Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Hereditary Neuropathy_CMT - isolated v1.9 | COX20 | Zornitza Stark Gene: cox20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Neuropathy_CMT - isolated v1.9 | COX20 | Zornitza Stark Classified gene: COX20 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Neuropathy_CMT - isolated v1.9 | COX20 | Zornitza Stark Gene: cox20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Neuropathy_CMT - isolated v1.8 | COX20 | Zornitza Stark reviewed gene: COX20: Rating: GREEN; Mode of pathogenicity: None; Publications: 33751098; Phenotypes: Neuropathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4172 | LONP1 | Zornitza Stark Mode of inheritance for gene: LONP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4171 | LONP1 | Zornitza Stark reviewed gene: LONP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31636596; Phenotypes: CODAS syndrome, MIM#600373, Mitochondrial cytopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Anophthalmia_Microphthalmia_Coloboma v1.9 | WLS | Zornitza Stark Classified gene: WLS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Anophthalmia_Microphthalmia_Coloboma v1.9 | WLS | Zornitza Stark Gene: wls has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.60 | WLS | Zornitza Stark Marked gene: WLS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.60 | WLS | Zornitza Stark Gene: wls has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.60 | WLS | Zornitza Stark Classified gene: WLS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.60 | WLS | Zornitza Stark Gene: wls has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.59 | WLS | Zornitza Stark Classified gene: WLS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.59 | WLS | Zornitza Stark Gene: wls has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4171 | WIPI2 | Zornitza Stark Phenotypes for gene: WIPI2 were changed from Intellectual developmental disorder with short stature and variable skeletal anomalies 618453 to Intellectual developmental disorder with short stature and variable skeletal anomalies 618453; global developmental delay; intellectual disability; refractory infantile/childhood-onset epilepsy; progressive tetraplegia with joint contractures; dyskinesia; speech and visual impairment; autistic features; ataxic gait | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4171 | WIPI2 | Zornitza Stark Publications for gene: WIPI2 were set to 30968111 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4170 | WIPI2 | Zornitza Stark Classified gene: WIPI2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4170 | WIPI2 | Zornitza Stark Gene: wipi2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4169 | ZDHHC15 | Zornitza Stark Phenotypes for gene: ZDHHC15 were changed from to Mental retardation, X-linked 91, 300577 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4168 | ZDHHC15 | Zornitza Stark Publications for gene: ZDHHC15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4167 | ZDHHC15 | Zornitza Stark Mode of inheritance for gene: ZDHHC15 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4166 | ZDHHC15 | Zornitza Stark reviewed gene: ZDHHC15: Rating: RED; Mode of pathogenicity: None; Publications: 34345675, 32989326; Phenotypes: Mental retardation, X-linked 91, 300577; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - paediatric v0.292 | DAB1 |
Daniel Flanagan gene: DAB1 was added gene: DAB1 was added to Ataxia - paediatric. Sources: Literature Mode of inheritance for gene: DAB1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DAB1 were set to PMID: 33928188 Phenotypes for gene: DAB1 were set to epilepsy; developmental delay; cerebellar ataxia; structural brain abnormalities; oral motor difficulty Penetrance for gene: DAB1 were set to unknown Review for gene: DAB1 was set to AMBER Added comment: WES trio analysis identified compound heterozygous DAB1 canonical splice variants in a child with epilepsy (onset 6 years), developmental delay, cerebellar ataxia, oral motor difficulty, and structural brain abnormalities. RT-PCR confirms that the first variant (c.307-2A>T) causes a in-frame deletion of 3 amino acids. The second variant (c.67+1G>T) is reported to causes an in-frame deletion of exon 4 (first coding exon) and loss of the ATG initiation site. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Spastic Paraplegia - paediatric v1.18 | ABHD16A | Seb Lunke Marked gene: ABHD16A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Spastic Paraplegia - paediatric v1.18 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Spastic Paraplegia - paediatric v1.18 | ABHD16A | Seb Lunke Classified gene: ABHD16A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Spastic Paraplegia - paediatric v1.18 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.235 | ABHD16A | Seb Lunke Marked gene: ABHD16A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.235 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.235 | ABHD16A | Seb Lunke Phenotypes for gene: ABHD16A were changed from Spastic paraplegia to Spastic paraplegia; intellectual disability; callosome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.234 | ABHD16A | Seb Lunke Classified gene: ABHD16A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.234 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.143 | PRPS1 |
Chern Lim edited their review of gene: PRPS1: Added comment: PMID: 25491489: Heterozygous missense variant, loss of function - PRS enzyme deficiency showed. Proband and her mother have various degrees of ataxia (examinations at 34yrs and 70yrs, respectively), peripheral neuropathy and hearing loss beyond the ophthalmological symptoms, whereas the phenotype of the affected older sister (36yo) is currently confined to the eye and milder.; Changed publications: 33898739, 28967191, 25491489 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4166 | ERBB4 | Seb Lunke Marked gene: ERBB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4166 | ERBB4 | Seb Lunke Gene: erbb4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4166 | ERBB4 | Seb Lunke Classified gene: ERBB4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4166 | ERBB4 | Seb Lunke Added comment: Comment on list classification: CNVs only, not clear on the differentiation between ID and ALS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4166 | ERBB4 | Seb Lunke Gene: erbb4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.143 | PRPS1 | Zornitza Stark Marked gene: PRPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.143 | PRPS1 | Zornitza Stark Gene: prps1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.143 | PRPS1 | Zornitza Stark Publications for gene: PRPS1 were set to PMID: 33898739 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4165 | ABHD16A | Seb Lunke Marked gene: ABHD16A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4165 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.326 | ABHD16A | Seb Lunke Marked gene: ABHD16A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.326 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.142 | PRPS1 | Zornitza Stark Classified gene: PRPS1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.142 | PRPS1 | Zornitza Stark Gene: prps1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.141 | PRPS1 | Zornitza Stark reviewed gene: PRPS1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Ataxia, deafness, eye disease; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.233 | ABHD16A | Lucy Spencer edited their review of gene: ABHD16A: Changed phenotypes: Spastic paraplegia, intellectual disability, callosome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.233 | ABHD16A |
Lucy Spencer changed review comment from: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature; to: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4165 | ABHD16A | Seb Lunke Phenotypes for gene: ABHD16A were changed from Spastic paraplegia to Spastic paraplegia; Intellectual Disability; Callosome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.326 | ABHD16A | Seb Lunke Phenotypes for gene: ABHD16A were changed from Spastic paraplegia to Spastic paraplegia; Intellectual Disability; Callosome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Spastic Paraplegia - paediatric v1.17 | ABHD16A |
Lucy Spencer gene: ABHD16A was added gene: ABHD16A was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABHD16A were set to PMID: 34587489 Phenotypes for gene: ABHD16A were set to Spastic paraplegia; intellectual disability; callosome Review for gene: ABHD16A was set to GREEN Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9309 | PANX1 | Zornitza Stark Publications for gene: PANX1 were set to 30918116; 32838805 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4164 | WIPI2 | Dean Phelan reviewed gene: WIPI2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30968111, 34557665; Phenotypes: global developmental delay, intellectual disability, refractory infantile/childhood-onset epilepsy, progressive tetraplegia with joint contractures, dyskinesia, speech and visual impairment, autistic features, ataxic gait; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4164 | ABHD16A | Seb Lunke Classified gene: ABHD16A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4164 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.141 | PRPS1 | Chern Lim edited their review of gene: PRPS1: Changed publications: PMID: 33898739, 28967191 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9308 | PANX1 | Zornitza Stark Mode of pathogenicity for gene: PANX1 was changed from None to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.325 | ABHD16A | Seb Lunke Classified gene: ABHD16A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.325 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Neuropathy_CMT - isolated v1.8 | COX20 |
Hazel Phillimore changed review comment from: Eight unrelated families carried the Chinese Han founder variant c.41A>G., p.(Lys14Arg) in either homozygous or compound heterozygous state with another variant. (This variant is predicted to cause aberrant splicing by abolishing the donor splice site of exon 1). Three homozygous for p.(Lys14Arg), two compound heterozygous with p.(Trp74Cys), the others with p.(Ser33Leu), c.157+7A>G, or p.(Gln87*) All patients displayed sensory ataxia, with early to juvenile age of onset from 1 to 17 years. The clinical presentations of these patients showed some overlaps in central and peripheral nervous systems. However, our patients presented predominant proprioceptive sensory loss and sensory ataxia rather than a multisystem neurological impairment. Initial symptoms: difficulty walking, bilateral foot deformity. Patient’s fibroblasts and transfected cell lines showed reduction of COX20 protein consistent with a loss-of-function mechanism, and reduced complex IV assembly, enzyme activity and oxygen consumption rate which is consistent with mitochondrial dysfunction.. Sources: Literature; to: Eight unrelated families carried the Chinese Han founder variant c.41A>G., p.(Lys14Arg) in either homozygous or compound heterozygous state with another variant. (This variant is predicted to cause aberrant splicing by abolishing the donor splice site of exon 1). Three homozygous for p.(Lys14Arg), two compound heterozygous with p.(Trp74Cys), the others with p.(Ser33Leu), c.157+7A>G, or p.(Gln87*) All patients displayed sensory ataxia, with early to juvenile age of onset from 1 to 17 years. The clinical presentations of these patients showed some overlap in central and peripheral nervous systems. They presented with predominant proprioceptive sensory loss and sensory ataxia rather than a multisystem neurological impairment. Initial symptoms: difficulty walking, bilateral foot deformity. Patient’s fibroblasts and transfected cell lines showed reduction of COX20 protein consistent with a loss-of-function mechanism, and reduced complex IV assembly, enzyme activity and oxygen consumption rate which is consistent with mitochondrial dysfunction.. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9307 | PANX1 | Zornitza Stark Mode of inheritance for gene: PANX1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.141 | PRPS1 |
Chern Lim commented on gene: PRPS1: PMID: 28967191 in one of the families, heterozygous variants in proband with hearing loss and ataxia developed in the proband in her forties, and ocular manifestations of retinal changes and disc pallor were first confirmed in the two affected daughters in their twenties. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9306 | PANX1 | Zornitza Stark Classified gene: PANX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9306 | PANX1 | Zornitza Stark Gene: panx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.233 | ABHD16A |
Lucy Spencer gene: ABHD16A was added gene: ABHD16A was added to Leukodystrophy - paediatric. Sources: Literature Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABHD16A were set to PMID: 34587489 Phenotypes for gene: ABHD16A were set to Spastic paraplegia Review for gene: ABHD16A was set to GREEN Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Neuropathy_CMT - isolated v1.8 | COX20 |
Hazel Phillimore gene: COX20 was added gene: COX20 was added to Hereditary Neuropathy_CMT - isolated. Sources: Literature Mode of inheritance for gene: COX20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COX20 were set to PMID: 33751098 Phenotypes for gene: COX20 were set to sensory neuronopathy; sensory neuron disease; ganglionopathy Review for gene: COX20 was set to GREEN Added comment: Eight unrelated families carried the Chinese Han founder variant c.41A>G., p.(Lys14Arg) in either homozygous or compound heterozygous state with another variant. (This variant is predicted to cause aberrant splicing by abolishing the donor splice site of exon 1). Three homozygous for p.(Lys14Arg), two compound heterozygous with p.(Trp74Cys), the others with p.(Ser33Leu), c.157+7A>G, or p.(Gln87*) All patients displayed sensory ataxia, with early to juvenile age of onset from 1 to 17 years. The clinical presentations of these patients showed some overlaps in central and peripheral nervous systems. However, our patients presented predominant proprioceptive sensory loss and sensory ataxia rather than a multisystem neurological impairment. Initial symptoms: difficulty walking, bilateral foot deformity. Patient’s fibroblasts and transfected cell lines showed reduction of COX20 protein consistent with a loss-of-function mechanism, and reduced complex IV assembly, enzyme activity and oxygen consumption rate which is consistent with mitochondrial dysfunction.. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.324 | ABHD16A |
Lucy Spencer gene: ABHD16A was added gene: ABHD16A was added to Callosome. Sources: Literature Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABHD16A were set to PMID: 34587489 Phenotypes for gene: ABHD16A were set to Spastic paraplegia Review for gene: ABHD16A was set to GREEN Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9305 | ZDHHC15 | Zornitza Stark Phenotypes for gene: ZDHHC15 were changed from Mental retardation, X-linked 91, 300577 to Mental retardation, X-linked 91, 300577; cerebral palsy; intellectual disability; autism spectrum disorder; epilepsy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9305 | ABHD16A | Seb Lunke Phenotypes for gene: ABHD16A were changed from Spastic paraplegia to Spastic paraplegia; Intellectual Disability; Callosome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9304 | ZDHHC15 | Zornitza Stark Publications for gene: ZDHHC15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4163 | ABHD16A |
Lucy Spencer gene: ABHD16A was added gene: ABHD16A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABHD16A were set to PMID: 34587489 Phenotypes for gene: ABHD16A were set to Spastic paraplegia Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9303 | ZDHHC15 |
Krithika Murali changed review comment from: Lewis et al Neurology Genetics 2021 Functional analysis of 4 ZDHHC15 variants - x2 Jin et al, others identified through GeneMatcher Yeast cells expressing ZDHHC15 p.L13P (Jin et al, maternally inherited), p.K115R (maternally inherited) and p.S330p were indistinguishable from cells harboring the reference ZDHHC15 allele, however those expressing p.H158R (also reported in Jin et al, maternally inherited) disrupted normal protein function.; to: Lewis et al Neurology Genetics 2021 Functional analysis of 4 ZDHHC15 variants - x2 Jin et al Nat Genet 2020 PMID 32989326, others identified through GeneMatcher Yeast cells expressing ZDHHC15 p.L13P (Jin et al, maternally inherited), p.K115R (maternally inherited) and p.S330p were indistinguishable from cells harboring the reference ZDHHC15 allele, however those expressing p.H158R (also reported in Jin et al, maternally inherited) disrupted normal protein function. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.141 | PRPS1 |
Chern Lim gene: PRPS1 was added gene: PRPS1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: PRPS1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: PRPS1 were set to PMID: 33898739 Phenotypes for gene: PRPS1 were set to Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy Review for gene: PRPS1 was set to AMBER gene: PRPS1 was marked as current diagnostic Added comment: PMID: 33898739: Heterozygous de novo missense variant in a 30yo female individual, presented with a 5-year history of progressive ataxia. She also had congenital strabismus, infantile-onset hearing loss, and a retinal dystrophy with progressive visual loss for the past 10 years. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9303 | PANX1 | Melanie Marty reviewed gene: PANX1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 33495594, 30918116, 32838805; Phenotypes: Oocyte maturation defect 7, MIM#618550; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - paediatric v0.292 | RFXANK | Zornitza Stark Marked gene: RFXANK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - paediatric v0.292 | RFXANK | Zornitza Stark Gene: rfxank has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9303 | ABHD16A | Seb Lunke Classified gene: ABHD16A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9303 | ABHD16A | Seb Lunke Gene: abhd16a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9302 | ZDHHC15 | Krithika Murali reviewed gene: ZDHHC15: Rating: RED; Mode of pathogenicity: None; Publications: 34345675; Phenotypes: cerebral palsy, intellectual disability, autism spectrum disorder, epilepsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - paediatric v0.292 | RFXANK | Zornitza Stark Classified gene: RFXANK as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - paediatric v0.292 | RFXANK | Zornitza Stark Gene: rfxank has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.130 | WLS |
Teresa Zhao gene: WLS was added gene: WLS was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: WLS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WLS were set to PMID: 34587386 Phenotypes for gene: WLS were set to Syndromic structural birth defects Review for gene: WLS was set to GREEN Added comment: - Homozygous mutations in 10 affected persons from 5 unrelated families. - Patients had multiorgan defects, including microcephal, facial dysmorphism, foot syndactyly, renal agenesis, alopecia, iris coloboma, and heart defects. - The mutations affected WLS protein stability and Wnt signaling. Knock-in mice showed tissue and cell vulnerability consistent with Wnt-signaling intensity and individual and collective functions of Wnts in embryogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9302 | WIPI2 | Zornitza Stark Marked gene: WIPI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9302 | WIPI2 | Zornitza Stark Gene: wipi2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9302 | WIPI2 | Zornitza Stark Publications for gene: WIPI2 were set to 30968111 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Anophthalmia_Microphthalmia_Coloboma v1.8 | WLS |
Teresa Zhao gene: WLS was added gene: WLS was added to Anophthalmia_Microphthalmia_Coloboma. Sources: Literature Mode of inheritance for gene: WLS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WLS were set to PMID: 34587386 Phenotypes for gene: WLS were set to Syndromic structural birth defects Review for gene: WLS was set to GREEN Added comment: - Homozygous mutations in 10 affected persons from 5 unrelated families. - Patients had multiorgan defects, including microcephal, facial dysmorphism, foot syndactyly, renal agenesis, alopecia, iris coloboma, and heart defects. - The mutations affected WLS protein stability and Wnt signaling. Knock-in mice showed tissue and cell vulnerability consistent with Wnt-signaling intensity and individual and collective functions of Wnts in embryogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9301 | WIPI2 | Zornitza Stark Classified gene: WIPI2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9301 | WIPI2 | Zornitza Stark Gene: wipi2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.88 | WLS |
Teresa Zhao gene: WLS was added gene: WLS was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Literature Mode of inheritance for gene: WLS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WLS were set to PMID: 34587386 Phenotypes for gene: WLS were set to Syndromic structural birth defects Review for gene: WLS was set to GREEN Added comment: - Homozygous mutations in 10 affected persons from 5 unrelated families. - Patients had multiorgan defects, including microcephal, facial dysmorphism, foot syndactyly, renal agenesis, alopecia, iris coloboma, and heart defects. - The mutations affected WLS protein stability and Wnt signaling. Knock-in mice showed tissue and cell vulnerability consistent with Wnt-signaling intensity and individual and collective functions of Wnts in embryogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.233 | ATP11A | Zornitza Stark Marked gene: ATP11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.233 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9300 | SNIP1 | Seb Lunke Publications for gene: SNIP1 were set to 22279524 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.233 | ATP11A | Zornitza Stark Classified gene: ATP11A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.233 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.97 | ATP11A | Zornitza Stark Marked gene: ATP11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.97 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.97 | ATP11A | Zornitza Stark Classified gene: ATP11A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.97 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4163 | ATP11A | Zornitza Stark Marked gene: ATP11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4163 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4163 | ATP11A | Zornitza Stark Classified gene: ATP11A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4163 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9299 | ATP11A | Zornitza Stark Marked gene: ATP11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9299 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital diaphragmatic hernia v1.3 | LONP1 | Seb Lunke Marked gene: LONP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital diaphragmatic hernia v1.3 | LONP1 | Seb Lunke Gene: lonp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital diaphragmatic hernia v1.3 | LONP1 |
Seb Lunke gene: LONP1 was added gene: LONP1 was added to Congenital diaphragmatic hernia. Sources: Literature Mode of inheritance for gene: LONP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LONP1 were set to 34547244 Phenotypes for gene: LONP1 were set to Congenital diaphragmatic hernia Penetrance for gene: LONP1 were set to Incomplete Review for gene: LONP1 was set to RED Added comment: LONP1 described as potential new risk factor for CDH. Putative disruptive variants are enriched by approx a factor 10 fold, but remain rare (up to 3% of studied CDH cohort). Segregation studies in 5 families showed incomplete penetrance, at ~50%. A mouse model with lung specific know-out had impaired lung development, but het mice unaffected. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - paediatric v0.291 | RFXANK |
Elena Savva gene: RFXANK was added gene: RFXANK was added to Ataxia - paediatric. Sources: Literature Mode of inheritance for gene: RFXANK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RFXANK were set to PMID: 33855173; 23314770; 28676232 Phenotypes for gene: RFXANK were set to Progressive Ataxia and Neurologic Regression; MHC class II deficiency, complementation group B MIM#209920 Review for gene: RFXANK was set to AMBER Added comment: PMID: 33855173 - 1 family (2 affecteds, 3rd not sequenced) with a homozygous c.271+1G>C splice variant, late-onset immunodeficiency and subacute progressive neurodegenerative disease, including cognition, motor, visual and cerebellar features. MRI demonstrated global cerebral and cerebellar atrophy. PMID: 23314770 - 1/34 MHCII deficient patients with biallelic variants reported with ataxia. Majority of patients (including patient with ataxia) share a founder variant (c.338-25_338del26). PMID: 28676232 - single 30 month old patient with ataxic gait and dysarthria and a homozygous PTC. Summary: 3 patients but uncommon feature, variable expressivity Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9299 | ATP11A | Zornitza Stark Classified gene: ATP11A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9299 | ATP11A | Zornitza Stark Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebellar and Pontocerebellar Hypoplasia v1.18 | TRIP4 | Zornitza Stark Marked gene: TRIP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebellar and Pontocerebellar Hypoplasia v1.18 | TRIP4 | Zornitza Stark Gene: trip4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.58 | WLS |
Teresa Zhao gene: WLS was added gene: WLS was added to Microcephaly. Sources: Literature Mode of inheritance for gene: WLS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WLS were set to PMID: 34587386 Phenotypes for gene: WLS were set to Syndromic structural birth defects Review for gene: WLS was set to GREEN Added comment: - Homozygous mutations in 10 affected persons from 5 unrelated families. - Patients had multiorgan defects, including microcephal, facial dysmorphism, foot syndactyly, renal agenesis, alopecia, iris coloboma, and heart defects. - The mutations affected WLS protein stability and Wnt signaling. Knock-in mice showed tissue and cell vulnerability consistent with Wnt-signaling intensity and individual and collective functions of Wnts in embryogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebellar and Pontocerebellar Hypoplasia v1.18 | TRIP4 | Zornitza Stark Classified gene: TRIP4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebellar and Pontocerebellar Hypoplasia v1.18 | TRIP4 | Zornitza Stark Gene: trip4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9298 | WIPI2 | Dean Phelan reviewed gene: WIPI2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30968111, 34557665; Phenotypes: global developmental delay, intellectual disability, refractory infantile/childhood-onset epilepsy, progressive tetraplegia with joint contractures, dyskinesia, speech and visual impairment, autistic features, ataxic gait; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9298 | WLS | Zornitza Stark Marked gene: WLS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9298 | WLS | Zornitza Stark Gene: wls has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9298 | WLS | Zornitza Stark Classified gene: WLS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9298 | WLS | Zornitza Stark Gene: wls has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | ABHD16A |
Lucy Spencer gene: ABHD16A was added gene: ABHD16A was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABHD16A were set to PMID: 34587489 Phenotypes for gene: ABHD16A were set to Spastic paraplegia Review for gene: ABHD16A was set to GREEN Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | SNIP1 | Teresa Zhao reviewed gene: SNIP1: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 34570759; Phenotypes: Psychomotor retardation, epilepsy, and craniofacial dysmorphism, 614501; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.379 | SHQ1 | Zornitza Stark Marked gene: SHQ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.379 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4162 | ATP11A |
Elena Savva gene: ATP11A was added gene: ATP11A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ATP11A were set to PMID: 34403372 Phenotypes for gene: ATP11A were set to Neurological disorder Mode of pathogenicity for gene: ATP11A was set to Other Review for gene: ATP11A was set to AMBER Added comment: PMID: 34403372: - Single de novo missense variant reported in a patient with developmental delay and neurological deterioration. - Patient MRI showed severe cerebral atrophy, ventriculomegaly, hypomyelination leukodystrophy, thinned corpus callosum. Axonal neuropathy suggested. - K/I heterozygous mice died perinatally. - Functional studies on missense variant show plasma membrane lipid content impairment, reduced ATPase activity etc. gnomAD: some NMD PTCs present, good quality variants found with 4-5 hets. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.379 | SHQ1 | Zornitza Stark Classified gene: SHQ1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.379 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.378 | SHQ1 |
Zornitza Stark gene: SHQ1 was added gene: SHQ1 was added to Regression. Sources: Literature Mode of inheritance for gene: SHQ1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SHQ1 were set to 34542157; 29178645 Phenotypes for gene: SHQ1 were set to Dystonia; Neurodegeneration Review for gene: SHQ1 was set to AMBER Added comment: Three unrelated families reported. Family 1: isolated dystonia only; Family 2: dystonia, and neurodegeneration; Family 3: neurodegeneration. Rated Amber as phenotypes likely represent a continuum but currently unclear what proportion have neurodegeneration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.96 | ATP11A |
Elena Savva gene: ATP11A was added gene: ATP11A was added to Hydrocephalus_Ventriculomegaly. Sources: Literature Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ATP11A were set to PMID: 34403372 Phenotypes for gene: ATP11A were set to Neurological disorder Mode of pathogenicity for gene: ATP11A was set to Other Review for gene: ATP11A was set to AMBER Added comment: PMID: 34403372: - Single de novo missense variant reported in a patient with developmental delay and neurological deterioration. - Patient MRI showed severe cerebral atrophy, ventriculomegaly, hypomyelination leukodystrophy, thinned corpus callosum. Axonal neuropathy suggested. - K/I heterozygous mice died perinatally. - Functional studies on missense variant show plasma membrane lipid content impairment, reduced ATPase activity etc. gnomAD: some NMD PTCs present, good quality variants found with 4-5 hets. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4162 | ERBB4 | Ain Roesley edited their review of gene: ERBB4: Changed phenotypes: intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - paediatric v0.232 | ATP11A |
Elena Savva gene: ATP11A was added gene: ATP11A was added to Leukodystrophy - paediatric. Sources: Literature Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ATP11A were set to PMID: 34403372 Phenotypes for gene: ATP11A were set to PMID: 34403372 Mode of pathogenicity for gene: ATP11A was set to Other Review for gene: ATP11A was set to AMBER Added comment: PMID: 34403372: - Single de novo missense variant reported in a patient with developmental delay and neurological deterioration. - Patient MRI showed severe cerebral atrophy, ventriculomegaly, hypomyelination leukodystrophy, thinned corpus callosum. Axonal neuropathy suggested. - K/I heterozygous mice died perinatally. - Functional studies on missense variant show plasma membrane lipid content impairment, reduced ATPase activity etc. gnomAD: some NMD PTCs present, good quality variants found with 4-5 hets. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4162 | ERBB4 |
Ain Roesley gene: ERBB4 was added gene: ERBB4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ERBB4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ERBB4 were set to 33603162 Penetrance for gene: ERBB4 were set to unknown Review for gene: ERBB4 was set to GREEN Added comment: CNVs reported only exonic deletions: 3x families with ID, speech delays, aggressive outbursts (including 1x de novo) 1x family with global dev delay inherited from unaffected parent exonic del with limited clinical info: 1x severe expressive language delay Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | ATP11A |
Elena Savva gene: ATP11A was added gene: ATP11A was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ATP11A were set to PMID: 34403372 Phenotypes for gene: ATP11A were set to Neurological disorder Mode of pathogenicity for gene: ATP11A was set to Other Review for gene: ATP11A was set to AMBER Added comment: PMID: 34403372: - Single de novo missense variant reported in a patient with developmental delay and neurological deterioration. - Patient MRI showed severe cerebral atrophy, ventriculomegaly, hypomyelination leukodystrophy, thinned corpus callosum. Axonal neuropathy suggested. - K/I heterozygous mice died perinatally. - Functional studies on missense variant show plasma membrane lipid content impairment, reduced ATPase activity etc. gnomAD: some NMD PTCs present, good quality variants found with 4-5 hets. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebellar and Pontocerebellar Hypoplasia v1.17 | TRIP4 |
Chern Lim gene: TRIP4 was added gene: TRIP4 was added to Cerebellar and Pontocerebellar Hypoplasia. Sources: Literature Mode of inheritance for gene: TRIP4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRIP4 were set to PMID: 34075209 Phenotypes for gene: TRIP4 were set to cerebellar hypoplasia and spinal muscular atrophy (PCH1) and congenital bone fractures. Review for gene: TRIP4 was set to AMBER gene: TRIP4 was marked as current diagnostic Added comment: PMID: 34075209: One patient with cerebellar hypoplasia and spinal muscular atrophy (PCH1) and congenital bone fractures, hom PTV. The same PTV had been previously reported in 3 patients from 2 families with prenatal spinal muscular atrophy and congenital bone fractures (PMID: 26924529). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - complex v0.194 | SHQ1 | Zornitza Stark Marked gene: SHQ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - complex v0.194 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - complex v0.194 | SHQ1 | Zornitza Stark Classified gene: SHQ1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - complex v0.194 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - complex v0.193 | SHQ1 |
Zornitza Stark gene: SHQ1 was added gene: SHQ1 was added to Dystonia - complex. Sources: Literature Mode of inheritance for gene: SHQ1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SHQ1 were set to 34542157; 29178645 Phenotypes for gene: SHQ1 were set to Dystonia; Neurodegeneration Review for gene: SHQ1 was set to AMBER Added comment: Three unrelated families reported. Family 1: isolated dystonia only; Family 2: dystonia, and neurodegeneration; Family 3: neurodegeneration. Rated Amber as phenotypes likely represent a continuum but currently unclear what proportion will have complex dystonia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4162 | SARS | Bryony Thompson Marked gene: SARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4162 | SARS | Bryony Thompson Gene: sars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4162 | SARS | Bryony Thompson Classified gene: SARS as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4162 | SARS | Bryony Thompson Gene: sars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | WLS |
Teresa Zhao changed review comment from: - We identified homozygous mutations in 10 affected persons from 5 unrelated families. - Patients had multiorgan defects, including microcephal, facial dysmorphism, foot syndactyly, renal agenesis, alopecia, iris coloboma, and heart defects. - The mutations affected WLS protein stability and Wnt signaling. Knock-in mice showed tissue and cell vulnerability consistent with Wnt-signaling intensity and individual and collective functions of Wnts in embryogenesis. Sources: Literature; to: - Homozygous mutations in 10 affected persons from 5 unrelated families. - Patients had multiorgan defects, including microcephal, facial dysmorphism, foot syndactyly, renal agenesis, alopecia, iris coloboma, and heart defects. - The mutations affected WLS protein stability and Wnt signaling. Knock-in mice showed tissue and cell vulnerability consistent with Wnt-signaling intensity and individual and collective functions of Wnts in embryogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4161 | SARS |
Bryony Thompson gene: SARS was added gene: SARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SARS were set to 28236339; 34570399 Phenotypes for gene: SARS were set to Intellectual disability Review for gene: SARS was set to AMBER Added comment: Summary - 2 unrelated families with overlapping ID phenotype, and supporting in vitro and patient cell assays. PMID: 28236339 - an Iranian family (distantly related) segregating a homozygous missense (c.514G>A, p.Asp172Asn) with moderate ID, microcephaly, ataxia, speech impairment, and aggressive behaviour. Also, supporting in vitro functional assays demonstrating altered protein function. PMID: 34570399 - a consanguineous Turkish family segregating a homozygous missense (c.638G>T, p.(Arg213Leu)) with developmental delay, central deafness, cardiomyopathy, and metabolic decompensation during fever leading to death. Also, reduced protein level and enzymatic activity in patient cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | WLS |
Teresa Zhao gene: WLS was added gene: WLS was added to Mendeliome. Sources: Literature Mode of inheritance for gene: WLS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WLS were set to PMID: 34587386 Phenotypes for gene: WLS were set to Syndromic structural birth defects Review for gene: WLS was set to GREEN Added comment: - We identified homozygous mutations in 10 affected persons from 5 unrelated families. - Patients had multiorgan defects, including microcephal, facial dysmorphism, foot syndactyly, renal agenesis, alopecia, iris coloboma, and heart defects. - The mutations affected WLS protein stability and Wnt signaling. Knock-in mice showed tissue and cell vulnerability consistent with Wnt-signaling intensity and individual and collective functions of Wnts in embryogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - isolated/combined v1.10 | SHQ1 | Zornitza Stark Marked gene: SHQ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - isolated/combined v1.10 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - isolated/combined v1.10 | SHQ1 | Zornitza Stark Classified gene: SHQ1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - isolated/combined v1.10 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - isolated/combined v1.9 | SHQ1 |
Zornitza Stark gene: SHQ1 was added gene: SHQ1 was added to Dystonia - isolated/combined. Sources: Literature Mode of inheritance for gene: SHQ1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SHQ1 were set to 34542157 Phenotypes for gene: SHQ1 were set to Dystonia Review for gene: SHQ1 was set to AMBER Added comment: Three unrelated families reported. Family 1: isolated dystonia only; Family 2: dystonia, and neurodegeneration; Family 3: neurodegeneration. Rated Amber as phenotypes likely represent a continuum but currently unclear what proportion would have isolated dystonia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | SHQ1 | Zornitza Stark Marked gene: SHQ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | SARS | Bryony Thompson Marked gene: SARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | SARS | Bryony Thompson Gene: sars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | SHQ1 | Zornitza Stark Classified gene: SHQ1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9297 | SHQ1 | Zornitza Stark Gene: shq1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9296 | SHQ1 |
Zornitza Stark gene: SHQ1 was added gene: SHQ1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SHQ1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SHQ1 were set to 34542157; 29178645 Phenotypes for gene: SHQ1 were set to Dystonia; Neurodegeneration Review for gene: SHQ1 was set to AMBER Added comment: Three unrelated families reported. Family 1: isolated dystonia only; Family 2: dystonia, and neurodegeneration; Family 3: neurodegeneration. Rated Amber as phenotypes likely represent a continuum but currently unclear. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9295 | SARS | Bryony Thompson Classified gene: SARS as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9295 | SARS | Bryony Thompson Gene: sars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9294 | SARS |
Bryony Thompson gene: SARS was added gene: SARS was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SARS were set to 28236339; 34570399 Phenotypes for gene: SARS were set to Intellectual disability Review for gene: SARS was set to AMBER Added comment: Summary - 2 unrelated families with overlapping ID phenotype, and supporting in vitro and patient cell assays. PMID: 28236339 - an Iranian family (distantly related) segregating a homozygous missense (c.514G>A, p.Asp172Asn) with moderate ID, microcephaly, ataxia, speech impairment, and aggressive behaviour. Also, supporting in vitro functional assays demonstrating altered protein function. PMID: 34570399 - a consanguineous Turkish family segregating a homozygous missense (c.638G>T, p.(Arg213Leu)) with developmental delay, central deafness, cardiomyopathy, and metabolic decompensation during fever leading to death. Also, reduced protein level and enzymatic activity in patient cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Macrocephaly_Megalencephaly v0.88 | NFIB | Zornitza Stark Tag SV/CNV tag was added to gene: NFIB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Macrocephaly_Megalencephaly v0.88 | NFIB | Zornitza Stark Marked gene: NFIB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Macrocephaly_Megalencephaly v0.88 | NFIB | Zornitza Stark Gene: nfib has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Macrocephaly_Megalencephaly v0.88 | NFIB | Zornitza Stark Phenotypes for gene: NFIB were changed from to Macrocephaly, acquired, with impaired intellectual development, MIM#618286 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Macrocephaly_Megalencephaly v0.87 | NFIB | Zornitza Stark Publications for gene: NFIB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Macrocephaly_Megalencephaly v0.86 | NFIB | Zornitza Stark Mode of inheritance for gene: NFIB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Macrocephaly_Megalencephaly v0.85 | NFIB | Zornitza Stark reviewed gene: NFIB: Rating: GREEN; Mode of pathogenicity: None; Publications: 30388402; Phenotypes: Macrocephaly, acquired, with impaired intellectual development, MIM#618286; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9293 | NDN | Zornitza Stark Marked gene: NDN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9293 | NDN | Zornitza Stark Gene: ndn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9293 | NDN | Zornitza Stark Phenotypes for gene: NDN were changed from to Prader-Willi syndrome, MIM# 176270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9292 | NDN | Zornitza Stark Mode of inheritance for gene: NDN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9291 | NDN | Zornitza Stark Classified gene: NDN as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9291 | NDN | Zornitza Stark Gene: ndn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9290 | NDN | Zornitza Stark reviewed gene: NDN: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Prader-Willi syndrome, MIM# 176270; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4160 | NDN | Zornitza Stark Phenotypes for gene: NDN were changed from to Prader-Willi syndrome, MIM# 176270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.141 | EEF2 | Zornitza Stark Marked gene: EEF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ataxia - adult onset v0.141 | EEF2 | Zornitza Stark Gene: eef2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9290 | NFIB | Zornitza Stark Marked gene: NFIB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9290 | NFIB | Zornitza Stark Gene: nfib has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9290 | NFIB | Zornitza Stark Phenotypes for gene: NFIB were changed from to Macrocephaly, acquired, with impaired intellectual development, MIM#618286 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9289 | NFIB | Zornitza Stark Publications for gene: NFIB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9288 | NFIB | Zornitza Stark Mode of inheritance for gene: NFIB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9287 | NFIB | Zornitza Stark Tag SV/CNV tag was added to gene: NFIB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9287 | NFIB | Zornitza Stark reviewed gene: NFIB: Rating: GREEN; Mode of pathogenicity: None; Publications: 30388402; Phenotypes: Macrocephaly, acquired, with impaired intellectual development, MIM#618286; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9287 | ZNF407 | Zornitza Stark Phenotypes for gene: ZNF407 were changed from Global developmental delay; Intellectual disability to SIMHA syndrome, MIM# 619557; Global developmental delay; Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9286 | ZNF407 | Zornitza Stark edited their review of gene: ZNF407: Changed phenotypes: SIMHA syndrome, MIM# 619557, Global developmental delay, Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4159 | ZNF407 | Zornitza Stark Phenotypes for gene: ZNF407 were changed from Global developmental delay; Intellectual disability to SIMHA syndrome, MIM# 619557; Global developmental delay; Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4158 | ZNF407 | Zornitza Stark edited their review of gene: ZNF407: Changed rating: AMBER; Changed phenotypes: SIMHA syndrome, MIM# 619557; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.9 | RNF113A | Zornitza Stark Marked gene: RNF113A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.9 | RNF113A | Zornitza Stark Gene: rnf113a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.9 | RNF113A | Zornitza Stark Classified gene: RNF113A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.9 | RNF113A | Zornitza Stark Gene: rnf113a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.8 | RNF113A |
Zornitza Stark gene: RNF113A was added gene: RNF113A was added to Growth failure. Sources: Expert Review Mode of inheritance for gene: RNF113A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: RNF113A were set to 25612912; 31793730; 31880405 Phenotypes for gene: RNF113A were set to Trichothiodystrophy 5, nonphotosensitive; OMIM #300953 Review for gene: RNF113A was set to GREEN Added comment: Four families reported, two with same variant. Clinical features include ID, microcephaly, IUGR/growth failure, hypogonadism, and sparse/brittle hair. One of the families had antenatal presentation. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome Breakage Disorders v1.5 | RNF113A | Zornitza Stark Marked gene: RNF113A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome Breakage Disorders v1.5 | RNF113A | Zornitza Stark Gene: rnf113a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome Breakage Disorders v1.5 | RNF113A | Zornitza Stark Classified gene: RNF113A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome Breakage Disorders v1.5 | RNF113A | Zornitza Stark Gene: rnf113a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome Breakage Disorders v1.4 | RNF113A |
Zornitza Stark gene: RNF113A was added gene: RNF113A was added to Chromosome Breakage Disorders. Sources: Expert Review Mode of inheritance for gene: RNF113A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: RNF113A were set to 25612912; 31793730; 31880405 Phenotypes for gene: RNF113A were set to Trichothiodystrophy 5, nonphotosensitive; OMIM #300953 Review for gene: RNF113A was set to GREEN Added comment: Four families reported, two with same variant. Clinical features include ID, microcephaly, IUGR/growth failure, hypogonadism, and sparse/brittle hair. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.58 | RNF113A | Zornitza Stark edited their review of gene: RNF113A: Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.58 | RNF113A | Zornitza Stark Publications for gene: RNF113A were set to 25612912; 31793730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.57 | RNF113A | Zornitza Stark Classified gene: RNF113A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.57 | RNF113A | Zornitza Stark Gene: rnf113a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.56 | RNF113A | Zornitza Stark edited their review of gene: RNF113A: Added comment: Two more individuals reported with different variants, at least one had microcephaly, upgrade to Green.; Changed rating: GREEN; Changed publications: 25612912, 31793730, 31880405 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4158 | RNF113A | Zornitza Stark Publications for gene: RNF113A were set to PMID: 25612912; 31793730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4157 | RNF113A | Zornitza Stark Classified gene: RNF113A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4157 | RNF113A | Zornitza Stark Gene: rnf113a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4156 | RNF113A | Zornitza Stark reviewed gene: RNF113A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31880405; Phenotypes: Trichothiodystrophy 5, nonphotosensitive, OMIM #300953; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4156 | RNF113A | Zornitza Stark Mode of inheritance for gene: RNF113A was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.20 | CHD7 | Zornitza Stark Marked gene: CHD7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.20 | CHD7 | Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.20 | CHD7 | Zornitza Stark Publications for gene: CHD7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.19 | CHD7 | Zornitza Stark reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 18834967; Phenotypes: Hypogonadotropic hypogonadism 5 with or without anosmia, MIM# 612370; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.56 | EIF3F | Zornitza Stark Phenotypes for gene: EIF3F were changed from EIF3F-related neurodevelopmental disorder to EIF3F-related neurodevelopmental disorder; Mental retardation, autosomal recessive 67, MIM# 618295 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.55 | EIF3F | Zornitza Stark reviewed gene: EIF3F: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal recessive 67, MIM# 618295; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.55 | EIF3F | Zornitza Stark Marked gene: EIF3F as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.55 | EIF3F | Zornitza Stark Gene: eif3f has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9286 | EIF3F | Zornitza Stark Publications for gene: EIF3F were set to 30409806 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9285 | EIF3F | Zornitza Stark edited their review of gene: EIF3F: Added comment: Hüffmeier et al (2021) reported 21 patients who were homozygous/compound heterozygous for Phe232Val variant in EIF3F. All affected individuals had developmental delay and speech delay. About half had behavioural problems, altered muscular tone, hearing loss, and short stature. The study suggests that microcephaly, reduced sensitivity to pain, cleft lip/palate, gastrointestinal symptoms and ophthalmological symptoms are part of the phenotypic spectrum.; Changed publications: 30409806, 33736665; Changed phenotypes: Mental retardation, autosomal recessive 67, MIM# 618295 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clefting disorders v0.142 | EIF3F | Zornitza Stark Marked gene: EIF3F as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clefting disorders v0.142 | EIF3F | Zornitza Stark Gene: eif3f has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clefting disorders v0.142 | EIF3F | Zornitza Stark Phenotypes for gene: EIF3F were changed from EIF3F-related neurodevelopmental disorder to EIF3F-related neurodevelopmental disorder; Mental retardation, autosomal recessive 67, MIM# 618295 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4155 | EIF3F | Zornitza Stark Publications for gene: EIF3F were set to 30409806 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.55 | EIF3F | Chirag Patel Classified gene: EIF3F as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.55 | EIF3F | Chirag Patel Gene: eif3f has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.54 | EIF3F |
Chirag Patel gene: EIF3F was added gene: EIF3F was added to Microcephaly. Sources: Literature Mode of inheritance for gene: EIF3F was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3F were set to PMID: 33736665 Phenotypes for gene: EIF3F were set to EIF3F-related neurodevelopmental disorder Review for gene: EIF3F was set to GREEN Added comment: Hüffmeier et al (2021) reported 21 patients who were homozygous/compound heterozygous for Phe232Val variant in EIF3F. All affected individuals had developmental delay and speech delay. About half had behavioural problems, altered muscular tone, hearing loss, and short stature. The study suggests that microcephaly, reduced sensitivity to pain, cleft lip/palate, gastrointestinal symptoms and ophthalmological symptoms are part of the phenotypic spectrum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clefting disorders v0.141 | EIF3F | Chirag Patel Classified gene: EIF3F as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clefting disorders v0.141 | EIF3F | Chirag Patel Gene: eif3f has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clefting disorders v0.140 | EIF3F |
Chirag Patel gene: EIF3F was added gene: EIF3F was added to Clefting disorders. Sources: Literature Mode of inheritance for gene: EIF3F was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3F were set to PMID: 33736665 Phenotypes for gene: EIF3F were set to EIF3F-related neurodevelopmental disorder Review for gene: EIF3F was set to GREEN Added comment: Hüffmeier et al (2021) reported 21 patients who were homozygous/compound heterozygous for Phe232Val variant in EIF3F. All affected individuals had developmental delay and speech delay. About half had behavioural problems, altered muscular tone, hearing loss, and short stature. The study suggests that microcephaly, reduced sensitivity to pain, cleft lip/palate, gastrointestinal symptoms and ophthalmological symptoms are part of the phenotypic spectrum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4154 | EIF3F | Chirag Patel reviewed gene: EIF3F: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33736665; Phenotypes: EIF3F-related neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.7 | KMT2A | Zornitza Stark Marked gene: KMT2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.7 | KMT2A | Zornitza Stark Added comment: Comment when marking as ready: Short stature is a feature. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.7 | KMT2A | Zornitza Stark Gene: kmt2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.7 | KMT2A | Zornitza Stark Publications for gene: KMT2A were set to PubMed: 22795537, 25810209, 29574747, 33783954 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.6 | KMT2A | Chirag Patel Classified gene: KMT2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.6 | KMT2A | Chirag Patel Gene: kmt2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.5 | KMT2A |
Chirag Patel gene: KMT2A was added gene: KMT2A was added to Growth failure. Sources: Literature Mode of inheritance for gene: KMT2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KMT2A were set to PubMed: 22795537, 25810209, 29574747, 33783954 Phenotypes for gene: KMT2A were set to Wiedemann-Steiner syndrome; OMIM #605130 Review for gene: KMT2A was set to GREEN Added comment: Wiedemann-Steiner syndrome is a congenital malformation syndrome characteriSed by hypertrichosis cubiti/back, short stature/growth retardation, mild to moderate intellectual disability; behavioral difficulties, and dysmorphism (long eyelashes, thick/arched eyebrows with lateral flare, broad nasal bridge, and downslanting and vertically narrow palpebral fissures). Many patients reported in the literature. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.186 | MFN2 | Zornitza Stark Marked gene: MFN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.186 | MFN2 | Zornitza Stark Gene: mfn2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.186 | MFN2 | Zornitza Stark Classified gene: MFN2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.186 | MFN2 | Zornitza Stark Gene: mfn2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | SAMHD1 | Zornitza Stark Marked gene: SAMHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | SAMHD1 | Zornitza Stark Gene: samhd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | RNASEH2C | Zornitza Stark Marked gene: RNASEH2C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | RNASEH2C | Zornitza Stark Gene: rnaseh2c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | RNASEH2A | Zornitza Stark Marked gene: RNASEH2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | RNASEH2A | Zornitza Stark Gene: rnaseh2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | RNASEH2B | Zornitza Stark Marked gene: RNASEH2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | RNASEH2B | Zornitza Stark Gene: rnaseh2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.185 | RNASEH2B | Zornitza Stark Publications for gene: RNASEH2B were set to PMID: 17846997, 28762473 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.184 | TREX1 | Zornitza Stark Marked gene: TREX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.184 | TREX1 | Zornitza Stark Gene: trex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.184 | TREX1 | Zornitza Stark Publications for gene: TREX1 were set to PMID: 17846997, 33528536 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.183 | TAF1 | Zornitza Stark Marked gene: TAF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.183 | TAF1 | Zornitza Stark Gene: taf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.183 | TAF1 | Zornitza Stark Publications for gene: TAF1 were set to PMID: 26637982, 33528536, 17273961 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.182 | SPTAN1 | Zornitza Stark Marked gene: SPTAN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.182 | SPTAN1 | Zornitza Stark Gene: sptan1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.182 | SPTAN1 | Zornitza Stark Publications for gene: SPTAN1 were set to PMID: 20493457, 33528536, 34364746 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.181 | ZSWIM6 | Zornitza Stark Marked gene: ZSWIM6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.181 | ZSWIM6 | Zornitza Stark Gene: zswim6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.181 | SAMHD1 | Chirag Patel Classified gene: SAMHD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.181 | SAMHD1 | Chirag Patel Gene: samhd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.180 | SAMHD1 |
Chirag Patel gene: SAMHD1 was added gene: SAMHD1 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: SAMHD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SAMHD1 were set to PMID: 19525956 Phenotypes for gene: SAMHD1 were set to Aicardi-Goutieres syndrome 5; OMIM #612952 Review for gene: SAMHD1 was set to GREEN Added comment: Aicardi-Goutieres syndrome is characterised by cerebral atrophy, leukodystrophy, intracranial calcifications, chronic CSF lymphocytosis, and increased CSF alpha-interferon, and neurologic dysfunction (progressive microcephaly, spasticity, dystonic posturing, profound psychomotor retardation), and often death in early childhood. Rice et al. (2009) reported biallelic SAMHD1 mutations in 13 families with AGS. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.179 | RNASEH2C | Chirag Patel Classified gene: RNASEH2C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.179 | RNASEH2C | Chirag Patel Gene: rnaseh2c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.178 | RNASEH2C |
Chirag Patel gene: RNASEH2C was added gene: RNASEH2C was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: RNASEH2C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNASEH2C were set to PMID: 17846997 Phenotypes for gene: RNASEH2C were set to Aicardi-Goutieres syndrome 3; OMIM #610329 Review for gene: RNASEH2C was set to GREEN Added comment: Aicardi-Goutieres syndrome is characterised by cerebral atrophy, leukodystrophy, intracranial calcifications, chronic CSF lymphocytosis, and increased CSF alpha-interferon, and neurologic dysfunction (progressive microcephaly, spasticity, dystonic posturing, profound psychomotor retardation), and often death in early childhood. Rice et al. (2007) reported biallelic RNASEH2C mutations in 18 families with AGS. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.177 | RNASEH2A | Chirag Patel Classified gene: RNASEH2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.177 | RNASEH2A | Chirag Patel Gene: rnaseh2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.176 | RNASEH2B | Chirag Patel Classified gene: RNASEH2B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.176 | RNASEH2B | Chirag Patel Gene: rnaseh2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.176 | RNASEH2A |
Chirag Patel gene: RNASEH2A was added gene: RNASEH2A was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: RNASEH2A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNASEH2A were set to PMID: 17846997 Phenotypes for gene: RNASEH2A were set to Aicardi-Goutieres syndrome 4; OMIM #610333 Review for gene: RNASEH2A was set to GREEN Added comment: Aicardi-Goutieres syndrome is characterised by cerebral atrophy, leukodystrophy, intracranial calcifications, chronic CSF lymphocytosis, and increased CSF alpha-interferon, and neurologic dysfunction (progressive microcephaly, spasticity, dystonic posturing, profound psychomotor retardation), and often death in early childhood. Rice et al. (2007) reported biallelic RNASEH2A mutations in 3 families with AGS. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.175 | RNASEH2B |
Chirag Patel gene: RNASEH2B was added gene: RNASEH2B was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: RNASEH2B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNASEH2B were set to PMID: 17846997, 28762473 Phenotypes for gene: RNASEH2B were set to Aicardi-Goutieres syndrome 2; OMIM #610181 Review for gene: RNASEH2B was set to GREEN Added comment: Aicardi-Goutieres syndrome is characterised by cerebral atrophy, leukodystrophy, intracranial calcifications, chronic CSF lymphocytosis, and increased CSF alpha-interferon, and neurologic dysfunction (progressive microcephaly, spasticity, dystonic posturing, profound psychomotor retardation), and often death in early childhood. Rice et al. (2007) reported biallelic RNASEH2B mutations in 47 families with AGS. Svingen et al. (2017) reported 2 siblings with atypical AGS with spastic quadriplegia, anarthria, preserved intellect, and increased iron signal in basal ganglia and homozygous RNASEH2B pathogenic variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.174 | TREX1 | Chirag Patel Classified gene: TREX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.174 | TREX1 | Chirag Patel Gene: trex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.173 | TREX1 |
Chirag Patel gene: TREX1 was added gene: TREX1 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: TREX1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: TREX1 were set to PMID: 17846997, 33528536 Phenotypes for gene: TREX1 were set to Aicardi-Goutieres syndrome 1, dominant and recessive, OMIM #225750 Review for gene: TREX1 was set to GREEN Added comment: Aicardi-Goutieres syndrome is characterised by cerebral atrophy, leukodystrophy, intracranial calcifications, chronic CSF lymphocytosis, and increased CSF alpha-interferon, and neurologic dysfunction (progressive microcephaly, spasticity, dystonic posturing, profound psychomotor retardation), and often death in early childhood. Rice et al. (2007) reported biallelic TREX1 mutations in 31 families with AGS, and de novo heterozygous TREX1 mutation in 1 patient with AGS. Moreno-De-Luca et al. (2021) reported 1 patient with CP and paternally inherited pathogenic variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.172 | TAF1 | Chirag Patel Classified gene: TAF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.172 | TAF1 | Chirag Patel Gene: taf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.171 | TAF1 |
Chirag Patel gene: TAF1 was added gene: TAF1 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: TAF1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: TAF1 were set to PMID: 26637982, 33528536, 17273961 Phenotypes for gene: TAF1 were set to Intellectual developmental disorder, X-linked syndromic 33, OMIM #300966; Dystonia-Parkinsonism, X-linked, OMIM #314250 Review for gene: TAF1 was set to GREEN Added comment: O'Rawe et al. (2015) reported 12 boys from 9 unrelated families with X-linked global developmental delay, intellectual disability, dysmorphism, generalized hypotonia, microcephaly and variable neurologic features (hypoplastic CC, spastic diplegia, dystonic movements, tremors). They identified 9 different hemizygous mutations in TAF1 gene (most de novo, 3 maternally inherited). No functional studies. The mutations were found by WGS, WES, targeted panel and microarray, and all confirmed by Sanger sequencing. Moreno-De-Luca et al. (2021) reported 2 patients with CP and de novo LP variant. Note: X-linked dystonia-parkinsonism (XDP) is caused by an SVA (short interspersed nuclear element, variable number of tandem repeats, and Alu composite) retrotransposon insertion in intron 32 of TAF1, which encodes the largest component of the TFIID complex, and resulted in significantly decreased expression levels of TAF1 and the dopamine receptor D2 gene (DRD2) in the caudate nucleus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.170 | SPTAN1 | Chirag Patel Classified gene: SPTAN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.170 | SPTAN1 | Chirag Patel Gene: sptan1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.169 | SPTAN1 | Chirag Patel Classified gene: SPTAN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.169 | SPTAN1 | Chirag Patel Gene: sptan1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.168 | SPTAN1 |
Chirag Patel gene: SPTAN1 was added gene: SPTAN1 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: SPTAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SPTAN1 were set to PMID: 20493457, 33528536, 34364746 Phenotypes for gene: SPTAN1 were set to Developmental and epileptic encephalopathy 5; OMIM #613477 Review for gene: SPTAN1 was set to GREEN Added comment: Developmental and epileptic encephalopathy-5 (DEE5) is a neurologic disorder characterised by tonic seizures/infantile spasms in first months of life, global developmental delay, lack of visual attention, poor head control, feeding difficulties, microcephaly, and spastic quadriplegia. Brain imaging may show cerebral atrophy and hypomyelination. Saitsu et al (2010) reported 2 patients with de novo in-frame mutations of SPTAN1 with early-onset WS with spastic quadriplegia, poor visual attention, and severe developmental delay. Moreno-De-Luca et al (2021) reported 3 patients with CP with de novo LP/P variants. Zahrani et al (2021) reported 1 patient with NDD (CP features) with de novo LP variant Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.167 | ZSWIM6 | Chirag Patel Classified gene: ZSWIM6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.167 | ZSWIM6 | Chirag Patel Gene: zswim6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.167 | ZSWIM6 | Chirag Patel Classified gene: ZSWIM6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.167 | ZSWIM6 | Chirag Patel Gene: zswim6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.166 | ZSWIM6 |
Chirag Patel gene: ZSWIM6 was added gene: ZSWIM6 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: ZSWIM6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZSWIM6 were set to PMID: 29198722 Phenotypes for gene: ZSWIM6 were set to Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, OMIM #617865 Review for gene: ZSWIM6 was set to GREEN Added comment: Palmer et al. (2017) reported 7 unrelated patients with neurodevelopmental disorder with movement abnormalities spasticity, abnormal gait, and autistic features. WES/WGS identified the same heterozygous R913X variant in exon 13 of ZSWIM6 gene (de novo in 6, unk in 1). The mutation was not found in gnomAD. Analysis of patient cells indicated that the mutant transcript escaped nonsense-mediated mRNA decay, and most likely produced a truncated protein, although antibody studies were unable to detect a truncated protein. Note: de novo missense variant within C-terminal Sin3-like domain of ZSWIM6 reported to cause acromelic frontonasal dysostosis (AFND), via a proposed gain-of-function effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1249 | TMTC3 | Zornitza Stark Marked gene: TMTC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1249 | TMTC3 | Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1249 | TMTC3 | Zornitza Stark Phenotypes for gene: TMTC3 were changed from Lissencephaly 8 MIM#617255 to Lissencephaly 8, MIM#617255 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1248 | TMTC3 | Zornitza Stark Classified gene: TMTC3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1248 | TMTC3 | Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1247 | WDR26 | Zornitza Stark Marked gene: WDR26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1247 | WDR26 | Zornitza Stark Gene: wdr26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1247 | WDR26 | Zornitza Stark Classified gene: WDR26 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1247 | WDR26 | Zornitza Stark Gene: wdr26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1246 | ZMYND11 | Zornitza Stark Marked gene: ZMYND11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1246 | ZMYND11 | Zornitza Stark Gene: zmynd11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1246 | ZMYND11 | Zornitza Stark Classified gene: ZMYND11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1246 | ZMYND11 | Zornitza Stark Gene: zmynd11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9285 | PTPRC | Zornitza Stark Marked gene: PTPRC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9285 | PTPRC | Zornitza Stark Gene: ptprc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9285 | PTPRC | Zornitza Stark Phenotypes for gene: PTPRC were changed from to Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971; Hepatitis C virus, susceptibility to MIM# 609532 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9284 | PTPRC | Zornitza Stark Publications for gene: PTPRC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9283 | PTPRC | Zornitza Stark Mode of inheritance for gene: PTPRC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9282 | PTPRC | Zornitza Stark reviewed gene: PTPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: 11145714, 12073144, 22689986, 10700239; Phenotypes: Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971, Hepatitis C virus, susceptibility to MIM# 609532; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.46 | PTPRC | Zornitza Stark Marked gene: PTPRC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.46 | PTPRC | Zornitza Stark Gene: ptprc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.46 | PTPRC | Zornitza Stark Phenotypes for gene: PTPRC were changed from to Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971; Hepatitis C virus, susceptibility to MIM# 609532 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.45 | PTPRC | Zornitza Stark Publications for gene: PTPRC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.44 | PTPRC | Zornitza Stark Mode of inheritance for gene: PTPRC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.43 | JAK3 | Zornitza Stark Marked gene: JAK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.43 | JAK3 | Zornitza Stark Gene: jak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.43 | JAK3 | Zornitza Stark Phenotypes for gene: JAK3 were changed from to SCID, autosomal recessive, T-negative/B-positive type MIM# 600802 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.42 | JAK3 | Zornitza Stark Publications for gene: JAK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.41 | JAK3 | Zornitza Stark Mode of inheritance for gene: JAK3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.40 | IL7R | Zornitza Stark Marked gene: IL7R as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.40 | IL7R | Zornitza Stark Gene: il7r has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.40 | IL7R | Zornitza Stark Phenotypes for gene: IL7R were changed from to Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type MIM# 608971; low T-cell numbers; normal-high B and NK-cell numbers; fever; rash; failure to thrive; recurrent respiratory and gastric infections; Hepatomegaly; Splenomegaly; diarrhoea; lymphadenopathy; pneumonitis; Pancytopaenia; decreased immunoglobulins | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.39 | IL7R | Zornitza Stark Publications for gene: IL7R were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.38 | IL7R | Zornitza Stark Mode of inheritance for gene: IL7R was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9282 | CORO1A | Zornitza Stark Marked gene: CORO1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9282 | CORO1A | Zornitza Stark Gene: coro1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9282 | CORO1A | Zornitza Stark Phenotypes for gene: CORO1A were changed from to Immunodeficiency 8, MIM# 615401 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9281 | CORO1A | Zornitza Stark Publications for gene: CORO1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9280 | CORO1A | Zornitza Stark Mode of inheritance for gene: CORO1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.37 | CORO1A | Zornitza Stark Marked gene: CORO1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.37 | CORO1A | Zornitza Stark Gene: coro1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.37 | CORO1A | Zornitza Stark Phenotypes for gene: CORO1A were changed from to Immunodeficiency 8, MIM# 615401 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.36 | CORO1A | Zornitza Stark Publications for gene: CORO1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.35 | CORO1A | Zornitza Stark Mode of inheritance for gene: CORO1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9279 | POU6F2 | Zornitza Stark Marked gene: POU6F2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9279 | POU6F2 | Zornitza Stark Added comment: Comment when marking as ready: No evidence for association with Mendelian disease. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9279 | POU6F2 | Zornitza Stark Gene: pou6f2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9279 | POU6F2 | Zornitza Stark Classified gene: POU6F2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9279 | POU6F2 | Zornitza Stark Gene: pou6f2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1245 | TMTC3 |
Danielle Ariti gene: TMTC3 was added gene: TMTC3 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for gene: TMTC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMTC3 were set to 27773428; 28973161; 32973946 Phenotypes for gene: TMTC3 were set to Lissencephaly 8 MIM#617255 Review for gene: TMTC3 was set to GREEN Added comment: 14 individuals from 8 unrelated families reported with bi-allelic LoF (frameshift, deletion, insertion) and missense variants. Lissencephaly-8 is a neurologic disorder characterised by delayed psychomotor development, ID with poor/absent speech, early-onset refractory seizures, hypotonia and appendicular spasticity. Seizures are considered a prominent phenotype: 6/9 patients developed refractory generalised or myoclonic seizures in infancy (PMID: 27773428) and in a reported family all four affected siblings presented with nocturnal seizures and ID (PMID: 28973161). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1245 | WDR26 |
Danielle Ariti gene: WDR26 was added gene: WDR26 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for gene: WDR26 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDR26 were set to 28686853; 33675273 Phenotypes for gene: WDR26 were set to Skraban-Deardorff syndrome MIM# 617616 Review for gene: WDR26 was set to GREEN Added comment: 20 individuals have been reported (only 17 with a clinical description available). All mono-allelic variants reported were de novo; most variants were LoF (frameshift, nonsense, splice site, deletion) but some were missense. Skraban-Deardorff syndrome is a neurodevelopmental disorder characterised by a broad range of clinical signs, including ID/DD, febrile and/or non-febrile seizures, abnormal facial features, feeding difficulties, and minor skeletal anomalies (Spastic gait). PMID: 28686853- Reported 15 individuals with pathogenic de novo WDR26 variants. 15/15 patients presented with both ID and seizures. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1245 | ZMYND11 |
Danielle Ariti gene: ZMYND11 was added gene: ZMYND11 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for gene: ZMYND11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZMYND11 were set to 32097528; 34216016 Phenotypes for gene: ZMYND11 were set to Mental retardation, autosomal dominant 30 MIM# 616083 Review for gene: ZMYND11 was set to GREEN Added comment: ZMYND11 variants are associated with a neurodevelopmental disorder, MRD30 that is characterised by developmental delay, particularly affecting speech, mild‐moderate intellectual disability, significant behavioural abnormalities, seizures, and hypotonia. * Most identified variants are likely to result in premature truncation and/or nonsense‐mediated decay. PMID: 34216016- Study of individuals with pathogenic ZMYND11 variants, 20/47 individuals presented with epilepsy (idiopathic focal epilepsy, Rolandic epilepsy, generalised epilepsies, Atypical Benign Partial Epilepsy etc). PMID: 32097528- Study of 16 patients with ZMYND11-related syndromic intellectual disability, 31% presented with epilepsy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4154 | CDH15 | Zornitza Stark reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9278 | CDH15 | Zornitza Stark Marked gene: CDH15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9278 | CDH15 | Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9278 | CDH15 | Zornitza Stark Phenotypes for gene: CDH15 were changed from to Mental retardation, autosomal dominant 3, MIM#612580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9277 | CDH15 | Zornitza Stark Publications for gene: CDH15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9276 | CDH15 | Zornitza Stark Mode of inheritance for gene: CDH15 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9275 | CDH15 | Zornitza Stark Classified gene: CDH15 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9275 | CDH15 | Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9274 | CDH15 | Zornitza Stark Tag disputed tag was added to gene: CDH15. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9274 | CDH15 |
Zornitza Stark commented on gene: CDH15: PMID: 19012874 - 4 unrelated patients with missense variants and mild-severe ID. Only two genes checked. All variants are common in gnomAD (>20 hets each) and classified as VUS or likely benign in ClinVar (paper is from 2008, pre-dates gnomAD). Functional studies were performed showing a LOF effect, where cell adhesion was reduced. However NMD PTCs are present in gnomAD (many >=6 hets each) PMID: 12052883 - null mouse model were viable, showed no gross developmental defects. In particular, the skeletal musculature appeared essentially normal. In the cerebellum of M-cadherin-lacking mutants, typical contactus adherens junctions were present and similar in size and numbers to the equivalent junctions in wild-type animals. However, the adhesion plaques in the cerebellum of these mutants appeared to contain elevated levels of N-cadherin compared to wild-type animals. PMID: 28422132 - reviewed microdeletions spanning multiple genes including CDH15, suggests it may contribute to a more severe neurological phenotype, with particular regard to brain malformations. PMID: 26506440 - speculates low penetrance for PTCs in this gene. Acknowledges variants in ExAC, describes them as benign Note no P/LP variants in ClinVar |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9274 | CDH15 | Zornitza Stark reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: None; Publications: 19012874, 12052883, 28422132, 26506440; Phenotypes: Mental retardation, autosomal dominant 3, MIM#612580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4154 | CDH15 | Zornitza Stark Marked gene: CDH15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4154 | CDH15 | Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4154 | CDH15 | Zornitza Stark Phenotypes for gene: CDH15 were changed from to Mental retardation, autosomal dominant 3 MIM#612580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4153 | CDH15 | Zornitza Stark Publications for gene: CDH15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.34 | PTPRC | Danielle Ariti reviewed gene: PTPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: 11145714, 12073144, 22689986, 10700239; Phenotypes: Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971, Hepatitis C virus, susceptibility to MIM# 609532; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9274 | JAK3 | Danielle Ariti reviewed gene: JAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 14615376, 11668610; Phenotypes: SCID, autosomal recessive, T-negative/B-positive type MIM# 600802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.34 | JAK3 | Danielle Ariti reviewed gene: JAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 14615376, 11668610; Phenotypes: SCID, autosomal recessive, T-negative/B-positive type MIM# 600802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9274 | CORO1A | Danielle Ariti reviewed gene: CORO1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25073507, 2352248, 18836449; Phenotypes: Immunodeficiency 8 MIM# 615401; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.34 | CORO1A | Danielle Ariti reviewed gene: CORO1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25073507, 2352248, 18836449; Phenotypes: Immunodeficiency 8 MIM# 615401; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9274 | POU6F2 | Chloe Stutterd reviewed gene: POU6F2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations SuperPanel v1.1 | Bryony Thompson Panel status changed from internal to public | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4152 | CDH15 | Zornitza Stark Mode of inheritance for gene: CDH15 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4151 | CDH15 | Zornitza Stark Tag disputed tag was added to gene: CDH15. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4151 | CDH15 | Zornitza Stark Classified gene: CDH15 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4151 | CDH15 | Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.125 | FGF8 | Zornitza Stark Marked gene: FGF8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.125 | FGF8 | Zornitza Stark Gene: fgf8 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.125 | FGF8 | Zornitza Stark Publications for gene: FGF8 were set to 24569166 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.124 | FGF8 | Zornitza Stark Classified gene: FGF8 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.124 | FGF8 | Zornitza Stark Gene: fgf8 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.123 | FGF8 | Zornitza Stark Tag SV/CNV tag was added to gene: FGF8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.123 | FGF8 | Zornitza Stark reviewed gene: FGF8: Rating: AMBER; Mode of pathogenicity: None; Publications: 34433009; Phenotypes: Hypoplastic femurs and pelvis, MIM#619545; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9274 | FGF8 | Zornitza Stark Phenotypes for gene: FGF8 were changed from Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Femoral hypoplasia to Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Hypoplastic femurs and pelvis, MIM#619545 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9273 | FGF8 | Zornitza Stark edited their review of gene: FGF8: Changed phenotypes: Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702, Hypoplastic femurs and pelvis, MIM#619545 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4150 | CDH15 | Elena Savva reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: Other; Publications: PMID: 19012874, 12052883, 28422132, 26506440; Phenotypes: Mental retardation, autosomal dominant 3 MIM#612580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations SuperPanel v1.0 |
Bryony Thompson Added Panel Vasculopathy SuperPanel Set child panels to: Vascular Malformations_Somatic; Vascular Malformations_Germline; Lymphoedema_nonsyndromic; Lymphoedema_syndromic Set panel types to: Royal Melbourne Hospital |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9273 | ARL6IP6 | Zornitza Stark Marked gene: ARL6IP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9273 | ARL6IP6 | Zornitza Stark Gene: arl6ip6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9273 | ARL6IP6 |
Zornitza Stark gene: ARL6IP6 was added gene: ARL6IP6 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ARL6IP6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ARL6IP6 were set to 31142202 Phenotypes for gene: ARL6IP6 were set to Cutis marmorata telangiectatica congenita Review for gene: ARL6IP6 was set to RED Added comment: A single case reported from a consanguineous family with a homozygous nonsense variant (p.Trp64Ter). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.148 | FRA7A | Bryony Thompson edited their review of STR: FRA7A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 5-53 repeats, with a median of 13.; Changed publications: 25196122, 33510257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.148 | FRA2A | Bryony Thompson edited their review of STR: FRA2A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 1-64 repeats, with a median of 16.; Changed publications: 24763282, 33510257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.148 | FRA12A | Bryony Thompson edited their review of STR: FRA12A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 8-120 repeats, with a median of 8.; Changed publications: 17236128, 33510257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Germline v1.4 | ARL6IP6 | Bryony Thompson Marked gene: ARL6IP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Germline v1.4 | ARL6IP6 | Bryony Thompson Gene: arl6ip6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Germline v1.4 | ARL6IP6 |
Bryony Thompson gene: ARL6IP6 was added gene: ARL6IP6 was added to Vascular Malformations_Germline. Sources: Other Mode of inheritance for gene: ARL6IP6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ARL6IP6 were set to 31142202 Phenotypes for gene: ARL6IP6 were set to Cutis marmorata telangiectatica congenita Review for gene: ARL6IP6 was set to RED Added comment: A single case reported from a consanguineous family with a homozygous nonsense variant (p.Trp64Ter). Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.215 | CPE | Zornitza Stark Marked gene: CPE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.215 | CPE | Zornitza Stark Gene: cpe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.215 | CPE | Zornitza Stark Classified gene: CPE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.215 | CPE | Zornitza Stark Gene: cpe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.214 | CPE |
Zornitza Stark gene: CPE was added gene: CPE was added to Differences of Sex Development. Sources: Literature Mode of inheritance for gene: CPE was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CPE were set to 26120850; 32936766; 34383079 Phenotypes for gene: CPE were set to Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 Review for gene: CPE was set to GREEN Added comment: 8 individuals from 5 unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4150 | CPE | Zornitza Stark Publications for gene: CPE were set to 26120850; 32936766 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4149 | CPE | Zornitza Stark Classified gene: CPE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4149 | CPE | Zornitza Stark Gene: cpe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4148 | CPE | Zornitza Stark edited their review of gene: CPE: Added comment: Bosch et al. 2021 (PMID: 34383079) reported on 4 individuals from 3 additional families harbouring 2 different homozygous truncating variants in this gene. Clinical presentation was prominent for obesity and intellectual disability. Hypogonadotropic hypogonadism was confirmed in one individual and was suspected but not tested for in another two subjects.; Changed rating: GREEN; Changed publications: 26120850, 32936766, 34383079; Changed phenotypes: Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9272 | CPE | Zornitza Stark Publications for gene: CPE were set to 26120850; 32936766 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9271 | CPE | Zornitza Stark Classified gene: CPE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9271 | CPE | Zornitza Stark Gene: cpe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9270 | CPE | Arina Puzriakova reviewed gene: CPE: Rating: GREEN; Mode of pathogenicity: None; Publications: 34383079; Phenotypes: Intellectual developmental disorder and hypogonadotropic hypogonadism, OMIM:619326; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.324 | HCFC1 | Zornitza Stark Marked gene: HCFC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.324 | HCFC1 | Zornitza Stark Gene: hcfc1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.324 | HCFC1 | Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.323 | HCFC1 | Zornitza Stark Publications for gene: HCFC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.322 | HCFC1 | Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.321 | HCFC1 | Zornitza Stark Classified gene: HCFC1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.321 | HCFC1 | Zornitza Stark Gene: hcfc1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.320 | HCFC1 | Zornitza Stark reviewed gene: HCFC1: Rating: RED; Mode of pathogenicity: None; Publications: 34164576, 24011988, 31207118; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4148 | HCFC1 | Zornitza Stark Marked gene: HCFC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4148 | HCFC1 | Zornitza Stark Gene: hcfc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4148 | HCFC1 | Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4147 | HCFC1 | Zornitza Stark Publications for gene: HCFC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4146 | HCFC1 | Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4145 | HCFC1 | Zornitza Stark reviewed gene: HCFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34164576, 24011988; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1245 | HCFC1 | Zornitza Stark Marked gene: HCFC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1245 | HCFC1 | Zornitza Stark Gene: hcfc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1245 | HCFC1 | Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1244 | HCFC1 | Zornitza Stark Publications for gene: HCFC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1243 | HCFC1 | Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1243 | HCFC1 | Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1242 | EIF2S3 | Zornitza Stark Marked gene: EIF2S3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1242 | EIF2S3 | Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1242 | EIF2S3 | Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome MIM# 300148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1241 | EIF2S3 | Zornitza Stark Publications for gene: EIF2S3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1240 | EIF2S3 | Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | HCFC1 |
Danielle Ariti changed review comment from: Well-established gene-disease association with >20 individuals reported Variants in the HCFC1 gene are associated with cases of syndromic and non-syndromic intellectual disability. Individuals present with severely delayed psychomotor development apparent in infancy, and severe neurological defects including intractable epilepsy, facial dysmorphia, and intellectual disability.; to: Well-established gene-disease association with >20 individuals reported Variants in the HCFC1 gene are associated with cases of syndromic and non-syndromic intellectual disability. Individuals present with severely delayed psychomotor development apparent in infancy, and severe neurological defects including intractable epilepsy, facial dysmorphia, and intellectual disability. Seizures being a prominent feature in this phenotype. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | HCFC1 | Danielle Ariti reviewed gene: HCFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34164576, 24011988; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type) MIM# 309541; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | EIF2S3 |
Danielle Ariti changed review comment from: 7 families reported males with hemizygous EIF2S3 variants; one mouse model. EIF2S3 variants cause intellectual disability syndrome, MEHMO which is derived from the clinical hallmarks: mental retardation, epileptic seizures, hypogonadism and hypogenitalism, microcephaly, and obesity. Seizures are prominent within this phenotype (more than 60% of patients).; to: 7 families reported males with hemizygous EIF2S3 variants; one mouse model. EIF2S3 variants cause intellectual disability syndrome, MEHMO which is derived from the clinical hallmarks: mental retardation, epileptic seizures, hypogonadism and hypogenitalism, microcephaly, and obesity. Seizures are prominent within this phenotype. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | EIF2S3 | Danielle Ariti reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 33714664, 32799315, 28055140; Phenotypes: MEHMO syndrome MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.377 | CSTB | Zornitza Stark Marked gene: CSTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.377 | CSTB | Zornitza Stark Gene: cstb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.377 | CSTB | Zornitza Stark Classified gene: CSTB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.377 | CSTB | Zornitza Stark Gene: cstb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.376 | CSTB |
Zornitza Stark Tag 5'UTR tag was added to gene: CSTB. Tag STR tag was added to gene: CSTB. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.376 | CSTB |
Zornitza Stark gene: CSTB was added gene: CSTB was added to Regression. Sources: Expert Review Mode of inheritance for gene: CSTB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSTB were set to 9012407; 9054946 Phenotypes for gene: CSTB were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800 Review for gene: CSTB was set to GREEN Added comment: Myoclonic epilepsy of Unverricht and Lundborg is an autosomal recessive disorder characterized by onset of neurodegeneration between 6 and 13 years of age. It is typically progressive in adolescence, with dramatic worsening of myoclonus and ataxia in the first 6 years after onset. The disease stabilises in early adulthood, and myoclonus and ataxia may even improve, and there is minimal to no cognitive decline. Note the most common causative allele is a dodecamer repeat in the promoter region. Missense variants have been reported, most commonly compound het with the repeat, except for p.Gly4Arg which has been reported in the homozygous state also. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4145 | CSTB | Zornitza Stark Marked gene: CSTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4145 | CSTB | Zornitza Stark Gene: cstb has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4145 | CSTB | Zornitza Stark Phenotypes for gene: CSTB were changed from to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4144 | CSTB | Zornitza Stark Publications for gene: CSTB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4143 | CSTB | Zornitza Stark Mode of inheritance for gene: CSTB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4142 | CSTB | Zornitza Stark Classified gene: CSTB as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4142 | CSTB | Zornitza Stark Gene: cstb has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4141 | CSTB | Zornitza Stark reviewed gene: CSTB: Rating: RED; Mode of pathogenicity: None; Publications: 9012407, 9054946; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9270 | CSTB | Zornitza Stark Marked gene: CSTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9270 | CSTB | Zornitza Stark Gene: cstb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9270 | CSTB | Zornitza Stark Phenotypes for gene: CSTB were changed from to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800; Keratolytic winter erythema (MIM#148370) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9269 | CSTB | Zornitza Stark Publications for gene: CSTB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9268 | CSTB | Zornitza Stark Mode of inheritance for gene: CSTB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9267 | CSTB | Zornitza Stark reviewed gene: CSTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 32920378, 18028412, 9012407, 9054946; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | CSTB | Zornitza Stark Marked gene: CSTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | CSTB | Zornitza Stark Added comment: Comment when marking as ready: Note the most common causative allele is a dodecamer repeat in the promoter region. Missense variants have been reported, most commonly compound het with the repeat, except for p.Gly4Arg which has been reported in the homozygous state also. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | CSTB | Zornitza Stark Gene: cstb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | CSTB |
Zornitza Stark Tag 5'UTR tag was added to gene: CSTB. Tag STR tag was added to gene: CSTB. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1239 | CSTB | Zornitza Stark Phenotypes for gene: CSTB were changed from Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800 to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1238 | CSTB | Zornitza Stark Phenotypes for gene: CSTB were changed from to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1237 | CSTB | Zornitza Stark Publications for gene: CSTB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1236 | CSTB | Zornitza Stark Mode of inheritance for gene: CSTB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9267 | CD3E | Zornitza Stark Marked gene: CD3E as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9267 | CD3E | Zornitza Stark Gene: cd3e has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9267 | CD3E | Zornitza Stark Phenotypes for gene: CD3E were changed from to Immunodeficiency 18 MIM# 615615 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9266 | CD3E | Zornitza Stark Publications for gene: CD3E were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9265 | CD3E | Zornitza Stark Mode of inheritance for gene: CD3E was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.34 | CD3E | Zornitza Stark Marked gene: CD3E as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.34 | CD3E | Zornitza Stark Gene: cd3e has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.34 | CD3E | Zornitza Stark Phenotypes for gene: CD3E were changed from to Immunodeficiency 18 MIM# 615615 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.33 | CD3E | Zornitza Stark Publications for gene: CD3E were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.32 | CD3E | Zornitza Stark Mode of inheritance for gene: CD3E was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9264 | CD3D | Zornitza Stark Marked gene: CD3D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9264 | CD3D | Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9264 | CD3D | Zornitza Stark Phenotypes for gene: CD3D were changed from to Immunodeficiency 19 MIM# 615617 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9263 | CD3D | Zornitza Stark Publications for gene: CD3D were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9262 | CD3D | Zornitza Stark Mode of inheritance for gene: CD3D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.31 | CD3D | Zornitza Stark Marked gene: CD3D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.31 | CD3D | Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.31 | CD3D | Zornitza Stark Phenotypes for gene: CD3D were changed from to Immunodeficiency 19 MIM# 615617 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.30 | CD3D | Zornitza Stark Publications for gene: CD3D were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.29 | CD3D | Zornitza Stark Mode of inheritance for gene: CD3D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9261 | ARHGAP26 | Zornitza Stark Marked gene: ARHGAP26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9261 | ARHGAP26 | Zornitza Stark Gene: arhgap26 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9261 | ARHGAP26 | Zornitza Stark Classified gene: ARHGAP26 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9261 | ARHGAP26 | Zornitza Stark Gene: arhgap26 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1235 | CSTB | Danielle Ariti reviewed gene: CSTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 32920378, 18028412; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.165 | SCN8A | Zornitza Stark Marked gene: SCN8A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.165 | SCN8A | Zornitza Stark Gene: scn8a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.165 | SCN8A | Zornitza Stark Phenotypes for gene: SCN8A were changed from to Cerebral Palsy; Epileptic encephalopathy 13 MIM# 614558; Cognitive impairment with or without cerebellar ataxia MIM# 614306 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.164 | SCN8A | Zornitza Stark Publications for gene: SCN8A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.163 | SCN8A | Zornitza Stark Mode of inheritance for gene: SCN8A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9260 | LEFTY2 | Zornitza Stark Marked gene: LEFTY2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9260 | LEFTY2 | Zornitza Stark Added comment: Comment when marking as ready: No reports since 1999. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9260 | LEFTY2 | Zornitza Stark Gene: lefty2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9260 | LEFTY2 | Zornitza Stark Phenotypes for gene: LEFTY2 were changed from to Heterotaxy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9259 | LEFTY2 | Zornitza Stark Publications for gene: LEFTY2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9258 | LEFTY2 | Zornitza Stark Mode of inheritance for gene: LEFTY2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9257 | LEFTY2 | Zornitza Stark Classified gene: LEFTY2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9257 | LEFTY2 | Zornitza Stark Gene: lefty2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9256 | CD3E | Danielle Ariti reviewed gene: CD3E: Rating: GREEN; Mode of pathogenicity: None; Publications: 5546002, 28597365, 8490660; Phenotypes: Immunodeficiency 18 MIM# 615615; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.28 | CD3E | Danielle Ariti reviewed gene: CD3E: Rating: GREEN; Mode of pathogenicity: None; Publications: 15546002, 28597365, 8490660; Phenotypes: Immunodeficiency 18 MIM# 615615; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9256 | CD3D | Danielle Ariti reviewed gene: CD3D: Rating: GREEN; Mode of pathogenicity: None; Publications: 14602880, 15546002, 21926461, 21883749; Phenotypes: Immunodeficiency 19 MIM# 615617; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Severe Combined Immunodeficiency (absent T present B cells) v0.28 | CD3D | Danielle Ariti reviewed gene: CD3D: Rating: GREEN; Mode of pathogenicity: None; Publications: 14602880, 15546002, 21926461, 21883749; Phenotypes: Immunodeficiency 19 MIM# 615617; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9256 | ARHGAP26 | Dean Phelan reviewed gene: ARHGAP26: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.162 | SCN8A | Danielle Ariti reviewed gene: SCN8A: Rating: GREEN; Mode of pathogenicity: Other; Publications: 33528536, 32989326, 31904124; Phenotypes: Cerebral Palsy, Epileptic encephalopathy 13 MIM# 614558, Cognitive impairment with or without cerebellar ataxia MIM# 614306; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9256 | MPL | Zornitza Stark Phenotypes for gene: MPL were changed from Myelofibrosis with myeloid metaplasia, somatic, MIM#2544503; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR to Myelofibrosis with myeloid metaplasia, somatic, MIM#254450; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bone Marrow Failure v1.7 | MPL | Zornitza Stark Phenotypes for gene: MPL were changed from Myelofibrosis with myeloid metaplasia, somatic, MIM#2544503; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR to Myelofibrosis with myeloid metaplasia, somatic, MIM#254450; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bone Marrow Failure v1.6 | MPL | Zornitza Stark edited their review of gene: MPL: Changed phenotypes: Myelofibrosis with myeloid metaplasia, somatic, MIM#254450, Thrombocythemia 2, MIM#601977, AD, SMu, Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Additional findings_Paediatric v0.257 | PTPRC | Zornitza Stark Phenotypes for gene: PTPRC were changed from Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 151460 to Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9255 | EPAS1 | Zornitza Stark Phenotypes for gene: EPAS1 were changed from Familial erythrocytosis (MIM#4611783), AD to Familial erythrocytosis (MIM#611783), AD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Liver Failure_Paediatric v1.8 | BCS1L | Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#124000 to GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Liver Failure_Paediatric v1.7 | BCS1L | Zornitza Stark edited their review of gene: BCS1L: Changed phenotypes: GRACILE syndrome, MIM# 603358, Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9254 | BCS1L | Zornitza Stark Phenotypes for gene: BCS1L were changed from Bjornstad syndrome MIM#262000; GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type MIM#1124000 to Bjornstad syndrome MIM#262000; GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type MIM#112400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cholestasis v0.204 | BCS1L | Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#124000 to GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cholestasis v0.203 | BCS1L | Zornitza Stark edited their review of gene: BCS1L: Changed phenotypes: GRACILE syndrome, MIM# 603358, Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cholestasis v0.203 | BCS1L | Zornitza Stark edited their review of gene: BCS1L: Changed phenotypes: GRACILE syndrome, MIM# 603358, Mitochondrial complex III deficiency, nuclear type 1 , MIM#12400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9253 | OPA1 | Zornitza Stark Phenotypes for gene: OPA1 were changed from Mitochondrial DNA depletion syndrome 14 (encephalocardiomyopathic type)MIM# 6168963; Behr syndrome MIM#210000, AR; Optic atrophy 1, MIM#165500; Optic atrophy plus syndrome, MIM# 125250 to Mitochondrial DNA depletion syndrome 14 (encephalocardiomyopathic type)MIM# 616896; Behr syndrome MIM#210000, AR; Optic atrophy 1, MIM#165500; Optic atrophy plus syndrome, MIM# 125250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.162 | MECP2 | Zornitza Stark Marked gene: MECP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.162 | MECP2 | Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.162 | MECP2 | Zornitza Stark Classified gene: MECP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.162 | MECP2 | Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9252 | MAOB | Zornitza Stark Marked gene: MAOB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9252 | MAOB | Zornitza Stark Gene: maob has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9252 | MAOB |
Zornitza Stark gene: MAOB was added gene: MAOB was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: MAOB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAOB were set to 31700678 Phenotypes for gene: MAOB were set to Cerebral palsy Review for gene: MAOB was set to RED Added comment: Variants identified in 2 unrelated individuals with CP (with same variant also identified in unaffected monozygotic twin). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.161 | MFN2 |
Krithika Murali gene: MFN2 was added gene: MFN2 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: MFN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MFN2 were set to 16437557; 21715711; 34114234; 33528536 Phenotypes for gene: MFN2 were set to Charcot-Marie-Tooth disease, axonal, type 2A2A - #609260; Charcot-Marie-Tooth disease, axonal, type 2A2B - #617087; Hereditary motor and sensory neuropathy VIA - 601152 Review for gene: MFN2 was set to RED Added comment: Most common cause of axonal Charcot-Marie-Tooth disease (CMT2). Homozygous and compound heterozygous MFN2 mutations have been reported in early-onset CMT2, including patients diagnosed <12 months of age. x1 het VUS reported in a prematurely born child with unilateral spastic CP (34114234) x1 paternally inherited pathogenic variant in MFN2 reported in 1 patient in CP cohort (33528536) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.161 | MAOB | Zornitza Stark Marked gene: MAOB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.161 | MAOB | Zornitza Stark Gene: maob has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.161 | MAOB | Zornitza Stark Phenotypes for gene: MAOB were changed from to Cerebral palsy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.160 | MAOB | Zornitza Stark Classified gene: MAOB as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.160 | MAOB | Zornitza Stark Gene: maob has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.159 | KMT2B | Zornitza Stark Marked gene: KMT2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.159 | KMT2B | Zornitza Stark Gene: kmt2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.159 | KMT2B | Zornitza Stark Classified gene: KMT2B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.159 | KMT2B | Zornitza Stark Gene: kmt2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.158 | KMT2A | Zornitza Stark Marked gene: KMT2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.158 | KMT2A | Zornitza Stark Gene: kmt2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.158 | KMT2A | Zornitza Stark Classified gene: KMT2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.158 | KMT2A | Zornitza Stark Gene: kmt2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1235 | KDM5C | Zornitza Stark Marked gene: KDM5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1235 | KDM5C | Zornitza Stark Gene: kdm5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1235 | KDM5C | Zornitza Stark Phenotypes for gene: KDM5C were changed from Epilepsy; Intellectual Disability; microcephaly; Spasticity; hypothyroidism to Epilepsy; Intellectual Disability; microcephaly; Spasticity; hypothyroidism; Mental retardation, X-linked, syndromic, Claes-Jensen type, MIM# 300534; MONDO:0010355 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1234 | KDM5C | Zornitza Stark Publications for gene: KDM5C were set to 23246292; 32279304; 26919706 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1233 | KDM5C | Zornitza Stark Classified gene: KDM5C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1233 | KDM5C | Zornitza Stark Gene: kdm5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1232 | KDM5C | Zornitza Stark reviewed gene: KDM5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 15586325, 32279304; Phenotypes: Mental retardation, X-linked, syndromic, Claes-Jensen type, MIM# 300534, MONDO:0010355; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1232 | ATP6V1B2 | Zornitza Stark Marked gene: ATP6V1B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1232 | ATP6V1B2 | Zornitza Stark Gene: atp6v1b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1232 | ATP6V1B2 | Zornitza Stark Classified gene: ATP6V1B2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1232 | ATP6V1B2 | Zornitza Stark Gene: atp6v1b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1231 | ATP6V1B2 | Zornitza Stark reviewed gene: ATP6V1B2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32873933; Phenotypes: Epileptic encephalopathy, Intellectual Disability, Deafness, congenital, with onychodystrophy, autosomal dominant, MIM# 124480; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4141 | ATP6V0C | Zornitza Stark Marked gene: ATP6V0C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4141 | ATP6V0C | Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4141 | ATP6V0C | Zornitza Stark Classified gene: ATP6V0C as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4141 | ATP6V0C | Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4140 | ATP6V0C |
Zornitza Stark gene: ATP6V0C was added gene: ATP6V0C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ATP6V0C. Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V0C were set to 33190975; 33090716 Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly Review for gene: ATP6V0C was set to AMBER Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9251 | ATP6V0C | Zornitza Stark Marked gene: ATP6V0C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9251 | ATP6V0C | Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9251 | ATP6V0C | Zornitza Stark Classified gene: ATP6V0C as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9251 | ATP6V0C | Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9250 | ATP6V0C | Zornitza Stark Tag SV/CNV tag was added to gene: ATP6V0C. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9250 | ATP6V0C |
Zornitza Stark gene: ATP6V0C was added gene: ATP6V0C was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V0C were set to 33190975; 33090716 Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly Review for gene: ATP6V0C was set to AMBER Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1231 | ATP6V0C | Zornitza Stark Marked gene: ATP6V0C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1231 | ATP6V0C | Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1231 | ATP6V0C | Zornitza Stark Classified gene: ATP6V0C as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1231 | ATP6V0C | Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ATP6V0C | Zornitza Stark Tag SV/CNV tag was added to gene: ATP6V0C. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ATP6V0C | Zornitza Stark reviewed gene: ATP6V0C: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual disability, seizures; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | MECP2 |
Krithika Murali gene: MECP2 was added gene: MECP2 was added to Cerebral Palsy. Sources: Expert list,Literature Mode of inheritance for gene: MECP2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: MECP2 were set to 30542205; 33528536 Phenotypes for gene: MECP2 were set to Encephalopathy, neonatal severe - 300673; Intellectual developmental disorder, X-linked syndromic, Lubs type - 300260; Intellectual developmental disorder, X-linked, syndromic 13 - 300055; Rett syndrome - 312750 Review for gene: MECP2 was set to GREEN Added comment: Pathogenic/likely pathogenic variants reported in 9 unrelated patients with CP Sources: Expert list, Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | MAOB |
Krithika Murali gene: MAOB was added gene: MAOB was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: MAOB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAOB were set to 31700678 Review for gene: MAOB was set to RED Added comment: Identified in 2 unrelated individuals with CP (with same variant also identified in unaffected monozygotic twin) in a gene not currently known to be associated disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | KMT2B |
Krithika Murali gene: KMT2B was added gene: KMT2B was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: KMT2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KMT2B were set to 29697234 Phenotypes for gene: KMT2B were set to Dystonia 28, childhood-onset - #617284 Review for gene: KMT2B was set to RED Added comment: Progressive early-onset movement disorder (mean age 7 years). Variants not previously reported in patients with CP. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | KMT2A |
Krithika Murali gene: KMT2A was added gene: KMT2A was added to Cerebral Palsy. Sources: Expert list,Literature Mode of inheritance for gene: KMT2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KMT2A were set to 33528536 Phenotypes for gene: KMT2A were set to Wiedemann-Steiner syndrome - #605130 Review for gene: KMT2A was set to GREEN Added comment: Pathogenic/likely pathogenic variants identified in 5 unrelated patients with CP (Moreno-de-Luca et al 2021). Sources: Expert list, Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | KDM5C |
Kavitha Kothur gene: KDM5C was added gene: KDM5C was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: KDM5C was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: KDM5C were set to 23246292; 32279304; 26919706 Phenotypes for gene: KDM5C were set to Epilepsy; Intellectual Disability; microcephaly; Spasticity; hypothyroidism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ATP6V1B2 |
Kavitha Kothur gene: ATP6V1B2 was added gene: ATP6V1B2 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: ATP6V1B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V1B2 were set to 31655144; 32934366; 32597767 Phenotypes for gene: ATP6V1B2 were set to Epileptic encephalopathy; Intellectual Disability; microcephaly, DOORS syndrome Review for gene: ATP6V1B2 was set to GREEN Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ATP6V0C |
Kavitha Kothur gene: ATP6V0C was added gene: ATP6V0C was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V0C were set to 33190975; 33090716 Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly Penetrance for gene: ATP6V0C were set to unknown Review for gene: ATP6V0C was set to AMBER Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | KIDINS220 | Zornitza Stark Marked gene: KIDINS220 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | KIDINS220 | Zornitza Stark Added comment: Comment when marking as ready: Phenotypic overlap with CP particularly for mono-allelic disease association. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | KIDINS220 | Zornitza Stark Gene: kidins220 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | KIDINS220 | Zornitza Stark Classified gene: KIDINS220 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.157 | KIDINS220 | Zornitza Stark Gene: kidins220 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.156 | KIDINS220 |
Krithika Murali gene: KIDINS220 was added gene: KIDINS220 was added to Cerebral Palsy. Sources: Expert list,Literature Mode of inheritance for gene: KIDINS220 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KIDINS220 were set to 30542205 Phenotypes for gene: KIDINS220 were set to Spastic paraplegia, intellectual disability, nystagmus, and obesity - #617296; Ventriculomegaly and arthrogryposis - #619501 Review for gene: KIDINS220 was set to GREEN Added comment: Well-established association with AD spastic paraplegia and AR ventriculomegaly and arthrogryposis - phenotypic overlap noted with CP. Also reported in 2 siblings with atypical CP likely due to parental germline mosaicism (PMID 30542205) Alternative gene names: ARMS Sources: Expert list, Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9249 | KDM7A | Zornitza Stark Marked gene: KDM7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9249 | KDM7A | Zornitza Stark Gene: kdm7a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9249 | KDM7A |
Zornitza Stark gene: KDM7A was added gene: KDM7A was added to Mendeliome. Sources: Literature Mode of inheritance for gene: KDM7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KDM7A were set to 25666757 Phenotypes for gene: KDM7A were set to Cerebral palsy Review for gene: KDM7A was set to RED Added comment: Synonyms: JHDMID, KDM7, KIAA1718 De novo missense VUS identified in a WES CP cohort study, no other reports. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.156 | KDM7A | Zornitza Stark Marked gene: KDM7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.156 | KDM7A | Zornitza Stark Gene: kdm7a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.156 | KDM7A | Zornitza Stark Phenotypes for gene: KDM7A were changed from to Cerebral palsy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.155 | KDM7A | Zornitza Stark Classified gene: KDM7A as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.155 | KDM7A | Zornitza Stark Gene: kdm7a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.154 | KCNQ2 | Zornitza Stark reviewed gene: KCNQ2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 7 - #613720; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.154 | KCNQ2 | Zornitza Stark Marked gene: KCNQ2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.154 | KCNQ2 | Zornitza Stark Gene: kcnq2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.154 | KCNQ2 | Zornitza Stark Phenotypes for gene: KCNQ2 were changed from Developmental and epileptic encephalopathy 7 - #613720; Myokymia - #121200; Seizures, benign neonatal, 1 - #121200 to Developmental and epileptic encephalopathy 7 - #613720 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.153 | KCNQ2 | Zornitza Stark Classified gene: KCNQ2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.153 | KCNQ2 | Zornitza Stark Gene: kcnq2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9248 | ROBO1 | Zornitza Stark Marked gene: ROBO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9248 | ROBO1 | Zornitza Stark Gene: robo1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9248 | ROBO1 | Zornitza Stark Phenotypes for gene: ROBO1 were changed from to Congenital heart disease; Pituitary anomalies | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9247 | ROBO1 | Zornitza Stark Publications for gene: ROBO1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9246 | ROBO1 | Zornitza Stark Mode of inheritance for gene: ROBO1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9245 | ROBO1 | Zornitza Stark reviewed gene: ROBO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28592524, 30530901, 30692597, 33270637, 28402530; Phenotypes: Congenital heart disease, Pituitary anomalies; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.19 | ROBO1 | Zornitza Stark Marked gene: ROBO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.19 | ROBO1 | Zornitza Stark Gene: robo1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.19 | ROBO1 | Zornitza Stark Classified gene: ROBO1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.19 | ROBO1 | Zornitza Stark Gene: robo1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.152 | KDM7A |
Krithika Murali changed review comment from: Synonyms: JHDMID, KDM7, KIAA1718 De novo missense VUS identified in a WES CP cohort study in a gene not known to be associated with disease. Sources: Expert list, Literature; to: Synonyms: JHDMID, KDM7, KIAA1718 De novo missense VUS identified in a WES CP cohort study in a gene not known to be associated with disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.152 | KDM7A |
Krithika Murali gene: KDM7A was added gene: KDM7A was added to Cerebral Palsy. Sources: Expert list,Literature Mode of inheritance for gene: KDM7A was set to Unknown Publications for gene: KDM7A were set to 25666757 Review for gene: KDM7A was set to RED Added comment: Synonyms: JHDMID, KDM7, KIAA1718 De novo missense VUS identified in a WES CP cohort study in a gene not known to be associated with disease. Sources: Expert list, Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.152 | KCNQ2 |
Krithika Murali gene: KCNQ2 was added gene: KCNQ2 was added to Cerebral Palsy. Sources: Expert list,Literature Mode of inheritance for gene: KCNQ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNQ2 were set to 33557955; 32585800; 22275249; 28655139 Phenotypes for gene: KCNQ2 were set to Developmental and epileptic encephalopathy 7 - #613720; Myokymia - #121200; Seizures, benign neonatal, 1 - #121200 Review for gene: KCNQ2 was set to AMBER Added comment: Well-validated association with early-onset epileptic encephalopathy (ClinGen) and neonatal seizures. In addition, KCNQ2 pathogenic variants reported in multiple individuals with intractable neonatal seizures and associated intellectual disability, developmental delay and motor impairment (axial hypotonia and/or spastic quadriplegia) - (PMID 22275249) x2 case reports of associated CP - 6 year old M with neonatal seizures and a CP-like syndrome. KCNQ2 exon 7 partial duplication impairing gene function (ClinVar ID 617505) - (PMID 32585800 and 33557955) and 2 year old F with perinatal encephalopathy, severe tetraparesis and cerebral visual impairment (PMID 28655139). Neonatal epileptic encephalopathy primary presentation in both cases. On Expert CP Gene List. Sources: Expert list, Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.18 | ROBO1 |
Natasha Brown gene: ROBO1 was added gene: ROBO1 was added to Pituitary hormone deficiency. Sources: Literature Mode of inheritance for gene: ROBO1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: ROBO1 were set to PMID: 30530901; 30692597; 33270637; 28402530 Phenotypes for gene: ROBO1 were set to pituitary stalk interruption syndrome; pituitary anomalies; pituitary hormone deficiency Review for gene: ROBO1 was set to GREEN Added comment: PMID: 30692597 novel hmz splice, single case; severe phenotype combined pituitary hormone deficiency, psychomotor developmental delay, severe intellectual disability, sensorineural hearing loss, strabismus, dysmorphism; parents reported to be unaffected. PMID: 30530901 Two affected from one family with 343.7 kb deletion of 3p12.3 encompassing ROBO1 PMID: 33270637 Larger cohort study found four individiuals (2x LOF; 2x missense) all het variants however those with missense variants also had other variants in different genes, evidence for pathogenicity of missense variants less clear. PMID: 28402530 In five unexplained cases of pit stalk interruption, found: p.Ala977Glnfs*40 in two affected sibs; p.Tyr1114Ter in a sporadic case, and p.Cys240Ser, affected child and paternal aunt. All heterozygous. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4139 | ARFGEF1 | Zornitza Stark Marked gene: ARFGEF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4139 | ARFGEF1 | Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4139 | ARFGEF1 | Zornitza Stark Classified gene: ARFGEF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4139 | ARFGEF1 | Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4138 | ARFGEF1 |
Zornitza Stark gene: ARFGEF1 was added gene: ARFGEF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARFGEF1 were set to 34113008 Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy Review for gene: ARFGEF1 was set to GREEN Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ARFGEF1 | Zornitza Stark Marked gene: ARFGEF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ARFGEF1 | Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ARFGEF1 | Zornitza Stark Classified gene: ARFGEF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1230 | ARFGEF1 | Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1229 | ARFGEF1 |
Zornitza Stark gene: ARFGEF1 was added gene: ARFGEF1 was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARFGEF1 were set to 34113008 Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy Review for gene: ARFGEF1 was set to GREEN Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9245 | ARFGEF1 | Zornitza Stark Marked gene: ARFGEF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9245 | ARFGEF1 | Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9245 | ARFGEF1 | Zornitza Stark Classified gene: ARFGEF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9245 | ARFGEF1 | Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9244 | ARFGEF1 |
Zornitza Stark gene: ARFGEF1 was added gene: ARFGEF1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARFGEF1 were set to 34113008 Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy Review for gene: ARFGEF1 was set to GREEN Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1228 | AP4B1 | Zornitza Stark Marked gene: AP4B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1228 | AP4B1 | Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1228 | AP4B1 | Zornitza Stark Classified gene: AP4B1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1228 | AP4B1 | Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1227 | AP4B1 |
Zornitza Stark gene: AP4B1 was added gene: AP4B1 was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: AP4B1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP4B1 were set to 21620353; 22290197; 24700674; 24781758; 32166732 Phenotypes for gene: AP4B1 were set to Spastic paraplegia 47, autosomal recessive, MIM# 614066 Review for gene: AP4B1 was set to GREEN Added comment: Autosomal recessive neurodegenerative disorder characterised by neonatal hypotonia that progresses to hypertonia and spasticity and severe ID with poor or absent speech development. Microcephaly is an early, presenting feature. Seizures reported in at least 3 families. >5 unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9243 | NPR3 | Zornitza Stark Marked gene: NPR3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9243 | NPR3 | Zornitza Stark Gene: npr3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9243 | NPR3 | Zornitza Stark Phenotypes for gene: NPR3 were changed from to Boudin-Mortier syndrome, MIM#619543; Tall stature, skeletal abnormalities, aortic dilatation | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9242 | NPR3 | Zornitza Stark Publications for gene: NPR3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9241 | NPR3 | Zornitza Stark Mode of inheritance for gene: NPR3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9240 | NPR3 | Zornitza Stark reviewed gene: NPR3: Rating: GREEN; Mode of pathogenicity: None; Publications: 30032985; Phenotypes: Boudin-Mortier syndrome, MIM#619543, Tall stature, skeletal abnormalities, aortic dilatation; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Aortopathy_Connective Tissue Disorders v1.55 | NPR3 | Zornitza Stark Phenotypes for gene: NPR3 were changed from Tall stature, skeletal abnormalities, aortic dilatation to Boudin-Mortier syndrome, MIM#619543; Tall stature, skeletal abnormalities, aortic dilatation | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Aortopathy_Connective Tissue Disorders v1.54 | NPR3 | Zornitza Stark edited their review of gene: NPR3: Changed phenotypes: Boudin-Mortier syndrome, MIM#619543, Tall stature, skeletal abnormalities, aortic dilatation | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4137 | PRR12 | Zornitza Stark Phenotypes for gene: PRR12 were changed from intellectual disability; iris abnormalities to Neuroocular syndrome, MIM#619539; Intellectual disability; Iris abnormalities; Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4136 | PRR12 | Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Intellectual disability, Iris abnormalities, Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9240 | PRR12 | Zornitza Stark Phenotypes for gene: PRR12 were changed from Intellectual disability; Iris abnormalities; Complex microphthalmia to Neuroocular syndrome, MIM#619539; Intellectual disability; Iris abnormalities; Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9239 | PRR12 | Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Intellectual disability, Iris abnormalities, Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Anophthalmia_Microphthalmia_Coloboma v1.8 | PRR12 | Zornitza Stark Phenotypes for gene: PRR12 were changed from Complex microphthalmia to Neuroocular syndrome, MIM#619539; Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Anophthalmia_Microphthalmia_Coloboma v1.7 | PRR12 | Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9239 | KCNC3 | Zornitza Stark Marked gene: KCNC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9239 | KCNC3 | Zornitza Stark Gene: kcnc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9239 | KCNC3 | Zornitza Stark Phenotypes for gene: KCNC3 were changed from to Spinocerebellar ataxia 13, MIM# 605259 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9238 | KCNC3 | Zornitza Stark Publications for gene: KCNC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9237 | KCNC3 | Zornitza Stark Mode of inheritance for gene: KCNC3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9236 | KCNC3 | Zornitza Stark reviewed gene: KCNC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 16501573, 25497598, 25981959, 25981959; Phenotypes: Spinocerebellar ataxia 13, MIM# 605259; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.152 | KCNC3 | Zornitza Stark Marked gene: KCNC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.152 | KCNC3 | Zornitza Stark Gene: kcnc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.152 | KCNC3 | Zornitza Stark Classified gene: KCNC3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.152 | KCNC3 | Zornitza Stark Gene: kcnc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.151 | KCNC3 |
Zornitza Stark gene: KCNC3 was added gene: KCNC3 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: KCNC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNC3 were set to 16501573; 25497598; 25981959; 25981959 Phenotypes for gene: KCNC3 were set to Spinocerebellar ataxia 13, MIM# 605259 Review for gene: KCNC3 was set to GREEN Added comment: ID and ataxia, variable age of onset, including in childhood. Reported in ataxic CP cohort. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.151 | KCNC3 |
Zornitza Stark gene: KCNC3 was added gene: KCNC3 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: KCNC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNC3 were set to 16501573; 25497598; 25981959; 25981959 Phenotypes for gene: KCNC3 were set to Spinocerebellar ataxia 13, MIM# 605259 Review for gene: KCNC3 was set to GREEN Added comment: ID and ataxia, variable age of onset, including in childhood. Reported in ataxic CP cohort. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.150 | ITPR1 | Zornitza Stark Marked gene: ITPR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.150 | ITPR1 | Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.150 | ITPR1 | Zornitza Stark Classified gene: ITPR1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.150 | ITPR1 | Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.149 | ITPR1 |
Zornitza Stark gene: ITPR1 was added gene: ITPR1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: ITPR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ITPR1 were set to 28826917; 25981959; 22986007 Phenotypes for gene: ITPR1 were set to Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360 Review for gene: ITPR1 was set to GREEN Added comment: Variants in this gene reported in individuals diagnosed with ataxic CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.148 | IQSEC2 | Zornitza Stark Marked gene: IQSEC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.148 | IQSEC2 | Zornitza Stark Gene: iqsec2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.148 | IQSEC2 |
Zornitza Stark gene: IQSEC2 was added gene: IQSEC2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: IQSEC2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: IQSEC2 were set to 33368194; 20473311; 23674175 Phenotypes for gene: IQSEC2 were set to Mental retardation, X-linked 1/78, MIM# 309530, MONDO:0010656; Severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome MONDO:0018347 Review for gene: IQSEC2 was set to RED Added comment: More than 20 unrelated families reported. Typical features are ID, microcephaly and hand stereotypies. Phenotypic overlap with Angelman-Rett-like syndromes rather than CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.147 | HPCA | Zornitza Stark Marked gene: HPCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.147 | HPCA | Zornitza Stark Gene: hpca has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.147 | HPCA |
Zornitza Stark changed review comment from: Isolated dystonia, variable age of onset, including in adolescence. Insufficient phenotypic overlap with CP. Sources: Expert list; to: Four families reported. Isolated dystonia, variable age of onset, including in adolescence. Insufficient phenotypic overlap with CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.147 | HPCA |
Zornitza Stark gene: HPCA was added gene: HPCA was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: HPCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HPCA were set to 30145809; 25799108 Phenotypes for gene: HPCA were set to Dystonia 2, torsion, autosomal recessive, MIM#224500 Review for gene: HPCA was set to RED Added comment: Isolated dystonia, variable age of onset, including in adolescence. Insufficient phenotypic overlap with CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.53 | MINPP1 | Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.52 | MINPP1 | Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9236 | MINPP1 | Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9235 | MINPP1 | Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.146 | MINPP1 | Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.145 | MINPP1 | Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebellar and Pontocerebellar Hypoplasia v1.17 | MINPP1 | Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebellar and Pontocerebellar Hypoplasia v1.16 | MINPP1 | Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.298 | ZC4H2 | Zornitza Stark Publications for gene: ZC4H2 were set to 23623388; 31885220 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.297 | ZC4H2 | Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.296 | ZC4H2 | Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9235 | ZC4H2 | Zornitza Stark Marked gene: ZC4H2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9235 | ZC4H2 | Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4136 | ZC4H2 | Zornitza Stark Marked gene: ZC4H2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4136 | ZC4H2 | Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4136 | ZC4H2 | Zornitza Stark Phenotypes for gene: ZC4H2 were changed from to Wieacker-Wolff syndrome, MIM# 314580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4135 | ZC4H2 | Zornitza Stark Publications for gene: ZC4H2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4134 | ZC4H2 | Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4133 | ZC4H2 | Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9235 | ZC4H2 | Zornitza Stark Phenotypes for gene: ZC4H2 were changed from to Wieacker-Wolff syndrome, MIM# 314580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9234 | ZC4H2 | Zornitza Stark Publications for gene: ZC4H2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9233 | ZC4H2 | Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.145 | ZC4H2 | Zornitza Stark Publications for gene: ZC4H2 were set to 23623388 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.144 | ZC4H2 | Zornitza Stark changed review comment from: Intellectual disability and spasticity are key features. At least one family had a diagnosis of CP.; to: Intellectual disability and spasticity are key features, more than 40 families reported. At least one family had a diagnosis of CP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.144 | ZC4H2 | Zornitza Stark edited their review of gene: ZC4H2: Changed publications: 23623388, 34322088, 33949289, 31885220, 31206972 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9232 | ZC4H2 | Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.144 | ZC4H2 | Zornitza Stark Marked gene: ZC4H2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.144 | ZC4H2 | Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.144 | ZC4H2 | Zornitza Stark Phenotypes for gene: ZC4H2 were changed from to Wieacker-Wolff syndrome, MIM# 314580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.143 | ZC4H2 | Zornitza Stark Publications for gene: ZC4H2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.142 | ZC4H2 | Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.141 | ZC4H2 | Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.141 | SPG11 | Zornitza Stark Marked gene: SPG11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.141 | SPG11 | Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.141 | SPG11 | Zornitza Stark Classified gene: SPG11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.141 | SPG11 | Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.140 | SPG11 |
Zornitza Stark gene: SPG11 was added gene: SPG11 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: SPG11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPG11 were set to 34183250; 33581793 Phenotypes for gene: SPG11 were set to Spastic paraplegia 11, autosomal recessive, MIM# 604360 Review for gene: SPG11 was set to GREEN Added comment: Intellectual disability and spasticity, reported in CP cohort. Recent review of >300 individuals with SPG11-related disease. Mean age at onset was 13.10 ± 3.65 years, with initial symptoms like gait disturbance (107/195, 54.87%) and intellectual disability (47/195, 24.10%). Cognitive decline (228/270, 84.44%) was the most common complex manifestation stepped by dysarthria (134/195, 68.72%), neuropathy (112/177, 63.28%), amyatrophy, sphincter disturbance (60/130, 46.15%) and ataxia (90/194, 46.39%). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.139 | SMARCB1 | Zornitza Stark Marked gene: SMARCB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.139 | SMARCB1 | Zornitza Stark Gene: smarcb1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.139 | SMARCB1 |
Zornitza Stark gene: SMARCB1 was added gene: SMARCB1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: SMARCB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMARCB1 were set to Coffin-Siris syndrome 3, MIM# 614608 Review for gene: SMARCB1 was set to RED Added comment: Intellectual disability and dysmorphic features, no strong phenotypic overlap with CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1226 | ACOX1 | Zornitza Stark Marked gene: ACOX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1226 | ACOX1 | Zornitza Stark Gene: acox1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1226 | ACOX1 | Zornitza Stark Phenotypes for gene: ACOX1 were changed from to Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1225 | ACOX1 | Zornitza Stark Publications for gene: ACOX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1224 | ACOX1 | Zornitza Stark Mode of inheritance for gene: ACOX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1223 | ACOX1 | Zornitza Stark reviewed gene: ACOX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32169171, 17458872; Phenotypes: Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470, Mitchell syndrome, MIM# 618960; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1223 | ALX4 | Zornitza Stark Marked gene: ALX4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1223 | ALX4 | Zornitza Stark Gene: alx4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1223 | ALX4 |
Zornitza Stark gene: ALX4 was added gene: ALX4 was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: ALX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ALX4 were set to 33269135 Phenotypes for gene: ALX4 were set to Parietal foramina 2, MIM# 609597 Review for gene: ALX4 was set to RED Added comment: Single case report of seizures in an individual with ALX4 variant and parietal foramina, unclear if related. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1222 | ADGRV1 | Zornitza Stark Phenotypes for gene: ADGRV1 were changed from Myoclonic epilepsy; febrile seizures; epilepsy to Myoclonic epilepsy; febrile seizures; epilepsy; Rolandic epilepsy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1221 | ADGRV1 | Zornitza Stark Publications for gene: ADGRV1 were set to 29266188; 29261713; 32962041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1220 | ADGRV1 | Zornitza Stark Mode of inheritance for gene: ADGRV1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1219 | ADGRV1 | Zornitza Stark Classified gene: ADGRV1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1219 | ADGRV1 | Zornitza Stark Gene: adgrv1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ADGRV1 | Zornitza Stark edited their review of gene: ADGRV1: Added comment: Two families reported with bi-allelic variants and Rolandic epilepsy.; Changed rating: AMBER; Changed publications: 29266188, 29261713, 32962041, 34160719; Changed phenotypes: Myoclonic epilepsy, febrile seizures, epilepsy, Rolandic epilepsy; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Classified gene: ACTG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Classified gene: ACTG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Marked gene: ACTG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Classified gene: ACTG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1218 | ACTG1 | Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1217 | ACTG1 |
Zornitza Stark gene: ACTG1 was added gene: ACTG1 was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: ACTG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ACTG1 were set to 22366783; 25052316 Phenotypes for gene: ACTG1 were set to Baraitser-Winter syndrome 2, MIM# 614583 Review for gene: ACTG1 was set to GREEN Added comment: Well established gene-disease association. ID and seizures correlate with extent of brain anomalies. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1216 | AARS2 | Zornitza Stark Publications for gene: AARS2 were set to 21549344; 25817015 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1215 | AARS2 | Zornitza Stark Classified gene: AARS2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1215 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1214 | AARS2 | Zornitza Stark changed review comment from: Seizures not a prominent feature of these conditions.; to: Seizures reported in some. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1214 | AARS2 | Zornitza Stark edited their review of gene: AARS2: Changed rating: AMBER; Changed publications: 21549344, 25817015, 32571458, 24808023 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1214 | TUBB3 | Zornitza Stark Marked gene: TUBB3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1214 | TUBB3 | Zornitza Stark Gene: tubb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1214 | TUBB3 | Zornitza Stark Phenotypes for gene: TUBB3 were changed from to Cortical dysplasia, complex, with other brain malformations 1, MIM# 614039 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1213 | TUBB3 | Zornitza Stark Publications for gene: TUBB3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1212 | TUBB3 | Zornitza Stark Mode of inheritance for gene: TUBB3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1211 | TUBB3 | Zornitza Stark reviewed gene: TUBB3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20829227, 25059107, 33318778; Phenotypes: Cortical dysplasia, complex, with other brain malformations 1, MIM# 614039; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1211 | SLC4A4 | Zornitza Stark Marked gene: SLC4A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1211 | SLC4A4 | Zornitza Stark Gene: slc4a4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1211 | SLC4A4 |
Zornitza Stark gene: SLC4A4 was added gene: SLC4A4 was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: SLC4A4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC4A4 were set to 33439394 Phenotypes for gene: SLC4A4 were set to Renal tubular acidosis, proximal, with ocular abnormalities, MIM# 604278 Review for gene: SLC4A4 was set to RED Added comment: Bi-allelic variants in SLC4A4 cause a syndrome characterised by proximal renal tubular acidosis (pRTA), ID, dental and ocular abnormalities, and hemiplegic migraine. Single family reported with 4 affected individuals, where seizures were a prominent feature, with adult onset. Two developed life-threatening status epilepticus. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.375 | SLC1A3 | Zornitza Stark Marked gene: SLC1A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.375 | SLC1A3 | Zornitza Stark Gene: slc1a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.375 | SLC1A3 | Zornitza Stark Phenotypes for gene: SLC1A3 were changed from to Episodic ataxia, type 6, MIM# 612656 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.374 | SLC1A3 | Zornitza Stark Publications for gene: SLC1A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.373 | SLC1A3 | Zornitza Stark Mode of inheritance for gene: SLC1A3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1210 | SLC1A3 | Zornitza Stark Marked gene: SLC1A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1210 | SLC1A3 | Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.372 | SLC1A3 | Zornitza Stark Classified gene: SLC1A3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.372 | SLC1A3 | Zornitza Stark Gene: slc1a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.371 | SLC1A3 | Zornitza Stark reviewed gene: SLC1A3: Rating: RED; Mode of pathogenicity: None; Publications: 19139306, 16116111, 29208948, 27829685, 32741053; Phenotypes: Episodic ataxia, type 6, MIM# 612656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1210 | SLC1A3 | Zornitza Stark Classified gene: SLC1A3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1210 | SLC1A3 | Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1209 | SLC1A3 |
Zornitza Stark gene: SLC1A3 was added gene: SLC1A3 was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: SLC1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC1A3 were set to 19139306; 16116111; 29208948; 27829685; 32741053 Phenotypes for gene: SLC1A3 were set to Episodic ataxia, type 6, MIM# 612656 Review for gene: SLC1A3 was set to GREEN Added comment: Seven families reported. Episodic ataxia type 6 (EA6) differs from other EA forms in long attack duration, epilepsy and absent myokymia, nystagmus, and tinnitus. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1208 | MAST1 | Zornitza Stark Marked gene: MAST1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1208 | MAST1 | Zornitza Stark Gene: mast1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1208 | MAST1 | Zornitza Stark Classified gene: MAST1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1208 | MAST1 | Zornitza Stark Gene: mast1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1207 | MAST1 |
Zornitza Stark gene: MAST1 was added gene: MAST1 was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: MAST1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAST1 were set to 31721002; 30449657; 32198973 Phenotypes for gene: MAST1 were set to Mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations; OMIM #618273 Review for gene: MAST1 was set to GREEN Added comment: 7 unrelated patients with mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations (MCCCHCM) with de novo heterozygous mutations in MAST1 gene. Intellectual disability and seizures are clinical features, together with characteristic brain imaging abnormalities. In vitro functional studies showed that 1 of the variants (lys276del) increased MAST1 binding to microtubules compared to controls. Mutant mice heterozygous for a Mast1 leu278del allele showed a thicker corpus callosum compared to wildtype, and an overall reduction in cortical volume and thickness and decreased cerebellar volume and number of granule and Purkinje cells due to increased apoptosis compared to controls. 1 Emirati patient with ID, microcephaly, and dysmorphic features, with missense variant in MAST1. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1206 | LAMA2 | Zornitza Stark Classified gene: LAMA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1206 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1205 | LAMA2 | Zornitza Stark Classified gene: LAMA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1205 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1204 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1204 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1204 | LAMA2 |
Zornitza Stark gene: LAMA2 was added gene: LAMA2 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: LAMA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LAMA2 were set to 33333793; 34325301 Phenotypes for gene: LAMA2 were set to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23 , MIM#618138 Review for gene: LAMA2 was set to GREEN Added comment: Epilepsy is a common, often severe, feature of LAMA2-related muscular dystrophy (LAMA2-RD) and could represent its onset and main manifestation, even in the absence of overt muscle involvement, reviewed in PMID 34325301. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1203 | CIC | Zornitza Stark Marked gene: CIC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1203 | CIC | Zornitza Stark Gene: cic has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1203 | CIC | Zornitza Stark Phenotypes for gene: CIC were changed from to Mental retardation, autosomal dominant 45, MIM# 617600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1202 | CIC | Zornitza Stark Publications for gene: CIC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1201 | CIC | Zornitza Stark Mode of inheritance for gene: CIC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1200 | CIC | Zornitza Stark reviewed gene: CIC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28288114; Phenotypes: Mental retardation, autosomal dominant 45, MIM# 617600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1200 | BRAF | Zornitza Stark Marked gene: BRAF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1200 | BRAF | Zornitza Stark Gene: braf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1200 | BRAF | Zornitza Stark Phenotypes for gene: BRAF were changed from to Cardiofaciocutaneous syndrome, MIM# 115150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1199 | BRAF | Zornitza Stark Publications for gene: BRAF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1198 | BRAF | Zornitza Stark Mode of inheritance for gene: BRAF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1197 | BRAF | Zornitza Stark reviewed gene: BRAF: Rating: GREEN; Mode of pathogenicity: None; Publications: 34309696; Phenotypes: Cardiofaciocutaneous syndrome, MIM# 115150; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Disorders of Glycosylation v1.19 | ALG10 | Zornitza Stark Marked gene: ALG10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Disorders of Glycosylation v1.19 | ALG10 | Zornitza Stark Gene: alg10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Disorders of Glycosylation v1.19 | ALG10 |
Zornitza Stark gene: ALG10 was added gene: ALG10 was added to Congenital Disorders of Glycosylation. Sources: Literature Mode of inheritance for gene: ALG10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALG10 were set to 33798445 Phenotypes for gene: ALG10 were set to Progressive myoclonus epilepsy; CDG Review for gene: ALG10 was set to RED Added comment: Single individual with homozygous variant identified in a progressive myoclonus epilepsy cohort. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1197 | ALG10 | Zornitza Stark Marked gene: ALG10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1197 | ALG10 | Zornitza Stark Gene: alg10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1197 | ALG10 |
Zornitza Stark gene: ALG10 was added gene: ALG10 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: ALG10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALG10 were set to 33798445 Phenotypes for gene: ALG10 were set to Progressive myoclonus epilepsy; CDG Review for gene: ALG10 was set to RED Added comment: Single individual with homozygous variant identified in a progressive myoclonus epilepsy cohort. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9232 | ALG10 | Zornitza Stark Marked gene: ALG10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9232 | ALG10 | Zornitza Stark Gene: alg10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9232 | ALG10 |
Zornitza Stark gene: ALG10 was added gene: ALG10 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ALG10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALG10 were set to 33798445 Phenotypes for gene: ALG10 were set to Progressive myoclonus epilepsy; CDG Review for gene: ALG10 was set to RED Added comment: Single individual with homozygous variant identified in a progressive myoclonus epilepsy cohort. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9231 | LRRK1 | Zornitza Stark Marked gene: LRRK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9231 | LRRK1 | Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9231 | LRRK1 | Zornitza Stark Classified gene: LRRK1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9231 | LRRK1 | Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9230 | LRRK1 |
Zornitza Stark gene: LRRK1 was added gene: LRRK1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: LRRK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LRRK1 were set to 27829680; 27055475; 31571209; 32119750 Phenotypes for gene: LRRK1 were set to Osteosclerotic metaphyseal dysplasia (OSMD) (OMIM: 615198) Review for gene: LRRK1 was set to GREEN Added comment: At least 4 unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.123 | LRRK1 | Zornitza Stark Marked gene: LRRK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.123 | LRRK1 | Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.123 | LRRK1 | Zornitza Stark Classified gene: LRRK1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.123 | LRRK1 | Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.122 | LRRK1 |
Zornitza Stark gene: LRRK1 was added gene: LRRK1 was added to Skeletal dysplasia. Sources: Expert Review Mode of inheritance for gene: LRRK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LRRK1 were set to 27829680; 27055475; 31571209; 32119750 Phenotypes for gene: LRRK1 were set to Osteosclerotic metaphyseal dysplasia (OSMD) (OMIM: 615198) Review for gene: LRRK1 was set to GREEN Added comment: At least 4 unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1196 | KIF4A |
Zornitza Stark gene: KIF4A was added gene: KIF4A was added to Genetic Epilepsy. Sources: Expert Review Mode of inheritance for gene: KIF4A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: KIF4A were set to 24812067; 34346154 Phenotypes for gene: KIF4A were set to Mental retardation, X-linked 100, MIM# 300923 Review for gene: KIF4A was set to AMBER Added comment: 12 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several. At least 3 reported as having seizures, though variable severity (including febrile Sz in one). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.96 | KIF4A | Zornitza Stark Marked gene: KIF4A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.96 | KIF4A | Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.96 | KIF4A | Zornitza Stark Classified gene: KIF4A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.96 | KIF4A | Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.95 | KIF4A |
Zornitza Stark gene: KIF4A was added gene: KIF4A was added to Hydrocephalus_Ventriculomegaly. Sources: Expert Review Mode of inheritance for gene: KIF4A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: KIF4A were set to 24812067; 34346154; 30679815 Phenotypes for gene: KIF4A were set to Mental retardation, X-linked 100, MIM# 300923 Review for gene: KIF4A was set to GREEN Added comment: 12 families reported. Severe hydrocephalus present in at least 3. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9229 | KIF4A | Zornitza Stark Publications for gene: KIF4A were set to 24812067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9228 | KIF4A | Zornitza Stark Classified gene: KIF4A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9228 | KIF4A | Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4133 | KIF4A | Zornitza Stark Publications for gene: KIF4A were set to 24812067; 34346154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4133 | KIF4A | Zornitza Stark Publications for gene: KIF4A were set to 24812067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9227 | KIF4A | Zornitza Stark edited their review of gene: KIF4A: Added comment: Further 11 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several.; Changed rating: GREEN; Changed publications: 24812067, 34346154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4132 | KIF4A | Zornitza Stark Classified gene: KIF4A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4132 | KIF4A | Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4131 | KIF4A | Zornitza Stark edited their review of gene: KIF4A: Added comment: Further 11 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several.; Changed rating: GREEN; Changed publications: 24812067, 34346154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9227 | HNRNPH1 | Zornitza Stark Marked gene: HNRNPH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9227 | HNRNPH1 | Zornitza Stark Gene: hnrnph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9227 | HNRNPH1 | Zornitza Stark Classified gene: HNRNPH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9227 | HNRNPH1 | Zornitza Stark Gene: hnrnph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.138 | PAK3 | Zornitza Stark Marked gene: PAK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.138 | PAK3 | Zornitza Stark Gene: pak3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.138 | PAK3 | Zornitza Stark Phenotypes for gene: PAK3 were changed from to Intellectual developmental disorder, X-linked 30, MIM# 300558 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.137 | PAK3 | Zornitza Stark Publications for gene: PAK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.136 | PAK3 | Zornitza Stark Mode of inheritance for gene: PAK3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.135 | PAK3 | Zornitza Stark Classified gene: PAK3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.135 | PAK3 | Zornitza Stark Gene: pak3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.134 | PAK3 | Zornitza Stark reviewed gene: PAK3: Rating: RED; Mode of pathogenicity: None; Publications: 25666757; Phenotypes: Intellectual developmental disorder, X-linked 30, MIM# 300558; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.134 | SLC2A1 | Zornitza Stark Marked gene: SLC2A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.134 | SLC2A1 | Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.134 | SLC2A1 | Zornitza Stark Classified gene: SLC2A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.134 | SLC2A1 | Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.133 | SLC2A1 |
Zornitza Stark gene: SLC2A1 was added gene: SLC2A1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: SLC2A1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: SLC2A1 were set to 30799092; 18451999; 20129935; 10980529; 20221955; 31196579 Phenotypes for gene: SLC2A1 were set to GLUT1 deficiency syndrome 1, infantile onset, severe, 606777; GLUT1 deficiency syndrome 2, childhood onset, 612126; Disorders of glucose transport Review for gene: SLC2A1 was set to GREEN Added comment: Well established gene-disease association. Mixture of ID and movement disorders, reported in a CP cohort. Treatable. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9226 | IRGM | Zornitza Stark Marked gene: IRGM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9226 | IRGM | Zornitza Stark Gene: irgm has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9226 | IRGM | Zornitza Stark Phenotypes for gene: IRGM were changed from to {Inflammatory bowel disease (Crohn disease) 19} MIM#612278 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9225 | IRGM | Zornitza Stark Publications for gene: IRGM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9224 | IRGM | Zornitza Stark Classified gene: IRGM as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9224 | IRGM | Zornitza Stark Gene: irgm has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9223 | UTP4 | Zornitza Stark Marked gene: UTP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9223 | UTP4 | Zornitza Stark Gene: utp4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9223 | UTP4 | Zornitza Stark Phenotypes for gene: UTP4 were changed from to North American Indian childhood cirrhosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9222 | UTP4 | Zornitza Stark Publications for gene: UTP4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9221 | UTP4 | Zornitza Stark Mode of inheritance for gene: UTP4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9220 | UTP4 | Zornitza Stark Classified gene: UTP4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9220 | UTP4 | Zornitza Stark Gene: utp4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | UTP4 | Zornitza Stark Tag refuted tag was added to gene: UTP4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | UTP4 | Zornitza Stark reviewed gene: UTP4: Rating: RED; Mode of pathogenicity: None; Publications: 12417987, 27535533; Phenotypes: North American Indian childhood cirrhosis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4131 | FAM149B1 | Zornitza Stark Marked gene: FAM149B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4131 | FAM149B1 | Zornitza Stark Gene: fam149b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4131 | FAM149B1 | Zornitza Stark Classified gene: FAM149B1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4131 | FAM149B1 | Zornitza Stark Gene: fam149b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.132 | SCN1A | Zornitza Stark Marked gene: SCN1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.132 | SCN1A | Zornitza Stark Gene: scn1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.132 | SCN1A | Zornitza Stark Classified gene: SCN1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.132 | SCN1A | Zornitza Stark Gene: scn1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.131 | PURA | Zornitza Stark Marked gene: PURA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.131 | PURA | Zornitza Stark Gene: pura has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.131 | PURA | Zornitza Stark Classified gene: PURA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.131 | PURA | Zornitza Stark Gene: pura has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.130 | HECW2 | Zornitza Stark Marked gene: HECW2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.130 | HECW2 | Zornitza Stark Gene: hecw2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | IRGM | Paul De Fazio reviewed gene: IRGM: Rating: RED; Mode of pathogenicity: None; Publications: 17554261, 19299395, 18985712, 20106866, 21278745, 20360734; Phenotypes: {Inflammatory bowel disease (Crohn disease) 19} MIM#612278; Mode of inheritance: Unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.130 | HECW2 | Zornitza Stark Classified gene: HECW2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.130 | HECW2 | Zornitza Stark Gene: hecw2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | UTP4 | Michelle Torres reviewed gene: UTP4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4130 | FAM149B1 |
Michelle Torres gene: FAM149B1 was added gene: FAM149B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM149B1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM149B1 were set to 30905400 Phenotypes for gene: FAM149B1 were set to Joubert; Ciliopathy Review for gene: FAM149B1 was set to GREEN gene: FAM149B1 was marked as current diagnostic Added comment: Four unrelated, but consanguineous, families reported with 2 truncating variants. Developmental delay with hypotonia and intellectual disability are typical features, and many children have characteristic facies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.129 | SCN1A |
Clare van Eyk gene: SCN1A was added gene: SCN1A was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: SCN1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SCN1A were set to PMID: 33528536; PMID: 34364746; PMID: 34114234 Phenotypes for gene: SCN1A were set to Developmental and epileptic encephalopathy 6B, non-Dravet (OMIM 619317); Dravet syndrome (OMIM 607208) Review for gene: SCN1A was set to GREEN Added comment: Six cases described with missense (3 cases) or loss of function (3 cases) variants in SCN1A in individuals diagnosed with cerebral palsy. Mutations in SCN1A cause a spectrum of early-onset epileptic encephalopathies, with some cases reported to have movement disorders clinically overlapping with cerebral palsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.129 | PURA |
Clare van Eyk gene: PURA was added gene: PURA was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: PURA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PURA were set to PMID: 34077496 Phenotypes for gene: PURA were set to Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) Review for gene: PURA was set to GREEN Added comment: PURA loss of function and missense variants cause a clinically variable neurodevelopmental disorder with movement disorders including dystonia and limb spasticity described in some individuals. One case with a novel frameshift deletion described with dyskinetic cerebral palsy and intellectual disability. An additional 3 cases with de novo variants (1 nonsense, 2 missense) reported in a retrospective analysis of a Clinical Laboratory referral cohort with cerebral palsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.129 | HECW2 |
Danielle Ariti gene: HECW2 was added gene: HECW2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: HECW2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HECW2 were set to 33528536; 33098801 Phenotypes for gene: HECW2 were set to Cerebral Palsy; Neurodevelopmental disorder with hypotonia, seizures, and absent language MIM# 617268 Review for gene: HECW2 was set to GREEN Added comment: 3 individuals in CP cohort with mono-allelic (2x de novo & 1 unknown inheritance) HECW2 variants. All individuals were diagnosed with idiopathic dystonic CP. HECW2 variants cause a neurodevelopmental disorder NDHSAL that presents with severe developmental delay, absent speech, epilepsy, encephalopathy, hypotonia, dystonia/dyskinesia, and macrocephaly. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.148 | FRA7A | Bryony Thompson Classified STR: FRA7A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.148 | FRA7A | Bryony Thompson Str: fra7a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Limb and Digital Malformations SuperPanel v0.2 | Bryony Thompson Changed child panels to: Radial Ray Abnormalities; Polydactyly; Hand and foot malformations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.129 | SHANK3 | Zornitza Stark Marked gene: SHANK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.129 | SHANK3 | Zornitza Stark Gene: shank3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.129 | SHANK3 |
Zornitza Stark gene: SHANK3 was added gene: SHANK3 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: SHANK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SHANK3 were set to 17173049 Phenotypes for gene: SHANK3 were set to Phelan-McDermid syndrome, MIM# 606232 Review for gene: SHANK3 was set to RED Added comment: Note deletions are common. ID with severe speech impairment/autistic features but movement disorders are not prominent, so limited overlap clinically with CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.128 | PIGN | Zornitza Stark Marked gene: PIGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.128 | PIGN | Zornitza Stark Gene: pign has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.128 | PIGN | Zornitza Stark Classified gene: PIGN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.128 | PIGN | Zornitza Stark Gene: pign has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.127 | PCDH19 | Zornitza Stark Marked gene: PCDH19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.127 | PCDH19 | Zornitza Stark Gene: pcdh19 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.127 | PCDH19 | Zornitza Stark Classified gene: PCDH19 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.127 | PCDH19 | Zornitza Stark Gene: pcdh19 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.126 | PCDH12 | Zornitza Stark Marked gene: PCDH12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.126 | PCDH12 | Zornitza Stark Gene: pcdh12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.126 | PCDH12 | Zornitza Stark Classified gene: PCDH12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.126 | PCDH12 | Zornitza Stark Gene: pcdh12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.125 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.125 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.125 | GRIN2B | Zornitza Stark Classified gene: GRIN2B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.125 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.124 | GNAO1 | Zornitza Stark Marked gene: GNAO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.124 | GNAO1 | Zornitza Stark Gene: gnao1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.124 | GNAO1 | Zornitza Stark Classified gene: GNAO1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.124 | GNAO1 | Zornitza Stark Gene: gnao1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.123 | FOXG1 | Zornitza Stark Marked gene: FOXG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.123 | FOXG1 | Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.123 | FOXG1 | Zornitza Stark Classified gene: FOXG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.123 | FOXG1 | Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.122 | GNB1 | Zornitza Stark Marked gene: GNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.122 | GNB1 | Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.122 | GNB1 | Zornitza Stark Classified gene: GNB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.122 | GNB1 | Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Limb and Digital Malformations SuperPanel v0.0 |
Bryony Thompson Added Panel Limb and Digital Malformations SuperPanel Set child panels to: Polydactyly; Hand and foot malformations Set panel types to: Superpanel; Royal Melbourne Hospital; Rare Disease |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.55 |
Bryony Thompson Panel name changed from Hand and foot malformation to Hand and foot malformations Panel status changed from internal to public |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.54 | WNT3 | Bryony Thompson Marked gene: WNT3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.54 | WNT3 | Bryony Thompson Gene: wnt3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.54 | WNT3 | Bryony Thompson Publications for gene: WNT3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.53 | TGDS | Bryony Thompson Marked gene: TGDS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.53 | TGDS | Bryony Thompson Gene: tgds has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.53 | TGDS | Bryony Thompson Publications for gene: TGDS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.52 | TGDS | Bryony Thompson Classified gene: TGDS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.52 | TGDS | Bryony Thompson Gene: tgds has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.51 | TGDS | Bryony Thompson reviewed gene: TGDS: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480037; Phenotypes: Catel-Manzke syndrome MIM#616145; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.51 | SMARCE1 | Bryony Thompson Marked gene: SMARCE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.51 | SMARCE1 | Bryony Thompson Gene: smarce1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.51 | SMARCE1 | Bryony Thompson Publications for gene: SMARCE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.50 | SMARCE1 | Bryony Thompson Classified gene: SMARCE1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.50 | SMARCE1 | Bryony Thompson Gene: smarce1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.49 | SMARCE1 | Bryony Thompson edited their review of gene: SMARCE1: Set current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.49 | SMARCE1 | Bryony Thompson reviewed gene: SMARCE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 25169878, 34205270; Phenotypes: Coffin-Siris syndrome 5 MIM#616938; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | GRIN2B |
Danielle Ariti gene: GRIN2B was added gene: GRIN2B was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: GRIN2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GRIN2B were set to 34531397; 33528536 Phenotypes for gene: GRIN2B were set to Cerebral Palsy; Developmental and epileptic encephalopathy 27 MIM# 616139; Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM# 613970 Review for gene: GRIN2B was set to GREEN Added comment: 3 individuals in CP cohort with mono-allelic (2x de novo & 1 unknown inheritance) GRIN2B variants. GRIN2B variants cause autosomal dominant neurodevelopmental disorders DEE27 and MRD6 that present with intellectual disability, seizures, hypotonia, movement disorders, and autistic features. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | GNB1 |
Danielle Ariti gene: GNB1 was added gene: GNB1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: GNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GNB1 were set to 33528536; 32989326; 34531397; 30194818 Phenotypes for gene: GNB1 were set to Cerebral Palsy; Mental retardation, autosomal dominant 42 MIM# 616973 Review for gene: GNB1 was set to GREEN Added comment: 4 individuals in CP cohort reported with mono-allelic (3x de novo & 1x unknown inheritance) GNB1 variants. All individuals presented with impaired movement (dystonia, spasticity) and ID; additional features were growth delay, ADHD and seizures. Additionally, all individuals had substitution affecting the p.Ile80 residue in exon 6 (28% of MRD42 cases carry variants at this residue and tend to present with Dystonia and growth delay more frequently than other residue-variant cases) Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.49 | SMARCB1 | Bryony Thompson Marked gene: SMARCB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.49 | SMARCB1 | Bryony Thompson Gene: smarcb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.49 | SMARCB1 | Bryony Thompson Publications for gene: SMARCB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.48 | SMARCB1 | Bryony Thompson Classified gene: SMARCB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.48 | SMARCB1 | Bryony Thompson Gene: smarcb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.47 | SMARCB1 | Bryony Thompson reviewed gene: SMARCB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 25169878; Phenotypes: Coffin-Siris syndrome 3 MIM#614608; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.47 | SMARCA4 | Bryony Thompson Marked gene: SMARCA4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.47 | SMARCA4 | Bryony Thompson Gene: smarca4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.47 | SMARCA4 | Bryony Thompson Publications for gene: SMARCA4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.46 | SMARCA4 | Bryony Thompson Classified gene: SMARCA4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.46 | SMARCA4 | Bryony Thompson Gene: smarca4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.45 | SMARCA4 | Bryony Thompson reviewed gene: SMARCA4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308; Phenotypes: Coffin-Siris syndrome 4 MIM#614609; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.45 | SMARCA2 | Bryony Thompson Marked gene: SMARCA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.45 | SMARCA2 | Bryony Thompson Gene: smarca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.45 | SMARCA2 | Bryony Thompson Mode of pathogenicity for gene: SMARCA2 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.44 | SMARCA2 | Bryony Thompson Publications for gene: SMARCA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.43 | SMARCA2 | Bryony Thompson Classified gene: SMARCA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.43 | SMARCA2 | Bryony Thompson Gene: smarca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.42 | RAD21 | Bryony Thompson Marked gene: RAD21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.42 | RAD21 | Bryony Thompson Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.42 | RAD21 | Bryony Thompson Classified gene: RAD21 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.42 | RAD21 | Bryony Thompson Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.41 | RAD21 | Bryony Thompson Publications for gene: RAD21 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.40 | PHF6 | Bryony Thompson Marked gene: PHF6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.40 | PHF6 | Bryony Thompson Gene: phf6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.40 | PHF6 | Bryony Thompson Publications for gene: PHF6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.39 | PHF6 | Bryony Thompson Mode of inheritance for gene: PHF6 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.38 | PHF6 | Bryony Thompson Classified gene: PHF6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.38 | PHF6 | Bryony Thompson Gene: phf6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.37 | PHF6 | Bryony Thompson edited their review of gene: PHF6: Changed rating: GREEN; Set current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.37 | PHF6 | Bryony Thompson reviewed gene: PHF6: Rating: ; Mode of pathogenicity: None; Publications: 19161141, 24092917, 12415272; Phenotypes: Borjeson-Forssman-Lehmann syndrome MIM#301900; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | GNAO1 |
Danielle Ariti gene: GNAO1 was added gene: GNAO1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: GNAO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GNAO1 were set to 33528536; 34364746; 33098801 Phenotypes for gene: GNAO1 were set to Cerebral Palsy; Neurodevelopmental disorder with involuntary movements MIM# 617493 Review for gene: GNAO1 was set to GREEN Added comment: >10 individuals in CP cohort reported with mono-allelic (de novo) GNAO1variants. The majority of these individuals were diagnosed with Dyskinetic CP displaying progressive movement disorder (dystonia, athetosis and chorea), ID and often seizures. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.37 | NXN | Bryony Thompson Marked gene: NXN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.37 | NXN | Bryony Thompson Gene: nxn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.37 | NXN | Bryony Thompson Publications for gene: NXN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.36 | NXN | Bryony Thompson Classified gene: NXN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.36 | NXN | Bryony Thompson Gene: nxn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.35 | LTBP2 | Bryony Thompson Marked gene: LTBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.35 | LTBP2 | Bryony Thompson Gene: ltbp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.35 | LTBP2 | Bryony Thompson Publications for gene: LTBP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.34 | LTBP2 | Bryony Thompson reviewed gene: LTBP2: Rating: RED; Mode of pathogenicity: None; Publications: 22539340; Phenotypes: Weill-Marchesani syndrome 3, recessive MIM#614819; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.34 | KMT2A | Bryony Thompson Marked gene: KMT2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.34 | KMT2A | Bryony Thompson Gene: kmt2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.34 | KMT2A | Bryony Thompson Publications for gene: KMT2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.33 | KMT2A | Bryony Thompson Classified gene: KMT2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.33 | KMT2A | Bryony Thompson Gene: kmt2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.32 | KMT2A | Bryony Thompson reviewed gene: KMT2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22795537, 24886118; Phenotypes: Wiedemann-Steiner syndrome MIM#605130; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.32 | KDM6A | Bryony Thompson Marked gene: KDM6A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.32 | KDM6A | Bryony Thompson Gene: kdm6a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.32 | KDM6A | Bryony Thompson Publications for gene: KDM6A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.31 | KDM6A | Bryony Thompson Classified gene: KDM6A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.31 | KDM6A | Bryony Thompson Gene: kdm6a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.30 | KDM6A | Bryony Thompson reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33674768; Phenotypes: Kabuki syndrome 2 MIM#300867, brachydactyly, clinodactyly; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | FOXG1 |
Danielle Ariti gene: FOXG1 was added gene: FOXG1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: FOXG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOXG1 were set to 34077496; 33528536 Phenotypes for gene: FOXG1 were set to Cerebral Palsy; Rett syndrome, congenital variant MIM# 613454 Review for gene: FOXG1 was set to GREEN Added comment: 5 individuals in CP cohort reported with mono-allelic (de novo) FOXG1 variants. All individuals presented with movement impairments (3 with Spastic quadriplegia), intellectual disability, and microcephaly (and 2 individuals with seizures). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | FMN1 | Bryony Thompson Marked gene: FMN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | FMN1 | Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.30 | IFT57 | Bryony Thompson Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.30 | IFT57 | Bryony Thompson Gene: ift57 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.30 | IFT57 | Bryony Thompson Publications for gene: IFT57 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lymphoedema_syndromic v0.11 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.29 | HDAC4 | Bryony Thompson Tag SV/CNV tag was added to gene: HDAC4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.29 | HDAC4 | Bryony Thompson Publications for gene: HDAC4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.28 | HDAC4 | Bryony Thompson Classified gene: HDAC4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.28 | HDAC4 | Bryony Thompson Gene: hdac4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | FMN1 | Bryony Thompson Classified gene: FMN1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9219 | FMN1 | Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9218 | FMN1 |
Bryony Thompson gene: FMN1 was added gene: FMN1 was added to Mendeliome. Sources: Literature SV/CNV tags were added to gene: FMN1. Mode of inheritance for gene: FMN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FMN1 were set to 20610440; 19383632; 15202026 Phenotypes for gene: FMN1 were set to oligosyndactyly; radioulnar synostosis; hearing loss; renal defects Review for gene: FMN1 was set to AMBER Added comment: A 263 Kb homozygous deletion of FMN1 has been identified in a single case with oligosyndactyly, radioulnar synostosis, hearing loss and renal defects. Also, a supporting null mouse model with oligosyndactyly. Also, a large duplication including GREM1 reported in association with Cenani–Lenz syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.27 | FMN1 | Bryony Thompson Marked gene: FMN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.27 | FMN1 | Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.27 | FMN1 | Bryony Thompson Phenotypes for gene: FMN1 were changed from to oligosyndactyly; radioulnar synostosis; hearing loss; renal defects | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.26 | FMN1 | Bryony Thompson Publications for gene: FMN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.25 | FMN1 | Bryony Thompson Mode of inheritance for gene: FMN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.24 | FMN1 | Bryony Thompson Classified gene: FMN1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.24 | FMN1 | Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.23 | FMN1 | Bryony Thompson Tag SV/CNV tag was added to gene: FMN1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.23 | FMN1 | Bryony Thompson reviewed gene: FMN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 20610440, 19383632, 15202026; Phenotypes: oligosyndactyly, radioulnar synostosis, hearing loss, renal defects; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9217 | LBX1 | Zornitza Stark Marked gene: LBX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9217 | LBX1 | Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9217 | LBX1 | Zornitza Stark Classified gene: LBX1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9217 | LBX1 | Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9216 | LBX1 |
Zornitza Stark gene: LBX1 was added gene: LBX1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: LBX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LBX1 were set to 30487221 Phenotypes for gene: LBX1 were set to Central hypoventilation syndrome, congenital, 3, MIM#619483 Review for gene: LBX1 was set to AMBER Added comment: Two siblings reported with homozygous LoF variant in this gene, supportive mouse model. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Central Hypoventilation v1.3 | LBX1 | Zornitza Stark Marked gene: LBX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Central Hypoventilation v1.3 | LBX1 | Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Central Hypoventilation v1.3 | LBX1 | Zornitza Stark Classified gene: LBX1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Central Hypoventilation v1.3 | LBX1 | Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Central Hypoventilation v1.2 | LBX1 |
Zornitza Stark gene: LBX1 was added gene: LBX1 was added to Central Hypoventilation. Sources: Expert Review Mode of inheritance for gene: LBX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LBX1 were set to 30487221 Phenotypes for gene: LBX1 were set to Central hypoventilation syndrome, congenital, 3, MIM#619483 Review for gene: LBX1 was set to AMBER Added comment: Two siblings reported with homozygous LoF variant in this gene, supportive mouse model. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9215 | FBXW4 | Bryony Thompson Phenotypes for gene: FBXW4 were changed from to Split-hand/foot malformation 3 syndrome MIM#246560 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9214 | B9D1 | Bryony Thompson Publications for gene: B9D1 were set to 24886560; 21493627; 25920555 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9213 | FBXW4 | Bryony Thompson Publications for gene: FBXW4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9212 | FBXW4 | Bryony Thompson Classified gene: FBXW4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9212 | FBXW4 | Bryony Thompson Gene: fbxw4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9211 | FBXW4 | Bryony Thompson reviewed gene: FBXW4: Rating: RED; Mode of pathogenicity: None; Publications: 12913067, 16235095, 27600068; Phenotypes: Split-hand/foot malformation 3 syndrome MIM#246560; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.23 | FBXW4 | Bryony Thompson Marked gene: FBXW4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.23 | FBXW4 | Bryony Thompson Gene: fbxw4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.23 | FBXW4 | Bryony Thompson Publications for gene: FBXW4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.22 | FBXW4 | Bryony Thompson reviewed gene: FBXW4: Rating: RED; Mode of pathogenicity: None; Publications: 12913067, 16235095, 27600068; Phenotypes: Split-hand/foot malformation (SHFM); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.22 | FBLN1 | Bryony Thompson Publications for gene: FBLN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.21 | FBLN1 | Bryony Thompson Marked gene: FBLN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.21 | FBLN1 | Bryony Thompson Gene: fbln1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.21 | FAT1 | Bryony Thompson Marked gene: FAT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.21 | FAT1 | Bryony Thompson Gene: fat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.21 | FAT1 | Bryony Thompson Phenotypes for gene: FAT1 were changed from to facial dysmorphism; colobomatous microphthalmia; ptosis; syndactyly with or without nephropathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.20 | FAT1 | Bryony Thompson Publications for gene: FAT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.19 | FAT1 | Bryony Thompson Mode of inheritance for gene: FAT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.18 | FAT1 | Bryony Thompson Classified gene: FAT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.18 | FAT1 | Bryony Thompson Gene: fat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.17 | EP300 | Bryony Thompson Marked gene: EP300 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.17 | EP300 | Bryony Thompson Gene: ep300 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.17 | EP300 | Bryony Thompson Classified gene: EP300 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.17 | EP300 | Bryony Thompson Added comment: Comment on list classification: Limb anomalies are a feature of Rubinstein-Taybi syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.17 | EP300 | Bryony Thompson Gene: ep300 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dystonia - complex v0.192 | IMPDH2 | Arina Puzriakova reviewed gene: IMPDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34305140; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | PIGN | Clare van Eyk changed review comment from: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype.An additional case with a homozygous missense variant in PIGN was described to have atypical cerebral palsy with multiple other anomalies.; to: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype. An additional case with a homozygous missense variant in PIGN was described to have atypical cerebral palsy with multiple other anomalies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | PIGN | Clare van Eyk Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | PIGN | Clare van Eyk edited their review of gene: PIGN: Added comment: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype.An additional case with a homozygous missense variant in PIGN was described to have atypical cerebral palsy with multiple other anomalies.; Changed rating: GREEN; Changed publications: PMID: 33528536, PMID: 34540776 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | PIGN |
Clare van Eyk gene: PIGN was added gene: PIGN was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: PIGN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGN were set to PMID: 33528536 Phenotypes for gene: PIGN were set to Multiple congenital anomalies-hypotonia-seizures syndrome 1 (OMIM 614080) Review for gene: PIGN was set to AMBER Added comment: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | PCDH19 |
Clare van Eyk changed review comment from: Variants in PCDH19 cause an X-linked disorder which affects heterozygous females, with hemizygous males largely unaffected. One male with spastic diplegic cerebral palsy described with a hemizygous predicted pathogenic variant. Sources: Literature; to: Variants in PCDH19 cause an X-linked disorder which affects heterozygous females, with hemizygous males largely unaffected. One male with spastic diplegic cerebral palsy described with a hemizygous predicted pathogenic variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | PCDH19 |
Clare van Eyk gene: PCDH19 was added gene: PCDH19 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: PCDH19 was set to Other Publications for gene: PCDH19 were set to PMID: 34321325 Phenotypes for gene: PCDH19 were set to Developmental and epileptic encephalopathy 9 (OMIM 300088) Review for gene: PCDH19 was set to RED Added comment: Variants in PCDH19 cause an X-linked disorder which affects heterozygous females, with hemizygous males largely unaffected. One male with spastic diplegic cerebral palsy described with a hemizygous predicted pathogenic variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.121 | PCDH12 |
Clare van Eyk gene: PCDH12 was added gene: PCDH12 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: PCDH12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCDH12 were set to PMID: 34321325; PMID: 29556033 Phenotypes for gene: PCDH12 were set to Diencephalic-mesencephalic junction dysplasia syndrome 1 (OMIM 251280) Review for gene: PCDH12 was set to GREEN Added comment: One case with homozygous nonsense variant reported with dysmorphic features, dystonic cerebral palsy and comorbidities including intellectual disability. Second individual with compound heterozygous truncating PCDH12 variants diagnosed as dyskinetic cerebral palsy with epilepsy and severe intellectual disability. Biallelic PCDH12 mutations cause a syndromic neurodevelopmental disorder with spasticity or dystonia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.8 | ZFP57 | Zornitza Stark Marked gene: ZFP57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.8 | ZFP57 | Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.8 | ZFP57 | Zornitza Stark Publications for gene: ZFP57 were set to 18622393; 23150280; 25848000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.7 | MKRN3 | Zornitza Stark reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.7 | MKRN3 |
Zornitza Stark Tag SV/CNV tag was added to gene: MKRN3. Tag 5'UTR tag was added to gene: MKRN3. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.7 | MKRN3 | Zornitza Stark Marked gene: MKRN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.7 | MKRN3 | Zornitza Stark Gene: mkrn3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.7 | MKRN3 | Zornitza Stark Publications for gene: MKRN3 were set to PMID: 23738509; http://igc.otago.ac.nz/home.html; 30794780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.6 | KCNK9 | Zornitza Stark Marked gene: KCNK9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.6 | KCNK9 | Zornitza Stark Gene: kcnk9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.6 | KCNK9 | Zornitza Stark Phenotypes for gene: KCNK9 were changed from Phenotype resulting from under expression: mental retardation, hypotonia, dysmprophism; Affected tissue: brain; Birk-Barel syndrome to Phenotype resulting from under expression: mental retardation, hypotonia, dysmprophism; Affected tissue: brain; Birk-Barel syndrome, MIM# 612292; MONDO:0012856 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.5 | KCNK9 | Zornitza Stark Publications for gene: KCNK9 were set to http://igc.otago.ac.nz/home.html; PMID: 24667089; 18678320; 30794780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.4 | KCNK9 | Zornitza Stark reviewed gene: KCNK9: Rating: GREEN; Mode of pathogenicity: None; Publications: 28333430, 27151206, 24980697, 18678320; Phenotypes: Birk-Barel syndrome, MIM# 612292, MONDO:0012856; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9211 | RAF1 | Zornitza Stark Marked gene: RAF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9211 | RAF1 | Zornitza Stark Gene: raf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9211 | RAF1 | Zornitza Stark Phenotypes for gene: RAF1 were changed from to Noonan syndrome 5, MIM# 611553; Cardiomyopathy, dilated, 1NN, MIM# 615916 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9210 | RAF1 | Zornitza Stark Publications for gene: RAF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9209 | RAF1 | Zornitza Stark Mode of pathogenicity for gene: RAF1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9208 | RAF1 | Zornitza Stark Mode of inheritance for gene: RAF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9207 | RAF1 | Zornitza Stark reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 17603483, 17603482, 31145547, 31030682, 29271604, 24777450; Phenotypes: Noonan syndrome 5, MIM# 611553, Cardiomyopathy, dilated, 1NN, MIM# 615916; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cardiomyopathy_Paediatric v0.108 | RAF1 | Zornitza Stark Marked gene: RAF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cardiomyopathy_Paediatric v0.108 | RAF1 | Zornitza Stark Gene: raf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cardiomyopathy_Paediatric v0.108 | RAF1 | Zornitza Stark Phenotypes for gene: RAF1 were changed from Noonan syndrome 5; Noonan syndrome 5 611553; LEOPARD syndrome 2 611554; syndromic HCM; LEOPARD syndrome 2; LEOPARD syndrome; Noonan syndrome to Cardiomyopathy, dilated, 1NN, MIM# 615916; Noonan syndrome 5, MIM# 611553 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cardiomyopathy_Paediatric v0.107 | RAF1 | Zornitza Stark Publications for gene: RAF1 were set to 17603482; 17603483 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cardiomyopathy_Paediatric v0.106 | RAF1 | Zornitza Stark reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24777450; Phenotypes: Cardiomyopathy, dilated, 1NN, MIM# 615916, Noonan syndrome 5, MIM# 611553; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.213 | CDKN1C | Zornitza Stark Marked gene: CDKN1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.213 | CDKN1C | Zornitza Stark Gene: cdkn1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.213 | CDKN1C | Zornitza Stark Phenotypes for gene: CDKN1C were changed from to IMAGe syndrome, MIM# 614732 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.212 | CDKN1C | Zornitza Stark Publications for gene: CDKN1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.211 | CDKN1C | Zornitza Stark Mode of pathogenicity for gene: CDKN1C was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.210 | CDKN1C | Zornitza Stark Mode of inheritance for gene: CDKN1C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differences of Sex Development v0.209 | CDKN1C | Zornitza Stark reviewed gene: CDKN1C: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 22634751, 33076988, 31976094, 31497289; Phenotypes: IMAGe syndrome, MIM# 614732; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9207 | CDKN1C | Zornitza Stark Marked gene: CDKN1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9207 | CDKN1C | Zornitza Stark Gene: cdkn1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9207 | CDKN1C | Zornitza Stark Phenotypes for gene: CDKN1C were changed from to Beckwith-Wiedemann syndrome, MIM# 130650; IMAGe syndrome, MIM# 614732; Silver-Russell syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9206 | CDKN1C | Zornitza Stark Publications for gene: CDKN1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9205 | CDKN1C | Zornitza Stark Mode of inheritance for gene: CDKN1C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9204 | CDKN1C | Zornitza Stark reviewed gene: CDKN1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 10424811, 8841187, 22205991, 20503313, 19843502, 15372379, 23511928, 30794780, 33076988, 31976094, 31497289; Phenotypes: Beckwith-Wiedemann syndrome, MIM# 130650, IMAGe syndrome, MIM# 614732, Silver-Russell syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.4 | CDKN1C | Zornitza Stark Marked gene: CDKN1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.4 | CDKN1C | Zornitza Stark Gene: cdkn1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.4 | CDKN1C | Zornitza Stark Publications for gene: CDKN1C were set to 10424811; PMID: 8841187; 22205991]; 20503313; 19843502; http://igc.otago.ac.nz/home.html; [15372379; 23511928; 30794780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | CDKN1C | Zornitza Stark reviewed gene: CDKN1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 10424811, 8841187, 22205991, 20503313, 19843502, 15372379, 23511928, 30794780, 33076988, 31976094, 31497289; Phenotypes: Beckwith-Wiedemann syndrome, MIM# 130650, IMAGe syndrome, MIM# 614732, Silver-Russell syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.16 | DYNC1I1 | Bryony Thompson Marked gene: DYNC1I1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.16 | DYNC1I1 | Bryony Thompson Gene: dync1i1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.16 | DYNC1I1 | Bryony Thompson Phenotypes for gene: DYNC1I1 were changed from to Split-hand/split-foot malformation (SHFM) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.15 | DYNC1I1 | Bryony Thompson Publications for gene: DYNC1I1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.14 | DYNC1I1 | Bryony Thompson Mode of inheritance for gene: DYNC1I1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.13 | DYNC1I1 | Bryony Thompson Tag SV/CNV tag was added to gene: DYNC1I1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.13 | DYNC1I1 | Bryony Thompson Classified gene: DYNC1I1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.13 | DYNC1I1 | Bryony Thompson Gene: dync1i1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.12 | DYNC1I1 | Bryony Thompson reviewed gene: DYNC1I1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22914741, 25231166, 32219838; Phenotypes: Split-hand/split-foot malformation (SHFM); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.12 | DPF2 | Bryony Thompson Marked gene: DPF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.12 | DPF2 | Bryony Thompson Gene: dpf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.12 | DPF2 | Bryony Thompson Classified gene: DPF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.12 | DPF2 | Bryony Thompson Gene: dpf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.11 | DPF2 | Bryony Thompson reviewed gene: DPF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29429572; Phenotypes: Coffin-Siris syndrome 7 MIM#618027; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.11 | DLX6 | Bryony Thompson Marked gene: DLX6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.11 | DLX6 | Bryony Thompson Gene: dlx6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.11 | DLX6 | Bryony Thompson Phenotypes for gene: DLX6 were changed from Split-hand/foot malformation 1 183600; Split-hand/foot malformation 1 with sensorineural hearing loss 220600 to Split-hand/foot malformation 1 183600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.10 | DLX6 | Bryony Thompson Publications for gene: DLX6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.9 | DLX6 | Bryony Thompson Mode of inheritance for gene: DLX6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.8 | DLX6 | Bryony Thompson reviewed gene: DLX6: Rating: RED; Mode of pathogenicity: None; Publications: 28611547; Phenotypes: Split-hand and foot malformation (SHFM, MIM 183600); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.8 | CHUK | Bryony Thompson Marked gene: CHUK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.8 | CHUK | Bryony Thompson Gene: chuk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.8 | CHUK | Bryony Thompson Publications for gene: CHUK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.7 | CHUK | Bryony Thompson Mode of inheritance for gene: CHUK was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.6 | CHUK | Bryony Thompson Classified gene: CHUK as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.6 | CHUK | Bryony Thompson Gene: chuk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.5 | ARHGAP31 | Bryony Thompson Marked gene: ARHGAP31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.5 | ARHGAP31 | Bryony Thompson Gene: arhgap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.5 | ARHGAP31 | Bryony Thompson Publications for gene: ARHGAP31 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.4 | ARHGAP31 | Bryony Thompson reviewed gene: ARHGAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 21565291, 24668619, 29924900; Phenotypes: Adams-Oliver syndrome 1 MIM#100300; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9204 | B9D1 | Bryony Thompson Classified gene: B9D1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9204 | B9D1 | Bryony Thompson Gene: b9d1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9203 | B9D1 |
Bryony Thompson changed review comment from: hNow N PMID: 34338422 - compound het missense and frameshift variant in a proband with anal atresia with vestibular fistula, ventricular septal defect, and right renal agenesis (VACTERL cohort) PMID: 21763481 - B9d1 -/- mouse displayed polydactyly, kidney cysts, ductal plate malformations, and abnormal patterning of the neural tube, concomitant with compromised ciliogenesis, ciliary protein localization, and Hedgehog (Hh) signal transduction.; to: 3 unrelated cases with a syndromic phenotype and a supporting null mouse model PMID: 34338422 - compound het missense and frameshift variant in a proband with anal atresia with vestibular fistula, ventricular septal defect, and right renal agenesis (VACTERL cohort) PMID: 24886560 - 2 Joubert syndrome cases PMID: 21763481 - B9d1 -/- mouse displayed polydactyly, kidney cysts, ductal plate malformations, and abnormal patterning of the neural tube, concomitant with compromised ciliogenesis, ciliary protein localization, and Hedgehog (Hh) signal transduction. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9203 | B9D1 | Bryony Thompson reviewed gene: B9D1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21763481, 24886560, 34338422; Phenotypes: Meckel syndrome, Joubert syndrome, VACTERL; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9203 | LEFTY2 | Elena Savva reviewed gene: LEFTY2: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 10518210, 10053005; Phenotypes: Heterotaxy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.4 | Bryony Thompson removed gene:B9D1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.1 | Bryony Thompson Panel types changed to Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | WNT5A |
Bryony Thompson gene: WNT5A was added gene: WNT5A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: WNT5A were set to Robinow syndrome, autosomal dominant 1 180700 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | WNT3 |
Bryony Thompson gene: WNT3 was added gene: WNT3 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WNT3 were set to Tetra-amelia syndrome 273395 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | WNT10B |
Bryony Thompson gene: WNT10B was added gene: WNT10B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: WNT10B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WNT10B were set to Split-hand/foot malformation 6 225300 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | TRPV4 |
Bryony Thompson gene: TRPV4 was added gene: TRPV4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: TRPV4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TRPV4 were set to Parastremmatic dwarfism 168400; Metatropic dysplasia 156530; Spinal muscular atrophy, distal, congenital nonprogressive 600175; Scapuloperoneal spinal muscular atrophy 181405; SED, Maroteaux type 184095; Spondylometaphyseal dysplasia, Kozlowski type 184252; Hereditary motor and sensory neuropathy, type IIc 606071; Brachyolmia type 3 113500; Digital arthropathy-brachydactyly, familial 606835 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | TRPS1 |
Bryony Thompson gene: TRPS1 was added gene: TRPS1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: TRPS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TRPS1 were set to Trichorhinophalangeal syndrome, type III 190351; Trichorhinophalangeal syndrome, type I 190350 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | TP63 |
Bryony Thompson gene: TP63 was added gene: TP63 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: TP63 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TP63 were set to Hay-Wells syndrome 106260; Rapp-Hodgkin syndrome 129400; Limb-mammary syndrome 603543; Split-hand/foot malformation 4 605289; Orofacial cleft 8 129400; ULT syndrome 103285; Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome 3 604292 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | TGDS |
Bryony Thompson gene: TGDS was added gene: TGDS was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: TGDS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TGDS were set to Catel-Manzke syndrome 616145 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | TBX15 |
Bryony Thompson gene: TBX15 was added gene: TBX15 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: TBX15 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TBX15 were set to Cousin syndrome 260660 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SOX9 |
Bryony Thompson gene: SOX9 was added gene: SOX9 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SOX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SOX9 were set to Campomelic dysplasia with autosomal sex reversal 114290 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SOST |
Bryony Thompson gene: SOST was added gene: SOST was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SOST was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: SOST were set to Van Buchem disease 239100; Sclerosteosis 1 269500; Craniodiaphyseal dysplasia, autosomal dominant 122860 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SMC3 |
Bryony Thompson gene: SMC3 was added gene: SMC3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SMC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMC3 were set to Cornelia de Lange syndrome 3 610759 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SMC1A |
Bryony Thompson gene: SMC1A was added gene: SMC1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SMC1A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: SMC1A were set to Cornelia de Lange syndrome 2 300590 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SMARCE1 |
Bryony Thompson gene: SMARCE1 was added gene: SMARCE1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: SMARCE1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMARCE1 were set to Coffin-Siris syndrome 5 MIM#616938 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SMARCB1 |
Bryony Thompson gene: SMARCB1 was added gene: SMARCB1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: SMARCB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMARCB1 were set to Coffin-Siris syndrome 3 MIM#614608 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SMARCA4 |
Bryony Thompson gene: SMARCA4 was added gene: SMARCA4 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: SMARCA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMARCA4 were set to Coffin-Siris syndrome 4 MIM#614609 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SMARCA2 |
Bryony Thompson gene: SMARCA2 was added gene: SMARCA2 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: SMARCA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMARCA2 were set to Nicolaides-Baraitser syndrome MIM#601358 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SMAD4 |
Bryony Thompson gene: SMAD4 was added gene: SMAD4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SMAD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMAD4 were set to Myhre syndrome 139210 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | SF3B4 |
Bryony Thompson gene: SF3B4 was added gene: SF3B4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SF3B4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SF3B4 were set to Acrofacial dysostosis 1, Nager type 154400 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ROR2 |
Bryony Thompson gene: ROR2 was added gene: ROR2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ROR2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: ROR2 were set to Robinow syndrome, autosomal recessive 268310; Brachydactyly, type B1 113000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | RECQL4 |
Bryony Thompson gene: RECQL4 was added gene: RECQL4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RECQL4 were set to Rothmund-Thomson syndrome 268400; RAPILINO syndrome 266280; Baller-Gerold syndrome 218600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | RBPJ |
Bryony Thompson gene: RBPJ was added gene: RBPJ was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: RBPJ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RBPJ were set to Adams-Oliver syndrome 3, 614814 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | RBM8A |
Bryony Thompson gene: RBM8A was added gene: RBM8A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RBM8A were set to Thrombocytopenia-absent radius syndrome 274000 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | RAD21 |
Bryony Thompson gene: RAD21 was added gene: RAD21 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: RAD21 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RAD21 were set to Cornelia de Lange syndrome 4 614701 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PTHLH |
Bryony Thompson gene: PTHLH was added gene: PTHLH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PTHLH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PTHLH were set to Brachydactyly, type E2 613382 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PTDSS1 |
Bryony Thompson gene: PTDSS1 was added gene: PTDSS1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PTDSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PTDSS1 were set to Lenz-Majewski hyperostotic dwarfism 151050 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PRMT7 |
Bryony Thompson gene: PRMT7 was added gene: PRMT7 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PRMT7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PRMT7 were set to Short stature, brachydactyly, intellectual developmental disability, and seizures 617157 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PRKAR1A |
Bryony Thompson gene: PRKAR1A was added gene: PRKAR1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PRKAR1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: PRKAR1A were set to Myxoma, intracardiac 255960; Acrodysostosis 1, with or without hormone resistance 101800; Pigmented nodular adrenocortical disease, primary, 1 610489 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | POLR1A |
Bryony Thompson gene: POLR1A was added gene: POLR1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: POLR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: POLR1A were set to Acrofacial dysostosis, Cincinnati type 616462 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PIGV |
Bryony Thompson gene: PIGV was added gene: PIGV was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PIGV was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PIGV were set to Hyperphosphatasia with mental retardation syndrome 1 239300 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PHF6 |
Bryony Thompson gene: PHF6 was added gene: PHF6 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: PHF6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PHF6 were set to Borjeson-Forssman-Lehmann syndrome MIM#301900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PGM3 |
Bryony Thompson gene: PGM3 was added gene: PGM3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PGM3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PGM3 were set to Immunodeficiency 23 615816 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PDE4D |
Bryony Thompson gene: PDE4D was added gene: PDE4D was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PDE4D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PDE4D were set to Acrodysostosis 2, with or without hormone resistance 614613 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | PDE3A |
Bryony Thompson gene: PDE3A was added gene: PDE3A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: PDE3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PDE3A were set to Hypertension and brachydactyly syndrome, 112410 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | NXN |
Bryony Thompson gene: NXN was added gene: NXN was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: NXN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NXN were set to Robinow syndrome, autosomal recessive 2 MIM#618529 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | NSDHL |
Bryony Thompson gene: NSDHL was added gene: NSDHL was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: NSDHL were set to CK syndrome 300831; Congenital hemidysplasia, ichthyosis, limb defects (CHILD) syndrome 308050 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | NOTCH1 |
Bryony Thompson gene: NOTCH1 was added gene: NOTCH1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: NOTCH1 were set to Limb, scalp and skull defects; AOS; Adams-Oliver syndrome 5, 616028; Combination of aplasia cutis congenita of the scalp vertex and terminal transverse limb defects (e.g., amputations, syndactyly, brachydactyly, or oligodactyly) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | NOG |
Bryony Thompson gene: NOG was added gene: NOG was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: NOG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NOG were set to Stapes ankylosis with broad thumb and toes 184460; Symphalangism, proximal, 1A 185800; Multiple synostoses syndrome 1 186500; Tarsal-carpal coalition syndrome 186570; Brachydactyly, type B2 611377 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | NIPBL |
Bryony Thompson gene: NIPBL was added gene: NIPBL was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome 1 122470 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | NECTIN4 |
Bryony Thompson gene: NECTIN4 was added gene: NECTIN4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: NECTIN4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NECTIN4 were set to Ectodermal dysplasia-syndactyly syndrome 1 MIM#613573 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | NECTIN1 |
Bryony Thompson gene: NECTIN1 was added gene: NECTIN1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: NECTIN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NECTIN1 were set to Cleft lip/palate-ectodermal dysplasia syndrome MIM#225060 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | MYCN |
Bryony Thompson gene: MYCN was added gene: MYCN was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYCN were set to Feingold syndrome (Microcephaly-oculo-digito-esophageal-duodenal) 164280 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | MGP |
Bryony Thompson gene: MGP was added gene: MGP was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: MGP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MGP were set to Keutel syndrome 245150 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | LTBP3 |
Bryony Thompson gene: LTBP3 was added gene: LTBP3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: LTBP3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: LTBP3 were set to Geleophysic dysplasia 3 617809; Dental anomalies and short stature 610216 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | LTBP2 |
Bryony Thompson gene: LTBP2 was added gene: LTBP2 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: LTBP2 was set to Unknown Phenotypes for gene: LTBP2 were set to Weill-Marchesani |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | LRP4 |
Bryony Thompson gene: LRP4 was added gene: LRP4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: LRP4 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: LRP4 were set to Sclerosteosis 2 614305; Cenani-Lenz syndactyly syndrome 212780 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | KMT2D |
Bryony Thompson gene: KMT2D was added gene: KMT2D was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: KMT2D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: KMT2D were set to Kabuki syndrome 1 - 147920 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | KMT2A |
Bryony Thompson gene: KMT2A was added gene: KMT2A was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: KMT2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KMT2A were set to Wiedemann-Steiner syndrome MIM#605130 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | KDM6A |
Bryony Thompson gene: KDM6A was added gene: KDM6A was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: KDM6A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: KDM6A were set to Kabuki syndrome 2 MIM#300867 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | IHH |
Bryony Thompson gene: IHH was added gene: IHH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: IHH was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: IHH were set to Brachydactyly, type A1 112500; Acrocapitofemoral dysplasia 607778 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | IFT57 |
Bryony Thompson gene: IFT57 was added gene: IFT57 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT57 were set to ?Orofaciodigital syndrome XVIII MIM#617927 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | HDAC8 |
Bryony Thompson gene: HDAC8 was added gene: HDAC8 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: HDAC8 were set to Wilson-Turner syndrome 309585; Cornelia de Lange syndrome 5 300882 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | HDAC4 |
Bryony Thompson gene: HDAC4 was added gene: HDAC4 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: HDAC4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HDAC4 were set to Albright hereditary osteodystrophy-like syndrome; Brachydactyly-intellectual disability |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | GSC |
Bryony Thompson gene: GSC was added gene: GSC was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: GSC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GSC were set to Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | GNAS |
Bryony Thompson gene: GNAS was added gene: GNAS was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: GNAS was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Phenotypes for gene: GNAS were set to McCune-Albright syndrome, somatic, mosaic 174800; ACTH-independent macronodular adrenal hyperplasia 219080 IC; Osseous heteroplasia, progressive 166350; Pseudohypoparathyroidism Ic 612462; Pseudopseudohypoparathyroidism 612463; Pseudohypoparathyroidism Ia 103580; Pseudohypoparathyroidism Ib 603233 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | GJA1 |
Bryony Thompson gene: GJA1 was added gene: GJA1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: GJA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: GJA1 were set to Hypoplastic left heart syndrome 1 241550; Syndactyly, type III 186100; Oculodentodigital dysplasia 164200; Palmoplantar keratoderma with congenital alopecia 104100; Craniometaphyseal dysplasia, autosomal recessive 218400; Erythrokeratodermia variabilis et progressiva 133200; Oculodentodigital dysplasia, autosomal recessive 257850 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | GDF6 |
Bryony Thompson gene: GDF6 was added gene: GDF6 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: GDF6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GDF6 were set to Multiple synostoses syndrome type 4 - 617898.; Klippel-Feil syndrome 1, autosomal dominant 118100 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FZD2 |
Bryony Thompson gene: FZD2 was added gene: FZD2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FZD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FZD2 were set to Autosomal dominant omodysplasia 164745; Autosomal dominant omodysplasia type 2 164745 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FMN1 |
Bryony Thompson gene: FMN1 was added gene: FMN1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: FMN1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FLNA |
Bryony Thompson gene: FLNA was added gene: FLNA was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FLNA was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: FLNA were set to Osteodysplasty Melnick Needles 309350 XLD; Otopalatodigital syndrome, type II 304120 XLD; Frontometaphyseal dysplasia 305620; Terminal osseous dysplasia 300244; Otopalatodigital syndrome, type I -311300 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FIG4 |
Bryony Thompson gene: FIG4 was added gene: FIG4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FIG4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FIG4 were set to Yunis-Varon syndrome 216340; Amyotrophic lateral sclerosis 11 612577 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FGF9 |
Bryony Thompson gene: FGF9 was added gene: FGF9 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FGF9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FGF9 were set to Multiple synostoses syndrome type 3 612961 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FBXW4 |
Bryony Thompson gene: FBXW4 was added gene: FBXW4 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: FBXW4 was set to Unknown Phenotypes for gene: FBXW4 were set to Split-hand/foot malformation 3 syndrome 246560 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FBN1 |
Bryony Thompson gene: FBN1 was added gene: FBN1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FBN1 were set to Marfan syndrome 154700; Weill-Marchesani syndrome 2, dominant 608328; Stiff skin syndrome 184900; Acromicric dysplasia 102370; Geleophysic dysplasia 2 614185 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FBLN1 |
Bryony Thompson gene: FBLN1 was added gene: FBLN1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: FBLN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: FBLN1 were set to Synpolydactyly, 3/3'4, associated with metacarpal and metatarsal synostoses 608180 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FAT1 |
Bryony Thompson gene: FAT1 was added gene: FAT1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: FAT1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ESCO2 |
Bryony Thompson gene: ESCO2 was added gene: ESCO2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ESCO2 were set to SC phocomelia syndrome 269000; Roberts syndrome 268300 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | EP300 |
Bryony Thompson gene: EP300 was added gene: EP300 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: EP300 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EP300 were set to Rubinstein-Taybi syndrome 180849 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | EOGT |
Bryony Thompson gene: EOGT was added gene: EOGT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: EOGT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EOGT were set to Adams Oliver syndrome 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DYNC1I1 |
Bryony Thompson gene: DYNC1I1 was added gene: DYNC1I1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: DYNC1I1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DVL3 |
Bryony Thompson gene: DVL3 was added gene: DVL3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DVL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DVL3 were set to Robinow syndrome, autosomal dominant 3, 616894 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DVL1 |
Bryony Thompson gene: DVL1 was added gene: DVL1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DVL1 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Phenotypes for gene: DVL1 were set to Robinow syndrome, autosomal dominant 2, MIM# 616331 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DPF2 |
Bryony Thompson gene: DPF2 was added gene: DPF2 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: DPF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DPF2 were set to Coffin-Siris syndrome 7 MIM#618027 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DOCK6 |
Bryony Thompson gene: DOCK6 was added gene: DOCK6 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DOCK6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DOCK6 were set to Adams-Oliver syndrome 2 614219 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DLX6 |
Bryony Thompson gene: DLX6 was added gene: DLX6 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: DLX6 was set to Unknown Phenotypes for gene: DLX6 were set to Split-hand/foot malformation 1 183600; Split-hand/foot malformation 1 with sensorineural hearing loss 220600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DLX5 |
Bryony Thompson gene: DLX5 was added gene: DLX5 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DLX5 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: DLX5 were set to Split-hand/foot malformation 1 with sensorineural hearing loss 220600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DLL4 |
Bryony Thompson gene: DLL4 was added gene: DLL4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DLL4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DLL4 were set to Adams-Oliver syndrome 6, 616589 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DHODH |
Bryony Thompson gene: DHODH was added gene: DHODH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DHODH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHODH were set to Miller syndrome (postaxial acrofacial dysostosis) 263750 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | DHCR7 |
Bryony Thompson gene: DHCR7 was added gene: DHCR7 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome 270400 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | CREBBP |
Bryony Thompson gene: CREBBP was added gene: CREBBP was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CREBBP were set to Rubinstein-Taybi syndrome 180849 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | CHUK |
Bryony Thompson gene: CHUK was added gene: CHUK was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: CHUK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHUK were set to ?Popliteal pterygium syndrome, Bartsocas-Papas type 2 MIM#619339; Cocoon syndrome MIM#613630 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | CHSY1 |
Bryony Thompson gene: CHSY1 was added gene: CHSY1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome 605282 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | CDH3 |
Bryony Thompson gene: CDH3 was added gene: CDH3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CDH3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CDH3 were set to Ectodermal dysplasia, ectrodactyly, and macular dystrophy 225280 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | FAM58A |
Bryony Thompson gene: FAM58A was added gene: FAM58A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FAM58A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: FAM58A were set to STAR syndrome 300707 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | CACNA1C |
Bryony Thompson gene: CACNA1C was added gene: CACNA1C was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CACNA1C was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: CACNA1C were set to Timothy syndrome MIM#601005 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | BMPR1B |
Bryony Thompson gene: BMPR1B was added gene: BMPR1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: BMPR1B was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: BMPR1B were set to Acromesomelic dysplasia, Demirhan type 609441; Brachydactyly, type A1, D 616849; Brachydactyly, type A2 112600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | BMP2 |
Bryony Thompson gene: BMP2 was added gene: BMP2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: BMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BMP2 were set to Brachydactyly, type A2 112600; short stature, facial dysmorphism and skeletal anomalies with or without cardiac aomalies 617877. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | B9D1 |
Bryony Thompson gene: B9D1 was added gene: B9D1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: B9D1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B9D1 were set to Meckel syndrome 9 614209 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | B3GLCT |
Bryony Thompson gene: B3GLCT was added gene: B3GLCT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B3GLCT were set to O-fucose-specific beta-1,3-N-glucosyltransferase deficiency (Disorders of protein O-glycosylation, O-mannosylglycan synthesis deficiencies); Peters-plus syndrome 261540 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ARID1B |
Bryony Thompson gene: ARID1B was added gene: ARID1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome type 1 - 135900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ARID1A |
Bryony Thompson gene: ARID1A was added gene: ARID1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARID1A were set to Coffin-Siris |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ARHGAP31 |
Bryony Thompson gene: ARHGAP31 was added gene: ARHGAP31 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARHGAP31 were set to Adams-Oliver syndrome 1 100300 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ANKRD11 |
Bryony Thompson gene: ANKRD11 was added gene: ANKRD11 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ANKRD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANKRD11 were set to KBG syndrome 148050 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | AFF4 |
Bryony Thompson gene: AFF4 was added gene: AFF4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ADAMTS17 |
Bryony Thompson gene: ADAMTS17 was added gene: ADAMTS17 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ADAMTS17 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAMTS17 were set to Weill-Marchesani syndrome type 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ADAMTS10 |
Bryony Thompson gene: ADAMTS10 was added gene: ADAMTS10 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ADAMTS10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAMTS10 were set to Weill-Marchesani syndrome 1, recessive, 277600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | ACVR1 |
Bryony Thompson gene: ACVR1 was added gene: ACVR1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ACVR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACVR1 were set to Fibrodysplasia ossificans progressiva 135100 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hand and foot malformations v0.0 | Bryony Thompson Added panel Hand and foot malformation | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.240 | TMEM107 | Bryony Thompson Classified gene: TMEM107 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.240 | TMEM107 | Bryony Thompson Gene: tmem107 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.239 | TMEM107 |
Bryony Thompson gene: TMEM107 was added gene: TMEM107 was added to Polydactyly. Sources: Expert list Mode of inheritance for gene: TMEM107 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM107 were set to 22698544; 26123494; 26518474 Phenotypes for gene: TMEM107 were set to Meckel syndrome 13 MIM#617562; Orofaciodigital syndrome XVI MIM#617563 Review for gene: TMEM107 was set to GREEN gene: TMEM107 was marked as current diagnostic Added comment: At least four unrelated families with polydactyly as a feature of the condition and a supporting null mouse model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.238 | MAP3K20 | Bryony Thompson Marked gene: MAP3K20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.238 | MAP3K20 | Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.238 | MAP3K20 | Bryony Thompson Classified gene: MAP3K20 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.238 | MAP3K20 | Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Polydactyly v0.237 | MAP3K20 |
Bryony Thompson gene: MAP3K20 was added gene: MAP3K20 was added to Polydactyly. Sources: Expert list Mode of inheritance for gene: MAP3K20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAP3K20 were set to 26755636; 32266845 Phenotypes for gene: MAP3K20 were set to Split-foot malformation with mesoaxial polydactyly MIM#616890 Review for gene: MAP3K20 was set to GREEN Added comment: PMID: 26755636 - Polydactyly is a feature of the condition in two consanguineous families with homozygous variants. A mouse model recapitulates the phenotype. PMID: 32266845 - A heterozygous missense was identified in a case with split hand/foot malformation (SHFM), but also large deletion including SHFM-causing genes is also present Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Marked gene: ECHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Classified gene: ECHS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Marked gene: EARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Classified gene: EARS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.121 | ARID1B | Bryony Thompson Marked gene: ARID1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.121 | ARID1B | Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.121 | ARID1B | Bryony Thompson Publications for gene: ARID1B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.120 | ARID1B | Bryony Thompson Mode of inheritance for gene: ARID1B was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.119 | ARID1B | Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported, at least one case identified in a skeletal dysplasia cohort. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.119 | ARID1B | Bryony Thompson Classified gene: ARID1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.119 | ARID1B | Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.118 | ARID1B | Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. > cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.118 | ARID1B | Bryony Thompson reviewed gene: ARID1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 34122524; Phenotypes: Coffin-Siris syndrome 1 MIM#135900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.118 | ARID1A | Bryony Thompson Marked gene: ARID1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.118 | ARID1A | Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.118 | ARID1A | Bryony Thompson Publications for gene: ARID1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.117 | ARID1A | Bryony Thompson Mode of inheritance for gene: ARID1A was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.116 | ARID1A | Bryony Thompson Classified gene: ARID1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.116 | ARID1A | Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.115 | ARID1A | Bryony Thompson changed review comment from: At least 5 cases have been reported with skeletal anomalies as a feature of the condition. Mosaicism is very common for the gene.; to: At least 5 cases have been reported with skeletal anomalies (brachydactyly and polydactyly) as a feature of the condition. Mosaicism is very common for the gene. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.115 | ARID1A | Bryony Thompson reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 32888375; Phenotypes: Coffin-Siris syndrome 2 MM#614607; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.116 | ECHS1 |
Danielle Ariti gene: ECHS1 was added gene: ECHS1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: ECHS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ECHS1 were set to 33528536; 34364746; 32858208 Phenotypes for gene: ECHS1 were set to Cerebral Palsy; Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277 Review for gene: ECHS1 was set to GREEN Added comment: Two cases in CP cohort reported with compound heterozygous ECHS1variants. One of the individuals presented with delayed motor skills with coordination problems, dystonia (at age 11), and spasticity in upper and lower limbs. ECHS1 variants cause an inborn error of metabolism disorder characterised by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Some of these cases display paroxysmal and non-paroxysmal dystonia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.116 | EARS2 |
Danielle Ariti gene: EARS2 was added gene: EARS2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: EARS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EARS2 were set to 33528536; 34364746 Phenotypes for gene: EARS2 were set to Cerebral Palsy; Combined oxidative phosphorylation deficiency 12 MIM# 614924 Review for gene: EARS2 was set to GREEN Added comment: Two individuals in CP cohort reported with bi-allelic EARS2 variants. One of the individuals presented with severe ID, ASD and seizures on top of impaired motor symptoms. Overlapping CP phenotype with COXPD12- mitochondrial neurologic disorder characterised by onset in infancy of hypotonia and delayed psychomotor development, or early developmental regression. Severe cases can present with Dystonia, Spastic tetraparesis and/or lack of speech. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Classified gene: SPEN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autism v0.168 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autism v0.168 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autism v0.168 | SPEN | Zornitza Stark Classified gene: SPEN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autism v0.168 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Marked gene: AFF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Classified gene: AFF4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal dysplasia v0.114 | AFF4 |
Bryony Thompson gene: AFF4 was added gene: AFF4 was added to Skeletal dysplasia. Sources: Other Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AFF4 were set to 25730767; 31058441 Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368 Mode of pathogenicity for gene: AFF4 was set to Other Review for gene: AFF4 was set to GREEN gene: AFF4 was marked as current diagnostic Added comment: CHOPS syndrome: C for Cognitive impairment and Coarse facies, H for Heart defects, O for Obesity, P for Pulmonary involvement and S for Short stature and Skeletal dysplasia. 8 out of 11 cases had skeletal dysplasia as a feature of the condition. Gain-of-function is the mechanism of disease. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Marked gene: DDX3X as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Classified gene: DDX3X as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Marked gene: DDHD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Classified gene: DDHD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.114 | DDX3X |
Danielle Ariti gene: DDX3X was added gene: DDX3X was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: DDX3X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: DDX3X were set to 33528536 Phenotypes for gene: DDX3X were set to Cerebral Palsy; Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958 Review for gene: DDX3X was set to GREEN Added comment: 6 individuals in CP cohort reported with de novo DDX3X variants. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.114 | DDHD2 |
Danielle Ariti gene: DDHD2 was added gene: DDHD2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: DDHD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDHD2 were set to 30705080; 34077496; 34321325 Phenotypes for gene: DDHD2 were set to Cerebral Palsy; Spastic paraplegia 54, autosomal recessive MIM# 615033 Review for gene: DDHD2 was set to GREEN Added comment: Two individuals reported in CP cohort. Phenotype-Spastic diplegia, and ID. Multiple reports of CP-mimic patients with global developmental delay and non-progressive spastic gait. SPG54 individuals display CP-like phenotype such as intellectual disability, early-onset spasticity of the lower limbs and delayed psychomotor development. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.114 | DDC | Zornitza Stark Marked gene: DDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.114 | DDC | Zornitza Stark Added comment: Comment when marking as ready: Phenotypic overlap with CP: ID and movement disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.114 | DDC | Zornitza Stark Gene: ddc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.114 | DDC | Zornitza Stark Classified gene: DDC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.114 | DDC | Zornitza Stark Gene: ddc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Marked gene: CYP2U1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Classified gene: CYP2U1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Marked gene: COL4A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Classified gene: COL4A2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.111 | DDC |
Danielle Ariti gene: DDC was added gene: DDC was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: DDC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDC were set to 33528536; 30799092; 33996177 Phenotypes for gene: DDC were set to Aromatic L-amino acid decarboxylase deficiency MIM# 608643 Review for gene: DDC was set to AMBER Added comment: Single case reported in CP cohort with Dystonic cerebral palsy. Multiple AADCD cases reported as CP- mimics due to phenotype overlap: dystonia and developmental delay. AADCD being is an inborn error in neurotransmitter metabolism disorder that leads to combined serotonin and catecholamine deficiency. Clinically characterised by vegetative symptoms, oculogyric crises, dystonia, and severe neurologic dysfunction (infancy/ early childhood); displays CP-like features. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1194 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to AMBER gene: SPEN was marked as current diagnostic Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Seizures were observed in only 3/32 (~9%) of patients Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autism v0.167 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Autism. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to GREEN gene: SPEN was marked as current diagnostic Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.129 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to GREEN gene: SPEN was marked as current diagnostic Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.92 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Deafness_IsolatedAndComplex. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to AMBER Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Hearing loss reported in ~10% of patients, uncommon phenotype Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.111 | CYP2U1 |
Danielle Ariti changed review comment from: Single case reported in CP cohort (bi-allelic c.A947T variant). SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia. Sources: Expert list; to: Single case reported in CP cohort (bi-allelic p.D316V variant). SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.111 | CYP2U1 |
Danielle Ariti gene: CYP2U1 was added gene: CYP2U1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: CYP2U1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CYP2U1 were set to 33528536; 29761117; 23176821 Phenotypes for gene: CYP2U1 were set to Cerebral Palsy; Spastic paraplegia 56, autosomal recessive MIM# 615030 Review for gene: CYP2U1 was set to GREEN Added comment: Single case reported in CP cohort (bi-allelic c.A947T variant). SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | NLRP5 | Anna Le Fevre reviewed gene: NLRP5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26323243, 31829238, 29574422, 30877238, 32222962, 34440388; Phenotypes: Miscarriage, Beckwith-Wiedemann syndrome, Multi locus imprinting disturbance in offspring; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.111 | COL4A2 |
Danielle Ariti gene: COL4A2 was added gene: COL4A2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: COL4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COL4A2 were set to 33528536; 33912663 Phenotypes for gene: COL4A2 were set to Cerebral Palsy; Brain small vessel disease 2 MIM# 614483 Review for gene: COL4A2 was set to GREEN Added comment: 7 individuals in CP cohort have been reported with mono-allelic COL4A2 variants. Phenotypic overlap: Spastic Triplegia, ID (no language), porencephaly and seizures. 2 siblings reported with bi-allelic variants; Spastic Cerebral Palsy with ID and Epilepsy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.111 | ATL1 | Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.111 | ATL1 | Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.110 | ATL1 | Zornitza Stark Publications for gene: ATL1 were set to PMID: 32989326 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.109 | ATL1 | Zornitza Stark Classified gene: ATL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.109 | ATL1 | Zornitza Stark Gene: atl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | ZNF445 |
Anna Le Fevre gene: ZNF445 was added gene: ZNF445 was added to Imprinting disorders. Sources: Literature Mode of inheritance for gene: ZNF445 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF445 were set to PMID: 34039421; 30602440; 30846001 Phenotypes for gene: ZNF445 were set to Temple syndrome; Multi locus imprinting disturbance (MLID) Penetrance for gene: ZNF445 were set to unknown Review for gene: ZNF445 was set to AMBER Added comment: Suggested rating: AMBER Single report (Kagami 2021) of a child with Temple syndrome and MLID found to have a novel homozygous truncating variant in ZNF445. ZNF445 has been shown to play a critical role in the maintenance of postfertilisation methylation imprints (Takahashi 2019). Mechanism and parent of origin effects remain uncertain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Marked gene: NGLY1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Classified gene: NGLY1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Marked gene: NEXMIF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Classified gene: NEXMIF as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Marked gene: PANK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Classified gene: PANK2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.104 | NDUFAF2 | Zornitza Stark Marked gene: NDUFAF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.104 | NDUFAF2 | Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.104 | NDUFAF2 | Zornitza Stark Phenotypes for gene: NDUFAF2 were changed from Cerebral palsy to Cerebral palsy; Mitochondrial complex I deficiency nuclear type 10 (OMIM 618233) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.103 | NDUFAF2 | Zornitza Stark Classified gene: NDUFAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.103 | NDUFAF2 | Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Marked gene: NDUFA12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Classified gene: NDUFA12 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.101 | NALCN | Zornitza Stark Marked gene: NALCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.101 | NALCN | Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.101 | NALCN | Zornitza Stark Phenotypes for gene: NALCN were changed from Cerebral palsy to Cerebral palsy; Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.100 | NALCN | Zornitza Stark Classified gene: NALCN as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.100 | NALCN | Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | ATL1 | Clare van Eyk reviewed gene: ATL1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33528536, PMID: 34321325; Phenotypes: Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NALCN | Clare van Eyk edited their review of gene: NALCN: Changed phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFA12 | Clare van Eyk Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFA12 | Clare van Eyk edited their review of gene: NDUFA12: Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort.; Changed phenotypes: Mitochondrial complex I deficiency, nuclear type 23 (OMIM 618244) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NEXMIF | Clare van Eyk Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NEXMIF | Clare van Eyk edited their review of gene: NEXMIF: Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date.; Changed phenotypes: X-linked intellectual disability 98 (OMIM:300912) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | PANK2 |
Clare van Eyk gene: PANK2 was added gene: PANK2 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: PANK2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PANK2 were set to PMID: 33098801 Phenotypes for gene: PANK2 were set to HARP syndrome ( OMIM 607236); Neurodegeneration with brain iron accumulation 1 (OMIM 234200) Review for gene: PANK2 was set to AMBER Added comment: One case reported with dystonic cerebral palsy. Dystonia and spasticity are reported in cases with variants in PANK2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NGLY1 |
Clare van Eyk gene: NGLY1 was added gene: NGLY1 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NGLY1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NGLY1 were set to PMID:33528536 Phenotypes for gene: NGLY1 were set to Congenital disorder of deglycosylation (OMIM 615273) Review for gene: NGLY1 was set to GREEN Added comment: Three cases with biallelic P/LP variants reported in Clinical Laboratory Referral Cohort retrospectively analysed for genetic determinants of cerebral palsy. Autosomal recessive, multisystem disorder with some overlapping clinical features with cerebral palsy, but this is a progressive condition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFAF2 | Clare van Eyk reviewed gene: NDUFAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: mitochondrial complex I deficiency nuclear type 10 (OMIM 618233); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFAF2 | Clare van Eyk Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NEXMIF |
Clare van Eyk changed review comment from: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date. Sources: Expert list; to: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NEXMIF |
Clare van Eyk gene: NEXMIF was added gene: NEXMIF was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: NEXMIF was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: NEXMIF were set to X-linked Intellectual disability; epilepsy; autism Penetrance for gene: NEXMIF were set to Incomplete Review for gene: NEXMIF was set to RED Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFAF2 |
Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype. Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Overlapping clinical phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFAF2 |
Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFAF2 |
Clare van Eyk gene: NDUFAF2 was added gene: NDUFAF2 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NDUFAF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFAF2 were set to PMID:33528536; PMID:34364746 Phenotypes for gene: NDUFAF2 were set to Cerebral palsy Review for gene: NDUFAF2 was set to GREEN Added comment: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NDUFA12 |
Clare van Eyk gene: NDUFA12 was added gene: NDUFA12 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NDUFA12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA12 were set to PMID:34364746 Phenotypes for gene: NDUFA12 were set to Spastic tetraparesis; intellectual disability; encephalopathy Review for gene: NDUFA12 was set to AMBER Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NALCN | Clare van Eyk reviewed gene: NALCN: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: Cerebral palsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NALCN | Clare van Eyk Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | NALCN |
Clare van Eyk gene: NALCN was added gene: NALCN was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NALCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NALCN were set to PMID:33528536; 34364746 Phenotypes for gene: NALCN were set to Cerebral palsy Review for gene: NALCN was set to AMBER Added comment: One case with pathogenic variant from clinical laboratory referral cohort. One additional VUS from tertiary care setting. NALCN variants cause a congenital disorder with contractures of the limbs, abnormal facial features, hypotonia, and developmental delay (OMIM: 611549). Cerebral palsy has not been described previously. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9203 | CARMIL2 | Zornitza Stark Marked gene: CARMIL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9203 | CARMIL2 | Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9203 | CARMIL2 | Zornitza Stark Phenotypes for gene: CARMIL2 were changed from to Immunodeficiency 58, MIM# 618131; Early onset paediatric inflammatory bowel disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9202 | CARMIL2 | Zornitza Stark Publications for gene: CARMIL2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9201 | CARMIL2 | Zornitza Stark Mode of inheritance for gene: CARMIL2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9200 | CARMIL2 | Zornitza Stark reviewed gene: CARMIL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29479355, 28112205, 27896283, 33723309; Phenotypes: Immunodeficiency 58, MIM# 618131, Early onset paediatric inflammatory bowel disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Marked gene: CARMIL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Classified gene: CARMIL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.60 | CARMIL2 |
Zornitza Stark gene: CARMIL2 was added gene: CARMIL2 was added to Inflammatory bowel disease. Sources: Expert Review Mode of inheritance for gene: CARMIL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CARMIL2 were set to 33723309 Phenotypes for gene: CARMIL2 were set to Early onset paediatric inflammatory bowel disease Review for gene: CARMIL2 was set to GREEN Added comment: Bi-allelic variants in this gene are associated with immunodeficiency. Four individuals from three families reported with early onset IBD. None manifested overt clinical signs of immunodeficiency before their diagnosis. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral vascular malformations v0.23 | SETD5 | Bryony Thompson Classified gene: SETD5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral vascular malformations v0.23 | SETD5 | Bryony Thompson Gene: setd5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral vascular malformations v0.22 | CHD4 | Bryony Thompson Classified gene: CHD4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral vascular malformations v0.22 | CHD4 | Bryony Thompson Gene: chd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral vascular malformations v0.21 | ABCC6 | Bryony Thompson Marked gene: ABCC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral vascular malformations v0.21 | ABCC6 | Bryony Thompson Gene: abcc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral vascular malformations v0.21 | ABCC6 | Bryony Thompson reviewed gene: ABCC6: Rating: RED; Mode of pathogenicity: None; Publications: 16086762; Phenotypes: Moya moya disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Marked gene: PNLDC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Classified gene: PNLDC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9199 | PNLDC1 |
Zornitza Stark gene: PNLDC1 was added gene: PNLDC1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: PNLDC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PNLDC1 were set to 34347949 Phenotypes for gene: PNLDC1 were set to Spermatogenic failure 57, MIM# 619528 Review for gene: PNLDC1 was set to GREEN Added comment: Four unrelated individuals reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9198 | FOXP1 | Zornitza Stark Marked gene: FOXP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9198 | FOXP1 | Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9198 | FOXP1 | Zornitza Stark Phenotypes for gene: FOXP1 were changed from to Mental retardation with language impairment and with or without autistic features, MIM# 613670 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.88 | FOXP1 | Zornitza Stark Marked gene: FOXP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.88 | FOXP1 | Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.88 | FOXP1 | Zornitza Stark Classified gene: FOXP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.88 | FOXP1 | Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.87 | FOXP1 |
Zornitza Stark gene: FOXP1 was added gene: FOXP1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review Mode of inheritance for gene: FOXP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOXP1 were set to 27657687 Phenotypes for gene: FOXP1 were set to Mental retardation with language impairment and with or without autistic features, MIM# 613670 Review for gene: FOXP1 was set to GREEN Added comment: Well established association with syndromic ID. Multiple individuals reported with congenital anomalies of the kidneys and urinary tract in PMID 27657687. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Marked gene: ZMYM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Classified gene: ZMYM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Heart Defect v0.128 | ZMYM2 |
Zornitza Stark gene: ZMYM2 was added gene: ZMYM2 was added to Congenital Heart Defect. Sources: Expert Review Mode of inheritance for gene: ZMYM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZMYM2 were set to 32891193 Phenotypes for gene: ZMYM2 were set to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 Review for gene: ZMYM2 was set to GREEN Added comment: Connaughton et al (2020 - PMID: 32891193) report on 19 individuals (from 15 unrelated families) with heterozygous pathogenic ZMYM2 variants. Affected individuals from 7 families presented with CAKUT while all of them displayed extra-renal features. Neurological manifestations were reported in 16 individuals from 14 families (data not available for 1 fam), among others hypotonia (3/14 fam), speech delay (4/14 fam), global DD (9/14 fam), ID (4/14 fam), microcephaly (4/14 fam). ASD was reported in 4 fam (4 indiv). Seizures were reported in 2 fam (2 indiv). Variable other features included cardiac defects, facial dysmorphisms, small hands and feet with dys-/hypo-plastic nails and clinodactyly. 14 pLoF variants were identified, in most cases as de novo events (8 fam). In 2 families the variant was inherited from an affected parent. Germline mosaicism occurred in 1 family. The human disease features were recapitulated in a X. tropicalis morpholino knockdown, with expression of truncating variants failing to rescue renal and craniofacial defects. Heterozygous Zmym2-deficient mice also recapitulated the features of CAKUT. ZMYM2 (previously ZNF198) encodes a nuclear zinc finger protein localizing to the nucleus (and PML nuclear body). It has previously been identified as transcriptional corepressor interacting with nuclear receptors and the LSD1-CoREST-HDAC1 complex. It has also been shown to interact with FOXP transcription factors. The authors provide evidence for loss of interaction of the truncated ZMYM2 with FOXP1 (mutations in the latter having recently been reported in syndromic CAKUT). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9197 | ZMYM2 | Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.86 | ZMYM2 | Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.85 | ZMYM2 | Zornitza Stark reviewed gene: ZMYM2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4130 | ZMYM2 | Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4129 | ZMYM2 | Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9197 | HCN2 | Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9196 | HCN2 | Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1194 | HCN2 | Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1193 | HCN2 | Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9196 | HSCB | Zornitza Stark Marked gene: HSCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9196 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9196 | HSCB | Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9196 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9195 | HSCB |
Zornitza Stark gene: HSCB was added gene: HSCB was added to Mendeliome. Sources: Expert list Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSCB were set to 32634119 Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5, MIM# 619523 Review for gene: HSCB was set to AMBER Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v1.2 | HSCB | Zornitza Stark Marked gene: HSCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v1.2 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v1.2 | HSCB | Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v1.2 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v1.1 | HSCB |
Zornitza Stark gene: HSCB was added gene: HSCB was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSCB were set to 32634119 Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5 619523 Review for gene: HSCB was set to AMBER Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9194 | FAM57B | Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9193 | FAM57B | Zornitza Stark edited their review of gene: FAM57B: Changed phenotypes: Cone-rod dystrophy 22, MIM# 619531, Maculopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Marked gene: FAM57B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Classified gene: FAM57B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cone-rod Dystrophy v0.30 | FAM57B |
Zornitza Stark gene: FAM57B was added gene: FAM57B was added to Cone-rod Dystrophy. Sources: Expert Review new gene name tags were added to gene: FAM57B. Mode of inheritance for gene: FAM57B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM57B were set to 33077892 Phenotypes for gene: FAM57B were set to Cone-rod dystrophy 22, MIM# 619531; Maculopathy Review for gene: FAM57B was set to GREEN Added comment: 4 patients with cone-rod dystrophy or maculopathy from 3 families, with LOF pathogenic variants in TLCD3B (ceramide synthase gene). Ceramide is a proapoptotic lipid as high levels of ceramides can lead to apoptosis of neuronal cells, including photoreceptors. Variants segregated with disease. TLCD3B showed high expression in the adult retina with higher expression in the macular than in the peripheral region. Tlcd3bKO/KO mice exhibited a significant reduction of the cone photoreceptor light responses, thinning of the outer nuclear layer, and loss of cone photoreceptors across the retina. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.101 | FAM57B | Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.100 | FAM57B | Zornitza Stark reviewed gene: FAM57B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cone-rod dystrophy 22, MIM# 619531; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Neuropathy_CMT - isolated v1.8 | CADM3 | Zornitza Stark Phenotypes for gene: CADM3 were changed from Charcot-Marie-Tooth disease to Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hereditary Neuropathy_CMT - isolated v1.7 | CADM3 | Zornitza Stark reviewed gene: CADM3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9193 | CADM3 | Zornitza Stark Phenotypes for gene: CADM3 were changed from Charcot-Marie-Tooth disease to Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9192 | CADM3 | Zornitza Stark reviewed gene: CADM3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | CAMTA1 |
Zornitza Stark changed review comment from: Combination of ID with ataxia overlaps with CP. Sources: Expert list; to: Combination of ID with ataxia overlaps with CP. At least 3 families reported, intragenic deletions. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Marked gene: CAMTA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Tag SV/CNV tag was added to gene: CAMTA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Classified gene: CAMTA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.98 | CAMTA1 |
Zornitza Stark gene: CAMTA1 was added gene: CAMTA1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: CAMTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CAMTA1 were set to 22693284; 24738973 Phenotypes for gene: CAMTA1 were set to Cerebellar ataxia, nonprogressive, with mental retardation, MIM# 614756 Review for gene: CAMTA1 was set to GREEN Added comment: Combination of ID with ataxia overlaps with CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Marked gene: CACNA1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Classified gene: CACNA1A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.96 | CACNA1A |
Zornitza Stark gene: CACNA1A was added gene: CACNA1A was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: CACNA1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1A were set to 29761117 Phenotypes for gene: CACNA1A were set to Developemental and epileptic encephalopathy 42, MIM# 617106; Episodic ataxia, type 2, MIM# 108500; Migraine, familial hemiplegic, 1, MIM# 141500; Migraine, familial hemiplegic, 1, with progressive cerebellar ataxia 141500; Spinocerebellar ataxia 6, MIM# 183086 Review for gene: CACNA1A was set to AMBER Added comment: Variants in this gene cause a range of phenotypes, including hemiplegia, although this tends to be episodic. Reported in a CP cohort. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.95 | BCL11A | Zornitza Stark Marked gene: BCL11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.95 | BCL11A | Zornitza Stark Gene: bcl11a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.95 | BCL11A |
Zornitza Stark gene: BCL11A was added gene: BCL11A was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: BCL11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BCL11A were set to Dias-Logan syndrome, MIM# 617101 Review for gene: BCL11A was set to RED Added comment: Intellectual disability, microcephaly, dysmorphic features and persistence of fetal haemoglobin but no specific overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mackenzie's Mission_Reproductive Carrier Screening v0.103 | BCAP31 |
Zornitza Stark gene: BCAP31 was added gene: BCAP31 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: BCAP31 were set to 24011989; 31330203; 33603160 Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 Review for gene: BCAP31 was set to GREEN Added comment: More than 20 unrelated families reported. Clinical features include severe intellectual disability (ID), dystonia, deafness, and central hypomyelination. Female carriers are mostly asymptomatic but may present with deafness. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4129 | BCAP31 | Zornitza Stark Marked gene: BCAP31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4129 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4129 | BCAP31 | Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4128 | BCAP31 | Zornitza Stark Publications for gene: BCAP31 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4127 | BCAP31 | Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4126 | BCAP31 | Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9192 | BCAP31 | Zornitza Stark Marked gene: BCAP31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9192 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9192 | BCAP31 | Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9191 | BCAP31 | Zornitza Stark Publications for gene: BCAP31 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9190 | BCAP31 | Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9189 | BCAP31 | Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Marked gene: BCAP31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Classified gene: BCAP31 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.93 | BCAP31 |
Zornitza Stark gene: BCAP31 was added gene: BCAP31 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: BCAP31 were set to 24011989; 31330203 Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 Review for gene: BCAP31 was set to GREEN Added comment: Phenotypic overlap with CP due to combination of almost no psychomotor development with dystonia and pyramidal signs. At least one patient reported who specifically had a CP diagnosis. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Marked gene: AUTS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Classified gene: AUTS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.90 | AUTS2 |
Zornitza Stark gene: AUTS2 was added gene: AUTS2 was added to Cerebral Palsy. Sources: Expert list SV/CNV tags were added to gene: AUTS2. Mode of inheritance for gene: AUTS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AUTS2 were set to 23332918; 27075013 Phenotypes for gene: AUTS2 were set to Mental retardation, autosomal dominant 26, MIM# 615834 Review for gene: AUTS2 was set to GREEN Added comment: Multiple individuals reported with ID/autism, but 'cerebral palsy' was the original clinical diagnosis in some. Predominantly deletions reported, so may not be tractable by all NGS assays. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Marked gene: AFF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Classified gene: AFF4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pulmonary Fibrosis_Interstitial Lung Disease v0.32 | AFF4 |
Zornitza Stark gene: AFF4 was added gene: AFF4 was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Expert Review Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AFF4 were set to 31058441; 25730767 Phenotypes for gene: AFF4 were set to CHOPS syndrome, MIM# 616368 Review for gene: AFF4 was set to GREEN Added comment: Chronic interstitial lung disease is a feature of this condition. More than 15 unrelated individuals reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.89 | ATRX | Zornitza Stark Marked gene: ATRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.89 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.89 | ATRX | Zornitza Stark Classified gene: ATRX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.89 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.88 | ATRX |
Zornitza Stark gene: ATRX was added gene: ATRX was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ATRX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ATRX were set to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580 Review for gene: ATRX was set to GREEN Added comment: ID and hypotonia/hypertonia/spasticity: phenotypic overlap with CP. Well established gene-disease association. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Marked gene: ATP1A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark edited their review of gene: ATP1A3: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Classified gene: ATP1A3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.86 | ATP1A3 |
Zornitza Stark gene: ATP1A3 was added gene: ATP1A3 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ATP1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ATP1A3 were set to Alternating hemiplegia of childhood 2, MIM# 614820; CAPOS syndrome, MIM# 601338; Dystonia-12, MIM# 128235 Review for gene: ATP1A3 was set to GREEN Added comment: The disorders associated with variants in this gene tend to have episodic symptoms, insufficient overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.85 | ASXL3 | Zornitza Stark Marked gene: ASXL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.85 | ASXL3 | Zornitza Stark Gene: asxl3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.85 | ASXL3 |
Zornitza Stark gene: ASXL3 was added gene: ASXL3 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ASXL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ASXL3 were set to Bainbridge-Ropers syndrome, MIM# 615485 Review for gene: ASXL3 was set to RED Added comment: Severe neurodevelopmental disorder but no strong overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.84 | ARX | Zornitza Stark Marked gene: ARX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.84 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.84 | ARX | Zornitza Stark Classified gene: ARX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.84 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.83 | ARX |
Zornitza Stark gene: ARX was added gene: ARX was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ARX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ARX were set to Developmental and epileptic encephalopathy 1, MIM# 308350; Lissencephaly, X-linked 2, MIM# 300215; Proud syndrome, MIM# 300004 Review for gene: ARX was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap: ID/seizures/abnormal tone. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Classified gene: AMPD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4126 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4126 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4126 | AMPD2 | Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4125 | AMPD2 | Zornitza Stark Publications for gene: AMPD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4124 | AMPD2 | Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4123 | AMPD2 | Zornitza Stark reviewed gene: AMPD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23911318, 27066553; Phenotypes: Pontocerebellar hypoplasia, type 9, MIM#615809; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9189 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9189 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9189 | AMPD2 | Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9188 | AMPD2 | Zornitza Stark Publications for gene: AMPD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9187 | AMPD2 | Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9186 | AMPD2 | Zornitza Stark Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9186 | AMPD2 | Zornitza Stark edited their review of gene: AMPD2: Added comment: Well established gene-disease association. Clinical features include severely delayed psychomotor development, progressive microcephaly, spasticity, seizures, and brain abnormalities, including brain atrophy, thin corpus callosum, and delayed myelination.; Changed rating: GREEN; Changed publications: 23911318, 27066553 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.81 | AMPD2 |
Zornitza Stark gene: AMPD2 was added gene: AMPD2 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: AMPD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AMPD2 were set to 23911318; 27066553; 29761117 Phenotypes for gene: AMPD2 were set to Pontocerebellar hypoplasia, type 9, MIM# 615809 Review for gene: AMPD2 was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap: ID and spastic paraplegia. Reported in CP cohort. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Incidentalome v0.79 | Zornitza Stark removed gene:ALS2 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9186 | ALS2 | Zornitza Stark Marked gene: ALS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9186 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9186 | ALS2 | Zornitza Stark Classified gene: ALS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9186 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Marked gene: ALS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Classified gene: ALS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.79 | ALS2 |
Zornitza Stark gene: ALS2 was added gene: ALS2 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALS2 were set to 12145748; 33409823; 30128655 Phenotypes for gene: ALS2 were set to Spastic paralysis, infantile onset ascending, MIM# 607225 Review for gene: ALS2 was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Marked gene: ALDH3A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Classified gene: ALDH3A2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cerebral Palsy v0.77 | ALDH3A2 |
Zornitza Stark gene: ALDH3A2 was added gene: ALDH3A2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALDH3A2 were set to 9027499; 9829906; 28543186 Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome, MIM# 270200 Review for gene: ALDH3A2 was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap with CP: ID and spastic paraplegia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.222 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9185 | HBG2 | Zornitza Stark Marked gene: HBG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9185 | HBG2 | Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9185 | HBG2 | Zornitza Stark Phenotypes for gene: HBG2 were changed from to Fetal hemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9184 | HBG2 | Zornitza Stark Publications for gene: HBG2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9183 | HBG2 | Zornitza Stark Mode of inheritance for gene: HBG2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9182 | HBG2 | Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26500940; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.221 | HBG2 | Zornitza Stark Marked gene: HBG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.221 | HBG2 | Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.221 | HBG2 | Zornitza Stark Phenotypes for gene: HBG2 were changed from Cyanosis, transient neonatal, 613977; 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1,141749 to Fetal haemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.220 | HBG2 | Zornitza Stark Mode of inheritance for gene: HBG2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.219 | HBG2 | Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9182 | HBG1 | Zornitza Stark Marked gene: HBG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9182 | HBG1 | Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9182 | HBG1 | Zornitza Stark Classified gene: HBG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9182 | HBG1 | Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9181 | HBG1 |
Zornitza Stark gene: HBG1 was added gene: HBG1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: HBG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HBG1 were set to 26500940 Phenotypes for gene: HBG1 were set to Fetal haemoglobin quantitative trait locus 1, 141749 Review for gene: HBG1 was set to GREEN Added comment: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.219 | HBG1 | Zornitza Stark Marked gene: HBG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.219 | HBG1 | Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.219 | HBG1 | Zornitza Stark Phenotypes for gene: HBG1 were changed from 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1, 141749 to Fetal haemoglobin quantitative trait locus 1, 141749 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.218 | HBG1 | Zornitza Stark changed review comment from: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or hematologic manifestations.; to: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.218 | HBG1 | Zornitza Stark reviewed gene: HBG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal haemoglobin quantitative trait locus 1 141749; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.218 | RPS24 | Zornitza Stark Marked gene: RPS24 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.218 | RPS24 | Zornitza Stark Gene: rps24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.218 | RPS24 | Zornitza Stark Phenotypes for gene: RPS24 were changed from Inherited Bone Marrow Failure Syndromes; Diamond-blackfan anemia 3, 610629; Diamond-Blackfan Anemia 3; Diamond Blackfan anemia; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 3; Diamond_Blackfan Anemia 3; 610629 Diamond_Blackfan Anemia 3; 610629 Diamond-blackfan anemia 3 to Diamond-Blackfan anaemia 3, MIM# 610629 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.217 | RPS24 | Zornitza Stark Publications for gene: RPS24 were set to 17186470; 23812780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.216 | RPS19 | Zornitza Stark Marked gene: RPS19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.216 | RPS19 | Zornitza Stark Gene: rps19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.216 | RPS19 | Zornitza Stark Phenotypes for gene: RPS19 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 105650 Diamond-Blackfan anemia 1; 105650 Diamond_Blackfan Anemia 1; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 1; Diamond-Blackfan anemia 1, 105650; Diamond_Blackfan Anemia to Diamond-Blackfan anaemia 1, MIM# 105650; MONDO:0007110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.215 | RPS19 | Zornitza Stark Publications for gene: RPS19 were set to 9988267 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.214 | RPS17 | Zornitza Stark Marked gene: RPS17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.214 | RPS17 | Zornitza Stark Gene: rps17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.214 | RPS17 | Zornitza Stark Phenotypes for gene: RPS17 were changed from Diamond-Blackfan anemia 4, 612527; 612527 Diamond-Blackfan anemia 4 to Diamond-Blackfan anaemia 4, MIM# 612527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.213 | RPS10 | Zornitza Stark Marked gene: RPS10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.213 | RPS10 | Zornitza Stark Gene: rps10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.213 | RPS10 | Zornitza Stark Phenotypes for gene: RPS10 were changed from 613308 Diamond-Blackfan anemia 9; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; DIAMOND-BLACKFAN ANEMIA 9; Diamond-Blackfan Anemia 9; Diamond-Blackfan Anemia; Diamond-Blackfan anemia 9, 613308; 613308 Diamond_Blackfan Anemia 9; Diamond_Blackfan Anemia 9 to Diamond-Blackfan anaemia 9, MIM# 613308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.212 | RPS10 | Zornitza Stark Publications for gene: RPS10 were set to 20116044 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.211 | RPL9 | Zornitza Stark Marked gene: RPL9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.211 | RPL9 | Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.211 | RPL9 | Zornitza Stark Phenotypes for gene: RPL9 were changed from Diamond-Blackfan anemia; N/A Diamond-Blackfan anemia; ?Diamond-Blackfan anaemia to Diamond Blackfan anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.210 | RPL9 | Zornitza Stark Publications for gene: RPL9 were set to 29114930 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.209 | RPL9 | Zornitza Stark Classified gene: RPL9 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.209 | RPL9 | Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9180 | WNT9B | Zornitza Stark Marked gene: WNT9B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9180 | WNT9B | Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9180 | WNT9B | Zornitza Stark Phenotypes for gene: WNT9B were changed from to Renal agenesis/hypoplasia/dysplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9179 | WNT9B | Zornitza Stark Publications for gene: WNT9B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9178 | WNT9B | Zornitza Stark Mode of inheritance for gene: WNT9B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9177 | WNT9B | Zornitza Stark Classified gene: WNT9B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9177 | WNT9B | Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9176 | WNT9B | Zornitza Stark reviewed gene: WNT9B: Rating: AMBER; Mode of pathogenicity: None; Publications: 34145744; Phenotypes: Renal agenesis/hypoplasia/dysplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.89 | WNT9B | Zornitza Stark Marked gene: WNT9B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.89 | WNT9B | Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.89 | WNT9B | Zornitza Stark Classified gene: WNT9B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.89 | WNT9B | Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9176 | DDX23 | Zornitza Stark Marked gene: DDX23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9176 | DDX23 | Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9176 | DDX23 | Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9175 | DDX23 | Zornitza Stark Publications for gene: DDX23 were set to 33057194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9174 | DDX23 | Zornitza Stark Classified gene: DDX23 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9174 | DDX23 | Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9173 | DDX23 | Zornitza Stark reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: 34050707; Phenotypes: DDX23-associated neurodevelopmental disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4123 | DDX23 | Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4122 | DDX23 | Zornitza Stark Publications for gene: DDX23 were set to 33057194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.17 | CHD7 | Belinda Chong edited their review of gene: CHD7: Changed publications: PMID: 29152903, PMID: 30733481 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary hormone deficiency v0.17 | CHD7 | Belinda Chong reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29152903, 30733481; Phenotypes: CHARGE syndrome MIM# 214800, Hypogonadotropic hypogonadism 5 with or without anosmia MIM# 612370; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9173 | TAF2 | Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204; 24084144 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9172 | TAF2 | Zornitza Stark Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9172 | TAF2 | Zornitza Stark Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9171 | TAF2 | Zornitza Stark edited their review of gene: TAF2: Added comment: New report of 4 individuals from 2 unrelated families, with severe intellectual disability, global developmental delay, postnatal microcephaly, feet deformities and thin corpus callosum. They had homozygous TAF2 missense variants detected by Exome Sequencing.; Changed rating: GREEN; Changed publications: 21937992, 22633631, 26350204, 24084144, 34474177 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.52 | TAF2 | Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4121 | TAF2 | Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Marked gene: ERGIC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Classified gene: ERGIC1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9170 | ERGIC1 |
Zornitza Stark gene: ERGIC1 was added gene: ERGIC1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERGIC1 were set to 28317099; 34037256 Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100 Review for gene: ERGIC1 was set to AMBER Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi. Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.296 | ERGIC1 | Zornitza Stark Marked gene: ERGIC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.296 | ERGIC1 | Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9169 | HMGB1 | Zornitza Stark Phenotypes for gene: HMGB1 were changed from Mirror image foot polydactyly to Mirror image foot polydactyly; Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9168 | HMGB1 | Zornitza Stark Publications for gene: HMGB1 were set to 34159400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | Zornitza Stark Marked gene: HMGB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.51 | HMGB1 | Zornitza Stark Marked gene: HMGB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.51 | HMGB1 | Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | SGCE | Anna Le Fevre reviewed gene: SGCE: Rating: GREEN; Mode of pathogenicity: None; Publications: 11528394, 12325078, 17200151, 16227522, 20301587, 33200041; Phenotypes: myoclonus, dystonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9167 | HMGB1 | Chirag Patel reviewed gene: HMGB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34164801; Phenotypes: Developmental delay and microcephaly, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9167 | HMGB1 | Chirag Patel Classified gene: HMGB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9167 | HMGB1 | Chirag Patel Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.51 | HMGB1 | Chirag Patel Phenotypes for gene: HMGB1 were changed from Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.51 | HMGB1 | Chirag Patel Phenotypes for gene: HMGB1 were changed from 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.50 | HMGB1 | Chirag Patel edited their review of gene: HMGB1: Changed phenotypes: Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.50 | HMGB1 | Chirag Patel Classified gene: HMGB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.50 | HMGB1 | Chirag Patel Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.49 | HMGB1 |
Chirag Patel gene: HMGB1 was added gene: HMGB1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HMGB1 were set to PMID: 34164801 Phenotypes for gene: HMGB1 were set to 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM # Review for gene: HMGB1 was set to GREEN Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | Chirag Patel Classified gene: HMGB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | Chirag Patel Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4119 | HMGB1 |
Chirag Patel gene: HMGB1 was added gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HMGB1 were set to PMID: 34164801 Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM # Review for gene: HMGB1 was set to GREEN Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.296 | ERGIC1 | Chirag Patel Classified gene: ERGIC1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.296 | ERGIC1 | Chirag Patel Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.295 | ERGIC1 |
Chirag Patel gene: ERGIC1 was added gene: ERGIC1 was added to Arthrogryposis. Sources: Literature Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERGIC1 were set to PMID: 28317099, 34037256 Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100 Review for gene: ERGIC1 was set to AMBER Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi. Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | UBE3A | Anna Le Fevre reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 8988171, 16470747; Phenotypes: Angelman syndrome OMIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.48 | TAF2 | Chirag Patel Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.48 | TAF2 | Chirag Patel Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.47 | TAF2 | Chirag Patel Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.47 | TAF2 | Chirag Patel Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4118 | TAF2 | Chirag Patel Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4118 | TAF2 | Chirag Patel Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | ZFP57 | Anna Le Fevre reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393, 27075368, 23150280, 30315371, 31399135, 33053156; Phenotypes: Transient Neonatal Diabetes Mellitus Type 1, Multi Locus Imprinting Disturbance, IUGR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.46 | TAF2 | Chirag Patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4117 | TAF2 | Chirag Patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | Chirag Patel Classified gene: DDX23 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | Chirag Patel Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | Chirag Patel Classified gene: DDX23 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | Chirag Patel Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4116 | DDX23 | Chirag Patel reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34050707; Phenotypes: Neurodevelopmental disorder, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.88 | WNT9B |
Chirag Patel gene: WNT9B was added gene: WNT9B was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic. Sources: Literature Mode of inheritance for gene: WNT9B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WNT9B were set to PMID: 34145744 Phenotypes for gene: WNT9B were set to Renal agenesis/hypoplasia/dysplasia, no OMIM # Review for gene: WNT9B was set to AMBER Added comment: WNT9B plays a key role in the development of the mammalian urogenital system. It is essential for the induction of mesonephric and metanephric tubules, the regulation of renal tubule morphogenesis, and the regulation of renal progenitor cell expansion and differentiation. WNT9B−/− mice have renal agenesis/hypoplasia and reproductive tract abnormalities. Lemire et al. (2021) report 4 individuals from 2 unrelated consanguineous families with bilateral renal agenesis/hypoplasia/dysplasia and homozygous variants in WNT9B. The proband from Family 1 had bilateral renal cystic dysplasia and chronic kidney disease, with 2 deceased siblings with bilateral renal hypoplasia/agenesis. The 3 affected family members were homozygous for a Gly317Arg missense variant in WNT9B. Proband from Family 2 had renal hypoplasia/dysplasia, chronic kidney disease, and was homozygous for a Pro5Alafs*52 nonsense variant in WNT9B. The proband's unaffected brother is also homozygous for the nonsense variant in WNT9B, suggesting nonpenetrance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.208 | RPL5 | Zornitza Stark Marked gene: RPL5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.208 | RPL5 | Zornitza Stark Gene: rpl5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.208 | RPL5 | Zornitza Stark Phenotypes for gene: RPL5 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 612561 Diamond-Blackfan anemia 6; Diamond-Blackfan anemia 6, 612561; Diamond-Blackfan Anemia 6; 612561 Diamond_Blackfan Anemia 6; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 6; Diamond_Blackfan Anemia 6 to Diamond-Blackfan anemia 6, MIM# 612561; MONDO:0012937 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.207 | RPL35A | Zornitza Stark Marked gene: RPL35A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.207 | RPL35A | Zornitza Stark Gene: rpl35a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.207 | RPL35A | Zornitza Stark Phenotypes for gene: RPL35A were changed from Inherited Bone Marrow Failure Syndromes; DIAMOND-BLACKFAN ANEMIA 5; Diamond-Blackfan anemia 5, 612528; 612528 Diamond-Blackfan anemia 5; Diamond Blackfan anemia; Diamond-Blackfan Anemia; Diamond-Blackfan Anemia 5; 612528 Diamond_Blackfan Anemia 5; Diamond_Blackfan Anemia 5 to Diamond-Blackfan anaemia 5, MIM# 612528 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.206 | RPL35A | Zornitza Stark Publications for gene: RPL35A were set to 18535205 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.205 | RPL35A | Zornitza Stark Tag SV/CNV tag was added to gene: RPL35A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.205 | RPL31 | Zornitza Stark Marked gene: RPL31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.205 | RPL31 | Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.205 | RPL31 | Zornitza Stark Phenotypes for gene: RPL31 were changed from N/A ? Diamond-Blackfan Anaemia to Diamond Blackfan anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.204 | RPL31 | Zornitza Stark Classified gene: RPL31 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.204 | RPL31 | Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.203 | RPL27 | Zornitza Stark Marked gene: RPL27 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.203 | RPL27 | Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.203 | RPL27 | Zornitza Stark Phenotypes for gene: RPL27 were changed from Diamond-Blackfan anemia; Diamond-Blackfan anemia 16, 617408 to Diamond-Blackfan anemia 16, MIM# 617408 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.202 | RPL27 | Zornitza Stark Classified gene: RPL27 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.202 | RPL27 | Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Marked gene: POLR1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Added comment: Comment when marking as ready: Four adults from three families reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Publications for gene: POLR1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - adult onset v0.91 | POLR1C | Zornitza Stark Classified gene: POLR1C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - adult onset v0.91 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9166 | FCGR2B | Zornitza Stark Marked gene: FCGR2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9166 | FCGR2B | Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9166 | FCGR2B | Zornitza Stark Phenotypes for gene: FCGR2B were changed from to {Systemic lupus erythematosus, susceptibility to} MIM#152700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9165 | FCGR2B | Zornitza Stark Publications for gene: FCGR2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9164 | FCGR2B | Zornitza Stark Mode of inheritance for gene: FCGR2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9163 | FCGR2B | Zornitza Stark Classified gene: FCGR2B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9163 | FCGR2B | Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.201 | RPS26 | Zornitza Stark Marked gene: RPS26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.201 | RPS26 | Zornitza Stark Gene: rps26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.201 | RPS26 | Zornitza Stark Phenotypes for gene: RPS26 were changed from Diamond-Blackfan anemia 10, 613309; Inherited Bone Marrow Failure Syndromes; Diamond-Blackfan anemia 10; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 613309 Diamond_Blackfan Anemia 10; Diamond_Blackfan Anemia 10; 613309 Diamond-Blackfan anemia 10 to Diamond-Blackfan anemia 10, MIM# 613309; MONDO:0013217 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.200 | RPS27 | Zornitza Stark Marked gene: RPS27 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.200 | RPS27 | Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.200 | RPS27 | Zornitza Stark Phenotypes for gene: RPS27 were changed from Diamond-Blackfan anemia; ?Diamond-Blackfan anemia 17, 617409; 617409 ?Diamond-Blackfan anemia 17, to Diamond-Blackfan anemia 17, MIM# 617409 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.199 | RPS27 | Zornitza Stark Publications for gene: RPS27 were set to 25424902; 23718193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.198 | RPS27 | Zornitza Stark Classified gene: RPS27 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.198 | RPS27 | Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.197 | RPS29 | Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, MIM# 615909 to Diamond-Blackfan anaemia 13, MIM# 615909 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.196 | RPS29 | Zornitza Stark Marked gene: RPS29 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.196 | RPS29 | Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.196 | RPS29 | Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, 615909; 615909 Diamond-Blackfan anemia 13 to Diamond-Blackfan anemia 13, MIM# 615909 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.195 | RPS29 | Zornitza Stark Classified gene: RPS29 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.195 | RPS29 | Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.194 | RPS7 | Zornitza Stark Marked gene: RPS7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.194 | RPS7 | Zornitza Stark Gene: rps7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.194 | RPS7 | Zornitza Stark Phenotypes for gene: RPS7 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan anemia 8, 612563; 612563 Diamond_Blackfan Anemia 8; DIAMOND-BLACKFAN ANEMIA 8; Diamond-Blackfan Anemia; 612563 Diamond-Blackfan anemia 8; Diamond_Blackfan Anemia 8 to Diamond-Blackfan anaemia 8, MIM# 612563; MONDO:0012939 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.193 | RPS7 | Zornitza Stark Publications for gene: RPS7 were set to 19061985; 27882484; 23718193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.192 | SBDS | Zornitza Stark Marked gene: SBDS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.192 | SBDS | Zornitza Stark Gene: sbds has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.192 | SBDS | Zornitza Stark Phenotypes for gene: SBDS were changed from 260400 Shwachman-Diamond syndrome; Shwachman-Diamond syndrome to Shwachman-Diamond syndrome, MIM# 260400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.191 | SEC23B | Zornitza Stark Marked gene: SEC23B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.191 | SEC23B | Zornitza Stark Gene: sec23b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.191 | SEC23B | Zornitza Stark Phenotypes for gene: SEC23B were changed from Congenital Dyserythropoietic Anemia; ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; 224100 ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; Anemia, dyserythropoieticcongenital, type II, 224100; Congenital dyserythropoietic anemia type II; 224100 Congenital dyserythropoietic anaemia type 2 to Dyserythropoietic anaemia, congenital, type II , MIM#224100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.190 | SEC23B | Zornitza Stark Publications for gene: SEC23B were set to 19561605 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.189 | SLC19A2 | Zornitza Stark Marked gene: SLC19A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.189 | SLC19A2 | Zornitza Stark Gene: slc19a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.189 | SLC19A2 | Zornitza Stark Phenotypes for gene: SLC19A2 were changed from 249270 Thiamine-Responsive Megaloblastic Anemia syndrome; Thiamine-Responsive Megaloblastic Anemia syndrome, 249270; 249270 Thiamine-responsive megaloblastic anemia syndrome to Thiamine-responsive megaloblastic anaemia syndrome, MIM# 249270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.188 | SLC25A38 | Zornitza Stark Marked gene: SLC25A38 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.188 | SLC25A38 | Zornitza Stark Gene: slc25a38 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.188 | SLC25A38 | Zornitza Stark Phenotypes for gene: SLC25A38 were changed from Anemia, sideroblastic, 2, pyridoxine-refractory, 205950; 205950 Pyridoxine refractory sideroblastic anaemia 2; 205950 Anemia, sideroblastic, 2, pyridoxine-refractory to Anaemia, sideroblastic, 2, pyridoxine-refractory, MIM# 205950 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.187 | XK | Zornitza Stark Marked gene: XK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.187 | XK | Zornitza Stark Gene: xk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.187 | XK | Zornitza Stark Phenotypes for gene: XK were changed from 300842 McLeod syndrome to McLeod syndrome with or without chronic granulomatous disease MIM# 300842; absence of red blood cell Kx antigen; weak expression of Kell red blood cell antigens; neuroacanthocytosis (peripheral and central nervous systems); cardiovascular abnormalities; myopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.186 | XK | Zornitza Stark Publications for gene: XK were set to 17683354; 11761473 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.185 | NHP2 | Zornitza Stark Marked gene: NHP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.185 | NHP2 | Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.185 | NHP2 | Zornitza Stark Phenotypes for gene: NHP2 were changed from 613987 Dyskeratosis congenita, autosomal recessive 2 to Dyskeratosis congenita, autosomal recessive 2, MIM# 613987 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.184 | NHP2 | Zornitza Stark Publications for gene: NHP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.183 | NHP2 | Zornitza Stark Classified gene: NHP2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.183 | NHP2 | Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.182 | NHP2 | Zornitza Stark changed review comment from: Dyskeratosis congenita is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features. Three unrelated families reported.; to: Pancytopaenia. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.182 | NHP2 | Zornitza Stark edited their review of gene: NHP2: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.182 | RPL18 | Zornitza Stark Marked gene: RPL18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.182 | RPL18 | Zornitza Stark Gene: rpl18 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.182 | RPL18 | Zornitza Stark Phenotypes for gene: RPL18 were changed from Diamond-Blackfan anaemia to Diamond-Blackfan anemia 18, MIM# 618310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.181 | RPL18 | Zornitza Stark Publications for gene: RPL18 were set to 28280134 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.180 | RPS28 | Zornitza Stark Marked gene: RPS28 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.180 | RPS28 | Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.180 | RPS28 | Zornitza Stark Phenotypes for gene: RPS28 were changed from Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 to Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.179 | RPS28 | Zornitza Stark Phenotypes for gene: RPS28 were changed from 606164 Diamond Blackfan anemia 15 with mandibulofacial dysostosis; Diamond Blackfan anemia 15 with mandibulofacial dysostosis, 606164 to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.178 | TSR2 | Zornitza Stark Marked gene: TSR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.178 | TSR2 | Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.178 | TSR2 | Zornitza Stark Phenotypes for gene: TSR2 were changed from 300946 ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis; ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, 300946 to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.177 | TSR2 | Zornitza Stark Classified gene: TSR2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.177 | TSR2 | Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.176 | ATRX | Zornitza Stark Marked gene: ATRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.176 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.176 | ATRX | Zornitza Stark Phenotypes for gene: ATRX were changed from 301040 Alpha-thalassemia/mental retardation syndrome to Alpha-thalassaemia/mental retardation syndrome, MIM# 301040 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.175 | ATRX | Zornitza Stark Publications for gene: ATRX were set to 19444090; 17579672; 11449489 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.174 | ATRX | Zornitza Stark Mode of inheritance for gene: ATRX was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.173 | ATRX | Zornitza Stark Classified gene: ATRX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.173 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.172 | ATRX | Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 7697714; Phenotypes: Alpha-thalassaemia/mental retardation syndrome, MIM# 301040; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.172 | DKC1 | Zornitza Stark Marked gene: DKC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.172 | DKC1 | Zornitza Stark Gene: dkc1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.172 | DKC1 | Zornitza Stark Phenotypes for gene: DKC1 were changed from 305000 Dyskeratosis congenita, X-linked to Dyskeratosis congenita, X-linked 305000; Hoyeraal-Hreidarsson Syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.171 | DKC1 | Zornitza Stark Publications for gene: DKC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.170 | DKC1 |
Zornitza Stark changed review comment from: Dyskeratosis congenita is classically defined by the triad of abnormal skin pigmentation, nail dystrophy, and leukoplakia of the oral mucosa. It is characterized by short telomeres. Progressive bone marrow failure occurs in over 80% of cases and is the main cause of early mortality. The phenotype is highly variable, and affected individuals may have multiple additional features, including pulmonary fibrosis, liver cirrhosis, premature hair loss and/or graying, osteoporosis, atresia of the lacrimal ducts, and learning difficulties. Males may have testicular atrophy. Predisposition to malignancy is an important feature. Hoyeraal-Hreidarsson syndrome (HHS) refers to a clinically severe variant of DKC that is characterized by multisystem involvement and early onset in utero. Patients with HHS show intrauterine growth retardation, microcephaly, delayed development, and bone marrow failure resulting in immunodeficiency, cerebellar hypoplasia, and sometimes enteropathy. Death often occurs in childhood. PMID: 25940403, at least 13 of the variants associated with dyskeratosis congenita were also reported to cause HHS: P10L, I38T, T66A, T67I, H68Q, H68Y, S121G, R158W, K314R, A353V, R378Q, A386T and IVS12+1, so NOT only variants in exon 11. Two mutations were only found in HH, T49M and S304N.; to: Pancytopaenia rather than a red cell disorder. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.170 | DKC1 | Zornitza Stark edited their review of gene: DKC1: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.170 | Zornitza Stark removed gene:HBE1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.169 | SF3B1 | Zornitza Stark Marked gene: SF3B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.169 | SF3B1 | Zornitza Stark Gene: sf3b1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.169 | SF3B1 | Zornitza Stark Phenotypes for gene: SF3B1 were changed from 605590 Refractory anaemia with ring sideroblasts to Myelodysplastic syndrome, somatic MIM# 614286 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.168 | SF3B1 | Zornitza Stark Mode of inheritance for gene: SF3B1 was changed from Unknown to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.167 | SF3B1 | Zornitza Stark Tag somatic tag was added to gene: SF3B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9162 | FCGR2B | Paul De Fazio reviewed gene: FCGR2B: Rating: RED; Mode of pathogenicity: None; Publications: 12115230, 15153543, 20385827; Phenotypes: {Systemic lupus erythematosus, susceptibility to} MIM#152700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9162 | GPX1 | Zornitza Stark Marked gene: GPX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9162 | GPX1 | Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9162 | GPX1 |
Zornitza Stark gene: GPX1 was added gene: GPX1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: GPX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GPX1 were set to 1131421; 476008; 5766310; 2492138 Phenotypes for gene: GPX1 were set to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164 Review for gene: GPX1 was set to RED Added comment: No individuals reported with GPX1 variants identified as the cause of Haemolytic anaemia due to glutathione peroxidase deficiency. Multiple papers report a number of cases of Haemolytic anaemia due to glutathione peroxidase deficiency, however there is no defined link or variant to GPX1 (PMID: 5766310. PMID: 1131421, PMID: 2492138, PMID: 476008) Overall, lowered glutathione peroxidase activity has been observed in a number of individuals with haemolytic anaemia however the evidence for a cause-and-effect relationship between the enzyme deficiency and the presenting anaemia is not evident. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.167 | GPX1 | Zornitza Stark Marked gene: GPX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.167 | GPX1 | Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.167 | GPX1 | Zornitza Stark Phenotypes for gene: GPX1 were changed from 614164 Hemolytic anemia due to glutathione peroxidase deficiency to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.166 | GPX1 | Zornitza Stark Publications for gene: GPX1 were set to 1131421 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9161 | CYP51A1 | Bryony Thompson Mode of inheritance for gene: CYP51A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9160 | CYP51A1 | Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.289 | CYP51A1 | Bryony Thompson Phenotypes for gene: CYP51A1 were changed from to Congenital cataract; infantile liver disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.288 | CYP51A1 | Bryony Thompson Publications for gene: CYP51A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.287 | CYP51A1 | Bryony Thompson Marked gene: CYP51A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.287 | CYP51A1 | Bryony Thompson Gene: cyp51a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.287 | CYP51A1 | Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9160 | CYB5A | Zornitza Stark Marked gene: CYB5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9160 | CYB5A | Zornitza Stark Gene: cyb5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9160 | CYB5A | Zornitza Stark Phenotypes for gene: CYB5A were changed from to Methemoglobinaemia and ambiguous genitalia, MIM# 250790 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9159 | CYB5A | Zornitza Stark Publications for gene: CYB5A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9158 | CYB5A | Zornitza Stark Mode of inheritance for gene: CYB5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9157 | CYB5A | Zornitza Stark reviewed gene: CYB5A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22170710, 32051920; Phenotypes: Methemoglobinemia and ambiguous genitalia 250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.165 | CYB5A | Zornitza Stark Marked gene: CYB5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.165 | CYB5A | Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.165 | CYB5A | Zornitza Stark Phenotypes for gene: CYB5A were changed from 250790 Methemoglobinemia and ambiguous genitalia to Methemoglobinaemia and ambiguous genitalia MIM#250790 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.164 | CYB5A | Zornitza Stark Publications for gene: CYB5A were set to 8168836; 20080843 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.163 | CYB5A | Zornitza Stark Classified gene: CYB5A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.163 | CYB5A | Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.162 | FTCD | Zornitza Stark Marked gene: FTCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.162 | FTCD | Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.162 | FTCD | Zornitza Stark Phenotypes for gene: FTCD were changed from 229100 Glutamate formiminotransferase deficiency to Glutamate formiminotransferase deficiency MIM# 229100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.161 | FTCD | Zornitza Stark Publications for gene: FTCD were set to 12815595 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.160 | FTCD | Zornitza Stark Classified gene: FTCD as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.160 | FTCD | Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.159 | GPX1 | Danielle Ariti reviewed gene: GPX1: Rating: RED; Mode of pathogenicity: None; Publications: 1131421, 476008, 5766310, 2492138; Phenotypes: Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.159 | SH2B3 | Zornitza Stark Marked gene: SH2B3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.159 | SH2B3 | Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.159 | SH2B3 | Zornitza Stark Classified gene: SH2B3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.159 | SH2B3 | Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.158 | SH2B3 |
Zornitza Stark gene: SH2B3 was added gene: SH2B3 was added to Red cell disorders. Sources: Expert Review somatic tags were added to gene: SH2B3. Mode of inheritance for gene: SH2B3 was set to Other Publications for gene: SH2B3 were set to 34349782; 23812944; 20843259 Phenotypes for gene: SH2B3 were set to Erythrocytosis, somatic, MIM# 133100 Mode of pathogenicity for gene: SH2B3 was set to Other Review for gene: SH2B3 was set to AMBER Added comment: Limited reports, variants appear to be somatic. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.157 | JAK2 | Zornitza Stark Marked gene: JAK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.157 | JAK2 | Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.157 | JAK2 | Zornitza Stark Classified gene: JAK2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.157 | JAK2 | Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.156 | JAK2 |
Zornitza Stark gene: JAK2 was added gene: JAK2 was added to Red cell disorders. Sources: Expert Review somatic tags were added to gene: JAK2. Mode of inheritance for gene: JAK2 was set to Other Publications for gene: JAK2 were set to 27389715 Phenotypes for gene: JAK2 were set to Erythrocytosis, somatic, 133100 Mode of pathogenicity for gene: JAK2 was set to Other Review for gene: JAK2 was set to AMBER Added comment: There is limited evidence to support an association of JAK2 variants with hereditary/congenital erythrocytosis. Typically, variants are somatic/acquired; and to date, only one report has described a patient with germline compound het variants (p.E846D and p.R1063H) in JAK2, who exhibited polyclonal erythrocytosis and megakaryocytic atypia but normal platelet number (PMID:27389715). GoF somatic variants in this gene are also associated with polycythaemia vera (PV), particularly p.V617F, but also with reports of some familial clustering due to inheritance of the JAK2 46/1 predisposition haplotype. Amber rating due to the somatic nature of variants. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.155 | VHL | Zornitza Stark Marked gene: VHL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.155 | VHL | Zornitza Stark Gene: vhl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.155 | VHL | Zornitza Stark Classified gene: VHL as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.155 | VHL | Zornitza Stark Gene: vhl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.154 | VHL |
Zornitza Stark gene: VHL was added gene: VHL was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: VHL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VHL were set to 12844285; 21454469; 24729484; 23403324 Phenotypes for gene: VHL were set to Erythrocytosis, familial, 2, MIM# 263400 Mode of pathogenicity for gene: VHL was set to Other Review for gene: VHL was set to GREEN Added comment: Well established gene-disease association. Bi-allelic missense variants, postulated to be hypomorphic. Note mono-allelic variants associated with Von Hippel Lindau syndrome. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.153 | SF3B1 | Danielle Ariti reviewed gene: SF3B1: Rating: RED; Mode of pathogenicity: Other; Publications: 21995386, 21909114; Phenotypes: Myelodysplastic syndrome, somatic MIM# 614286; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.153 | CYB5A | Danielle Ariti reviewed gene: CYB5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 22170710, 20080843, 32051920, 3951505; Phenotypes: Methemoglobinaemia and ambiguous genitalia MIM#250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.153 | EPOR | Zornitza Stark Marked gene: EPOR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.153 | EPOR | Zornitza Stark Gene: epor has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.153 | EPOR | Zornitza Stark Classified gene: EPOR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.153 | EPOR | Zornitza Stark Gene: epor has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.152 | EPOR |
Zornitza Stark gene: EPOR was added gene: EPOR was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EPOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPOR were set to 8506290; 9292543; 30507031; 33061762 Phenotypes for gene: EPOR were set to [Erythrocytosis, familial, 1], MIM# 133100 Review for gene: EPOR was set to GREEN Added comment: Well established gene-disease association. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.151 | FTCD | Danielle Ariti reviewed gene: FTCD: Rating: AMBER; Mode of pathogenicity: None; Publications: 29178637, 30740726, 5301410; Phenotypes: Glutamate formiminotransferase deficiency MIM# 229100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 | ALOX12B | Zornitza Stark Marked gene: ALOX12B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 | ALOX12B | Zornitza Stark Gene: alox12b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 | ALOX12B | Zornitza Stark Phenotypes for gene: ALOX12B were changed from to Ichthyosis, congenital, autosomal recessive 2, MIM# 242100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.106 | ALOX12B | Zornitza Stark Mode of inheritance for gene: ALOX12B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | ALOX12B | Zornitza Stark reviewed gene: ALOX12B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, congenital, autosomal recessive 2, MIM# 242100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9157 | COL14A1 | Zornitza Stark Marked gene: COL14A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9157 | COL14A1 | Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9157 | COL14A1 |
Zornitza Stark gene: COL14A1 was added gene: COL14A1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: COL14A1 were set to 22972947 Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B Review for gene: COL14A1 was set to RED Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | COL14A1 | Zornitza Stark Marked gene: COL14A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | COL14A1 | Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | SMARCAD1 | Zornitza Stark Phenotypes for gene: SMARCAD1 were changed from Basan syndrome (MIM#129200) to Basan syndrome, MIM#129200; Huriez syndrome, OMIM #181600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 | NLRP1 | Zornitza Stark Marked gene: NLRP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 | NLRP1 | Zornitza Stark Gene: nlrp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 | Chirag Patel Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.103 | NLRP1 | Chirag Patel Classified gene: NLRP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.103 | NLRP1 | Chirag Patel Gene: nlrp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.102 | NLRP1 |
Chirag Patel gene: NLRP1 was added gene: NLRP1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature Mode of inheritance for gene: NLRP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NLRP1 were set to PMID: 27662089 Phenotypes for gene: NLRP1 were set to Palmoplantar carcinoma, multiple self-healing, OMIM # 615225 Review for gene: NLRP1 was set to GREEN Added comment: Multiple self-healing palmoplantar carcinoma (MSPC) is characterised by recurrent keratoacanthomas in palmoplantar skin and conjunctival and corneal epithelia. Patients experience a high susceptibility to malignant squamous cell carcinoma. Zhong et al. (2016) reported 3 families with variants in NLRP1 a) Affected mother and son with MSPC from a Caucasian French family. Whole exome sequencing (+ Sanger sequencing) identified a heterozygous missense mutation in NLRP1 gene (M77T), that appeared de novo in the mother and segregated with disease in the family. The variant was not found in 672 controls or 61 exome-sequenced subjects' DNA. b) Large 5-generation Tunisian family segregating autosomal dominant MSPC. Whole exome sequencing identified a heterozygous missense mutation in exon 1 of NLRP1 gene (A54T), that segregated with disease in 16 family members. c) 4-generation kindred with MSPC. Sanger sequencing of NLRP1 exon 1 identified heterozygosity for a missense mutation (A66V, that segregated with disease in the family. d) 2 sibs in a consanguineous family with features of MSPC, with homozygous in-frame deletion in NLRP1 gene. Functional analysis demonstrated that all 3 MSPC-associated missense mutations are gain-of-function variants that cause increased inflammasome activation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.101 | SMARCAD1 | Chirag Patel Classified gene: SMARCAD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.101 | SMARCAD1 | Chirag Patel Gene: smarcad1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.100 | SMARCAD1 | Chirag Patel reviewed gene: SMARCAD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29409814; Phenotypes: Huriez syndrome, OMIM #181600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Palmoplantar Keratoderma and Erythrokeratoderma v0.100 | COL14A1 |
Chirag Patel gene: COL14A1 was added gene: COL14A1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: COL14A1 were set to PMID: 22972947 Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B Review for gene: COL14A1 was set to RED Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.151 | EPO | Zornitza Stark Marked gene: EPO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.151 | EPO | Zornitza Stark Gene: epo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.151 | EPO | Zornitza Stark Classified gene: EPO as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.151 | EPO | Zornitza Stark Gene: epo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.150 | EPO |
Zornitza Stark gene: EPO was added gene: EPO was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPO were set to 27651169; 29514032; 32130275; 20700488; 30507031; 28283061 Phenotypes for gene: EPO were set to Erythrocytosis, familial, 5, MIM# 617907; Diamond-Blackfan anaemia-like, MIM# 617911 Review for gene: EPO was set to GREEN Added comment: More than 5 unrelated families reported, though note one paper has been retracted. Single family with bi-allelic variants and a DBA phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.149 | EPAS1 | Zornitza Stark Marked gene: EPAS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.149 | EPAS1 | Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.149 | EPAS1 | Zornitza Stark Classified gene: EPAS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.149 | EPAS1 | Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.148 | EPAS1 |
Zornitza Stark gene: EPAS1 was added gene: EPAS1 was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EPAS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPAS1 were set to 18184961; 18378852; 22367913; 18650473 Phenotypes for gene: EPAS1 were set to Erythrocytosis, familial, 4, MIM# 611783 Mode of pathogenicity for gene: EPAS1 was set to Other Review for gene: EPAS1 was set to GREEN Added comment: Most mutations are gain-of-function missense variants in exon 12, but variants in exon 9 have also been described, in association with paraganglioma. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9156 | EGLN1 | Zornitza Stark Marked gene: EGLN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9156 | EGLN1 | Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9156 | EGLN1 | Zornitza Stark Phenotypes for gene: EGLN1 were changed from to Erythrocytosis, familial, 3, MIM# 609820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9155 | EGLN1 | Zornitza Stark Publications for gene: EGLN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9154 | EGLN1 | Zornitza Stark Mode of inheritance for gene: EGLN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9153 | EGLN1 | Zornitza Stark reviewed gene: EGLN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19092153, 16407130, 17579185; Phenotypes: Erythrocytosis, familial, 3, MIM# 609820; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.147 | EGLN1 | Zornitza Stark Marked gene: EGLN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.147 | EGLN1 | Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.147 | EGLN1 | Zornitza Stark Classified gene: EGLN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.147 | EGLN1 | Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.146 | EGLN1 |
Zornitza Stark gene: EGLN1 was added gene: EGLN1 was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EGLN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EGLN1 were set to 19092153; 16407130; 17579185 Phenotypes for gene: EGLN1 were set to Erythrocytosis, familial, 3, MIM# 609820 Review for gene: EGLN1 was set to GREEN Added comment: At least 3 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.145 | BPGM | Zornitza Stark Marked gene: BPGM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.145 | BPGM | Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.145 | BPGM | Zornitza Stark Classified gene: BPGM as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.145 | BPGM | Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.144 | BPGM |
Zornitza Stark gene: BPGM was added gene: BPGM was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: BPGM was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: BPGM were set to 1421379; 27651169; 25015942 Phenotypes for gene: BPGM were set to Erythrocytosis, familial, 8, MIM# 222800 Review for gene: BPGM was set to AMBER Added comment: Mixture of mono-allelic and bi-allelic variants reported, MOI uncertain. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Holoprosencephaly and septo-optic dysplasia v1.2 | RAD21 | Zornitza Stark Publications for gene: RAD21 were set to 31334757 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Holoprosencephaly and septo-optic dysplasia v1.1 | RAD21 | Arina Puzriakova reviewed gene: RAD21: Rating: ; Mode of pathogenicity: None; Publications: 32696056; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9153 | FGFR2 | Zornitza Stark Marked gene: FGFR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9153 | FGFR2 | Zornitza Stark Gene: fgfr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9153 | FGFR2 | Zornitza Stark Phenotypes for gene: FGFR2 were changed from to Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis,MIM# 207410; Apert syndrome, MIM# 101200; Beare-Stevenson cutis gyrata syndrome, MIM# 123790; Bent bone dysplasia syndrome, MIM# 614592; Craniofacial-skeletal-dermatologic dysplasia, MIM# 101600; Craniosynostosis, nonspecific; Crouzon syndrome , MIM#123500; Jackson-Weiss syndrome,MIM# 123150; LADD syndrome, MIM# 149730; Pfeiffer syndrome,MIM# 101600; Saethre-Chotzen syndrome 101400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9152 | FGFR2 | Zornitza Stark Publications for gene: FGFR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9151 | FGFR2 | Zornitza Stark Mode of inheritance for gene: FGFR2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9150 | SLC4A1 | Zornitza Stark Marked gene: SLC4A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9150 | SLC4A1 | Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9150 | SLC4A1 | Zornitza Stark Phenotypes for gene: SLC4A1 were changed from to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653; Distal renal tubular acidosis 1 MIM# 179800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9149 | SLC4A1 | Zornitza Stark Publications for gene: SLC4A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9148 | SLC4A1 | Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leukodystrophy - adult onset v0.90 | POLR1C | Ain Roesley reviewed gene: POLR1C: Rating: AMBER; Mode of pathogenicity: None; Publications: 33190326, 34484918; Phenotypes: Leukodystrophy, hypomyelinating, 11, MIM# 616494; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9147 | FGFR2 | Chern Lim reviewed gene: FGFR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29848297, 32879300, 27323706; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9147 | SLC4A1 | Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 7949112, 8640229, 16227998, 8640229, 16227998, 33881640, 32632909; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653, Distal renal tubular acidosis 1 MIM# 179800; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.143 | TRNT1 | Zornitza Stark Marked gene: TRNT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.143 | TRNT1 | Zornitza Stark Gene: trnt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.143 | TRNT1 | Zornitza Stark Phenotypes for gene: TRNT1 were changed from sideroblastic anaemia; 616084 Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay to Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.142 | TRNT1 | Zornitza Stark Publications for gene: TRNT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.141 | TRNT1 | Zornitza Stark reviewed gene: TRNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25193871, 23553769, 29170023, 27389523; Phenotypes: Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.27 | STEAP3 | Zornitza Stark Marked gene: STEAP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.27 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.27 | STEAP3 | Zornitza Stark Phenotypes for gene: STEAP3 were changed from 615234 ?Anemia, hypochromic microcytic, with iron overload 2 to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.26 | STEAP3 | Zornitza Stark Publications for gene: STEAP3 were set to 22031863 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.25 | STEAP3 | Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.24 | STEAP3 | Zornitza Stark Classified gene: STEAP3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.24 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.23 | STEAP3 | Zornitza Stark reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9147 | STEAP3 | Zornitza Stark Phenotypes for gene: STEAP3 were changed from Anemia, hypochromic microcytic, with iron overload 2, MIM# 615234 to Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9146 | STEAP3 | Zornitza Stark Publications for gene: STEAP3 were set to 22031863; 25515317 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9145 | STEAP3 | Zornitza Stark Classified gene: STEAP3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9145 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9144 | STEAP3 |
Zornitza Stark changed review comment from: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence.; to: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence. Conflicting evidence (PMID 26675350): Large Chinese study (of normal and α-thalassemia subjects) investigated the prevalence of STEAP3 mutations in humans and their physiologic consequences. Discovered a relatively high prevalence of potentially harmful recessive alleles. However, whilst the identified STEAP3 mutations exhibited impaired ferrireductase activity in vitro, they had little or no effect on erythrocyte phenotypes |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9144 | STEAP3 | Zornitza Stark edited their review of gene: STEAP3: Changed rating: RED; Changed publications: 22031863, 25515317, 26675350; Changed phenotypes: Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.141 | STEAP3 | Zornitza Stark Marked gene: STEAP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.141 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.141 | STEAP3 | Zornitza Stark Phenotypes for gene: STEAP3 were changed from hypochromic anaemia to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.140 | STEAP3 | Zornitza Stark Publications for gene: STEAP3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.139 | STEAP3 | Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.138 | STEAP3 | Zornitza Stark Classified gene: STEAP3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.138 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.137 | PGK1 | Zornitza Stark Marked gene: PGK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.137 | PGK1 | Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.137 | PGK1 | Zornitza Stark Phenotypes for gene: PGK1 were changed from 300653 Phosphoglycerate kinase 1 deficiency to Phosphoglycerate kinase 1 deficiency MIM# 300653 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.136 | PGK1 | Zornitza Stark Publications for gene: PGK1 were set to 16740138; 6412025 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.135 | PGK1 | Zornitza Stark Classified gene: PGK1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.135 | PGK1 | Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.134 | LARS2 | Zornitza Stark Marked gene: LARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.134 | LARS2 | Zornitza Stark Gene: lars2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.134 | LARS2 | Zornitza Stark Phenotypes for gene: LARS2 were changed from hydrops/sideroblastic anaemia to Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.133 | LARS2 | Zornitza Stark Publications for gene: LARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.132 | LARS2 | Zornitza Stark Mode of inheritance for gene: LARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.131 | SLC4A1 | Zornitza Stark Marked gene: SLC4A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.131 | SLC4A1 | Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.131 | SLC4A1 | Zornitza Stark Phenotypes for gene: SLC4A1 were changed from 166900 Ovalocytosis, SA type, 185020 Cryohydrocytosis; RBC membrane abnormality; 166900 Ovalocytosis, SA type; Haemolytic Anemia; Cryohydrocytosis,185020; 612653 Spherocytosis, type 4; Ovalocytosis, SA type, 166900; Spherocytosis, type 4, 612653 to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.130 | SLC4A1 | Zornitza Stark Publications for gene: SLC4A1 were set to 1722314 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.129 | SLC4A1 | Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.128 | STEAP3 | Danielle Ariti reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.128 | PGK1 | Danielle Ariti reviewed gene: PGK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28580215, 20151463; Phenotypes: Phosphoglycerate kinase 1 deficiency MIM# 300653; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.128 | LARS2 | Danielle Ariti reviewed gene: LARS2: Rating: AMBER; Mode of pathogenicity: None; Publications: 26537577, 32442335; Phenotypes: Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.128 | SLC4A1 | Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 10926824, 7949112, 16392641, 8640229, 16227998, 8640229, 16227998; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.128 | RPL26 | Zornitza Stark Marked gene: RPL26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.128 | RPL26 | Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.128 | RPL26 | Zornitza Stark Phenotypes for gene: RPL26 were changed from Diamond-Blackfan anemia 11, MIM# 614900 to Diamond-Blackfan anaemia 11, MIM# 614900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.127 | RPL26 | Zornitza Stark Phenotypes for gene: RPL26 were changed from ?Diamond-Blackfan anemia 11, 614900; 614900 ?Diamond-Blackfan anemia 11 to Diamond-Blackfan anemia 11, MIM# 614900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.126 | RPL26 | Zornitza Stark Classified gene: RPL26 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.126 | RPL26 | Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.125 | RPL15 | Zornitza Stark Marked gene: RPL15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.125 | RPL15 | Zornitza Stark Gene: rpl15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.125 | RPL15 | Zornitza Stark Phenotypes for gene: RPL15 were changed from Diamond-Blackfan anemia 12, MIM# 615550 to Diamond-Blackfan anaemia 12, MIM# 615550 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.124 | RPL15 | Zornitza Stark Phenotypes for gene: RPL15 were changed from 615550 ?Diamond-Blackfan anaemia 12; ?Diamond-Blackfan anemia 12, 615550; 615550 ?Diamond-Blackfan anemia 1 to Diamond-Blackfan anemia 12, MIM# 615550 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.123 | RPL15 | Zornitza Stark Publications for gene: RPL15 were set to 23812780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.122 | RPL15 | Zornitza Stark Mode of inheritance for gene: RPL15 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.121 | RPL11 | Zornitza Stark Marked gene: RPL11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.121 | RPL11 | Zornitza Stark Gene: rpl11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.121 | RPL11 | Zornitza Stark Phenotypes for gene: RPL11 were changed from Diamond_Blackfan Anemia 7; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 612562 Diamond-Blackfan anemia 7; Diamond-Blackfan Anemia 7; 612562 Diamond_Blackfan Anemia 7; DIAMOND-BLACKFAN ANEMIA 7; Diamond-Blackfan anemia 7, 612562 to Diamond-Blackfan anemia 7, MIM# 612562; MONDO:0012938 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.120 | PKLR | Zornitza Stark Marked gene: PKLR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.120 | PKLR | Zornitza Stark Gene: pklr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.120 | PKLR | Zornitza Stark Phenotypes for gene: PKLR were changed from 266200 PYRUVATE KINASE DEFICIENCY; Enzyme Disorder; PYRUVATE KINASE DEFICIENCY; 266200 Pyruvate kinase deficiency; Pyruvate kinase deficiency, 266200; Pyruvate kinase deficiency to Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900; Pyruvate kinase deficiency, MIM# 266200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.119 | PKLR | Zornitza Stark Mode of inheritance for gene: PKLR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.118 | PKLR | Zornitza Stark reviewed gene: PKLR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900, Pyruvate kinase deficiency, MIM# 266200; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.118 | PIEZO1 | Zornitza Stark Marked gene: PIEZO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.118 | PIEZO1 | Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.118 | PIEZO1 | Zornitza Stark Phenotypes for gene: PIEZO1 were changed from Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema, 194380; 194380 Stomatocytosis; Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Stomatocytosis; Dehydrated hereditary stomatocytosis; 616843 Lymphatic malformation 6; 194380 Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Hereditary xerocytosis to Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.117 | PIEZO1 | Zornitza Stark Publications for gene: PIEZO1 were set to 22529292; 23695678 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.116 | PIEZO1 | Zornitza Stark Mode of inheritance for gene: PIEZO1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.115 | PIEZO1 | Zornitza Stark reviewed gene: PIEZO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21944700, 23695678, 23479567; Phenotypes: Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.115 | PFKM | Zornitza Stark Marked gene: PFKM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.115 | PFKM | Zornitza Stark Gene: pfkm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.115 | PFKM | Zornitza Stark Phenotypes for gene: PFKM were changed from Glycogen storage disease VII, 232800; 232800 Glycogen storage disease VII to Glycogen storage disease VII, MIM# 232800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.114 | PFKM | Zornitza Stark Publications for gene: PFKM were set to 7513946; 2140573 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.113 | PFKM | Zornitza Stark reviewed gene: PFKM: Rating: GREEN; Mode of pathogenicity: None; Publications: 24427140, 27066546, 30792690; Phenotypes: Glycogen storage disease VII, MIM# 232800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9144 | NT5C3A | Zornitza Stark Marked gene: NT5C3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9144 | NT5C3A | Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9144 | NT5C3A | Zornitza Stark Phenotypes for gene: NT5C3A were changed from to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9143 | NT5C3A | Zornitza Stark Publications for gene: NT5C3A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9142 | NT5C3A | Zornitza Stark Mode of inheritance for gene: NT5C3A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9141 | NT5C3A | Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.113 | NT5C3A | Zornitza Stark Marked gene: NT5C3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.113 | NT5C3A | Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.113 | NT5C3A | Zornitza Stark Phenotypes for gene: NT5C3A were changed from Anemia, hemolytic, due to UMPH1 deficiency, 266120; 266120 Anemia, hemolytic, due to UMPH1 deficiency to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.112 | NT5C3A | Zornitza Stark Publications for gene: NT5C3A were set to 11369620; 12714505 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.111 | NT5C3A | Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Oligodontia v0.6 | WNT10B | Zornitza Stark Marked gene: WNT10B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Oligodontia v0.6 | WNT10B | Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Oligodontia v0.6 | WNT10B | Zornitza Stark Classified gene: WNT10B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Oligodontia v0.6 | WNT10B | Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Marked gene: RHOBTB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Classified gene: RHOBTB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alternating Hemiplegia and Hemiplegic Migraine v0.50 | RHOBTB2 |
Zornitza Stark gene: RHOBTB2 was added gene: RHOBTB2 was added to Alternating Hemiplegia and Hemiplegic Migraine. Sources: Literature Mode of inheritance for gene: RHOBTB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RHOBTB2 were set to 33504645 Phenotypes for gene: RHOBTB2 were set to Developmental and epileptic encephalopathy 64 618004; Alternating hemiplegia Review for gene: RHOBTB2 was set to GREEN Added comment: Eleven affected patients were identified. All had heterozygous missense variants involving exon 9 of RHOBTB2, confirmed as de novo in 9 cases. All had a complex motor phenotype, including at least 2 different kinds of movement disorder, e.g., ataxia and dystonia. Many patients demonstrated several features fulfilling the criteria for AHC: 10 patients had a movement disorder including paroxysmal elements, and 8 experienced hemiplegic episodes. In contrast to classic AHC, commonly caused by mutations in ATP1A3, these events were reported later only in RHOBTB2 mutation-positive patients from 20 months of age. All had ID, and many had seizures, so this represents an expansion of the phenotype rather than a distinct disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.46 | COPB2 | Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.46 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.45 | COPB2 |
Zornitza Stark edited their review of gene: COPB2: Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported. All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data. Note one of the individuals with heterozygous variant had significant microcephaly in addition to the two sibs with bi-allelic variants.; Changed rating: AMBER; Changed publications: 29036432, 34450031; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Marked gene: COPB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Classified gene: COPB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Osteogenesis Imperfecta and Osteoporosis v0.64 | COPB2 |
Zornitza Stark gene: COPB2 was added gene: COPB2 was added to Osteogenesis Imperfecta. Sources: Literature Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COPB2 were set to 34450031 Phenotypes for gene: COPB2 were set to Osteoporosis, recurrent fractures and developmental delay Review for gene: COPB2 was set to GREEN Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported. All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4116 | COPB2 | Zornitza Stark Classified gene: COPB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4116 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4115 | COPB2 | Zornitza Stark reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Oligodontia v0.5 | WNT10B |
Ain Roesley gene: WNT10B was added gene: WNT10B was added to Oligodontia. Sources: Literature Mode of inheritance for gene: WNT10B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: WNT10B were set to 27321946; 29364501; 21554266; 31050392 Phenotypes for gene: WNT10B were set to Tooth agenesis, selective, 8 MIM#617073 Penetrance for gene: WNT10B were set to unknown Review for gene: WNT10B was set to GREEN Added comment: PMID: 27321946; 4 unrelated families (including 1 with 3 affecteds). 3x missense and 1x truncating. Luciferase assays demonstrated LoF compared to WT. PMID: 29364501; 7 unrelated families all missense. Arg159Pro identified in 4 families and family#5 also had variants in WNT10A. Re-evaluation of a previously reported family #8 - 1 heterozygote who only had tooth agenesis while 6 other relatives who were homozygotes also had split hand-foot malformation NOTE: No genotype phenotype correlation between AD tooth agenesis and AR split hand-foot malformation - missense have also been reported in SHFM (PMID: 31050392). While it's noted that most reports of SHFM did not investigate oligodontia in their patients or carrier parents, PMID: 21554266 noted their carrier parents were healthy and clinically distinguishable Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Disorders of Glycosylation v1.18 | SLC37A4 | Zornitza Stark Phenotypes for gene: SLC37A4 were changed from Congenital disorder of glycosylation type II to Congenital disorder of glycosylation, type IIw, MIM# 619525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital Disorders of Glycosylation v1.17 | SLC37A4 | Zornitza Stark edited their review of gene: SLC37A4: Changed phenotypes: Congenital disorder of glycosylation, type IIw 619525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9141 | IMPG1 | Zornitza Stark Phenotypes for gene: IMPG1 were changed from Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200 to Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9140 | IMPG1 | Zornitza Stark reviewed gene: IMPG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 91, MIM# 153870; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.100 | IMPG1 | Zornitza Stark Phenotypes for gene: IMPG1 were changed from Retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.99 | IMPG1 | Zornitza Stark edited their review of gene: IMPG1: Changed phenotypes: Retinitis pigmentosa, MONDO:0019200, Retinitis pigmentosa 91, MIM# 153870 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9140 | ABCC11 | Zornitza Stark Marked gene: ABCC11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9140 | ABCC11 | Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9140 | ABCC11 | Zornitza Stark Phenotypes for gene: ABCC11 were changed from to [Axillary odor, variation in] 117800; [Colostrum secretion, variation in] 117800; [Earwax, wet/dry] 117800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9139 | ABCC11 | Zornitza Stark Classified gene: ABCC11 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9139 | ABCC11 | Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9138 | ABCC11 | Zornitza Stark reviewed gene: ABCC11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: [Axillary odor, variation in] 117800, [Colostrum secretion, variation in] 117800, [Earwax, wet/dry] 117800; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.111 | PUS1 | Zornitza Stark Marked gene: PUS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.111 | PUS1 | Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.111 | PUS1 | Zornitza Stark Phenotypes for gene: PUS1 were changed from 600462 Myopathy, lactic acidosis, and sideroblastic anemia 1; Myopathy, Lactic Acidosis, and Sideroblastic Anemia, 600462; 600462 Myopathy, Lactic Acidosis, and Sideroblastic Anemia to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.110 | PUS1 | Zornitza Stark Publications for gene: PUS1 were set to 15108122; 15772074 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.109 | PUS1 | Zornitza Stark edited their review of gene: PUS1: Changed phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.109 | HSPA9 | Zornitza Stark Marked gene: HSPA9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.109 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.109 | HSPA9 | Zornitza Stark Phenotypes for gene: HSPA9 were changed from sideroblastic anaemia; 182170 Sideroblastic anaemia 4; 182170 sideroblastic anaemia type 4; Sideroblastic anaemia type 4, 182170 to Anaemia, sideroblastic, 4, MIM# 182170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.108 | HSPA9 | Zornitza Stark reviewed gene: HSPA9: Rating: GREEN; Mode of pathogenicity: None; Publications: 26491070; Phenotypes: Anaemia, sideroblastic, 4, MIM# 182170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9138 | KCNN4 | Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26198474; 26178367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9137 | KCNN4 |
Zornitza Stark changed review comment from: At least three families reported. Sources: Expert list; to: Well established gene-disease association, more than 10 families and functional data. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9137 | KCNN4 | Zornitza Stark edited their review of gene: KCNN4: Changed publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Changed phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.108 | KCNN4 | Zornitza Stark Marked gene: KCNN4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.108 | KCNN4 | Zornitza Stark Gene: kcnn4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.108 | KCNN4 | Zornitza Stark Phenotypes for gene: KCNN4 were changed from Hereditary Xerocytosis; 616689 Dehydrated hereditary stomatocytosis 2 to Dehydrated hereditary stomatocytosis 2, MIM# 616689 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.107 | KCNN4 | Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26178367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.106 | KCNN4 | Zornitza Stark Mode of inheritance for gene: KCNN4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.105 | KCNN4 | Zornitza Stark reviewed gene: KCNN4: Rating: GREEN; Mode of pathogenicity: None; Publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.105 | KLF1 | Zornitza Stark Marked gene: KLF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.105 | KLF1 | Zornitza Stark Gene: klf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.105 | KLF1 | Zornitza Stark Phenotypes for gene: KLF1 were changed from 613673 Congenital dyserythropoietic anaemia type 4; Congenital Dyserythropoietic Anemia; 613673 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type IV, 613673; Dyserythropoietic anemia, congenital, type IV to Dyserythropoietic anaemia, congenital, type IV, MIM# 613673; MONDO:0013355 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.104 | KLF1 | Zornitza Stark Publications for gene: KLF1 were set to 21055716; 29200155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.103 | HK1 | Zornitza Stark Marked gene: HK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.103 | HK1 | Zornitza Stark Gene: hk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.103 | HK1 | Zornitza Stark Phenotypes for gene: HK1 were changed from 235700 Enzyme Disorder; Hemolytic anemia due to hexokinase deficiency, 235700; 235700 Hemolytic anemia due to hexokinase deficiency; Hemolytic anemia due to hexokinase deficiency; Enzyme Disorder to Haemolytic anaemia due to hexokinase deficiency, MIM# 235700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.102 | HK1 | Zornitza Stark Publications for gene: HK1 were set to 7655856; 12393545 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.101 | HK1 | Zornitza Stark reviewed gene: HK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7655856, 12393545, 33361148, 31119733, 27282571; Phenotypes: Haemolytic anaemia due to hexokinase deficiency, MIM# 235700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1193 | HCN4 | Zornitza Stark Marked gene: HCN4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1193 | HCN4 | Zornitza Stark Gene: hcn4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1193 | HCN4 |
Zornitza Stark gene: HCN4 was added gene: HCN4 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for gene: HCN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HCN4 were set to 30127718; 29588962 Phenotypes for gene: HCN4 were set to {Epilepsy, idiopathic generalized, susceptibility to, 18}, MIM# 619521 Review for gene: HCN4 was set to RED Added comment: Two families reported. Variant did not segregate with disease in one (PMID 29588962), and was present in two affected sibs from another family reported in PMID 30127718, some functional data to support impact of variant on protein function. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.101 | KIF23 | Zornitza Stark Marked gene: KIF23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.101 | KIF23 | Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.101 | KIF23 | Zornitza Stark Phenotypes for gene: KIF23 were changed from Enzyme Disorder; Anaemia, dyserythropoietic congenital, type III; Congenital dyserythropoietic anemia (CDA); Congenital dyserythropoietic anemia type III; 605064 Congenital dyserythropoietic anaemia type 3; CDA III to Congenital dyserythropoietic anemia type III | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.100 | KIF23 | Zornitza Stark Classified gene: KIF23 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.100 | KIF23 | Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4115 | MTRR | Zornitza Stark Marked gene: MTRR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4115 | MTRR | Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4115 | MTRR | Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4114 | MTRR | Zornitza Stark Publications for gene: MTRR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4113 | MTRR | Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4112 | MTRR | Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9137 | MTRR | Zornitza Stark Marked gene: MTRR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9137 | MTRR | Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9137 | MTRR | Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9136 | MTRR | Zornitza Stark Publications for gene: MTRR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9135 | MTRR | Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9134 | MTRR | Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.99 | MTRR | Zornitza Stark Marked gene: MTRR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.99 | MTRR | Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.99 | MTRR | Zornitza Stark Phenotypes for gene: MTRR were changed from Homocystinuria-megaloblastic anemia, cbl E type, 236270; 236270 Homocystinuria-megaloblastic anemia, cbl E type to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.98 | MTRR | Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4112 | MTR | Zornitza Stark Marked gene: MTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4112 | MTR | Zornitza Stark Gene: mtr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4112 | MTR | Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4111 | MTR | Zornitza Stark Publications for gene: MTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4110 | MTR | Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4109 | MTR | Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9134 | MTR | Zornitza Stark Marked gene: MTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9134 | MTR | Zornitza Stark Gene: mtr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9134 | MTR | Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9133 | MTR | Zornitza Stark Publications for gene: MTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9132 | MTR | Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9131 | MTR | Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.98 | MTR | Zornitza Stark Marked gene: MTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.98 | MTR | Zornitza Stark Gene: mtr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.98 | MTR | Zornitza Stark Phenotypes for gene: MTR were changed from Homocystinuria-megaloblastic anemia, cblG complementation type, 250940; 250940 Homocystinuria-megaloblastic anemia, cblG complementation type to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.97 | MTR | Zornitza Stark Publications for gene: MTR were set to 9683607; 12068375 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.96 | MTR | Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autoinflammatory Disorders v0.121 | LPIN2 | Zornitza Stark Marked gene: LPIN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autoinflammatory Disorders v0.121 | LPIN2 | Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autoinflammatory Disorders v0.121 | LPIN2 | Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autoinflammatory Disorders v0.120 | LPIN2 | Zornitza Stark Publications for gene: LPIN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autoinflammatory Disorders v0.119 | LPIN2 | Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autoinflammatory Disorders v0.118 | LPIN2 | Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9131 | LPIN2 | Zornitza Stark Marked gene: LPIN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9131 | LPIN2 | Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9131 | LPIN2 | Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9130 | LPIN2 | Zornitza Stark Publications for gene: LPIN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9129 | LPIN2 | Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9128 | LPIN2 | Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.96 | LPIN2 | Zornitza Stark Marked gene: LPIN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.96 | LPIN2 | Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.96 | LPIN2 | Zornitza Stark Phenotypes for gene: LPIN2 were changed from Congenital dyserythropoietic anemia; Microcytic anemia; Majeed syndrome, 609628; 609628 Microcytic anemia; CDA; Majeed syndrome; 609628 Majeed syndrome to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.95 | LPIN2 | Zornitza Stark Publications for gene: LPIN2 were set to 17330256; 15994876 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.94 | LPIN2 | Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.206 | KCNQ1 | Zornitza Stark Marked gene: KCNQ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.206 | KCNQ1 | Zornitza Stark Gene: kcnq1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.206 | KCNQ1 |
Zornitza Stark gene: KCNQ1 was added gene: KCNQ1 was added to Hydrops fetalis. Sources: Expert Review Mode of inheritance for gene: KCNQ1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNQ1 were set to 27539165 Phenotypes for gene: KCNQ1 were set to Long QT syndrome 1, 192500 Review for gene: KCNQ1 was set to RED Added comment: Can present antenatally with bradycardia, but no specific mention of hydrops. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.205 | KCNH2 | Zornitza Stark Marked gene: KCNH2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.205 | KCNH2 | Zornitza Stark Gene: kcnh2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.205 | KCNH2 |
Zornitza Stark gene: KCNH2 was added gene: KCNH2 was added to Hydrops fetalis. Sources: Expert Review Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNH2 were set to 27492745 Phenotypes for gene: KCNH2 were set to long QT syndrome Review for gene: KCNH2 was set to RED Added comment: Single case report identified of presentation with hydrops. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Marked gene: SCN5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Classified gene: SCN5A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrops fetalis v0.203 | SCN5A |
Zornitza Stark gene: SCN5A was added gene: SCN5A was added to Hydrops fetalis. Sources: Expert Review Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SCN5A were set to 22064211; 15184283; 19419784 Phenotypes for gene: SCN5A were set to Long QT syndrome 3 (MIM#603830) Review for gene: SCN5A was set to GREEN Added comment: Three families reported with severe perinatal presentation, including hydrops. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.147 | OPDM1 | Zornitza Stark Tag adult-onset tag was added to STR: OPDM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.147 | NIID | Zornitza Stark Tag adult-onset tag was added to STR: NIID. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.147 | Zornitza Stark Panel types changed to Australian Genomics; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | VACTERLX | Zornitza Stark Tag paediatric-onset tag was added to STR: VACTERLX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | OPML1 | Zornitza Stark Tag adult-onset tag was added to STR: OPML1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Marked STR: NIPA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Tag adult-onset tag was added to STR: NIPA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRAXF | Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXF. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRA7A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA7A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRA11B | Zornitza Stark Marked STR: FRA11B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRA11B | Zornitza Stark Str: fra11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRA11B | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11B. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRA11A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FAME7 | Zornitza Stark Tag adult-onset tag was added to STR: FAME7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FAME6 | Zornitza Stark Tag adult-onset tag was added to STR: FAME6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FAME4 | Zornitza Stark Tag adult-onset tag was added to STR: FAME4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | DMD |
Zornitza Stark Tag adult-onset tag was added to STR: DMD. Tag paediatric-onset tag was added to STR: DMD. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRA2A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA2A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | FRA12A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA12A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CCD | Zornitza Stark Marked STR: CCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CCD | Zornitza Stark Str: ccd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CCD | Zornitza Stark Tag paediatric-onset tag was added to STR: CCD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Marked STR: CANVAS_ACAGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Str: canvas_acagg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Tag adult-onset tag was added to STR: CANVAS_ACAGG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | XDP | Zornitza Stark Tag adult-onset tag was added to STR: XDP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | TOF | Zornitza Stark Tag paediatric-onset tag was added to STR: TOF. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SPD1 | Zornitza Stark Tag paediatric-onset tag was added to STR: SPD1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA8 | Zornitza Stark Tag adult-onset tag was added to STR: SCA8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA7 | Zornitza Stark Tag adult-onset tag was added to STR: SCA7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA6 | Zornitza Stark Tag adult-onset tag was added to STR: SCA6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA37 | Zornitza Stark Tag adult-onset tag was added to STR: SCA37. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA36 | Zornitza Stark Tag adult-onset tag was added to STR: SCA36. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA31 | Zornitza Stark Tag adult-onset tag was added to STR: SCA31. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA3 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA3. Tag paediatric-onset tag was added to STR: SCA3. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA2 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA2. Tag paediatric-onset tag was added to STR: SCA2. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA17 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA17. Tag paediatric-onset tag was added to STR: SCA17. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA12 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA12. Tag paediatric-onset tag was added to STR: SCA12. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA10 | Zornitza Stark Tag adult-onset tag was added to STR: SCA10. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9128 | FOXE3 | Zornitza Stark Marked gene: FOXE3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9128 | FOXE3 | Zornitza Stark Gene: foxe3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9128 | FOXE3 | Zornitza Stark Phenotypes for gene: FOXE3 were changed from to Anterior segment dysgenesis 2, multiple subtypes, MIM#610256; Cataract 34, multiple types, MIM#612968; Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9127 | FOXE3 | Zornitza Stark Publications for gene: FOXE3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9126 | FOXE3 | Zornitza Stark Mode of inheritance for gene: FOXE3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9125 | FOXE3 | Eleanor Williams reviewed gene: FOXE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 26854927, 27218149, 16826526, 19708017, 20140963, 20664696, 20361012, 24019743, 27669367, 29878917, 32436650, 34046667, 11159941, 19708017, 20806047, 21150893, 11980846, 34046667; Phenotypes: Anterior segment dysgenesis 2, multiple subtypes, MIM#610256, Cataract 34, multiple types, MIM#612968, Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9125 | SLC26A1 | Zornitza Stark Phenotypes for gene: SLC26A1 were changed from to Nephrolithiasis, calcium oxalate, MIM#167030 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9124 | SLC26A1 | Zornitza Stark Publications for gene: SLC26A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9123 | SLC26A1 | Zornitza Stark Mode of inheritance for gene: SLC26A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9122 | SLC26A1 | Zornitza Stark Classified gene: SLC26A1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9122 | SLC26A1 | Zornitza Stark Gene: slc26a1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9121 | SLC26A1 | Zornitza Stark reviewed gene: SLC26A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27210743, 20160351, 30383413, 27125215; Phenotypes: Nephrolithiasis, calcium oxalate, MIM#167030; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9121 | RHAG | Zornitza Stark Marked gene: RHAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9121 | RHAG | Zornitza Stark Gene: rhag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9121 | RHAG | Zornitza Stark Phenotypes for gene: RHAG were changed from to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9120 | RHAG | Zornitza Stark Publications for gene: RHAG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9119 | RHAG | Zornitza Stark Mode of inheritance for gene: RHAG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9118 | SPTA1 | Zornitza Stark Marked gene: SPTA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9118 | SPTA1 | Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9118 | SPTA1 | Zornitza Stark Phenotypes for gene: SPTA1 were changed from to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9117 | SPTA1 | Zornitza Stark Publications for gene: SPTA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9116 | SPTA1 | Zornitza Stark Mode of inheritance for gene: SPTA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9115 | SPTA1 | Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.94 | RHAG | Zornitza Stark Marked gene: RHAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.94 | RHAG | Zornitza Stark Gene: rhag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.94 | RHAG | Zornitza Stark Phenotypes for gene: RHAG were changed from Stomatocytosis; Anemia, hemolytic, Rh-null, regulator type (BIALLELIC, autosomal or pseudoautosomal), 268150; 185000 Overhydrated hereditary stomatocytosis; Overhydrated hereditary stomatocytosis (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 185000; 268150 Anemia, hemolytic, Rh-null, regulator type to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.93 | RHAG | Zornitza Stark Publications for gene: RHAG were set to 18931342 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.92 | SLC11A2 | Zornitza Stark Marked gene: SLC11A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.92 | SLC11A2 | Zornitza Stark Gene: slc11a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.92 | SLC11A2 | Zornitza Stark Phenotypes for gene: SLC11A2 were changed from 206100 Anemia, hypochromic microcytic, with iron overload 1; Anemia, hypochromic microcytic, with iron overload 1, 206100 to Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.91 | SLC11A2 | Zornitza Stark Publications for gene: SLC11A2 were set to 16160008; 16439678; 15459009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.90 | SLC2A1 | Zornitza Stark Marked gene: SLC2A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.90 | SLC2A1 | Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.90 | SLC2A1 | Zornitza Stark Phenotypes for gene: SLC2A1 were changed from Stomatocytosis; 612126 GLUT1 deficiency without epilepsy and/or hemolytic anemia; 608885 Stomatin-deficient cryohydrocytosis with neurologic defects; Pyridoxine-refractory sideroblastic anemia to Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885; delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia; haemolytic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.89 | SLC2A1 | Zornitza Stark Publications for gene: SLC2A1 were set to 22492876; 21791420 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9115 | SPTB | Zornitza Stark Marked gene: SPTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9115 | SPTB | Zornitza Stark Gene: sptb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.88 | SPTA1 | Zornitza Stark Marked gene: SPTA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.88 | SPTA1 | Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.88 | SPTA1 | Zornitza Stark Phenotypes for gene: SPTA1 were changed from 270970 Spherocytosis, type 3; 266140 Pyropoikilocytosis; RBC membrane abnormality; Pyropoikilocytosis (BIALLELIC, autosomal or pseudoautosomal), 266140; 266140 Pyropoikilocytosis, 270970 Spherocytosis, type 3; Spherocytosis, type 3 (BIALLELIC, autosomal or pseudoautosomal), 270970; 130600 Elliptocytosis-2; Elliptocytosis-2 (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 130600 to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.87 | SPTA1 | Zornitza Stark Publications for gene: SPTA1 were set to 1679439; 3940543; 4077050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9115 | SPTB | Zornitza Stark Phenotypes for gene: SPTB were changed from to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9114 | SPTB | Zornitza Stark Publications for gene: SPTB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9113 | SPTB | Zornitza Stark Mode of inheritance for gene: SPTB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.86 | SPTB | Zornitza Stark Marked gene: SPTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.86 | SPTB | Zornitza Stark Gene: sptb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.86 | SPTB | Zornitza Stark Phenotypes for gene: SPTB were changed from 617948 Elliptocytosis-3; Spherocytosis,616649; Anemia, neonatal hemolytic, fatal and near-fatal; RBC membrane abnormality; 616649 Spherocytosis, type 2; 616649 Anemia, neonatal hemolytic, fatal and near-fatal; Elliptocytosis to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.85 | SPTB | Zornitza Stark Publications for gene: SPTB were set to 8226774; 3276733 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.84 | TCN2 | Zornitza Stark Marked gene: TCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.84 | TCN2 | Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.84 | TCN2 | Zornitza Stark Phenotypes for gene: TCN2 were changed from megaloblastic bone marrow; neutropenia; thrombocytopenia; 275350 Transcobalamin II deficiency; Agammaglobulinemia; pancytopenia; neutropenic colitis; failure to thrive; Transcobalamin II deficiency; can have a presentation similar to severe combined immunodeficiency; hypotonia, myoclonic like movements, pallor, purpura, anaemia, thrombocytopenia, megaloblastosis, aplastic bone marrow to Transcobalamin II deficiency MIM# 275350; Decreased Ig levels; Megaloblastic anaemia; pancytopaenia; Reticulocytopaenia; failure to thrive; diarrhoea; hypogammaglobulinaemia; pallor; hypotonia; respiratory infection; if untreated (B12) for prolonged periods results in intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.83 | TCN2 | Zornitza Stark Publications for gene: TCN2 were set to 10518276; 7849710 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9112 | TF | Zornitza Stark Marked gene: TF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9112 | TF | Zornitza Stark Gene: tf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9112 | TF | Zornitza Stark Phenotypes for gene: TF were changed from to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9111 | TF | Zornitza Stark Publications for gene: TF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9110 | TF | Zornitza Stark Mode of inheritance for gene: TF was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.82 | TF | Zornitza Stark Marked gene: TF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.82 | TF | Zornitza Stark Gene: tf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.82 | TF | Zornitza Stark Phenotypes for gene: TF were changed from Congenital hypotransferrinemia; Atransferrinemia, 209300; 209300 Congenital hypotransferrinemia to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9109 | SLC11A2 | Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.23 | SLC11A2 | Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9109 | RHAG | Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9109 | SPTB | Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9109 | TF | Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.23 | TF | Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.81 | RHAG | Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.81 | SLC11A2 | Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.81 | SLC2A1 | Danielle Ariti reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27353637; Phenotypes: Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885, delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia, haemolytic anaemia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.81 | HBD | Zornitza Stark Marked gene: HBD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.81 | HBD | Zornitza Stark Gene: hbd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.81 | HBD | Zornitza Stark Phenotypes for gene: HBD were changed from Thalassemia due to Hb Lepore; Thalassemia,delta; Thalassemiadue to HbLepore; 141749 Delta-beta thalassaemia, thalassaemia due to Hb Lepore; Thalassemia, delta to Thalassaemia, delta-; Thalassaemia due to Hb Lepore | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.80 | HBD | Zornitza Stark reviewed gene: HBD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassaemia, delta-, Thalassaemia due to Hb Lepore; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.80 | HBB | Zornitza Stark Marked gene: HBB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.80 | HBB | Zornitza Stark Gene: hbb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.80 | HBB | Zornitza Stark Phenotypes for gene: HBB were changed from Sickle cell anemia (BIALLELIC, autosomal or pseudoautosomal),603903; 613985 Thalassemia, beta; Erythremias, beta-; 603902 Thalassemia-beta, dominant inclusion-body; Thalassemias, beta-,(BIALLELIC, autosomal or pseudoautosomal), 613985; Hereditary persistence of fetal hemoglobin,(MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown),141749; 603902 Dominand inclusion body beta thalassaemia; 603903 Sickle cell disease; 141749 Delta-beta thalassaemia; Heinz body anemias, beta- (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 140700; Globin Disorder; Thalassemia-beta, dominant inclusion-body, 603902; Delta-beta thalassemia (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 141749; 613985 Beta thalassaemia; Methemoglobinemias, beta- to Thalassemia, beta, MIM# 613985; Sickle cell anaemia, MIM# 603903; Methaemoglobinaemia, beta type, MIM# 617971; Hereditary persistence of fetal haemoglobin, MIM# 141749; Heinz body anaemia, MIM# 140700; Erythrocytosis 6, MIM# 617980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.79 | HBB | Zornitza Stark reviewed gene: HBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, beta, MIM# 613985, Sickle cell anaemia, MIM# 603903, Methaemoglobinaemia, beta type, MIM# 617971, Hereditary persistence of fetal haemoglobin, MIM# 141749, Heinz body anaemia, MIM# 140700, Erythrocytosis 6, MIM# 617980; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.79 | HBA2 | Zornitza Stark Marked gene: HBA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.79 | HBA2 | Zornitza Stark Gene: hba2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.79 | HBA2 | Zornitza Stark Phenotypes for gene: HBA2 were changed from Hypochromic microcytic anemia; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Erythrocytosis; 60413 Thalassemia, alpha; Heinz body anemia,140700; Thalassemia, alpha-, 604131 to Thalassemia, alpha-, MIM# 604131; Heinz body anaemia, MIM# 140700; Erythrocytosis 7, MIM# 617981 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.78 | HBA2 | Zornitza Stark reviewed gene: HBA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, alpha-, MIM# 604131, Heinz body anaemia, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.78 | HBA1 | Zornitza Stark Marked gene: HBA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.78 | HBA1 | Zornitza Stark Gene: hba1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.78 | HBA1 | Zornitza Stark Phenotypes for gene: HBA1 were changed from Thalassemias, alpha-, 604131; 604131 Thalassemias, alpha; Erythremias, alpha-; Heinz body anemias, alpha-, 140700; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Methemoglobinemias, alpha- to Thalassemias, alpha-, MIM# 604131; Heinz body anemias, alpha-, MIM# 140700; Erythrocytosis 7, MIM# 617981 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.77 | HBA1 | Zornitza Stark reviewed gene: HBA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemias, alpha-, MIM# 604131, Heinz body anemias, alpha-, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.77 | GSS | Zornitza Stark Marked gene: GSS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.77 | GSS | Zornitza Stark Gene: gss has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.77 | GSS | Zornitza Stark Phenotypes for gene: GSS were changed from 231900 Enzyme Disorder; Hemolytic anemia due to glutathione synthetase deficiency, 231900; 266130 Glutathione synthetase deficiency; Enzyme Disorder; Glutathione synthetase deficiency, 266130; Hemolytic anemia due to glutathione synthetase deficiency to Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.76 | GSS | Zornitza Stark Publications for gene: GSS were set to 8896573 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | GSS | Zornitza Stark reviewed gene: GSS: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896573, 31198081, 29395598, 29340523, 28267090; Phenotypes: Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.195 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; deafness; ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; deafness; ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.194 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.92 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.91 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Muscular dystrophy and myopathy_Paediatric v0.93 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Muscular dystrophy and myopathy_Paediatric v0.92 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9109 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9108 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | SPTA1 | Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | SPTB | Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | TCN2 | Danielle Ariti reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency MIM# 275350, Decreased Ig levels, Megaloblastic anaemia, pancytopaenia, Reticulocytopaenia, failure to thrive, diarrhoea, hypogammaglobulinaemia, pallor, hypotonia, respiratory infection, if untreated (B12) for prolonged periods results in intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | TF | Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SCA1 | Zornitza Stark Tag adult-onset tag was added to STR: SCA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | SBMA | Zornitza Stark Tag adult-onset tag was added to STR: SBMA. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | RCPS | Zornitza Stark Tag paediatric-onset tag was added to STR: RCPS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CCHS | Zornitza Stark Marked STR: CCHS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | CCHS | Zornitza Stark Str: cchs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9108 | GSR | Zornitza Stark Marked gene: GSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9108 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9108 | GSR | Zornitza Stark Phenotypes for gene: GSR were changed from to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9107 | GSR | Zornitza Stark Publications for gene: GSR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9106 | GSR | Zornitza Stark Mode of inheritance for gene: GSR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9105 | GSR | Zornitza Stark Classified gene: GSR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9105 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9104 | GSR | Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | GSR | Zornitza Stark Marked gene: GSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.75 | GSR | Zornitza Stark Phenotypes for gene: GSR were changed from Hemolytic anemia due to glutathione reductase deficiency; Enzyme Disorder; NA Enzyme Disorder to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.74 | GSR | Zornitza Stark Publications for gene: GSR were set to 8533822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.73 | GSR | Zornitza Stark Classified gene: GSR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.73 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.72 | GSR | Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.146 | Bryony Thompson Panel status changed from internal to public | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.294 | MAGEL2 | Zornitza Stark Publications for gene: MAGEL2 were set to 24076603; 27195816; 26365340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.293 | MAGEL2 | Zornitza Stark Mode of inheritance for gene: MAGEL2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9104 | MKRN3 | Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405 33214675 31041429 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | MKRN3 | Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405, 33214675, 31041429, 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9104 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33820833, 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.292 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26365340, 33820833, 34128869; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | OPMD | Zornitza Stark Tag adult-onset tag was added to STR: OPMD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | OPDM2 | Zornitza Stark Tag adult-onset tag was added to STR: OPDM2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | MEDPSACH | Zornitza Stark Tag paediatric-onset tag was added to STR: MEDPSACH. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | HSAN8 | Zornitza Stark Tag paediatric-onset tag was added to STR: HSAN8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | FRA2A | Bryony Thompson Marked STR: FRA2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | FRA2A | Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | FRA2A | Bryony Thompson Classified STR: FRA2A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.145 | FRA2A | Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.144 | FRA2A |
Bryony Thompson STR: FRA2A was added STR: FRA2A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA2A were set to 24763282 Phenotypes for STR: FRA2A were set to Neurodevelopmental delay Review for STR: FRA2A was set to AMBER Added comment: Three families with a wide spectrum of neurodevelopmental phenotypes with expression of folate-sensitive fragile site FRA2A. The CGG repeat is in an alternative promoter for AFF3, active in the brain. Expansion of >300 repeats causes expression of FRA2A and is associated with hypermethylation and silencing of AFF3 in at least one individual. There were 3-20 repeats in normal controls. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.72 | GPI | Zornitza Stark Marked gene: GPI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.72 | GPI | Zornitza Stark Gene: gpi has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.72 | GPI | Zornitza Stark Phenotypes for gene: GPI were changed from 613470 Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency; Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency, 613470 to Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.71 | GPI | Zornitza Stark Publications for gene: GPI were set to 411100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.70 | GPI | Zornitza Stark reviewed gene: GPI: Rating: GREEN; Mode of pathogenicity: None; Publications: 8499925, 9856489, 32103498; Phenotypes: Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4109 | UMPS | Zornitza Stark Marked gene: UMPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4109 | UMPS | Zornitza Stark Gene: umps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4109 | UMPS | Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria MIM# 258900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4108 | UMPS | Zornitza Stark Publications for gene: UMPS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4107 | UMPS | Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | UMPS | Zornitza Stark reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9104 | UMPS | Zornitza Stark Marked gene: UMPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9104 | UMPS | Zornitza Stark Gene: umps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9104 | UMPS | Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria, MIM# 258900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9103 | UMPS | Zornitza Stark Publications for gene: UMPS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9102 | UMPS | Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9101 | UMPS |
Zornitza Stark edited their review of gene: UMPS: Added comment: 20 unrelated patients have been reported with biallelic missense variants; one mouse model Orotic aciduria is characterised by megaloblastic anaemia and orotic acid crystalluria, frequently associated with a degree of physical and intellectual disability. Other features include, congenital malformations (Atrial/ Ventricular septal defect) and immunodeficiencies (T-cell dysfunction, failure to thrive, recurrent infections). Haematology features - Megaloblastic anaemia - Low to normal reticulocyte count - Anisocytosis - Poikilocytosis - Hypochromia; Changed publications: 9042911, 33489760; Changed phenotypes: Orotic aciduria, MIM# 258900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.70 | UMPS | Zornitza Stark Marked gene: UMPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.70 | UMPS | Zornitza Stark Gene: umps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.70 | UMPS | Zornitza Stark Phenotypes for gene: UMPS were changed from 258900 Orotic aciduria with megaloblastic anaemia to Orotic aciduria MIM# 258900; megaloblastic anaemia; orotic acid crystalluria; ID; immunodeficiencies | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.69 | UMPS | Zornitza Stark Publications for gene: UMPS were set to 9042911 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Imprinting disorders v0.3 | MAGEL2 |
Anna Le Fevre gene: MAGEL2 was added gene: MAGEL2 was added to Imprinting disorders. Sources: Literature Mode of inheritance for gene: MAGEL2 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Publications for gene: MAGEL2 were set to 24076603; 31397880; 29599419; 30302899 Phenotypes for gene: MAGEL2 were set to Schaaf-Yang syndrome; Chitayat-Hall Syndrome Review for gene: MAGEL2 was set to GREEN Added comment: MAGEL2 is a single-exon gene. Frameshift mutations may not cause nonsense-mediated decay, but instead a variety of truncated or elongated protein products. The pathogenicity of haploinsufficiency of the paternal allele is uncertain (ClinGen review 2018). A dominant-negative effect has been suggested. Haploinsufficiency may play a role. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Autism v0.167 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9101 | TMPRSS6 | Zornitza Stark Marked gene: TMPRSS6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9101 | TMPRSS6 | Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9101 | TMPRSS6 | Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9100 | TMPRSS6 | Zornitza Stark Publications for gene: TMPRSS6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9099 | TMPRSS6 | Zornitza Stark Mode of inheritance for gene: TMPRSS6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.68 | TMPRSS6 | Zornitza Stark Marked gene: TMPRSS6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.68 | TMPRSS6 | Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.68 | TMPRSS6 | Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from Iron refractoryirondeficiencyanemia,206200; Iron-Refractory Iron Deficiency Anemia; 206200 Iron refractoryirondeficiencyanemia to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.67 | TMPRSS6 | Zornitza Stark Publications for gene: TMPRSS6 were set to 18408718 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9098 | TPI1 |
Zornitza Stark changed review comment from: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; to: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital haemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9098 | TPI1 |
Zornitza Stark edited their review of gene: TPI1: Added comment: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; Changed publications: 9338582, 32873690, 8503454; Changed phenotypes: Haemolytic anaemia due to triosephosphate isomerase deficiency, MIM# 615512 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.66 | TPI1 | Zornitza Stark Marked gene: TPI1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.66 | TPI1 | Zornitza Stark Gene: tpi1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.66 | TPI1 | Zornitza Stark Phenotypes for gene: TPI1 were changed from 615512 Hemolytic anemia due to triosephosphate isomerase deficiency; Enzyme Disorder; Hemolytic anemia due to triosephosphate isomerase deficiency,615512 to Haemolytic anaemia due to triosephosphate isomerase deficiency MIM# 615512; chronic haemolytic anaemia; neuromuscular dysfunction; intracellular accumulation of dihydroxyacetone phosphate (DHAP) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.65 | TPI1 | Zornitza Stark Publications for gene: TPI1 were set to 11698297; 9338582 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mitochondrial disease v0.648 | YARS2 | Zornitza Stark Marked gene: YARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mitochondrial disease v0.648 | YARS2 | Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mitochondrial disease v0.648 | YARS2 | Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mitochondrial disease v0.647 | YARS2 | Zornitza Stark Publications for gene: YARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mitochondrial disease v0.646 | YARS2 | Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mitochondrial disease v0.645 | YARS2 | Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9098 | YARS2 | Zornitza Stark Marked gene: YARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9098 | YARS2 | Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: ; Mode of pathogenicity: None; Publications: 24076603, 30302899, 31397880; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9098 | YARS2 | Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9097 | YARS2 | Zornitza Stark Publications for gene: YARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9096 | YARS2 | Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9095 | YARS2 | Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9095 | TMPRSS6 | Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metal Metabolism Disorders v0.23 | TMPRSS6 | Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.64 | TMPRSS6 | Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.64 | TPI1 | Danielle Ariti reviewed gene: TPI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9338582, 32873690, 8503454; Phenotypes: Hemolytic anemia due to triosephosphate isomerase deficiency MIM# 615512, chronic hemolytic anaemia, neuromuscular dysfunction, intracellular accumulation of dihydroxyacetone phosphate (DHAP); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.64 | GLRX5 | Zornitza Stark Marked gene: GLRX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.64 | GLRX5 | Zornitza Stark Gene: glrx5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.64 | GLRX5 | Zornitza Stark Phenotypes for gene: GLRX5 were changed from 616860 Pyridoxine refractory sideroblastic anaemia 3; Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive, 205950; 205950 Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive to Anaemia, sideroblastic, 3, pyridoxine-refractory, MIM# 616860 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.63 | GLRX5 | Zornitza Stark Publications for gene: GLRX5 were set to 20364084; 25342667; 17485548 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.62 | GLRX5 | Zornitza Stark changed review comment from: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.; to: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anaemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.62 | GIF | Zornitza Stark Marked gene: GIF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.62 | GIF | Zornitza Stark Gene: gif has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.62 | GIF | Zornitza Stark Phenotypes for gene: GIF were changed from 261000 Intrinsic factor deficiency to Intrinsic factor deficiency, MIM# 261000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.61 | GIF | Zornitza Stark Publications for gene: GIF were set to 15738392; 14576042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.60 | GIF | Zornitza Stark reviewed gene: GIF: Rating: GREEN; Mode of pathogenicity: None; Publications: 14695536, 14576042, 15738392; Phenotypes: Intrinsic factor deficiency, MIM# 261000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.371 | GCLC | Zornitza Stark Marked gene: GCLC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.371 | GCLC | Zornitza Stark Gene: gclc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.371 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.370 | GCLC | Zornitza Stark Publications for gene: GCLC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.369 | GCLC | Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.368 | GCLC | Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28571779, 10515893; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9095 | GCLC | Zornitza Stark Marked gene: GCLC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9095 | GCLC | Zornitza Stark Gene: gclc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.60 | UMPS | Danielle Ariti reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900, megaloblastic anaemia, orotic acid crystalluria, ID, immunodeficiencies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9095 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450; Disorders of the gamma-glutamyl cycle | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9094 | GCLC | Zornitza Stark Publications for gene: GCLC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9093 | GCLC | Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9092 | GCLC | Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.60 | GCLC | Zornitza Stark Marked gene: GCLC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.60 | GCLC | Zornitza Stark Gene: gclc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.60 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.59 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from 230450 Glutamate-cysteine ligase deficiency; Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, 230450; Enzyme Disorder; Glutamate-cysteine ligase deficiency; 230450 Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency to Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.58 | GCLC | Zornitza Stark Publications for gene: GCLC were set to 10515893 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.57 | GCLC | Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.143 | FRA7A | Bryony Thompson Marked STR: FRA7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.143 | FRA7A | Bryony Thompson Str: fra7a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.143 | FRA7A |
Bryony Thompson STR: FRA7A was added STR: FRA7A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA7A were set to 25196122 Phenotypes for STR: FRA7A were set to Autism spectrum disorder Review for STR: FRA7A was set to AMBER Added comment: A de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. The expanded allele showed hypermethylation of the adjacent CpG island and reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line. The probands mother had a pre-mutation with 85 repeats. Controls showed a CGG-repeat range of 5 to 22. In a second family a pre-mutation (66-72) was identified in 3 siblings with ASD and an unaffected father. One of the siblings had mitotic instability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Marked gene: MAP1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Gene: map1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Classified gene: MAP1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Gene: map1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9092 | PDGFRL | Zornitza Stark Marked gene: PDGFRL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9092 | PDGFRL | Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9092 | PDGFRL | Zornitza Stark Classified gene: PDGFRL as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9092 | PDGFRL | Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.57 | YARS2 | Zornitza Stark Marked gene: YARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.57 | YARS2 | Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.57 | YARS2 | Zornitza Stark Phenotypes for gene: YARS2 were changed from 613561 Myopathy, lactic acidosis, and sideroblastic anemia 2; Myopathy, lactic acidosis, and sideroblastic anemia 2, 613561 to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.56 | YARS2 | Zornitza Stark Publications for gene: YARS2 were set to 23918765; 22504945; 20598274 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.142 | VACTERLX | Bryony Thompson Marked STR: VACTERLX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.142 | VACTERLX | Bryony Thompson Str: vacterlx has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.142 | VACTERLX |
Bryony Thompson STR: VACTERLX was added STR: VACTERLX was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: VACTERLX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: VACTERLX were set to 20452998; 32639022 Phenotypes for STR: VACTERLX were set to VACTERL association, X-linked MIM#314390 Review for STR: VACTERLX was set to RED Added comment: NM_003413.4(ZIC3):c.163GCC[X] PMID: 20452998 - reports a single case with VACTERL association and an expansion of the poly-Ala tract from 10 to 12 alanines. PMID: 32639022 - a family with Oculo-auriculo-vertebral spectrum (OAVS) segregates the 11 alanine expansion in affected males This polyalanine tract is highly polymorphic in gnomAD v2.1, there are 86 hemizygote 12 alanine expansions present and 65 hemizygotes with the 11 alanine expansion. The 13 polyalanine expansion is also present in 13 hemizygotes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9091 | PDGFRL | Michelle Torres reviewed gene: PDGFRL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.141 | FRA12A | Bryony Thompson Marked STR: FRA12A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.141 | FRA12A | Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.141 | FRA12A | Bryony Thompson Classified STR: FRA12A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.141 | FRA12A | Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.140 | FRA12A |
Bryony Thompson STR: FRA12A was added STR: FRA12A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA12A were set to 17236128 Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630 Review for STR: FRA12A was set to AMBER Added comment: NM_173602.2:c.-137CGG[X] All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp. 70 controls used to determine the "normal" repeat range. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.55 | XK | Danielle Ariti reviewed gene: XK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8004674, 30128557, 30800707; Phenotypes: McLeod syndrome with or without chronic granulomatous disease MIM# 300842, absence of red blood cell Kx antigen, weak expression of Kell red blood cell antigens, neuroacanthocytosis (peripheral and central nervous systems), cardiovascular abnormalities, myopathy; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.139 | FRA11A | Bryony Thompson Marked STR: FRA11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.139 | FRA11A | Bryony Thompson Str: fra11a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.139 | FRA11A |
Bryony Thompson STR: FRA11A was added STR: FRA11A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA11A was set to Unknown Publications for STR: FRA11A were set to 18160775; 453198 Phenotypes for STR: FRA11A were set to Intellectual disability Review for STR: FRA11A was set to RED Added comment: Expansion of a polymorphic CGG-repeat located at the 5' end of the C11orf80 gene causes expression of the folate-sensitive fragile site FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. The expansion was identified in the 15-year-old proband with intellectual disability as well as in phenotypically normal members of the family. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.55 | YARS2 | Danielle Ariti reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.138 | TOF | Bryony Thompson Marked STR: TOF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.138 | TOF | Bryony Thompson Str: tof has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.138 | TOF | Bryony Thompson Classified STR: TOF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.138 | TOF | Bryony Thompson Str: tof has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.137 | TOF |
Bryony Thompson STR: TOF was added STR: TOF was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: TOF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: TOF were set to 19948535; 11748311 Phenotypes for STR: TOF were set to Tetralogy of Fallot MIM#187500 Review for STR: TOF was set to GREEN STR: TOF was marked as clinically relevant Added comment: Poly-alanine tract expansion. In vitro functional assays demonstrated the expansion lead to protein aggregation in cells. Two unrelated cases reported with 25 repeats, one case with isolated interrupted aortic arch and one case with scoliosis, facial asymmetry, upslanting palpebral fissures, absent PV, isolated left pulmonary artery (expected de novo - excluded in mother and father not available for testing). Other variant types cause disease in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deafness_IsolatedAndComplex v1.90 | MAP1B |
Elena Savva gene: MAP1B was added gene: MAP1B was added to Deafness_IsolatedAndComplex. Sources: Literature Mode of inheritance for gene: MAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAP1B were set to PMID: 33268592 Phenotypes for gene: MAP1B were set to Periventricular nodular heterotopia 9 MIM#618918; sensorineural hearing loss Review for gene: MAP1B was set to GREEN Added comment: PMID: 33268592 - three unrelated patients with heterozygous missense variants and nonsyndromic sensorineural hearing loss. Functional studies on one missense show reduced protein expression and less phosphorylation. Variant correction via CRISPR rescued cell dysfunction, and K/O mice show hearing loss Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.136 | FRAXF | Bryony Thompson Marked STR: FRAXF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.136 | FRAXF | Bryony Thompson Str: fraxf has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.136 | FRAXF |
Bryony Thompson STR: FRAXF was added STR: FRAXF was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRAXF was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: FRAXF were set to 7874164; 10094554; 8651274 Phenotypes for STR: FRAXF were set to Intellectual disability Review for STR: FRAXF was set to RED Added comment: FRAXF is a folate-sensitive fragile site, where expansion was identified in a male with developmental delay. However, further studies found that expression of the fragile site through expansion is not associated with a disease phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Marked gene: UBE2U as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Classified gene: UBE2U as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.287 | UBE2U | Zornitza Stark Marked gene: UBE2U as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.287 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.287 | UBE2U | Zornitza Stark Classified gene: UBE2U as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.287 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9091 | IFIH1 | Zornitza Stark Marked gene: IFIH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9091 | IFIH1 | Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9091 | IFIH1 | Zornitza Stark Phenotypes for gene: IFIH1 were changed from to Aicardi-Goutieres syndrome 7, MIM#615846; Early-onset Inflammatory Bowel Disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9090 | IFIH1 | Zornitza Stark Publications for gene: IFIH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9089 | IFIH1 | Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1191 | PRICKLE2 |
Zornitza Stark gene: PRICKLE2 was added gene: PRICKLE2 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRICKLE2 were set to 34092786 Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms Review for gene: PRICKLE2 was set to GREEN Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.135 | FRA11B | Bryony Thompson Classified STR: FRA11B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.135 | FRA11B | Bryony Thompson Added comment: Comment on list classification: Low evidence of clinical relevance of expression of the fragile site. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.135 | FRA11B | Bryony Thompson Str: fra11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.134 | FRA11B |
Bryony Thompson STR: FRA11B was added STR: FRA11B was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA11B were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933 Phenotypes for STR: FRA11B were set to Jacobsen syndrome MIM#147791 Review for STR: FRA11B was set to AMBER Added comment: FRA11B is a rare folate sensitive fragile site caused by expansion of (CCG)n in the 5'UTR of CBL, and hypermethylation of adjacent CpG islands. There are commonly 11 repeats. The pre-mutation ranges from 80-100, while >100 leads to expression of the fragile site. Two cases of Jacobsen (llq-) syndrome, which is the clinical presentation of the loss of part of the long arm of chromosome 11, have been associated with the FRA11B repeat expansion (expected breakpoint). The estimated prevalence of the FRA11B expansion is 1 in 5,000, which the estimated prevalence of Jacobsen syndrome is <1 in 100,000. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4104 | PRICKLE2 |
Hazel Phillimore gene: PRICKLE2 was added gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRICKLE2 were set to PMID: 34092786 Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms Review for gene: PRICKLE2 was set to GREEN Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.59 | IFIH1 |
Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant. Sources: Literature; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified. Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant. Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9088 | IFIH1 |
Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified. Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant. Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9088 | IFIH1 |
Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9088 | PRICKLE2 |
Hazel Phillimore changed review comment from: Six subjects from four unrelated families with heterozygous variants (two de novo missense (c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg)), one de novo nonsense variant (c.214 C>T; p.(Arg72*) and one frameshift variant (c.1286_1287delGT; p.(Ser429Thrfs*56)) which segregated with the disease in three affected females. Loss-of-function (homozygous) variants cause seizures in flies, and both heterozygous and homozygous mice showed behavioral abnormalities including altered social interaction, learning abnormalities, and behavioural inflexibility. PubMed: 21276947.; to: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PubMed: 21276947). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Marked gene: IFIH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Classified gene: IFIH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9088 | IFIH1 | Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Inflammatory bowel disease v0.58 | IFIH1 |
Sarah Pantaleo gene: IFIH1 was added gene: IFIH1 was added to Inflammatory bowel disease. Sources: Literature Mode of inheritance for gene: IFIH1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: IFIH1 were set to 34185153 Phenotypes for gene: IFIH1 were set to Inflammatory Bowel Disease Penetrance for gene: IFIH1 were set to Incomplete Review for gene: IFIH1 was set to GREEN Added comment: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9088 | FGF8 | Zornitza Stark Marked gene: FGF8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9088 | FGF8 | Zornitza Stark Gene: fgf8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9088 | FGF8 | Zornitza Stark Phenotypes for gene: FGF8 were changed from to Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Femoral hypoplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9087 | FGF8 | Zornitza Stark Publications for gene: FGF8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9086 | FGF8 | Zornitza Stark Mode of inheritance for gene: FGF8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Susceptibility to Viral Infections v0.77 | IFIH1 | Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9085 | FGF8 | Zornitza Stark Tag SV/CNV tag was added to gene: FGF8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9085 | FGF8 | Zornitza Stark reviewed gene: FGF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cataract v0.286 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Cataract. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9085 | UBE2U | Zornitza Stark Marked gene: UBE2U as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9085 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9085 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9085 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9085 | PRICKLE2 | Zornitza Stark Phenotypes for gene: PRICKLE2 were changed from to Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9084 | PRICKLE2 | Zornitza Stark Publications for gene: PRICKLE2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4104 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9083 | PRICKLE2 | Zornitza Stark Mode of inheritance for gene: PRICKLE2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Marked gene: COPB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9082 | PRICKLE2 | Hazel Phillimore reviewed gene: PRICKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34092786; Phenotypes: Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9082 | UBE2U |
Ee Ming Wong changed review comment from: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature; to: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Marked gene: CACNA1I as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Classified gene: CACNA1I as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Marked gene: CACNA1I as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Classified gene: CACNA1I as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Marked gene: GRIK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9082 | UBE2U | Zornitza Stark Classified gene: UBE2U as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9082 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4102 | COPB2 |
Belinda Chong gene: COPB2 was added gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COPB2 were set to PMID: 34450031 Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay Review for gene: COPB2 was set to AMBER Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis 3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Classified gene: GRIK2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9081 | FGF8 | Dean Phelan reviewed gene: FGF8: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 34433009; Phenotypes: Femoral hypoplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9081 | LRP1 | Seb Lunke Marked gene: LRP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9081 | LRP1 | Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.4 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.4 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1188 | GRIK2 | Zornitza Stark Classified gene: GRIK2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1188 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9081 | LRP1 | Seb Lunke Classified gene: LRP1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9081 | LRP1 | Seb Lunke Added comment: Comment on list classification: Two papers without related phenotypes and little overall evidence for gene disease association. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9081 | LRP1 | Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.4 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.4 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9080 | COPB2 | Zornitza Stark Phenotypes for gene: COPB2 were changed from Microcephaly 19, primary, autosomal recessive, MIM# 617800 to Microcephaly 19, primary, autosomal recessive, MIM# 617800; Osteoporosis and developmental delay | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9079 | COPB2 | Zornitza Stark Publications for gene: COPB2 were set to 29036432 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9078 | COPB2 | Zornitza Stark Mode of inheritance for gene: COPB2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1187 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9077 | COPB2 | Zornitza Stark Classified gene: COPB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9077 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4102 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9076 | CACNA1I | Seb Lunke Marked gene: CACNA1I as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9076 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1187 | GRIK2 |
Danielle Ariti gene: GRIK2 was added gene: GRIK2 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: GRIK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: GRIK2 were set to 34375587; 17847003; 25039795 Phenotypes for gene: GRIK2 were set to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD) Review for gene: GRIK2 was set to GREEN Added comment: Over 10 individuals with variants in GRIK2; Bi-allelic and mono-allelic; loss of function 2 (sibs) with bi-allelic truncating variants and 1 family with bi-allelic deletion (removing exons 7 and 8). 11 individuals with de novo mono-allelic missense variants (5x with the same missense variant c.1969G>A (p.Ala657Thr) all the others were near this location). Associated with nonsyndromic neurodevelopmental disorder (NDD) with intellectual disability and developmental delay as core features with 30-50% individuals experiencing seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9076 | CACNA1I | Seb Lunke Classified gene: CACNA1I as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9076 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4102 | GRIK2 | Zornitza Stark Marked gene: GRIK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4102 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4102 | GRIK2 | Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Mendeliome. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4101 | GRIK2 | Zornitza Stark Publications for gene: GRIK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.3 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Growth failure. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to AMBER gene: ZNF668 was marked as current diagnostic Added comment: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | LRP1 | Elena Savva reviewed gene: LRP1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 26142438, 33776059; Phenotypes: ?Keratosis pilaris atrophicans MIM#604093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4100 | GRIK2 | Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | COPB2 | Belinda Chong reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34450031; Phenotypes: Osteoporosis and developmental delay; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4099 | GRIK2 | Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | GRIK2 | Zornitza Stark Marked gene: GRIK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | CFAP206 | Seb Lunke Marked gene: CFAP206 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | CFAP206 | Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9075 | GRIK2 | Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; Nonsyndromic neurodevelopmental disorder, autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9074 | CFAP206 | Seb Lunke Publications for gene: CFAP206 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9073 | GRIK2 | Zornitza Stark Publications for gene: GRIK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9072 | GRIK2 | Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9071 | CFAP206 | Seb Lunke Classified gene: CFAP206 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9071 | CFAP206 | Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9070 | CFAP206 | Seb Lunke Phenotypes for gene: CFAP206 were changed from Multiple morphological abnormalities of the fagella to Multiple morphological abnormalities of the flagella | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.45 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.45 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.45 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.45 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9069 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9069 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9069 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9069 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9068 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9068 | GRIK2 | Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 | Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.44 | ZNF668 | Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.44 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9068 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Marked gene: LAMA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Classified gene: LAMA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Classified gene: LAMA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9068 | GLIS1 | Seb Lunke Marked gene: GLIS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9068 | GLIS1 | Seb Lunke Gene: glis1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microcephaly v1.44 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9068 | GLIS1 | Seb Lunke Phenotypes for gene: GLIS1 were changed from Increased ocular pressure to Increased ocular pressure; Glaucoma | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Joubert syndrome and other neurological ciliopathies v1.13 | LAMA1 |
Zornitza Stark gene: LAMA1 was added gene: LAMA1 was added to Joubert syndrome and other neurological ciliopathies. Sources: Literature Mode of inheritance for gene: LAMA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LAMA1 were set to 34423300 Phenotypes for gene: LAMA1 were set to Poretti-Boltshauser syndrome, MIM# 615960 Review for gene: LAMA1 was set to GREEN Added comment: Four families with Poretti-Bolthauser syndrome identified in a cohort of 'unsolved' Joubert syndrome patients -- included due to phenotypic overlap. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9067 | GLIS1 |
Seb Lunke changed review comment from: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described. Sources: Literature; to: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described. The authors did show dysregulation of GLIS1 in a human cell line study, and performed linkage analysis suggesting an association of the GLIS1 locus with Glaucoma in UK biobank samples. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9067 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9067 | CFAP206 |
Ain Roesley gene: CFAP206 was added gene: CFAP206 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CFAP206 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFAP206 were set to Multiple morphological abnormalities of the fagella Penetrance for gene: CFAP206 were set to unknown Review for gene: CFAP206 was set to AMBER Added comment: 1x hom with a fs variant Sperm from knockout mouse model mainly had a fagellum of normal length but most of them showed abnormal forms including bent and coiled fagella. There was also a significant increase of sperm cells with absent or short fagella compared to the WT mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9067 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Marked gene: SLC32A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1186 | SLC32A1 |
Zornitza Stark gene: SLC32A1 was added gene: SLC32A1 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC32A1 were set to 34038384 Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus Review for gene: SLC32A1 was set to GREEN Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9067 | SLC32A1 | Zornitza Stark Marked gene: SLC32A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9067 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9067 | GLIS1 |
Seb Lunke gene: GLIS1 was added gene: GLIS1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: GLIS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GLIS1 were set to 34385434 Phenotypes for gene: GLIS1 were set to Increased ocular pressure Review for gene: GLIS1 was set to RED Added comment: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9066 | SLC32A1 | Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9066 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9065 | SLC32A1 |
Zornitza Stark gene: SLC32A1 was added gene: SLC32A1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC32A1 were set to 34038384 Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus Review for gene: SLC32A1 was set to GREEN Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.55 | GATA1 | Zornitza Stark Marked gene: GATA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.55 | GATA1 | Zornitza Stark Gene: gata1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.55 | GATA1 | Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 to Thrombocytopaenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.54 | GATA1 | Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anemia 300367; 300367 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; Myelodysplastic syndrome (MDS), Paediatric; Diamond-Blackfan anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities 300835; Diamond Blackfan Anaemia; 300835 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; 300367 Diamond Blackfan Anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities; Thrombocytopenia, X-linked, with or without dyserythropoietic anemia, 300367 to Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.53 | GATA1 | Zornitza Stark edited their review of gene: GATA1: Changed publications: 30228860, 24766296, 22706301 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.53 | GATA1 | Zornitza Stark edited their review of gene: GATA1: Changed phenotypes: Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9064 | G6PD | Zornitza Stark Marked gene: G6PD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9064 | G6PD | Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9064 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9063 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from to Haemolytic anemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9062 | G6PD | Zornitza Stark Publications for gene: G6PD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9061 | G6PD | Zornitza Stark Mode of inheritance for gene: G6PD was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9060 | G6PD | Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: 18177777; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.53 | G6PD | Zornitza Stark Marked gene: G6PD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.53 | G6PD | Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.53 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.52 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from 300908 Hemolytic anemia, G6PD deficient (favism); Enzyme Disorder; 300908 Hemolytic anemia due to G6PD deficiency; Hemolytic anemia due to G6PD deficiency, 300908 to Haemolytic anemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.51 | G6PD | Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9060 | EPB42 | Zornitza Stark Marked gene: EPB42 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9060 | EPB42 | Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9060 | EPB42 | Zornitza Stark Phenotypes for gene: EPB42 were changed from to Spherocytosis, type 5, MIM# 612690 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9059 | EPB42 | Zornitza Stark Publications for gene: EPB42 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9058 | EPB42 | Zornitza Stark Mode of inheritance for gene: EPB42 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9057 | EPB42 | Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.51 | EPB42 | Zornitza Stark Marked gene: EPB42 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.51 | EPB42 | Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.51 | EPB42 | Zornitza Stark Phenotypes for gene: EPB42 were changed from Spherocytosis, type 5, 612690; 612690 Hereditary spherocytosis type 5; RBC membrane abnormality; Hereditary spherocytosis type 5; 612690 Spherocytosis, type 5; EPB42-related hereditary spherocytosis; Minkowski-Chauffard disease; Spherocytosis, Recessive; Elliptocytosis to Spherocytosis, type 5, MIM# 612690 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.50 | EPB42 | Zornitza Stark Publications for gene: EPB42 were set to 12176912; 7772513; 1558976 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.49 | EPB42 | Zornitza Stark edited their review of gene: EPB42: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.49 | EPB42 | Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9057 | EPB41 | Zornitza Stark Marked gene: EPB41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9057 | EPB41 | Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9057 | EPB41 | Zornitza Stark Phenotypes for gene: EPB41 were changed from to Elliptocytosis-1, MIM# 611804 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9056 | EPB41 | Zornitza Stark Publications for gene: EPB41 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9055 | EPB41 | Zornitza Stark Mode of inheritance for gene: EPB41 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9054 | EPB41 | Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.49 | EPB41 | Zornitza Stark Marked gene: EPB41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.49 | EPB41 | Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.49 | EPB41 | Zornitza Stark Phenotypes for gene: EPB41 were changed from Elliptocytosis-1,611804; RBC membrane abnormality; 611804 Hereditary elliptocytosis; 611804 Elliptocytosis-1; Elliptocytosis; Hereditary elliptocytosis to Elliptocytosis-1, MIM# 611804 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.48 | EPB41 | Zornitza Stark Publications for gene: EPB41 were set to 8423235; 1430200; 3134067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.47 | EPB41 | Zornitza Stark Mode of inheritance for gene: EPB41 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.46 | EPB41 | Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9054 | DHFR | Zornitza Stark Marked gene: DHFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9054 | DHFR | Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9054 | DHFR | Zornitza Stark Phenotypes for gene: DHFR were changed from to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9053 | DHFR | Zornitza Stark Publications for gene: DHFR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9052 | DHFR | Zornitza Stark Mode of inheritance for gene: DHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9051 | DHFR | Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.46 | DHFR | Zornitza Stark Marked gene: DHFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.46 | DHFR | Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.46 | DHFR | Zornitza Stark Phenotypes for gene: DHFR were changed from Megaloblastic anemia due to dihydrofolate reductase deficiency, 613839; 613839 Megaloblastic anemia due to dihydrofolate reductase deficiency to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.45 | DHFR | Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9051 | CYB5R3 | Zornitza Stark Marked gene: CYB5R3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9051 | CYB5R3 | Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9051 | CYB5R3 | Zornitza Stark Phenotypes for gene: CYB5R3 were changed from to Methaemoglobinaemia, type I and II, MIM# 250800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9050 | CYB5R3 | Zornitza Stark Publications for gene: CYB5R3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9049 | CYB5R3 | Zornitza Stark Mode of inheritance for gene: CYB5R3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9048 | CYB5R3 | Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methaemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.45 | CYB5R3 | Zornitza Stark Marked gene: CYB5R3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.45 | CYB5R3 | Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.45 | CYB5R3 | Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methemoglobinaemia, type I and II, MIM# 250800 to Methaemoglobinaemia, type I and II, MIM# 250800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.44 | CYB5R3 | Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methaemoglobinaemia; 250800 Methemoglobinemia; Methaemoglobinaemia type I and II, 250800; 250800 Methaemoglobinaemia type I and II to Methemoglobinaemia, type I and II, MIM# 250800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.43 | CYB5R3 | Zornitza Stark Publications for gene: CYB5R3 were set to 18318771; 15921385 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.42 | CYB5R3 | Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Classified STR: NIPA1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Added comment: Comment on list classification: This is an association/risk allele rather than high-risk disease-causing expansion, and not useful in the clinical diagnostic setting. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Classified STR: NIPA1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.131 | NIPA1 |
Bryony Thompson STR: NIPA1 was added STR: NIPA1 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: NIPA1 was set to Unknown Publications for STR: NIPA1 were set to 30342764; 22378146 Phenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis Review for STR: NIPA1 was set to GREEN Added comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.42 | CUBN | Zornitza Stark Marked gene: CUBN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.42 | CUBN | Zornitza Stark Gene: cubn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.42 | CUBN | Zornitza Stark Phenotypes for gene: CUBN were changed from Megaloblastic anemia-1, Finnish type, 261100; Megaloblastic Anemia; 261100 Megaloblastic anemia-1, Finnish type to Imerslund-Grasbeck syndrome 1, MIM# 261100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.41 | CUBN | Zornitza Stark Publications for gene: CUBN were set to 17285242; 15024727 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.40 | CUBN | Zornitza Stark reviewed gene: CUBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10080186, 21208123, 17668238]; Phenotypes: Imerslund-Grasbeck syndrome 1, MIM# 261100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.40 | COX4I2 | Zornitza Stark changed review comment from: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs).; to: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs). Note no other variants reported in this gene since original report in 2009. All variants submitted to ClinVar are VOUS/LB/B. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.40 | COX4I2 | Zornitza Stark Marked gene: COX4I2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.40 | COX4I2 | Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.40 | COX4I2 | Zornitza Stark Phenotypes for gene: COX4I2 were changed from Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, 612714; 612714 Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, andCalvarial Hyperostosis; 612714 Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.39 | COX4I2 | Zornitza Stark Publications for gene: COX4I2 were set to 19268275 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.38 | COX4I2 | Zornitza Stark Classified gene: COX4I2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.38 | COX4I2 | Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.37 | COX4I2 | Zornitza Stark reviewed gene: COX4I2: Rating: RED; Mode of pathogenicity: None; Publications: 19268275, 22730437; Phenotypes: Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.37 | CDAN1 | Zornitza Stark Marked gene: CDAN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.37 | CDAN1 | Zornitza Stark Gene: cdan1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.37 | CDAN1 | Zornitza Stark Phenotypes for gene: CDAN1 were changed from 224120 Dyserythropoietic anemia, congenital, type Ia; 224120 Congenital dyserythropoietic anaemia type 1a; Dyserythropoietic anemia, congenital, type Ia, 224120 to Dyserythropoietic anaemia, congenital, type Ia, 224120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.36 | CDAN1 | Zornitza Stark Publications for gene: CDAN1 were set to 16098079; 12434312 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.35 | CDAN1 | Zornitza Stark edited their review of gene: CDAN1: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ia, 224120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.35 | ALDOA | Zornitza Stark Marked gene: ALDOA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.35 | ALDOA | Zornitza Stark Gene: aldoa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.35 | ALDOA | Zornitza Stark Phenotypes for gene: ALDOA were changed from Enzyme Disorder; Glycogen storage disease; Aldolase A deficiency; 611881 Aldolase A deficiency; 611881 Glycogen storage disease XII; Glycogen storage disease XII, 611881; Glycogen storage disease due to aldolase A deficiency to Glycogen storage disease XII , MIM#611881 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.34 | ALDOA | Zornitza Stark Publications for gene: ALDOA were set to 8598869; 7331996 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.33 | ALDOA | Zornitza Stark reviewed gene: ALDOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7331996, 8598869, 25392908; Phenotypes: Glycogen storage disease XII , MIM#611881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9048 | CD59 | Zornitza Stark Marked gene: CD59 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9048 | CD59 | Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9048 | CD59 | Zornitza Stark Phenotypes for gene: CD59 were changed from to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9047 | CD59 | Zornitza Stark Publications for gene: CD59 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9046 | CD59 | Zornitza Stark Mode of inheritance for gene: CD59 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.33 | CD59 |
Zornitza Stark changed review comment from: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.; to: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis. More than 5 unrelated families reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9045 | CD59 | Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.33 | CD59 | Zornitza Stark Marked gene: CD59 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.33 | CD59 | Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.33 | CD59 | Zornitza Stark Phenotypes for gene: CD59 were changed from Dyskeratosis congenita, X-linked, 305000; 305000 Dyskeratosis congenita, X-linked to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.32 | CD59 | Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.32 | C15orf41 | Zornitza Stark Marked gene: C15orf41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.32 | C15orf41 | Zornitza Stark Gene: c15orf41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.32 | C15orf41 | Zornitza Stark Phenotypes for gene: C15orf41 were changed from 615631 Congenital dyserythropoietic anaemia type 1b; Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib; 615631 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib, 615631 to Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.31 | C15orf41 | Zornitza Stark Publications for gene: C15orf41 were set to 29031773; 23716552; 29885034 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.30 | C15orf41 | Zornitza Stark edited their review of gene: C15orf41: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Marked STR: HSAN8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Classified STR: HSAN8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.129 | HSAN8 |
Bryony Thompson STR: HSAN8 was added STR: HSAN8 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: HSAN8 were set to 26005867 Phenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488 Review for STR: HSAN8 was set to GREEN STR: HSAN8 was marked as clinically relevant Added comment: NM_021619.3(PRDM12):c.1041CGC[X] Poly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.128 | RCPS |
Bryony Thompson changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.128 | RCPS | Bryony Thompson Marked STR: RCPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.128 | RCPS | Bryony Thompson Str: rcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.128 | RCPS | Bryony Thompson Classified STR: RCPS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.128 | RCPS | Bryony Thompson Str: rcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.127 | RCPS |
Bryony Thompson STR: RCPS was added STR: RCPS was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: RCPS were set to 24360810; 29112243 Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: RCPS was set to GREEN STR: RCPS was marked as clinically relevant Added comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.30 | SYNCRIP | Zornitza Stark Marked gene: SYNCRIP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.30 | SYNCRIP | Zornitza Stark Gene: syncrip has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.30 | SYNCRIP |
Zornitza Stark gene: SYNCRIP was added gene: SYNCRIP was added to Periventricular Grey Matter Heterotopia. Sources: Literature Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SYNCRIP were set to 34157790 Phenotypes for gene: SYNCRIP were set to SYNCRIP-related neurodevelopmental disorder Review for gene: SYNCRIP was set to RED Added comment: One of 8 individuals reported so far had PVNH. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9045 | NEDD4L | Zornitza Stark Marked gene: NEDD4L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9045 | NEDD4L | Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9045 | NEDD4L | Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9044 | NEDD4L | Zornitza Stark Publications for gene: NEDD4L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9043 | NEDD4L | Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9042 | NEDD4L | Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.29 | NEDD4L | Zornitza Stark Marked gene: NEDD4L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.29 | NEDD4L | Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.29 | NEDD4L | Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.28 | NEDD4L | Zornitza Stark Publications for gene: NEDD4L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.27 | NEDD4L | Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.27 | NEDD4L | Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.26 | NEDD4L | Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Marked STR: MEDPSACH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Str: medpsach has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Classified STR: MEDPSACH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Str: medpsach has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.125 | MEDPSACH |
Bryony Thompson STR: MEDPSACH was added STR: MEDPSACH was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: MEDPSACH were set to 9887340; 17133256; 21922596 Phenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170 Review for STR: MEDPSACH was set to GREEN STR: MEDPSACH was marked as clinically relevant STR: MEDPSACH was marked as current diagnostic Added comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.26 | FLNA | Zornitza Stark Marked gene: FLNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.26 | FLNA | Zornitza Stark Gene: flna has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.26 | FLNA | Zornitza Stark Phenotypes for gene: FLNA were changed from to Heterotopia, periventricular, 1 , MIM#300049 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.25 | FLNA | Zornitza Stark Publications for gene: FLNA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.24 | FLNA | Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.23 | FLNA | Zornitza Stark reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: 9883725, 15668422, 15994863; Phenotypes: Heterotopia, periventricular, 1 , MIM#300049; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Marked gene: ARF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.22 | DCHS1 | Zornitza Stark Marked gene: DCHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.22 | DCHS1 | Zornitza Stark Gene: dchs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.22 | DCHS1 | Zornitza Stark Phenotypes for gene: DCHS1 were changed from to Van Maldergem syndrome 1, MIM# 601390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.21 | DCHS1 | Zornitza Stark Publications for gene: DCHS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.20 | DCHS1 | Zornitza Stark Mode of inheritance for gene: DCHS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.19 | DCHS1 | Zornitza Stark reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Classified gene: ARF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1184 | ARF1 |
Zornitza Stark gene: ARF1 was added gene: ARF1 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARF1 were set to 28868155; 34353862 Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185 Review for gene: ARF1 was set to GREEN Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Marked gene: ARF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Classified gene: ARF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4097 | ARF1 |
Zornitza Stark gene: ARF1 was added gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARF1 were set to 28868155; 34353862 Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185 Review for gene: ARF1 was set to GREEN Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.19 | ARF1 | Zornitza Stark changed review comment from: Additional reported of affected parent and child.; to: Additional report of affected parent and child. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.19 | ARF1 | Zornitza Stark commented on gene: ARF1: Additional reported of affected parent and child. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Periventricular Grey Matter Heterotopia v0.19 | ARF1 | Zornitza Stark edited their review of gene: ARF1: Changed publications: 28868155, 34353862; Changed phenotypes: Periventricular nodular heterotopia 8, MIM# 618185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9042 | ARF1 | Zornitza Stark Publications for gene: ARF1 were set to 28868155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Craniosynostosis v1.25 | GINS2 | Zornitza Stark Marked gene: GINS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Craniosynostosis v1.25 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Craniosynostosis v1.25 | GINS2 |
Zornitza Stark gene: GINS2 was added gene: GINS2 was added to Craniosynostosis. Sources: Literature Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GINS2 were set to 34353863 Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis Review for gene: GINS2 was set to RED Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.3 | GINS2 | Zornitza Stark Marked gene: GINS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.3 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.3 | GINS2 |
Zornitza Stark gene: GINS2 was added gene: GINS2 was added to Growth failure. Sources: Literature Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GINS2 were set to 34353863 Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis Review for gene: GINS2 was set to RED Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9041 | GINS2 | Zornitza Stark Marked gene: GINS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9041 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9041 | GINS2 | Zornitza Stark Classified gene: GINS2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9041 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.30 | ANK1 | Zornitza Stark Marked gene: ANK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.30 | ANK1 | Zornitza Stark Gene: ank1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.30 | ANK1 | Zornitza Stark Phenotypes for gene: ANK1 were changed from Spherocytosis, type 1; Spherocytosis, type 1,182900; RBC membrane abnormality; 182900 Spherocytosis, type 1; 182900 RBC membrane abnormality to Spherocytosis, type 1, MIM# 182900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.29 | ANK1 | Zornitza Stark Publications for gene: ANK1 were set to 7883994; 9590147; 11167760 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.28 | ANK1 | Zornitza Stark reviewed gene: ANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8640229; Phenotypes: Spherocytosis, type 1, MIM# 182900; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9040 | AMN | Zornitza Stark Marked gene: AMN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9040 | AMN | Zornitza Stark Gene: amn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9040 | AMN | Zornitza Stark Phenotypes for gene: AMN were changed from to Imerslund-Grasbeck syndrome 2, MIM# 618882 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9039 | AMN | Zornitza Stark Publications for gene: AMN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9038 | AMN | Zornitza Stark Mode of inheritance for gene: AMN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9037 | AMN | Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.28 | AMN | Zornitza Stark Marked gene: AMN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.28 | AMN | Zornitza Stark Gene: amn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.28 | AMN | Zornitza Stark Phenotypes for gene: AMN were changed from 261100 Megaloblastic anemia-1, Norwegian type; Megaloblastic anemia-1, Norwegian type, 261100 to Imerslund-Grasbeck syndrome 2, MIM# 618882 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.27 | AMN | Zornitza Stark Publications for gene: AMN were set to 17285242; 12590260 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.26 | AMN | Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.124 | DMD | Bryony Thompson Marked STR: DMD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.124 | DMD | Bryony Thompson Str: dmd has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.124 | DMD |
Bryony Thompson STR: DMD was added STR: DMD was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: DMD was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: DMD were set to 27417533 Phenotypes for STR: DMD were set to Duchenne muscular dystrophy MIM#310200; Becker muscular dystrophy MIM#300376 Review for STR: DMD was set to RED Added comment: Single family reported with GAA repeat expansion in intron 62. Normal repeat range 11-33 in healthy controls. Expanded repeats range from 59-82 in the family, with 2 female carriers manifesting symptoms, a male foetus, 2 asymptomatic female carriers, and 2 male asymptomatic carriers ages 6 and 4 years. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9037 | AK1 | Zornitza Stark Marked gene: AK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9037 | AK1 | Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9037 | AK1 | Zornitza Stark Phenotypes for gene: AK1 were changed from to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9036 | AK1 | Zornitza Stark Publications for gene: AK1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9035 | AK1 | Zornitza Stark Mode of inheritance for gene: AK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9034 | AK1 | Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.26 | AK1 | Zornitza Stark Marked gene: AK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.26 | AK1 | Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.26 | AK1 | Zornitza Stark Phenotypes for gene: AK1 were changed from 612631 Hemolytic anemia due to adenylate kinase deficiency; Hemolytic anemia due to adenylate kinase deficiency, 612631 to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.25 | AK1 | Zornitza Stark Publications for gene: AK1 were set to 28211224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.24 | AK1 | Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9034 | ALAS2 | Zornitza Stark Marked gene: ALAS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9034 | ALAS2 | Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9034 | ALAS2 | Zornitza Stark Phenotypes for gene: ALAS2 were changed from to Anaemia, sideroblastic, 1, MIM# 300751; Protoporphyria, erythropoietic, X-linked, MIM# 300752 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9033 | ALAS2 | Zornitza Stark Publications for gene: ALAS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9032 | ALAS2 | Zornitza Stark Mode of inheritance for gene: ALAS2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9031 | ALAS2 | Zornitza Stark reviewed gene: ALAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10029606, 7949148, 10029606, 25615817; Phenotypes: Anaemia, sideroblastic, 1, MIM# 300751, Protoporphyria, erythropoietic, X-linked, MIM# 300752; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.24 | ALAS2 | Zornitza Stark Marked gene: ALAS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.24 | ALAS2 | Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.24 | ALAS2 | Zornitza Stark Phenotypes for gene: ALAS2 were changed from Anemia, sideroblastic, 1 300751; Anemia, sideroblastic, 1, 300751; 300751 Sideroblastic anaemia 1; 300751 Anemia, sideroblastic, 1 to Anaemia, sideroblastic, 1, MIM# 300751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.23 | ALAS2 | Zornitza Stark Publications for gene: ALAS2 were set to 10029606 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.22 | ALAS2 |
Zornitza Stark edited their review of gene: ALAS2: Added comment: The essential features of X-linked sideroblastic anemia include: (1) a hypochromic microcytic anaemia and 2 discrete populations of red blood cells, one microcytic and the other normocytic; (2) marrow ringed sideroblasts, particularly prominent in the late erythroid precursors; (3) a variable haematologic response to pharmacologic doses of pyridoxine; and (4) systemic iron overload secondary to chronic ineffective erythropoiesis. The age of clinical onset of the disorder can vary from in utero to the ninth decade. Well established gene-disease association.; Changed publications: 10029606, 7949148, 10029606 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.22 | ALAS2 | Zornitza Stark edited their review of gene: ALAS2: Changed phenotypes: Anaemia, sideroblastic, 1, MIM# 300751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.22 | ABCG8 | Zornitza Stark Marked gene: ABCG8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.22 | ABCG8 | Zornitza Stark Gene: abcg8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.22 | ABCG8 | Zornitza Stark Phenotypes for gene: ABCG8 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolemia 1, MIM# 210250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.21 | ABCG8 | Zornitza Stark Publications for gene: ABCG8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.20 | ABCG8 | Zornitza Stark reviewed gene: ABCG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 33807969; Phenotypes: Sitosterolemia 1, MIM# 210250; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.20 | ADA2 | Zornitza Stark Marked gene: ADA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.20 | ADA2 | Zornitza Stark Gene: ada2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.20 | ADA2 | Zornitza Stark Phenotypes for gene: ADA2 were changed from Diamond Blackfan anaemia to Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome, MIM# 615688 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.19 | ADA2 | Zornitza Stark Publications for gene: ADA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.18 | ADA2 |
Zornitza Stark changed review comment from: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency. At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.; to: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency. At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population. Anaemia is a reported feature. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Familial hypercholesterolaemia v0.18 | ABCG5 | Zornitza Stark Marked gene: ABCG5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Familial hypercholesterolaemia v0.18 | ABCG5 | Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Familial hypercholesterolaemia v0.18 | ABCG5 | Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Familial hypercholesterolaemia v0.17 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Familial hypercholesterolaemia v0.16 | ABCG5 | Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Familial hypercholesterolaemia v0.15 | ABCG5 | Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9031 | ABCG5 | Zornitza Stark Marked gene: ABCG5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9031 | ABCG5 | Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9031 | ABCG5 | Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9030 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9029 | ABCG5 | Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9028 | ABCG5 | Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.18 | ABCG5 | Zornitza Stark Marked gene: ABCG5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.18 | ABCG5 | Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.18 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to 32546081; 23556150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.17 | ABCG5 | Zornitza Stark edited their review of gene: ABCG5: Changed publications: 34304999, 33907061, 32546081, 23556150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.17 | ABCG5 | Zornitza Stark Phenotypes for gene: ABCG5 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolaemia 2, MIM# 618666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.16 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.15 | ABCG5 | Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.2 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.368 | ABCB7 | Zornitza Stark Marked gene: ABCB7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.368 | ABCB7 | Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.368 | ABCB7 | Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.367 | ABCB7 | Zornitza Stark Phenotypes for gene: ABCB7 were changed from to Anaemia, sideroblastic, with ataxia, MIM# 301310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.366 | ABCB7 | Zornitza Stark Publications for gene: ABCB7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.366 | ABCB7 | Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.365 | ABCB7 | Zornitza Stark Classified gene: ABCB7 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.365 | ABCB7 | Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regression v0.364 | ABCB7 | Zornitza Stark reviewed gene: ABCB7: Rating: RED; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.14 | ABCB7 | Zornitza Stark Marked gene: ABCB7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.14 | ABCB7 | Zornitza Stark Gene: abcb7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.14 | ABCB7 | Zornitza Stark Phenotypes for gene: ABCB7 were changed from 301310 Sideroblastic anaemia; Anemia, sideroblastic, with ataxia; Anemia, sideroblastic, with ataxia, 301310; 301310 Sideroblastic Anemia and Ataxia; Sideroblastic Anemia and Ataxia to Anaemia, sideroblastic, with ataxia, MIM# 301310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.13 | ABCB7 | Zornitza Stark Publications for gene: ABCB7 were set to 11843825; 4045952; 11050011 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.12 | ABCB7 | Zornitza Stark reviewed gene: ABCB7: Rating: GREEN; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Red cell disorders v0.11 | Zornitza Stark Panel name changed from Rare anaemia_GEL to Red cell disorders | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.320 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1183 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1182 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9028 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9027 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4096 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4095 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4095 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.320 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Callosome v0.319 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1182 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic Epilepsy v0.1181 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9027 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9026 | CLCN3 | Zornitza Stark reviewed gene: CLCN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9026 | TOM1 | Zornitza Stark Marked gene: TOM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9026 | TOM1 | Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9026 | TOM1 |
Zornitza Stark gene: TOM1 was added gene: TOM1 was added to Mendeliome. Sources: Expert list Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TOM1 were set to 31263572 Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510 Review for gene: TOM1 was set to RED Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Combined Immunodeficiency v1.1 | TOM1 | Zornitza Stark Marked gene: TOM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Combined Immunodeficiency v1.1 | TOM1 | Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Combined Immunodeficiency v1.1 | TOM1 |
Zornitza Stark gene: TOM1 was added gene: TOM1 was added to Combined Immunodeficiency. Sources: Expert list Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TOM1 were set to 31263572 Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510 Review for gene: TOM1 was set to RED Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9025 | ARF1 | Arina Puzriakova reviewed gene: ARF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28868155, 34353862; Phenotypes: Periventricular nodular heterotopia 8, OMIM:618185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9025 | GINS2 |
Arina Puzriakova gene: GINS2 was added gene: GINS2 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GINS2 were set to 34353863 Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis Review for gene: GINS2 was set to RED Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9025 | DNAH10 | Zornitza Stark Phenotypes for gene: DNAH10 were changed from primary male infertility with asthenoteratozoospermia to Spermatogenic failure 56, MIM# 619515 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9024 | DNAH10 | Zornitza Stark reviewed gene: DNAH10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 56, MIM# 619515; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4095 | GNB2 | Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4094 | GNB2 | Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9024 | GNB2 | Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9023 | GNB2 | Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9023 | KIDINS220 | Zornitza Stark Phenotypes for gene: KIDINS220 were changed from Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; cerebral ventriculomegaly; limb contractures to Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; Ventriculomegaly and arthrogryposis, MIM# 619501 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9022 | KIDINS220 | Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296, Ventriculomegaly and arthrogryposis, MIM# 619501 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.94 | KIDINS220 | Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hydrocephalus_Ventriculomegaly v0.93 | KIDINS220 | Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.292 | KIDINS220 | Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.291 | KIDINS220 | Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.1 |
Zornitza Stark Panel name changed from Growth failure in early childhood to Growth failure Panel types changed to Victorian Clinical Genetics Services; Rare Disease |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.404 | ZFP57 | Zornitza Stark edited their review of gene: ZFP57: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.404 | ZFP57 | Zornitza Stark Marked gene: ZFP57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.404 | ZFP57 | Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.404 | ZFP57 | Zornitza Stark Phenotypes for gene: ZFP57 were changed from diabetes mellitus, transient neonatal, 1MONDO:0011073; Diabetes mellitus, transient neonatal 1 OMIM:601410; IUGR; Multi Locus Imprinting Disturbance to Diabetes mellitus, transient neonatal 1, MIM# 601410 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.403 | ZFP57 | Zornitza Stark Classified gene: ZFP57 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.403 | ZFP57 | Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.402 | ZFP57 | Zornitza Stark reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393; Phenotypes: Diabetes mellitus, transient neonatal 1, MIM# 601410; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Muscular dystrophy and myopathy_Paediatric v0.92 | GOSR2 | Bryony Thompson Classified gene: GOSR2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Muscular dystrophy and myopathy_Paediatric v0.92 | GOSR2 | Bryony Thompson Added comment: Comment on list classification: Additional cases reported with muscular dystrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Muscular dystrophy and myopathy_Paediatric v0.92 | GOSR2 | Bryony Thompson Gene: gosr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Muscular dystrophy and myopathy_Paediatric v0.91 | GOSR2 | Bryony Thompson reviewed gene: GOSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34167170, 33639315, 33639315, 29855340, DOI:https://doi.org/10.1016/j.nmd.2013.06.404; Phenotypes: Epilepsy, progressive myoclonic 6 MIM#614018, congenital muscluar dystrophy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.402 | PADI6 | Zornitza Stark Marked gene: PADI6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.402 | PADI6 | Zornitza Stark Gene: padi6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.402 | PADI6 | Zornitza Stark Phenotypes for gene: PADI6 were changed from miscarriages in the family; Preimplantation embryonic lethality 2 OMIM:617234; Short stature; preimplantation embryonic lethality 2 MONDO:0014978; Multi Locus Imprinting Disturbance; IUGR; Beckwith-Wiedemann syndrome to IUGR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.401 | PADI6 | Zornitza Stark Mode of inheritance for gene: PADI6 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.400 | PADI6 | Zornitza Stark reviewed gene: PADI6: Rating: AMBER; Mode of pathogenicity: None; Publications: 33221824, 32928291, 29574422; Phenotypes: IUGR; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.400 | NLRP7 | Zornitza Stark Marked gene: NLRP7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.400 | NLRP7 | Zornitza Stark Gene: nlrp7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.400 | NLRP7 | Zornitza Stark Phenotypes for gene: NLRP7 were changed from hydatidiform mole, recurrent, 1 MONDO:0009273; Short stature; fetal wastage; Hydatidiform mole, recurrent, 1 OMIM:231090; IUGR; Multi Locus Imprinting Disturbance to IUGR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.399 | NLRP7 | Zornitza Stark Mode of inheritance for gene: NLRP7 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.398 | NLRP7 | Zornitza Stark reviewed gene: NLRP7: Rating: AMBER; Mode of pathogenicity: None; Publications: 28561018; Phenotypes: IUGR; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Myopathy Superpanel v1.43 | Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Myopathy - adult onset; Muscular dystrophy_Paediatric; Rhabdomyolysis; Limb Girdle Muscular Dystrophy | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9022 | CHRM1 | Bryony Thompson Marked gene: CHRM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9022 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Marked gene: CHRM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4093 | CHRM1 |
Bryony Thompson gene: CHRM1 was added gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218 Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism Review for gene: CHRM1 was set to AMBER Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways. PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu) PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9022 | CHRM1 | Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9022 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9021 | CHRM1 |
Bryony Thompson gene: CHRM1 was added gene: CHRM1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218 Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism Review for gene: CHRM1 was set to AMBER Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways. PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu) PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9020 | FGF20 | Zornitza Stark Marked gene: FGF20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9020 | FGF20 | Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9020 | FGF20 | Zornitza Stark Classified gene: FGF20 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9020 | FGF20 | Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9019 | FGF20 |
Zornitza Stark gene: FGF20 was added gene: FGF20 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: FGF20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FGF20 were set to 22698282 Phenotypes for gene: FGF20 were set to Renal hypodysplasia/aplasia 2, MIM#615721 Review for gene: FGF20 was set to AMBER Added comment: Multiple affected fetuses in a consanguineous family; functional data. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9018 | ITGA8 | Zornitza Stark Marked gene: ITGA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9018 | ITGA8 | Zornitza Stark Gene: itga8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9018 | ITGA8 | Zornitza Stark Phenotypes for gene: ITGA8 were changed from to Renal hypodysplasia/aplasia 1, MIM# 191830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9017 | ITGA8 | Zornitza Stark Publications for gene: ITGA8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9016 | ITGA8 | Zornitza Stark Mode of inheritance for gene: ITGA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9015 | ITGA8 | Zornitza Stark reviewed gene: ITGA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 24439109; Phenotypes: Renal hypodysplasia/aplasia 1, MIM# 191830; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.87 | ITGA8 | Zornitza Stark Marked gene: ITGA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.87 | ITGA8 | Zornitza Stark Gene: itga8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.87 | ITGA8 | Zornitza Stark Phenotypes for gene: ITGA8 were changed from to Renal hypodysplasia/aplasia 1, MIM# 191830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.86 | ITGA8 | Zornitza Stark Publications for gene: ITGA8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.85 | ITGA8 | Zornitza Stark Mode of inheritance for gene: ITGA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Nonsyndromic v0.84 | ITGA8 | Zornitza Stark reviewed gene: ITGA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 24439109; Phenotypes: Renal hypodysplasia/aplasia 1, MIM# 191830; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Multiple epiphyseal dysplasia and pseudoachondroplasia v0.4 | Bryony Thompson Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.398 | NLRP5 | Zornitza Stark Marked gene: NLRP5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.398 | NLRP5 | Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.398 | NLRP5 | Zornitza Stark Phenotypes for gene: NLRP5 were changed from body asymmetry; Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR to Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.397 | NLRP5 | Zornitza Stark Mode of inheritance for gene: NLRP5 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.396 | NLRP5 | Zornitza Stark Classified gene: NLRP5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.396 | NLRP5 | Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.395 | NLRP5 |
Zornitza Stark changed review comment from: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP2 in the MOTHER of the patient. Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother. Current trio filtering protocols may not account for this adequately.; to: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP5 in the MOTHER of the patient. Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother. Current trio filtering protocols may not account for this adequately. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.395 | NLRP5 | Zornitza Stark reviewed gene: NLRP5: Rating: AMBER; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: IUGR; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.395 | STAT3 | Zornitza Stark Marked gene: STAT3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.395 | STAT3 | Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.395 | STAT3 | Zornitza Stark Classified gene: STAT3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.395 | STAT3 | Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.394 | Zornitza Stark removed gene:NPR2 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9015 | NPR2 | Zornitza Stark Marked gene: NPR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9015 | NPR2 | Zornitza Stark Gene: npr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9015 | NPR2 | Zornitza Stark Phenotypes for gene: NPR2 were changed from to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Epiphyseal chondrodysplasia, Miura type, MIM# 615923; Short stature with nonspecific skeletal abnormalities, MIM# 616255 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9014 | NPR2 | Zornitza Stark Publications for gene: NPR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9013 | NPR2 | Zornitza Stark Mode of inheritance for gene: NPR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9012 | NPR2 |
Zornitza Stark changed review comment from: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models. Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.; to: Bi-allelic variants: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models. Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth. Mono-allelic variants have been linked to both tall stature and short stature disorders. Multiple families. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9012 | NPR2 | Zornitza Stark edited their review of gene: NPR2: Changed publications: 31555216, 16384845, 15146390, 22870295, 24057292, 24259409, 16384845, 24471569; Changed phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Epiphyseal chondrodysplasia, Miura type, MIM# 615923, Short stature with nonspecific skeletal abnormalities, MIM# 616255; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9012 | NPR2 | Zornitza Stark reviewed gene: NPR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31555216, 16384845, 15146390; Phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Short stature, disproportionate, Oval vertebral bodies in infancy, Progressive shortening of humerus, radius and ulna in first year, dwarfism, Prominent forehead; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.393 | Zornitza Stark removed gene:RAPSN from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.291 | RAPSN | Zornitza Stark Marked gene: RAPSN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.291 | RAPSN | Zornitza Stark Gene: rapsn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.291 | RAPSN | Zornitza Stark Phenotypes for gene: RAPSN were changed from to Fetal akinesia deformation sequence 2 MIM# 618388; AChR deficiency; fetal akinesia; IUGR; micrognathia; hypokinesia; contractures; muscular hypotonia; feeding difficulties; severe respiratory insufficiency; history of miscarriage | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.290 | RAPSN | Zornitza Stark Publications for gene: RAPSN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.289 | RAPSN | Zornitza Stark Mode of inheritance for gene: RAPSN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Arthrogryposis v0.288 | RAPSN | Zornitza Stark reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9012 | RPS6KA3 | Zornitza Stark Marked gene: RPS6KA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9012 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9012 | RPS6KA3 | Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9011 | RPS6KA3 | Zornitza Stark Publications for gene: RPS6KA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9010 | RPS6KA3 | Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9009 | RPS6KA3 | Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.392 | RPS6KA3 | Zornitza Stark Marked gene: RPS6KA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.392 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.392 | RPS6KA3 | Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from Coffin Lowry to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.391 | RPS6KA3 | Zornitza Stark Publications for gene: RPS6KA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.390 | RPS6KA3 | Zornitza Stark Classified gene: RPS6KA3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.390 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Atrial Fibrillation v0.7 | SHOX2 | Zornitza Stark Marked gene: SHOX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Atrial Fibrillation v0.7 | SHOX2 | Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Atrial Fibrillation v0.7 | SHOX2 |
Zornitza Stark gene: SHOX2 was added gene: SHOX2 was added to Atrial Fibrillation. Sources: Expert Review Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SHOX2 were set to 30443179 Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation Review for gene: SHOX2 was set to RED Added comment: Single family reported with LoF in this gene and AF. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9009 | SHOX2 | Zornitza Stark Marked gene: SHOX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9009 | SHOX2 | Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mendeliome v0.9009 | SHOX2 |
Zornitza Stark gene: SHOX2 was added gene: SHOX2 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SHOX2 were set to 30443179 Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation Review for gene: SHOX2 was set to RED Added comment: Single family reported with LoF in this gene and AF. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.389 | SHOX2 | Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.388 | SHOX2 | Zornitza Stark Marked gene: SHOX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.388 | SHOX2 | Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.388 | SHOX2 | Zornitza Stark Phenotypes for gene: SHOX2 were changed from to Sinus Node Dysfunction; Atrial Fibrillation | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.387 | SHOX2 | Zornitza Stark Publications for gene: SHOX2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.386 | SHOX2 | Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.385 | SMARCAL1 | Zornitza Stark Marked gene: SMARCAL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.385 | SMARCAL1 | Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.385 | SMARCAL1 | Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from to Schimke immune-osseous dysplasia MIM# 242900; T cell deficiency; Short stature; IUGR; spondyloepiphyseal dysplasia; growth retardation; renal dysfunction; lymphocytopaenia; nephropathy; bacterial/viral/fungal infections; may present as SCID; bone marrow failure | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.384 | SMARCAL1 | Zornitza Stark Publications for gene: SMARCAL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.383 | SMARCAL1 | Zornitza Stark Mode of inheritance for gene: SMARCAL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.382 | SMARCAL1 | Zornitza Stark Classified gene: SMARCAL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.382 | SMARCAL1 | Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.381 | NPR2 |
Danielle Ariti gene: NPR2 was added gene: NPR2 was added to Growth failure in early childhood. Sources: Literature Mode of inheritance for gene: NPR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NPR2 were set to 31555216; 16384845; 15146390 Phenotypes for gene: NPR2 were set to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Short stature, disproportionate; Oval vertebral bodies in infancy; Progressive shortening of humerus, radius and ulna in first year; dwarfism; Prominent forehead Review for gene: NPR2 was set to GREEN Added comment: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models. Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Marked gene: EPHB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Classified gene: EPHB4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Malformations_Somatic v1.5 | EPHB4 |
Bryony Thompson gene: EPHB4 was added gene: EPHB4 was added to Vascular Malformations_Somatic. Sources: Other Mode of inheritance for gene: EPHB4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHB4 were set to 31300548; 30760892 Phenotypes for gene: EPHB4 were set to Capillary malformation-arteriovenous malformation Review for gene: EPHB4 was set to AMBER Added comment: A single CV-AVM case has been reported with mosaicism of an EPHB4 variant. Mosaicism has also been reported for the other CV-AVM gene, RASA1. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.381 | STAT3 |
Danielle Ariti gene: STAT3 was added gene: STAT3 was added to Growth failure in early childhood. Sources: Literature Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: STAT3 were set to 25349174; 25038750; 25359994 Phenotypes for gene: STAT3 were set to Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Lymphoproliferation; solid organ autoimmunity; growth failure; recurrent infections; short stature; IUGR; eczema; delayed puberty; dental abnormalities; autoimmune interstitial lung disease; juvenile-onset arthritis; primary hypothyroidism Mode of pathogenicity for gene: STAT3 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: STAT3 was set to GREEN Added comment: 18 individuals from 15 unrelated families; monoallelic (missense or in-frame del) variants; gain of function; Multiple mouse models Individuals exhibited various clinical features, with most presenting with early-onset autoimmunity and growth failure (IUGR, lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, recurrent infections, and short stature (<2SDS)). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.85 | HS2ST1 | Zornitza Stark Marked gene: HS2ST1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.85 | HS2ST1 | Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.85 | HS2ST1 | Zornitza Stark Classified gene: HS2ST1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.85 | HS2ST1 | Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.84 | HS2ST1 |
Zornitza Stark gene: HS2ST1 was added gene: HS2ST1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review Mode of inheritance for gene: HS2ST1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HS2ST1 were set to 33159882 Phenotypes for gene: HS2ST1 were set to Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194 Review for gene: HS2ST1 was set to GREEN Added comment: 4 individuals from 3 unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | PHPX | Zornitza Stark Tag paediatric-onset tag was added to STR: PHPX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.381 | RAPSN | Danielle Ariti reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v1.0 | Bryony Thompson promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.9 | Bryony Thompson Panel status changed from internal to public | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.8 | DNAL4 |
Bryony Thompson gene: DNAL4 was added gene: DNAL4 was added to Mirror movements. Sources: Other Mode of inheritance for gene: DNAL4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAL4 were set to 25098561; 25236653 Phenotypes for gene: DNAL4 were set to Mirror movements 3 MIM#616059 Review for gene: DNAL4 was set to RED Added comment: Only a single large consanguineous Pakastani family with a homozygous variant reported. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.7 | RAD51 | Bryony Thompson Marked gene: RAD51 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.7 | RAD51 | Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.7 | RAD51 | Bryony Thompson Classified gene: RAD51 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.7 | RAD51 | Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.6 | RAD51 |
Bryony Thompson gene: RAD51 was added gene: RAD51 was added to Mirror movements. Sources: Expert list Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAD51 were set to 25763452; 22305526; 27830107; 24808016 Phenotypes for gene: RAD51 were set to Mirror movements 2 MIM#614508 Review for gene: RAD51 was set to GREEN gene: RAD51 was marked as current diagnostic Added comment: >3 families/probands reported with mirror movements Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.381 | RPS6KA3 | Danielle Ariti reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.381 | SHOX2 | Danielle Ariti reviewed gene: SHOX2: Rating: RED; Mode of pathogenicity: None; Publications: 30443179, 16537395, 16537395; Phenotypes: Linked to Sinus Node Dysfunction, Linked to Atrial Fibrillation; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Growth failure v0.381 | SMARCAL1 | Danielle Ariti reviewed gene: SMARCAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301550, 17089404, 20036229; Phenotypes: Schimke immune-osseous dysplasia MIM# 242900, T cell deficiency, Short stature, IUGR, spondyloepiphyseal dysplasia, growth retardation, renal dysfunction, lymphocytopaenia, nephropathy, bacterial/viral/fungal infections, may present as SCID, bone marrow failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.5 | NTN1 | Bryony Thompson Marked gene: NTN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.5 | NTN1 | Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.5 | NTN1 | Bryony Thompson Classified gene: NTN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.5 | NTN1 | Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mirror movements v0.4 | NTN1 |
Bryony Thompson gene: NTN1 was added gene: NTN1 was added to Mirror movements. Sources: Expert list Mode of inheritance for gene: NTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NTN1 were set to 25763452; 28945198; 33472083 Phenotypes for gene: NTN1 were set to Mirror movements 4 MIM#618264 Review for gene: NTN1 was set to GREEN gene: NTN1 was marked as current diagnostic Added comment: Two unrelated families and an unrelated proband with mirror movements. Also, a mouse model recapitulates the human phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | HPE5 | Zornitza Stark Tag paediatric-onset tag was added to STR: HPE5. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | HMNMYO | Zornitza Stark Tag paediatric-onset tag was added to STR: HMNMYO. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | HFGS_tract3 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | HFGS_tract2 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | HFGS_tract1 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | HDL2 | Zornitza Stark Tag adult-onset tag was added to STR: HDL2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repeat Disorders v0.123 | HD | Zornitza Stark Tag adult-onset tag was added to STR: HD. |