Thompson reviewed gene: CLDN9: Rating: GREEN; Mode of pathogenicity: None; Publications: 19696885, 31175426, 34265170; Phenotypes: Deafness, autosomal recessive 116 MIM#619093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4036 UBR1 Zornitza Stark Marked gene: UBR1 as ready
Intellectual disability syndromic and non-syndromic v0.4036 UBR1 Zornitza Stark Gene: ubr1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4036 UBR1 Zornitza Stark Phenotypes for gene: UBR1 were changed from to Johanson-Blizzard syndrome (MIM#243800)
Intellectual disability syndromic and non-syndromic v0.4035 UBR1 Zornitza Stark Publications for gene: UBR1 were set to
Intellectual disability syndromic and non-syndromic v0.4034 UBR1 Zornitza Stark Mode of inheritance for gene: UBR1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Hereditary Neuropathy_CMT - isolated v1.3 VCP Kristin Rigbye reviewed gene: VCP: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 32165109; Phenotypes: Charcot-Marie-Tooth disease, type 2Y (MIM#616687), AD; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8709 UBR1 Zornitza Stark changed review comment from: >50 unrelated families reported, reviewed in PMID: 24599544.

Common clinical features include poor growth, mental retardation, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.; to: >50 unrelated families reported, reviewed in PMID: 24599544.

Common clinical features include poor growth, intellectual disability, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.
Intellectual disability syndromic and non-syndromic v0.4033 UBR1 Zornitza Stark changed review comment from: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, mental retardation, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.; to: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, intellectual disability, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.
Intellectual disability syndromic and non-syndromic v0.4033 UBR1 Zornitza Stark reviewed gene: UBR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24599544; Phenotypes: Johanson-Blizzard syndrome (MIM#243800); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8709 UBR1 Zornitza Stark Marked gene: UBR1 as ready
Mendeliome v0.8709 UBR1 Zornitza Stark Gene: ubr1 has been classified as Green List (High Evidence).
Mendeliome v0.8709 UBR1 Zornitza Stark Phenotypes for gene: UBR1 were changed from to Johanson-Blizzard syndrome (MIM#243800)
Mendeliome v0.8708 UBR1 Zornitza Stark Publications for gene: UBR1 were set to
Mendeliome v0.8707 UBR1 Zornitza Stark Mode of inheritance for gene: UBR1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8706 UBR1 Zornitza Stark reviewed gene: UBR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24599544; Phenotypes: Johanson-Blizzard syndrome (MIM#243800); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Heart Defect v0.120 UBR1 Zornitza Stark Marked gene: UBR1 as ready
Congenital Heart Defect v0.120 UBR1 Zornitza Stark Gene: ubr1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.120 UBR1 Zornitza Stark Phenotypes for gene: UBR1 were changed from to Johanson-Blizzard syndrome (MIM#243800)
Congenital Heart Defect v0.119 UBR1 Zornitza Stark Publications for gene: UBR1 were set to
Congenital Heart Defect v0.118 UBR1 Zornitza Stark Mode of inheritance for gene: UBR1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Congenital Heart Defect v0.117 UBR1 Zornitza Stark reviewed gene: UBR1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Johanson-Blizzard syndrome (MIM#243800); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8706 ACTL6A Zornitza Stark Marked gene: ACTL6A as ready
Mendeliome v0.8706 ACTL6A Zornitza Stark Gene: actl6a has been classified as Green List (High Evidence).
Mendeliome v0.8706 ACTL6A Zornitza Stark Phenotypes for gene: ACTL6A were changed from to Intellectual disability
Mendeliome v0.8705 ACTL6A Zornitza Stark Publications for gene: ACTL6A were set to
Congenital Heart Defect v0.117 UBR1 Teresa Zhao reviewed gene: UBR1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24599544; Phenotypes: Johanson-Blizzard syndrome (MIM#243800); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8704 ACTL6A Zornitza Stark Mode of inheritance for gene: ACTL6A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8703 ACTL6A Zornitza Stark changed review comment from: Two individuals from unrelated families reported with missense variants in this gene. Part of the BAF complex. Only one confirmed de novo.; to: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.
PMID 31994175: fourth individual reported, recurrent de novo p.Arg377Trp
Mendeliome v0.8703 ACTL6A Zornitza Stark edited their review of gene: ACTL6A: Changed publications: 28649782, 31994175
Intellectual disability syndromic and non-syndromic v0.4033 ACTL6A Zornitza Stark changed review comment from: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.; to: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.
PMID 31994175: fourth individual reported, recurrent de novo p.Arg377Trp
Intellectual disability syndromic and non-syndromic v0.4033 ACTL6A Zornitza Stark edited their review of gene: ACTL6A: Changed publications: 28649782, 31994175
Intellectual disability syndromic and non-syndromic v0.4033 ACTL6A Zornitza Stark changed review comment from: Two individuals from unrelated families reported with missense variants in this gene. Part of the BAF complex. Only one confirmed de novo.; to: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.
Mendeliome v0.8703 VAV1 Zornitza Stark Marked gene: VAV1 as ready
Mendeliome v0.8703 VAV1 Zornitza Stark Gene: vav1 has been classified as Red List (Low Evidence).
Mendeliome v0.8703 VAV1 Zornitza Stark gene: VAV1 was added
gene: VAV1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: VAV1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: VAV1 were set to 20638113; 23058036
Phenotypes for gene: VAV1 were set to Common variable immnodeficiency
Review for gene: VAV1 was set to RED
Added comment: Reduced VAV1 expression has been reported in multiple T-CVID cases, however only one large deletion (exon 2-27) has been reported in a single case in a publication from 2012. The CNV was detected using real-time qPCR, but was not confirmed by an orthogonal method.
Sources: Expert Review
Predominantly Antibody Deficiency v0.80 TCF3 Zornitza Stark Marked gene: TCF3 as ready
Predominantly Antibody Deficiency v0.80 TCF3 Zornitza Stark Gene: tcf3 has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.80 TCF3 Zornitza Stark Phenotypes for gene: TCF3 were changed from to Agammaglobulinaemia 8, autosomal dominant, MIM# 616941
Predominantly Antibody Deficiency v0.79 TCF3 Zornitza Stark Publications for gene: TCF3 were set to
Predominantly Antibody Deficiency v0.78 TCF3 Zornitza Stark Mode of inheritance for gene: TCF3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.77 TCF3 Zornitza Stark reviewed gene: TCF3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24216514, 28532655, 30063982, 8001124, 8001125; Phenotypes: Agammaglobulinaemia 8, autosomal dominant, MIM# 616941; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8702 TCF3 Zornitza Stark Marked gene: TCF3 as ready
Mendeliome v0.8702 TCF3 Zornitza Stark Gene: tcf3 has been classified as Green List (High Evidence).
Mendeliome v0.8702 TCF3 Zornitza Stark Phenotypes for gene: TCF3 were changed from to Agammaglobulinaemia 8, autosomal dominant, MIM# 616941
Mendeliome v0.8701 TCF3 Zornitza Stark Publications for gene: TCF3 were set to
Mendeliome v0.8700 TCF3 Zornitza Stark Mode of inheritance for gene: TCF3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8699 TCF3 Zornitza Stark reviewed gene: TCF3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24216514, 28532655, 30063982, 8001124, 8001125; Phenotypes: Agammaglobulinaemia 8, autosomal dominant, MIM# 616941; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Disorders of immune dysregulation v0.92 PRKCD Zornitza Stark Marked gene: PRKCD as ready
Disorders of immune dysregulation v0.92 PRKCD Zornitza Stark Gene: prkcd has been classified as Green List (High Evidence).
Disorders of immune dysregulation v0.92 PRKCD Zornitza Stark Phenotypes for gene: PRKCD were changed from to Autoimmune lymphoproliferative syndrome, type III, MIM# 615559; CVID 9
Disorders of immune dysregulation v0.91 PRKCD Zornitza Stark Publications for gene: PRKCD were set to
Disorders of immune dysregulation v0.90 PRKCD Zornitza Stark Mode of inheritance for gene: PRKCD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Disorders of immune dysregulation v0.89 PRKCD Zornitza Stark reviewed gene: PRKCD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23319571, 23666743, 23430113, 11976687, 33047643, 29867916; Phenotypes: Autoimmune lymphoproliferative syndrome, type III, MIM# 615559, CVID 9; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8699 PRKCD Zornitza Stark Marked gene: PRKCD as ready
Mendeliome v0.8699 PRKCD Zornitza Stark Gene: prkcd has been classified as Green List (High Evidence).
Mendeliome v0.8699 PRKCD Zornitza Stark Phenotypes for gene: PRKCD were changed from to Autoimmune lymphoproliferative syndrome, type III, MIM# 615559; CVID 9
Mendeliome v0.8698 PRKCD Zornitza Stark Publications for gene: PRKCD were set to
Mendeliome v0.8697 PRKCD Zornitza Stark Mode of inheritance for gene: PRKCD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8696 PRKCD Zornitza Stark reviewed gene: PRKCD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23319571, 23666743, 23430113, 11976687, 33047643, 29867916; Phenotypes: Autoimmune lymphoproliferative syndrome, type III, MIM# 615559, CVID 9; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Disorders of immune dysregulation v0.89 CTLA4 Zornitza Stark Marked gene: CTLA4 as ready
Disorders of immune dysregulation v0.89 CTLA4 Zornitza Stark Gene: ctla4 has been classified as Green List (High Evidence).
Disorders of immune dysregulation v0.89 CTLA4 Zornitza Stark Phenotypes for gene: CTLA4 were changed from to Autoimmune lymphoproliferative syndrome, type V, MIM# 616100
Disorders of immune dysregulation v0.88 CTLA4 Zornitza Stark Publications for gene: CTLA4 were set to
Disorders of immune dysregulation v0.87 CTLA4 Zornitza Stark Mode of inheritance for gene: CTLA4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Disorders of immune dysregulation v0.86 CTLA4 Zornitza Stark reviewed gene: CTLA4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25213377, 25329329, 30377434; Phenotypes: Autoimmune lymphoproliferative syndrome, type V, MIM# 616100; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Predominantly Antibody Deficiency v0.77 CD19 Zornitza Stark Marked gene: CD19 as ready
Predominantly Antibody Deficiency v0.77 CD19 Zornitza Stark Gene: cd19 has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.77 CD19 Zornitza Stark Phenotypes for gene: CD19 were changed from to Immunodeficiency, common variable, 3, MIM# 613493
Predominantly Antibody Deficiency v0.76 CD19 Zornitza Stark Publications for gene: CD19 were set to
Predominantly Antibody Deficiency v0.75 CD19 Zornitza Stark Mode of inheritance for gene: CD19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.74 CD19 Zornitza Stark reviewed gene: CD19: Rating: GREEN; Mode of pathogenicity: None; Publications: 16672701, 17882224, 17882224, 21330302, 21159371; Phenotypes: Immunodeficiency, common variable, 3, MIM# 613493; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8696 CD19 Zornitza Stark changed review comment from: More than 5 unrelated families reported.; to: More than 5 unrelated families reported. Clinical features include increased susceptibility to infection, hypogammaglobulinaemia, and normal numbers of mature B cells in blood, indicating a B-cell antibody-deficient immunodeficiency disorder.
Mendeliome v0.8696 CD19 Zornitza Stark Marked gene: CD19 as ready
Mendeliome v0.8696 CD19 Zornitza Stark Gene: cd19 has been classified as Green List (High Evidence).
Mendeliome v0.8696 CD19 Zornitza Stark Phenotypes for gene: CD19 were changed from to Immunodeficiency, common variable, 3, MIM# 613493
Mendeliome v0.8695 CD19 Zornitza Stark Publications for gene: CD19 were set to
Mendeliome v0.8694 CD19 Zornitza Stark Mode of inheritance for gene: CD19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8693 CD19 Zornitza Stark reviewed gene: CD19: Rating: GREEN; Mode of pathogenicity: None; Publications: 16672701, 17882224, 17882224, 21330302, 21159371; Phenotypes: Immunodeficiency, common variable, 3, MIM# 613493; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v1.0 Zornitza Stark promoted panel to version 1.0
Mandibulofacial Acrofacial dysostosis v0.105 RPS26 Zornitza Stark Classified gene: RPS26 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.105 RPS26 Zornitza Stark Gene: rps26 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.104 RPS26 Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb anomalies are a feature.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap.
Mandibulofacial Acrofacial dysostosis v0.104 RPS26 Zornitza Stark edited their review of gene: RPS26: Changed rating: AMBER
Mandibulofacial Acrofacial dysostosis v0.104 RPL5 Zornitza Stark Classified gene: RPL5 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.104 RPL5 Zornitza Stark Gene: rpl5 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.103 RPL5 Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb anomalies are a feature.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap.
Mandibulofacial Acrofacial dysostosis v0.103 RPL5 Zornitza Stark edited their review of gene: RPL5: Changed rating: AMBER
Mandibulofacial Acrofacial dysostosis v0.103 RPL11 Zornitza Stark Classified gene: RPL11 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.103 RPL11 Zornitza Stark Gene: rpl11 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.102 RPL11 Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb abnormalities are common.; to: Well established gene-disease association. Craniofacial and limb abnormalities are common, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap.
Mandibulofacial Acrofacial dysostosis v0.102 RPL11 Zornitza Stark edited their review of gene: RPL11: Changed rating: AMBER
Mandibulofacial Acrofacial dysostosis v0.100 EVC2 Zornitza Stark Marked gene: EVC2 as ready
Mandibulofacial Acrofacial dysostosis v0.100 EVC2 Zornitza Stark Gene: evc2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.100 EVC2 Zornitza Stark Phenotypes for gene: EVC2 were changed from to Ellis-van Creveld syndrome, MIM# 225500; Weyers acrofacial dysostosis, MIM# 193530
Mandibulofacial Acrofacial dysostosis v0.99 EVC2 Zornitza Stark Publications for gene: EVC2 were set to
Mandibulofacial Acrofacial dysostosis v0.98 EVC2 Zornitza Stark Mode of inheritance for gene: EVC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.97 EVC2 Zornitza Stark reviewed gene: EVC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16404586, 19810119; Phenotypes: Ellis-van Creveld syndrome, MIM# 225500, Weyers acrofacial dysostosis, MIM# 193530; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.97 EVC Zornitza Stark Marked gene: EVC as ready
Mandibulofacial Acrofacial dysostosis v0.97 EVC Zornitza Stark Gene: evc has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.97 EVC Zornitza Stark Phenotypes for gene: EVC were changed from to Weyers acrofacial dysostosis, MIM# 193530; Ellis-van Creveld syndrome, MIM# 225500
Mandibulofacial Acrofacial dysostosis v0.96 EVC Zornitza Stark Publications for gene: EVC were set to
Mandibulofacial Acrofacial dysostosis v0.95 EVC Zornitza Stark Mode of inheritance for gene: EVC was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.94 EVC Zornitza Stark edited their review of gene: EVC: Changed rating: GREEN
Mandibulofacial Acrofacial dysostosis v0.94 EVC Zornitza Stark reviewed gene: EVC: Rating: ; Mode of pathogenicity: None; Publications: 10700184, 23220543; Phenotypes: Weyers acrofacial dysostosis, MIM# 193530, Ellis-van Creveld syndrome, MIM# 225500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4033 SNRPB Zornitza Stark Marked gene: SNRPB as ready
Intellectual disability syndromic and non-syndromic v0.4033 SNRPB Zornitza Stark Gene: snrpb has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4033 SNRPB Zornitza Stark Phenotypes for gene: SNRPB were changed from to Cerebrocostomandibular syndrome, MIM# 117650
Intellectual disability syndromic and non-syndromic v0.4032 SNRPB Zornitza Stark Publications for gene: SNRPB were set to
Intellectual disability syndromic and non-syndromic v0.4031 SNRPB Zornitza Stark Mode of inheritance for gene: SNRPB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4030 SNRPB Zornitza Stark reviewed gene: SNRPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25047197, 25504470, 26971886; Phenotypes: Cerebrocostomandibular syndrome, MIM# 117650; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Tag 5'UTR tag was added to gene: SNRPB.
Tag deep intronic tag was added to gene: SNRPB.
Mendeliome v0.8693 SNRPB Zornitza Stark Marked gene: SNRPB as ready
Mendeliome v0.8693 SNRPB Zornitza Stark Gene: snrpb has been classified as Green List (High Evidence).
Mendeliome v0.8693 SNRPB Zornitza Stark Phenotypes for gene: SNRPB were changed from to Cerebrocostomandibular syndrome, MIM# 117650
Mendeliome v0.8692 SNRPB Zornitza Stark Publications for gene: SNRPB were set to
Mendeliome v0.8691 SNRPB Zornitza Stark Mode of inheritance for gene: SNRPB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8690 SNRPB Zornitza Stark Tag 5'UTR tag was added to gene: SNRPB.
Tag deep intronic tag was added to gene: SNRPB.
Mendeliome v0.8690 SNRPB Zornitza Stark reviewed gene: SNRPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25047197, 25504470, 26971886; Phenotypes: Cerebrocostomandibular syndrome, MIM# 117650; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Marked gene: SNRPB as ready
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Gene: snrpb has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Phenotypes for gene: SNRPB were changed from to Cerebrocostomandibular syndrome, MIM# 117650
Mandibulofacial Acrofacial dysostosis v0.93 SNRPB Zornitza Stark Publications for gene: SNRPB were set to
Mandibulofacial Acrofacial dysostosis v0.92 SNRPB Zornitza Stark Mode of inheritance for gene: SNRPB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.91 SNRPB Zornitza Stark reviewed gene: SNRPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25047197, 25504470, 26971886; Phenotypes: Cerebrocostomandibular syndrome, MIM# 117650; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.91 Zornitza Stark removed gene:SCARF2 from the panel
Mandibulofacial Acrofacial dysostosis v0.90 RPS26 Zornitza Stark Marked gene: RPS26 as ready
Mandibulofacial Acrofacial dysostosis v0.90 RPS26 Zornitza Stark Gene: rps26 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.90 RPS26 Zornitza Stark Phenotypes for gene: RPS26 were changed from to Diamond-Blackfan anemia 10, MIM# 613309; MONDO:0013217
Mandibulofacial Acrofacial dysostosis v0.89 RPS26 Zornitza Stark Publications for gene: RPS26 were set to
Mandibulofacial Acrofacial dysostosis v0.88 RPS26 Zornitza Stark Mode of inheritance for gene: RPS26 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.87 RPS26 Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature.
Mandibulofacial Acrofacial dysostosis v0.87 RPL5 Zornitza Stark Marked gene: RPL5 as ready
Mandibulofacial Acrofacial dysostosis v0.87 RPL5 Zornitza Stark Gene: rpl5 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.87 RPL5 Zornitza Stark Phenotypes for gene: RPL5 were changed from to Diamond-Blackfan anemia 6, MIM# 612561; MONDO:0012937
Mandibulofacial Acrofacial dysostosis v0.86 RPL5 Zornitza Stark Publications for gene: RPL5 were set to
Mandibulofacial Acrofacial dysostosis v0.85 RPL5 Zornitza Stark Mode of inheritance for gene: RPL5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.84 RPL5 Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature.
Clefting disorders v0.138 RBM10 Zornitza Stark Marked gene: RBM10 as ready
Clefting disorders v0.138 RBM10 Zornitza Stark Gene: rbm10 has been classified as Green List (High Evidence).
Clefting disorders v0.138 RBM10 Zornitza Stark Phenotypes for gene: RBM10 were changed from TARPS; Cleft palate; TARP SYNDROME to TARP syndrome, MIM# 311900
Clefting disorders v0.137 RBM10 Zornitza Stark Publications for gene: RBM10 were set to 20451169
Clefting disorders v0.136 RBM10 Zornitza Stark reviewed gene: RBM10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20451169, 24259342, 30450804, 30189253, 33340101; Phenotypes: TARP syndrome, MIM# 311900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8690 RBM10 Zornitza Stark Marked gene: RBM10 as ready
Mendeliome v0.8690 RBM10 Zornitza Stark Gene: rbm10 has been classified as Green List (High Evidence).
Mendeliome v0.8690 RBM10 Zornitza Stark Phenotypes for gene: RBM10 were changed from to TARP syndrome, MIM# 311900
Mendeliome v0.8689 RBM10 Zornitza Stark Publications for gene: RBM10 were set to
Mendeliome v0.8688 RBM10 Zornitza Stark Mode of inheritance for gene: RBM10 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8687 RBM10 Zornitza Stark reviewed gene: RBM10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20451169, 24259342, 30450804, 30189253, 33340101; Phenotypes: TARP syndrome, MIM# 311900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mandibulofacial Acrofacial dysostosis v0.84 RBM10 Zornitza Stark Marked gene: RBM10 as ready
Mandibulofacial Acrofacial dysostosis v0.84 RBM10 Zornitza Stark Gene: rbm10 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.84 RBM10 Zornitza Stark Phenotypes for gene: RBM10 were changed from to TARP syndrome, MIM# 311900
Mandibulofacial Acrofacial dysostosis v0.83 RBM10 Zornitza Stark Publications for gene: RBM10 were set to
Mandibulofacial Acrofacial dysostosis v0.82 RBM10 Zornitza Stark Mode of inheritance for gene: RBM10 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mandibulofacial Acrofacial dysostosis v0.81 RBM10 Zornitza Stark reviewed gene: RBM10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20451169, 24259342, 30450804, 30189253, 33340101; Phenotypes: TARP syndrome, MIM# 311900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mandibulofacial Acrofacial dysostosis v0.81 Zornitza Stark removed gene:PUF60 from the panel
Disorders of immune dysregulation v0.86 IPO8 Zornitza Stark Phenotypes for gene: IPO8 were changed from Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities
Disorders of immune dysregulation v0.85 IPO8 Zornitza Stark edited their review of gene: IPO8: Changed phenotypes: Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472, Loeys-Dietz syndrome-like, cardiovascular, neurologic, skeletal and immunologic abnormalities
Mendeliome v0.8687 IPO8 Zornitza Stark Phenotypes for gene: IPO8 were changed from Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities
Mendeliome v0.8686 IPO8 Zornitza Stark edited their review of gene: IPO8: Changed phenotypes: Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472, Loeys-Dietz syndrome-like, cardiovascular, neurologic, skeletal and immunologic abnormalities
Aortopathy_Connective Tissue Disorders v1.42 IPO8 Zornitza Stark Phenotypes for gene: IPO8 were changed from Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities
Aortopathy_Connective Tissue Disorders v1.41 IPO8 Zornitza Stark edited their review of gene: IPO8: Changed phenotypes: Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472
Cardiomyopathy_Paediatric v0.101 MYL2 Zornitza Stark Publications for gene: MYL2 were set to 23365102; 27378946; 32453731
Cardiomyopathy_Paediatric v0.100 MYL2 Zornitza Stark changed review comment from: Monoallelic variants in this gene are a well established as a cause of cardiomyopathy. Thirteen infants from 9 families reported with bi-allelic variants in last exon and an infantile skeletal myopathy/DCM phenotype. Dutch families all had same founder variant; one Italian family had two different variants. Additional family reported in PMID 32453731; to: Monoallelic variants in this gene are a well established as a cause of cardiomyopathy. Thirteen infants from 9 families reported with bi-allelic variants in last exon and an infantile skeletal myopathy/DCM phenotype. Dutch families all had same founder variant; one Italian family had two different variants. Two additional families reported in PMID 32453731 and 33731536
Cardiomyopathy_Paediatric v0.100 MYL2 Zornitza Stark edited their review of gene: MYL2: Changed publications: 23365102, 27378946, 32453731, 33731536
Cardiomyopathy_Paediatric v0.100 MYL2 Zornitza Stark Marked gene: MYL2 as ready
Cardiomyopathy_Paediatric v0.100 MYL2 Zornitza Stark Gene: myl2 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.100 MYL2 Zornitza Stark Phenotypes for gene: MYL2 were changed from Cardiomyopathy, familial hypertrophic, 10 to Myopathy, myofibrillar, 12, infantile-onset, with cardiomyopathy, MIM# 619424; Cardiomyopathy, hypertrophic, 10, MIM# 608758
Cardiomyopathy_Paediatric v0.99 MYL2 Zornitza Stark Publications for gene: MYL2 were set to
Cardiomyopathy_Paediatric v0.98 MYL2 Zornitza Stark Mode of inheritance for gene: MYL2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Cardiomyopathy_Paediatric v0.97 MYL2 Zornitza Stark reviewed gene: MYL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23365102, 27378946, 32453731; Phenotypes: Myopathy, myofibrillar, 12, infantile-onset, with cardiomyopathy, MIM# 619424, Cardiomyopathy, hypertrophic, 10 608758; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8686 OTX2 Zornitza Stark edited their review of gene: OTX2: Added comment: Three families reported with variants in OTX2 and otocyephaly-dysgnathia. Note variants were inherited in two of the families: in one family, from mother with microphthalmia (recognised OTX2 phenotype) and the other from an unaffected father. Lamb animal model reported.; Changed publications: 24167467, 25589041, 31969185; Changed phenotypes: Microphthalmia, syndromic 5, MIM# 610125, Pituitary hormone deficiency, combined, 6, MIM# 613986, Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125, Otocephaly-dysgnathia complex
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Marked gene: OTX2 as ready
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Gene: otx2 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Classified gene: OTX2 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Gene: otx2 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.79 OTX2 Zornitza Stark gene: OTX2 was added
gene: OTX2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert Review
Mode of inheritance for gene: OTX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: OTX2 were set to 24167467; 25589041; 31969185
Phenotypes for gene: OTX2 were set to Otocephaly-dysgnathia complex
Review for gene: OTX2 was set to AMBER
Added comment: Three families reported with variants in OTX2 and otocyephaly-dysgnathia. Note variants were inherited in two of the families: in one family, from mother with microphthalmia (recognised OTX2 phenotype) and the other from an unaffected father. Lamb animal model reported.
Sources: Expert Review
Mandibulofacial Acrofacial dysostosis v0.78 PRRX1 Zornitza Stark Phenotypes for gene: PRRX1 were changed from Agnathia-otocephaly complex, MIM# 202650 to Agnathia-otocephaly complex, MIM# 202650
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Marked gene: PRRX1 as ready
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Gene: prrx1 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Phenotypes for gene: PRRX1 were changed from to Agnathia-otocephaly complex, MIM# 202650
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Publications for gene: PRRX1 were set to 21294718; 22211708; 22674740; 23444262
Mandibulofacial Acrofacial dysostosis v0.76 PRRX1 Zornitza Stark Publications for gene: PRRX1 were set to
Mandibulofacial Acrofacial dysostosis v0.76 PRRX1 Zornitza Stark Mode of inheritance for gene: PRRX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.75 PRRX1 Zornitza Stark reviewed gene: PRRX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21294718, 22211708, 22674740, 23444262; Phenotypes: Agnathia-otocephaly complex, MIM# 202650; Mode of inheritance: None