Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Hand and foot malformations v0.0 FBN1 Bryony Thompson gene: FBN1 was added
gene: FBN1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FBN1 were set to Marfan syndrome 154700; Weill-Marchesani syndrome 2, dominant 608328; Stiff skin syndrome 184900; Acromicric dysplasia 102370; Geleophysic dysplasia 2 614185
Hand and foot malformations v0.0 FBLN1 Bryony Thompson gene: FBLN1 was added
gene: FBLN1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: FBLN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: FBLN1 were set to Synpolydactyly, 3/3'4, associated with metacarpal and metatarsal synostoses 608180
Hand and foot malformations v0.0 FAT1 Bryony Thompson gene: FAT1 was added
gene: FAT1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: FAT1 was set to Unknown
Hand and foot malformations v0.0 ESCO2 Bryony Thompson gene: ESCO2 was added
gene: ESCO2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ESCO2 were set to SC phocomelia syndrome 269000; Roberts syndrome 268300
Hand and foot malformations v0.0 EP300 Bryony Thompson gene: EP300 was added
gene: EP300 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: EP300 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EP300 were set to Rubinstein-Taybi syndrome 180849
Hand and foot malformations v0.0 EOGT Bryony Thompson gene: EOGT was added
gene: EOGT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: EOGT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EOGT were set to Adams Oliver syndrome 4
Hand and foot malformations v0.0 DYNC1I1 Bryony Thompson gene: DYNC1I1 was added
gene: DYNC1I1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: DYNC1I1 was set to Unknown
Hand and foot malformations v0.0 DVL3 Bryony Thompson gene: DVL3 was added
gene: DVL3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DVL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DVL3 were set to Robinow syndrome, autosomal dominant 3, 616894
Hand and foot malformations v0.0 DVL1 Bryony Thompson gene: DVL1 was added
gene: DVL1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DVL1 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Phenotypes for gene: DVL1 were set to Robinow syndrome, autosomal dominant 2, MIM# 616331
Hand and foot malformations v0.0 DPF2 Bryony Thompson gene: DPF2 was added
gene: DPF2 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: DPF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DPF2 were set to Coffin-Siris syndrome 7 MIM#618027
Hand and foot malformations v0.0 DOCK6 Bryony Thompson gene: DOCK6 was added
gene: DOCK6 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DOCK6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DOCK6 were set to Adams-Oliver syndrome 2 614219
Hand and foot malformations v0.0 DLX6 Bryony Thompson gene: DLX6 was added
gene: DLX6 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: DLX6 was set to Unknown
Phenotypes for gene: DLX6 were set to Split-hand/foot malformation 1 183600; Split-hand/foot malformation 1 with sensorineural hearing loss 220600
Hand and foot malformations v0.0 DLX5 Bryony Thompson gene: DLX5 was added
gene: DLX5 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DLX5 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: DLX5 were set to Split-hand/foot malformation 1 with sensorineural hearing loss 220600
Hand and foot malformations v0.0 DLL4 Bryony Thompson gene: DLL4 was added
gene: DLL4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DLL4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DLL4 were set to Adams-Oliver syndrome 6, 616589
Hand and foot malformations v0.0 DHODH Bryony Thompson gene: DHODH was added
gene: DHODH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DHODH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHODH were set to Miller syndrome (postaxial acrofacial dysostosis) 263750
Hand and foot malformations v0.0 DHCR7 Bryony Thompson gene: DHCR7 was added
gene: DHCR7 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome 270400
Hand and foot malformations v0.0 CREBBP Bryony Thompson gene: CREBBP was added
gene: CREBBP was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CREBBP were set to Rubinstein-Taybi syndrome 180849
Hand and foot malformations v0.0 CHUK Bryony Thompson gene: CHUK was added
gene: CHUK was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: CHUK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHUK were set to ?Popliteal pterygium syndrome, Bartsocas-Papas type 2 MIM#619339; Cocoon syndrome MIM#613630
Hand and foot malformations v0.0 CHSY1 Bryony Thompson gene: CHSY1 was added
gene: CHSY1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome 605282
Hand and foot malformations v0.0 CDH3 Bryony Thompson gene: CDH3 was added
gene: CDH3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CDH3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDH3 were set to Ectodermal dysplasia, ectrodactyly, and macular dystrophy 225280
Hand and foot malformations v0.0 FAM58A Bryony Thompson gene: FAM58A was added
gene: FAM58A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FAM58A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: FAM58A were set to STAR syndrome 300707
Hand and foot malformations v0.0 CACNA1C Bryony Thompson gene: CACNA1C was added
gene: CACNA1C was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CACNA1C was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: CACNA1C were set to Timothy syndrome MIM#601005
Hand and foot malformations v0.0 BMPR1B Bryony Thompson gene: BMPR1B was added
gene: BMPR1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: BMPR1B was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: BMPR1B were set to Acromesomelic dysplasia, Demirhan type 609441; Brachydactyly, type A1, D 616849; Brachydactyly, type A2 112600
Hand and foot malformations v0.0 BMP2 Bryony Thompson gene: BMP2 was added
gene: BMP2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: BMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BMP2 were set to Brachydactyly, type A2 112600; short stature, facial dysmorphism and skeletal anomalies with or without cardiac aomalies 617877.
Hand and foot malformations v0.0 B9D1 Bryony Thompson gene: B9D1 was added
gene: B9D1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: B9D1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B9D1 were set to Meckel syndrome 9 614209
Hand and foot malformations v0.0 B3GLCT Bryony Thompson gene: B3GLCT was added
gene: B3GLCT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B3GLCT were set to O-fucose-specific beta-1,3-N-glucosyltransferase deficiency (Disorders of protein O-glycosylation, O-mannosylglycan synthesis deficiencies); Peters-plus syndrome 261540
Hand and foot malformations v0.0 ARID1B Bryony Thompson gene: ARID1B was added
gene: ARID1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome type 1 - 135900
Hand and foot malformations v0.0 ARID1A Bryony Thompson gene: ARID1A was added
gene: ARID1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARID1A were set to Coffin-Siris
Hand and foot malformations v0.0 ARHGAP31 Bryony Thompson gene: ARHGAP31 was added
gene: ARHGAP31 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARHGAP31 were set to Adams-Oliver syndrome 1 100300
Hand and foot malformations v0.0 ANKRD11 Bryony Thompson gene: ANKRD11 was added
gene: ANKRD11 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ANKRD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKRD11 were set to KBG syndrome 148050
Hand and foot malformations v0.0 AFF4 Bryony Thompson gene: AFF4 was added
gene: AFF4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368
Hand and foot malformations v0.0 ADAMTS17 Bryony Thompson gene: ADAMTS17 was added
gene: ADAMTS17 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ADAMTS17 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTS17 were set to Weill-Marchesani syndrome type 4
Hand and foot malformations v0.0 ADAMTS10 Bryony Thompson gene: ADAMTS10 was added
gene: ADAMTS10 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ADAMTS10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTS10 were set to Weill-Marchesani syndrome 1, recessive, 277600
Hand and foot malformations v0.0 ACVR1 Bryony Thompson gene: ACVR1 was added
gene: ACVR1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ACVR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACVR1 were set to Fibrodysplasia ossificans progressiva 135100
Hand and foot malformations v0.0 Bryony Thompson Added panel Hand and foot malformation
Polydactyly v0.240 TMEM107 Bryony Thompson Classified gene: TMEM107 as Green List (high evidence)
Polydactyly v0.240 TMEM107 Bryony Thompson Gene: tmem107 has been classified as Green List (High Evidence).
Polydactyly v0.239 TMEM107 Bryony Thompson gene: TMEM107 was added
gene: TMEM107 was added to Polydactyly. Sources: Expert list
Mode of inheritance for gene: TMEM107 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM107 were set to 22698544; 26123494; 26518474
Phenotypes for gene: TMEM107 were set to Meckel syndrome 13 MIM#617562; Orofaciodigital syndrome XVI MIM#617563
Review for gene: TMEM107 was set to GREEN
gene: TMEM107 was marked as current diagnostic
Added comment: At least four unrelated families with polydactyly as a feature of the condition and a supporting null mouse model.
Sources: Expert list
Polydactyly v0.238 MAP3K20 Bryony Thompson Marked gene: MAP3K20 as ready
Polydactyly v0.238 MAP3K20 Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence).
Polydactyly v0.238 MAP3K20 Bryony Thompson Classified gene: MAP3K20 as Green List (high evidence)
Polydactyly v0.238 MAP3K20 Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence).
Polydactyly v0.237 MAP3K20 Bryony Thompson gene: MAP3K20 was added
gene: MAP3K20 was added to Polydactyly. Sources: Expert list
Mode of inheritance for gene: MAP3K20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAP3K20 were set to 26755636; 32266845
Phenotypes for gene: MAP3K20 were set to Split-foot malformation with mesoaxial polydactyly MIM#616890
Review for gene: MAP3K20 was set to GREEN
Added comment: PMID: 26755636 - Polydactyly is a feature of the condition in two consanguineous families with homozygous variants. A mouse model recapitulates the phenotype.
PMID: 32266845 - A heterozygous missense was identified in a case with split hand/foot malformation (SHFM), but also large deletion including SHFM-causing genes is also present
Sources: Expert list
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Marked gene: ECHS1 as ready
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Classified gene: ECHS1 as Green List (high evidence)
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.117 EARS2 Zornitza Stark Marked gene: EARS2 as ready
Cerebral Palsy v0.117 EARS2 Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.117 EARS2 Zornitza Stark Classified gene: EARS2 as Green List (high evidence)
Cerebral Palsy v0.117 EARS2 Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.121 ARID1B Bryony Thompson Marked gene: ARID1B as ready
Skeletal dysplasia v0.121 ARID1B Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence).
Skeletal dysplasia v0.121 ARID1B Bryony Thompson Publications for gene: ARID1B were set to
Skeletal dysplasia v0.120 ARID1B Bryony Thompson Mode of inheritance for gene: ARID1B was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Skeletal dysplasia v0.119 ARID1B Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported, at least one case identified in a skeletal dysplasia cohort.
Skeletal dysplasia v0.119 ARID1B Bryony Thompson Classified gene: ARID1B as Green List (high evidence)
Skeletal dysplasia v0.119 ARID1B Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence).
Skeletal dysplasia v0.118 ARID1B Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. > cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported.
Skeletal dysplasia v0.118 ARID1B Bryony Thompson reviewed gene: ARID1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 34122524; Phenotypes: Coffin-Siris syndrome 1 MIM#135900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Skeletal dysplasia v0.118 ARID1A Bryony Thompson Marked gene: ARID1A as ready
Skeletal dysplasia v0.118 ARID1A Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence).
Skeletal dysplasia v0.118 ARID1A Bryony Thompson Publications for gene: ARID1A were set to
Skeletal dysplasia v0.117 ARID1A Bryony Thompson Mode of inheritance for gene: ARID1A was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Skeletal dysplasia v0.116 ARID1A Bryony Thompson Classified gene: ARID1A as Green List (high evidence)
Skeletal dysplasia v0.116 ARID1A Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence).
Skeletal dysplasia v0.115 ARID1A Bryony Thompson changed review comment from: At least 5 cases have been reported with skeletal anomalies as a feature of the condition. Mosaicism is very common for the gene.; to: At least 5 cases have been reported with skeletal anomalies (brachydactyly and polydactyly) as a feature of the condition. Mosaicism is very common for the gene.
Skeletal dysplasia v0.115 ARID1A Bryony Thompson reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 32888375; Phenotypes: Coffin-Siris syndrome 2 MM#614607; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Cerebral Palsy v0.116 ECHS1 Danielle Ariti gene: ECHS1 was added
gene: ECHS1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: ECHS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ECHS1 were set to 33528536; 34364746; 32858208
Phenotypes for gene: ECHS1 were set to Cerebral Palsy; Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277
Review for gene: ECHS1 was set to GREEN
Added comment: Two cases in CP cohort reported with compound heterozygous ECHS1variants.
One of the individuals presented with delayed motor skills with coordination problems, dystonia (at age 11), and spasticity in upper and lower limbs.

ECHS1 variants cause an inborn error of metabolism disorder characterised by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Some of these cases display paroxysmal and non-paroxysmal dystonia.
Sources: Expert list
Cerebral Palsy v0.116 EARS2 Danielle Ariti gene: EARS2 was added
gene: EARS2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: EARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EARS2 were set to 33528536; 34364746
Phenotypes for gene: EARS2 were set to Cerebral Palsy; Combined oxidative phosphorylation deficiency 12 MIM# 614924
Review for gene: EARS2 was set to GREEN
Added comment: Two individuals in CP cohort reported with bi-allelic EARS2 variants.
One of the individuals presented with severe ID, ASD and seizures on top of impaired motor symptoms.

Overlapping CP phenotype with COXPD12- mitochondrial neurologic disorder characterised by onset in infancy of hypotonia and delayed psychomotor development, or early developmental regression. Severe cases can present with Dystonia, Spastic tetraparesis and/or lack of speech.
Sources: Expert list
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Marked gene: SPEN as ready
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence)
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Congenital Heart Defect v0.130 SPEN Zornitza Stark Marked gene: SPEN as ready
Congenital Heart Defect v0.130 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Congenital Heart Defect v0.130 SPEN Zornitza Stark Classified gene: SPEN as Green List (high evidence)
Congenital Heart Defect v0.130 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Autism v0.168 SPEN Zornitza Stark Marked gene: SPEN as ready
Autism v0.168 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Autism v0.168 SPEN Zornitza Stark Classified gene: SPEN as Green List (high evidence)
Autism v0.168 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Marked gene: SPEN as ready
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence)
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Marked gene: AFF4 as ready
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Classified gene: AFF4 as Green List (high evidence)
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.114 AFF4 Bryony Thompson gene: AFF4 was added
gene: AFF4 was added to Skeletal dysplasia. Sources: Other
Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AFF4 were set to 25730767; 31058441
Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368
Mode of pathogenicity for gene: AFF4 was set to Other
Review for gene: AFF4 was set to GREEN
gene: AFF4 was marked as current diagnostic
Added comment: CHOPS syndrome: C for Cognitive impairment and Coarse facies, H for Heart defects, O for Obesity, P for Pulmonary involvement and S for Short stature and Skeletal dysplasia. 8 out of 11 cases had skeletal dysplasia as a feature of the condition. Gain-of-function is the mechanism of disease.
Sources: Other
Cerebral Palsy v0.116 DDX3X Zornitza Stark Marked gene: DDX3X as ready
Cerebral Palsy v0.116 DDX3X Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence).
Cerebral Palsy v0.116 DDX3X Zornitza Stark Classified gene: DDX3X as Green List (high evidence)
Cerebral Palsy v0.116 DDX3X Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence).
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Marked gene: DDHD2 as ready
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Classified gene: DDHD2 as Green List (high evidence)
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.114 DDX3X Danielle Ariti gene: DDX3X was added
gene: DDX3X was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: DDX3X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: DDX3X were set to 33528536
Phenotypes for gene: DDX3X were set to Cerebral Palsy; Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958
Review for gene: DDX3X was set to GREEN
Added comment: 6 individuals in CP cohort reported with de novo DDX3X variants.
Sources: Expert list
Cerebral Palsy v0.114 DDHD2 Danielle Ariti gene: DDHD2 was added
gene: DDHD2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: DDHD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDHD2 were set to 30705080; 34077496; 34321325
Phenotypes for gene: DDHD2 were set to Cerebral Palsy; Spastic paraplegia 54, autosomal recessive MIM# 615033
Review for gene: DDHD2 was set to GREEN
Added comment: Two individuals reported in CP cohort. Phenotype-Spastic diplegia, and ID.

Multiple reports of CP-mimic patients with global developmental delay and non-progressive spastic gait.

SPG54 individuals display CP-like phenotype such as intellectual disability, early-onset spasticity of the lower limbs and delayed psychomotor development.
Sources: Expert list
Cerebral Palsy v0.114 DDC Zornitza Stark Marked gene: DDC as ready
Cerebral Palsy v0.114 DDC Zornitza Stark Added comment: Comment when marking as ready: Phenotypic overlap with CP: ID and movement disorders
Cerebral Palsy v0.114 DDC Zornitza Stark Gene: ddc has been classified as Green List (High Evidence).
Cerebral Palsy v0.114 DDC Zornitza Stark Classified gene: DDC as Green List (high evidence)
Cerebral Palsy v0.114 DDC Zornitza Stark Gene: ddc has been classified as Green List (High Evidence).
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Marked gene: CYP2U1 as ready
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Classified gene: CYP2U1 as Green List (high evidence)
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Marked gene: COL4A2 as ready
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Classified gene: COL4A2 as Green List (high evidence)
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.111 DDC Danielle Ariti gene: DDC was added
gene: DDC was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: DDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDC were set to 33528536; 30799092; 33996177
Phenotypes for gene: DDC were set to Aromatic L-amino acid decarboxylase deficiency MIM# 608643
Review for gene: DDC was set to AMBER
Added comment: Single case reported in CP cohort with Dystonic cerebral palsy.

Multiple AADCD cases reported as CP- mimics due to phenotype overlap: dystonia and developmental delay.

AADCD being is an inborn error in neurotransmitter metabolism disorder that leads to combined serotonin and catecholamine deficiency. Clinically characterised by vegetative symptoms, oculogyric crises, dystonia, and severe neurologic dysfunction (infancy/ early childhood); displays CP-like features.
Sources: Expert list
Genetic Epilepsy v0.1194 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to AMBER
gene: SPEN was marked as current diagnostic
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.

Seizures were observed in only 3/32 (~9%) of patients
Sources: Literature
Autism v0.167 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Autism. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to GREEN
gene: SPEN was marked as current diagnostic
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.
Sources: Literature
Congenital Heart Defect v0.129 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to GREEN
gene: SPEN was marked as current diagnostic
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.
Sources: Literature
Deafness_IsolatedAndComplex v1.92 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Deafness_IsolatedAndComplex. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to AMBER
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.

Hearing loss reported in ~10% of patients, uncommon phenotype
Sources: Literature
Cerebral Palsy v0.111 CYP2U1 Danielle Ariti changed review comment from: Single case reported in CP cohort (bi-allelic c.A947T variant).

SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia.
Sources: Expert list; to: Single case reported in CP cohort (bi-allelic p.D316V variant).

SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia.
Sources: Expert list
Cerebral Palsy v0.111 CYP2U1 Danielle Ariti gene: CYP2U1 was added
gene: CYP2U1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: CYP2U1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CYP2U1 were set to 33528536; 29761117; 23176821
Phenotypes for gene: CYP2U1 were set to Cerebral Palsy; Spastic paraplegia 56, autosomal recessive MIM# 615030
Review for gene: CYP2U1 was set to GREEN
Added comment: Single case reported in CP cohort (bi-allelic c.A947T variant).

SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia.
Sources: Expert list
Imprinting disorders v0.3 NLRP5 Anna Le Fevre reviewed gene: NLRP5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26323243, 31829238, 29574422, 30877238, 32222962, 34440388; Phenotypes: Miscarriage, Beckwith-Wiedemann syndrome, Multi locus imprinting disturbance in offspring; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Cerebral Palsy v0.111 COL4A2 Danielle Ariti gene: COL4A2 was added
gene: COL4A2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: COL4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COL4A2 were set to 33528536; 33912663
Phenotypes for gene: COL4A2 were set to Cerebral Palsy; Brain small vessel disease 2 MIM# 614483
Review for gene: COL4A2 was set to GREEN
Added comment: 7 individuals in CP cohort have been reported with mono-allelic COL4A2 variants. Phenotypic overlap: Spastic Triplegia, ID (no language), porencephaly and seizures.

2 siblings reported with bi-allelic variants; Spastic Cerebral Palsy with ID and Epilepsy.
Sources: Expert list
Cerebral Palsy v0.111 ATL1 Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 )
Cerebral Palsy v0.111 ATL1 Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 )
Cerebral Palsy v0.110 ATL1 Zornitza Stark Publications for gene: ATL1 were set to PMID: 32989326
Cerebral Palsy v0.109 ATL1 Zornitza Stark Classified gene: ATL1 as Green List (high evidence)
Cerebral Palsy v0.109 ATL1 Zornitza Stark Gene: atl1 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 ZNF445 Anna Le Fevre gene: ZNF445 was added
gene: ZNF445 was added to Imprinting disorders. Sources: Literature
Mode of inheritance for gene: ZNF445 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF445 were set to PMID: 34039421; 30602440; 30846001
Phenotypes for gene: ZNF445 were set to Temple syndrome; Multi locus imprinting disturbance (MLID)
Penetrance for gene: ZNF445 were set to unknown
Review for gene: ZNF445 was set to AMBER
Added comment: Suggested rating: AMBER

Single report (Kagami 2021) of a child with Temple syndrome and MLID found to have a novel homozygous truncating variant in ZNF445. ZNF445 has been shown to play a critical role in the maintenance of postfertilisation methylation imprints (Takahashi 2019). Mechanism and parent of origin effects remain uncertain.
Sources: Literature
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Marked gene: NGLY1 as ready
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Classified gene: NGLY1 as Green List (high evidence)
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Marked gene: NEXMIF as ready
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence).
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Classified gene: NEXMIF as Red List (low evidence)
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence).
Cerebral Palsy v0.105 PANK2 Zornitza Stark Marked gene: PANK2 as ready
Cerebral Palsy v0.105 PANK2 Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.105 PANK2 Zornitza Stark Classified gene: PANK2 as Amber List (moderate evidence)
Cerebral Palsy v0.105 PANK2 Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.104 NDUFAF2 Zornitza Stark Marked gene: NDUFAF2 as ready
Cerebral Palsy v0.104 NDUFAF2 Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.104 NDUFAF2 Zornitza Stark Phenotypes for gene: NDUFAF2 were changed from Cerebral palsy to Cerebral palsy; Mitochondrial complex I deficiency nuclear type 10 (OMIM 618233)
Cerebral Palsy v0.103 NDUFAF2 Zornitza Stark Classified gene: NDUFAF2 as Green List (high evidence)
Cerebral Palsy v0.103 NDUFAF2 Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Marked gene: NDUFA12 as ready
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Classified gene: NDUFA12 as Amber List (moderate evidence)
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.101 NALCN Zornitza Stark Marked gene: NALCN as ready
Cerebral Palsy v0.101 NALCN Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.101 NALCN Zornitza Stark Phenotypes for gene: NALCN were changed from Cerebral palsy to Cerebral palsy; Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266)
Cerebral Palsy v0.100 NALCN Zornitza Stark Classified gene: NALCN as Amber List (moderate evidence)
Cerebral Palsy v0.100 NALCN Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.99 ATL1 Clare van Eyk reviewed gene: ATL1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33528536, PMID: 34321325; Phenotypes: Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.99 NALCN Clare van Eyk edited their review of gene: NALCN: Changed phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266)
Cerebral Palsy v0.99 NDUFA12 Clare van Eyk Deleted their comment
Cerebral Palsy v0.99 NDUFA12 Clare van Eyk edited their review of gene: NDUFA12: Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort.; Changed phenotypes: Mitochondrial complex I deficiency, nuclear type 23 (OMIM 618244)
Cerebral Palsy v0.99 NEXMIF Clare van Eyk Deleted their comment
Cerebral Palsy v0.99 NEXMIF Clare van Eyk edited their review of gene: NEXMIF: Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date.; Changed phenotypes: X-linked intellectual disability 98 (OMIM:300912)
Cerebral Palsy v0.99 PANK2 Clare van Eyk gene: PANK2 was added
gene: PANK2 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: PANK2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PANK2 were set to PMID: 33098801
Phenotypes for gene: PANK2 were set to HARP syndrome ( OMIM 607236); Neurodegeneration with brain iron accumulation 1 (OMIM 234200)
Review for gene: PANK2 was set to AMBER
Added comment: One case reported with dystonic cerebral palsy. Dystonia and spasticity are reported in cases with variants in PANK2.
Sources: Literature
Cerebral Palsy v0.99 NGLY1 Clare van Eyk gene: NGLY1 was added
gene: NGLY1 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NGLY1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NGLY1 were set to PMID:33528536
Phenotypes for gene: NGLY1 were set to Congenital disorder of deglycosylation (OMIM 615273)
Review for gene: NGLY1 was set to GREEN
Added comment: Three cases with biallelic P/LP variants reported in Clinical Laboratory Referral Cohort retrospectively analysed for genetic determinants of cerebral palsy. Autosomal recessive, multisystem disorder with some overlapping clinical features with cerebral palsy, but this is a progressive condition.
Sources: Literature
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk reviewed gene: NDUFAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: mitochondrial complex I deficiency nuclear type 10 (OMIM 618233); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk Deleted their review
Cerebral Palsy v0.99 NEXMIF Clare van Eyk changed review comment from: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date.
Sources: Expert list; to: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date.
Sources: Expert list
Cerebral Palsy v0.99 NEXMIF Clare van Eyk gene: NEXMIF was added
gene: NEXMIF was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: NEXMIF was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: NEXMIF were set to X-linked Intellectual disability; epilepsy; autism
Penetrance for gene: NEXMIF were set to Incomplete
Review for gene: NEXMIF was set to RED
Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date.
Sources: Expert list
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype.
Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Overlapping clinical phenotype.
Sources: Literature
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233).
Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype.
Sources: Literature
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk gene: NDUFAF2 was added
gene: NDUFAF2 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NDUFAF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFAF2 were set to PMID:33528536; PMID:34364746
Phenotypes for gene: NDUFAF2 were set to Cerebral palsy
Review for gene: NDUFAF2 was set to GREEN
Added comment: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233).
Sources: Literature
Cerebral Palsy v0.99 NDUFA12 Clare van Eyk gene: NDUFA12 was added
gene: NDUFA12 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NDUFA12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA12 were set to PMID:34364746
Phenotypes for gene: NDUFA12 were set to Spastic tetraparesis; intellectual disability; encephalopathy
Review for gene: NDUFA12 was set to AMBER
Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort.
Sources: Literature
Cerebral Palsy v0.99 NALCN Clare van Eyk reviewed gene: NALCN: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: Cerebral palsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.99 NALCN Clare van Eyk Deleted their review
Cerebral Palsy v0.99 NALCN Clare van Eyk gene: NALCN was added
gene: NALCN was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NALCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NALCN were set to PMID:33528536; 34364746
Phenotypes for gene: NALCN were set to Cerebral palsy
Review for gene: NALCN was set to AMBER
Added comment: One case with pathogenic variant from clinical laboratory referral cohort. One additional VUS from tertiary care setting. NALCN variants cause a congenital disorder with contractures of the limbs, abnormal facial features, hypotonia, and developmental delay (OMIM: 611549). Cerebral palsy has not been described previously.
Sources: Literature
Mendeliome v0.9203 CARMIL2 Zornitza Stark Marked gene: CARMIL2 as ready
Mendeliome v0.9203 CARMIL2 Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence).
Mendeliome v0.9203 CARMIL2 Zornitza Stark Phenotypes for gene: CARMIL2 were changed from to Immunodeficiency 58, MIM# 618131; Early onset paediatric inflammatory bowel disease
Mendeliome v0.9202 CARMIL2 Zornitza Stark Publications for gene: CARMIL2 were set to
Mendeliome v0.9201 CARMIL2 Zornitza Stark Mode of inheritance for gene: CARMIL2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9200 CARMIL2 Zornitza Stark reviewed gene: CARMIL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29479355, 28112205, 27896283, 33723309; Phenotypes: Immunodeficiency 58, MIM# 618131, Early onset paediatric inflammatory bowel disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Marked gene: CARMIL2 as ready
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Classified gene: CARMIL2 as Green List (high evidence)
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.60 CARMIL2 Zornitza Stark gene: CARMIL2 was added
gene: CARMIL2 was added to Inflammatory bowel disease. Sources: Expert Review
Mode of inheritance for gene: CARMIL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CARMIL2 were set to 33723309
Phenotypes for gene: CARMIL2 were set to Early onset paediatric inflammatory bowel disease
Review for gene: CARMIL2 was set to GREEN
Added comment: Bi-allelic variants in this gene are associated with immunodeficiency. Four individuals from three families reported with early onset IBD. None manifested overt clinical signs of immunodeficiency before their diagnosis.
Sources: Expert Review
Cerebral vascular malformations v0.23 SETD5 Bryony Thompson Classified gene: SETD5 as Amber List (moderate evidence)
Cerebral vascular malformations v0.23 SETD5 Bryony Thompson Gene: setd5 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v0.22 CHD4 Bryony Thompson Classified gene: CHD4 as Amber List (moderate evidence)
Cerebral vascular malformations v0.22 CHD4 Bryony Thompson Gene: chd4 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v0.21 ABCC6 Bryony Thompson Marked gene: ABCC6 as ready
Cerebral vascular malformations v0.21 ABCC6 Bryony Thompson Gene: abcc6 has been classified as Red List (Low Evidence).
Cerebral vascular malformations v0.21 ABCC6 Bryony Thompson reviewed gene: ABCC6: Rating: RED; Mode of pathogenicity: None; Publications: 16086762; Phenotypes: Moya moya disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9200 PNLDC1 Zornitza Stark Marked gene: PNLDC1 as ready
Mendeliome v0.9200 PNLDC1 Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence).
Mendeliome v0.9200 PNLDC1 Zornitza Stark Classified gene: PNLDC1 as Green List (high evidence)
Mendeliome v0.9200 PNLDC1 Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence).
Mendeliome v0.9199 PNLDC1 Zornitza Stark gene: PNLDC1 was added
gene: PNLDC1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: PNLDC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PNLDC1 were set to 34347949
Phenotypes for gene: PNLDC1 were set to Spermatogenic failure 57, MIM# 619528
Review for gene: PNLDC1 was set to GREEN
Added comment: Four unrelated individuals reported.
Sources: Expert Review
Mendeliome v0.9198 FOXP1 Zornitza Stark Marked gene: FOXP1 as ready
Mendeliome v0.9198 FOXP1 Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence).
Mendeliome v0.9198 FOXP1 Zornitza Stark Phenotypes for gene: FOXP1 were changed from to Mental retardation with language impairment and with or without autistic features, MIM# 613670
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Marked gene: FOXP1 as ready
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Classified gene: FOXP1 as Green List (high evidence)
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.87 FOXP1 Zornitza Stark gene: FOXP1 was added
gene: FOXP1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review
Mode of inheritance for gene: FOXP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOXP1 were set to 27657687
Phenotypes for gene: FOXP1 were set to Mental retardation with language impairment and with or without autistic features, MIM# 613670
Review for gene: FOXP1 was set to GREEN
Added comment: Well established association with syndromic ID. Multiple individuals reported with congenital anomalies of the kidneys and urinary tract in PMID 27657687.
Sources: Expert Review
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Marked gene: ZMYM2 as ready
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Classified gene: ZMYM2 as Green List (high evidence)
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.128 ZMYM2 Zornitza Stark gene: ZMYM2 was added
gene: ZMYM2 was added to Congenital Heart Defect. Sources: Expert Review
Mode of inheritance for gene: ZMYM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZMYM2 were set to 32891193
Phenotypes for gene: ZMYM2 were set to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Review for gene: ZMYM2 was set to GREEN
Added comment: Connaughton et al (2020 - PMID: 32891193) report on 19 individuals (from 15 unrelated families) with heterozygous pathogenic ZMYM2 variants.

Affected individuals from 7 families presented with CAKUT while all of them displayed extra-renal features. Neurological manifestations were reported in 16 individuals from 14 families (data not available for 1 fam), among others hypotonia (3/14 fam), speech delay (4/14 fam), global DD (9/14 fam), ID (4/14 fam), microcephaly (4/14 fam). ASD was reported in 4 fam (4 indiv). Seizures were reported in 2 fam (2 indiv). Variable other features included cardiac defects, facial dysmorphisms, small hands and feet with dys-/hypo-plastic nails and clinodactyly.

14 pLoF variants were identified, in most cases as de novo events (8 fam). In 2 families the variant was inherited from an affected parent. Germline mosaicism occurred in 1 family.

The human disease features were recapitulated in a X. tropicalis morpholino knockdown, with expression of truncating variants failing to rescue renal and craniofacial defects. Heterozygous Zmym2-deficient mice also recapitulated the features of CAKUT.

ZMYM2 (previously ZNF198) encodes a nuclear zinc finger protein localizing to the nucleus (and PML nuclear body).

It has previously been identified as transcriptional corepressor interacting with nuclear receptors and the LSD1-CoREST-HDAC1 complex. It has also been shown to interact with FOXP transcription factors.

The authors provide evidence for loss of interaction of the truncated ZMYM2 with FOXP1 (mutations in the latter having recently been reported in syndromic CAKUT).
Sources: Expert Review
Mendeliome v0.9197 ZMYM2 Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.86 ZMYM2 Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 ZMYM2 Zornitza Stark reviewed gene: ZMYM2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4130 ZMYM2 Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Intellectual disability syndromic and non-syndromic v0.4129 ZMYM2 Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Mendeliome v0.9197 HCN2 Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders
Mendeliome v0.9196 HCN2 Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders
Genetic Epilepsy v0.1194 HCN2 Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders
Genetic Epilepsy v0.1193 HCN2 Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders
Mendeliome v0.9196 HSCB Zornitza Stark Marked gene: HSCB as ready
Mendeliome v0.9196 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9196 HSCB Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence)
Mendeliome v0.9196 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9195 HSCB Zornitza Stark gene: HSCB was added
gene: HSCB was added to Mendeliome. Sources: Expert list
Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSCB were set to 32634119
Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5, MIM# 619523
Review for gene: HSCB was set to AMBER
Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model.
Sources: Expert list
Red cell disorders v1.2 HSCB Zornitza Stark Marked gene: HSCB as ready
Red cell disorders v1.2 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Red cell disorders v1.2 HSCB Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence)
Red cell disorders v1.2 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Red cell disorders v1.1 HSCB Zornitza Stark gene: HSCB was added
gene: HSCB was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSCB were set to 32634119
Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5 619523
Review for gene: HSCB was set to AMBER
Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model.
Sources: Expert list
Mendeliome v0.9194 FAM57B Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy
Mendeliome v0.9193 FAM57B Zornitza Stark edited their review of gene: FAM57B: Changed phenotypes: Cone-rod dystrophy 22, MIM# 619531, Maculopathy
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Marked gene: FAM57B as ready
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence).
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Classified gene: FAM57B as Green List (high evidence)
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence).
Cone-rod Dystrophy v0.30 FAM57B Zornitza Stark gene: FAM57B was added
gene: FAM57B was added to Cone-rod Dystrophy. Sources: Expert Review
new gene name tags were added to gene: FAM57B.
Mode of inheritance for gene: FAM57B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM57B were set to 33077892
Phenotypes for gene: FAM57B were set to Cone-rod dystrophy 22, MIM# 619531; Maculopathy
Review for gene: FAM57B was set to GREEN
Added comment: 4 patients with cone-rod dystrophy or maculopathy from 3 families, with LOF pathogenic variants in TLCD3B (ceramide synthase gene). Ceramide is a proapoptotic lipid as high levels of ceramides can lead to apoptosis of neuronal cells, including photoreceptors. Variants segregated with disease. TLCD3B showed high expression in the adult retina with higher expression in the macular than in the peripheral region. Tlcd3bKO/KO mice exhibited a significant reduction of the cone photoreceptor light responses, thinning of the outer nuclear layer, and loss of cone photoreceptors across the retina.
Sources: Expert Review
Retinitis pigmentosa v0.101 FAM57B Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy
Retinitis pigmentosa v0.100 FAM57B Zornitza Stark reviewed gene: FAM57B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cone-rod dystrophy 22, MIM# 619531; Mode of inheritance: None
Mendeliome v0.9193 CADM3 Zornitza Stark Phenotypes for gene: CADM3 were changed from Charcot-Marie-Tooth disease to Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519
Mendeliome v0.9192 CADM3 Zornitza Stark reviewed gene: CADM3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark changed review comment from: Combination of ID with ataxia overlaps with CP.
Sources: Expert list; to: Combination of ID with ataxia overlaps with CP. At least 3 families reported, intragenic deletions.
Sources: Expert list
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Marked gene: CAMTA1 as ready
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Tag SV/CNV tag was added to gene: CAMTA1.
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Classified gene: CAMTA1 as Green List (high evidence)
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.98 CAMTA1 Zornitza Stark gene: CAMTA1 was added
gene: CAMTA1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: CAMTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CAMTA1 were set to 22693284; 24738973
Phenotypes for gene: CAMTA1 were set to Cerebellar ataxia, nonprogressive, with mental retardation, MIM# 614756
Review for gene: CAMTA1 was set to GREEN
Added comment: Combination of ID with ataxia overlaps with CP.
Sources: Expert list
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Marked gene: CACNA1A as ready
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Classified gene: CACNA1A as Amber List (moderate evidence)
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.96 CACNA1A Zornitza Stark gene: CACNA1A was added
gene: CACNA1A was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: CACNA1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1A were set to 29761117
Phenotypes for gene: CACNA1A were set to Developemental and epileptic encephalopathy 42, MIM# 617106; Episodic ataxia, type 2, MIM# 108500; Migraine, familial hemiplegic, 1, MIM# 141500; Migraine, familial hemiplegic, 1, with progressive cerebellar ataxia 141500; Spinocerebellar ataxia 6, MIM# 183086
Review for gene: CACNA1A was set to AMBER
Added comment: Variants in this gene cause a range of phenotypes, including hemiplegia, although this tends to be episodic. Reported in a CP cohort.
Sources: Expert Review
Cerebral Palsy v0.95 BCL11A Zornitza Stark Marked gene: BCL11A as ready
Cerebral Palsy v0.95 BCL11A Zornitza Stark Gene: bcl11a has been classified as Red List (Low Evidence).
Cerebral Palsy v0.95 BCL11A Zornitza Stark gene: BCL11A was added
gene: BCL11A was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: BCL11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BCL11A were set to Dias-Logan syndrome, MIM# 617101
Review for gene: BCL11A was set to RED
Added comment: Intellectual disability, microcephaly, dysmorphic features and persistence of fetal haemoglobin but no specific overlap with CP.
Sources: Expert Review
Mackenzie's Mission_Reproductive Carrier Screening v0.103 BCAP31 Zornitza Stark gene: BCAP31 was added
gene: BCAP31 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: BCAP31 were set to 24011989; 31330203; 33603160
Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Review for gene: BCAP31 was set to GREEN
Added comment: More than 20 unrelated families reported. Clinical features include severe intellectual disability (ID), dystonia, deafness, and central hypomyelination. Female carriers are mostly asymptomatic but may present with deafness.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4129 BCAP31 Zornitza Stark Marked gene: BCAP31 as ready
Intellectual disability syndromic and non-syndromic v0.4129 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4129 BCAP31 Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Intellectual disability syndromic and non-syndromic v0.4128 BCAP31 Zornitza Stark Publications for gene: BCAP31 were set to
Intellectual disability syndromic and non-syndromic v0.4127 BCAP31 Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4126 BCAP31 Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9192 BCAP31 Zornitza Stark Marked gene: BCAP31 as ready
Mendeliome v0.9192 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Mendeliome v0.9192 BCAP31 Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Mendeliome v0.9191 BCAP31 Zornitza Stark Publications for gene: BCAP31 were set to
Mendeliome v0.9190 BCAP31 Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9189 BCAP31 Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Marked gene: BCAP31 as ready
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Classified gene: BCAP31 as Green List (high evidence)
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Cerebral Palsy v0.93 BCAP31 Zornitza Stark gene: BCAP31 was added
gene: BCAP31 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: BCAP31 were set to 24011989; 31330203
Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Review for gene: BCAP31 was set to GREEN
Added comment: Phenotypic overlap with CP due to combination of almost no psychomotor development with dystonia and pyramidal signs. At least one patient reported who specifically had a CP diagnosis.
Sources: Expert Review
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Marked gene: AUTS2 as ready
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Classified gene: AUTS2 as Green List (high evidence)
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.90 AUTS2 Zornitza Stark gene: AUTS2 was added
gene: AUTS2 was added to Cerebral Palsy. Sources: Expert list
SV/CNV tags were added to gene: AUTS2.
Mode of inheritance for gene: AUTS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AUTS2 were set to 23332918; 27075013
Phenotypes for gene: AUTS2 were set to Mental retardation, autosomal dominant 26, MIM# 615834
Review for gene: AUTS2 was set to GREEN
Added comment: Multiple individuals reported with ID/autism, but 'cerebral palsy' was the original clinical diagnosis in some.

Predominantly deletions reported, so may not be tractable by all NGS assays.
Sources: Expert list
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Marked gene: AFF4 as ready
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Classified gene: AFF4 as Green List (high evidence)
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.32 AFF4 Zornitza Stark gene: AFF4 was added
gene: AFF4 was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Expert Review
Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AFF4 were set to 31058441; 25730767
Phenotypes for gene: AFF4 were set to CHOPS syndrome, MIM# 616368
Review for gene: AFF4 was set to GREEN
Added comment: Chronic interstitial lung disease is a feature of this condition. More than 15 unrelated individuals reported.
Sources: Expert Review
Cerebral Palsy v0.89 ATRX Zornitza Stark Marked gene: ATRX as ready
Cerebral Palsy v0.89 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Cerebral Palsy v0.89 ATRX Zornitza Stark Classified gene: ATRX as Green List (high evidence)
Cerebral Palsy v0.89 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Cerebral Palsy v0.88 ATRX Zornitza Stark gene: ATRX was added
gene: ATRX was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ATRX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ATRX were set to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580
Review for gene: ATRX was set to GREEN
Added comment: ID and hypotonia/hypertonia/spasticity: phenotypic overlap with CP. Well established gene-disease association.
Sources: Expert Review
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Marked gene: ATP1A3 as ready
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark edited their review of gene: ATP1A3: Changed rating: RED
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Classified gene: ATP1A3 as Red List (low evidence)
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.86 ATP1A3 Zornitza Stark gene: ATP1A3 was added
gene: ATP1A3 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ATP1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ATP1A3 were set to Alternating hemiplegia of childhood 2, MIM# 614820; CAPOS syndrome, MIM# 601338; Dystonia-12, MIM# 128235
Review for gene: ATP1A3 was set to GREEN
Added comment: The disorders associated with variants in this gene tend to have episodic symptoms, insufficient overlap with CP.
Sources: Expert Review
Cerebral Palsy v0.85 ASXL3 Zornitza Stark Marked gene: ASXL3 as ready
Cerebral Palsy v0.85 ASXL3 Zornitza Stark Gene: asxl3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.85 ASXL3 Zornitza Stark gene: ASXL3 was added
gene: ASXL3 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ASXL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ASXL3 were set to Bainbridge-Ropers syndrome, MIM# 615485
Review for gene: ASXL3 was set to RED
Added comment: Severe neurodevelopmental disorder but no strong overlap with CP.
Sources: Expert Review
Cerebral Palsy v0.84 ARX Zornitza Stark Marked gene: ARX as ready
Cerebral Palsy v0.84 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Cerebral Palsy v0.84 ARX Zornitza Stark Classified gene: ARX as Green List (high evidence)
Cerebral Palsy v0.84 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Cerebral Palsy v0.83 ARX Zornitza Stark gene: ARX was added
gene: ARX was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ARX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ARX were set to Developmental and epileptic encephalopathy 1, MIM# 308350; Lissencephaly, X-linked 2, MIM# 300215; Proud syndrome, MIM# 300004
Review for gene: ARX was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap: ID/seizures/abnormal tone.
Sources: Expert Review
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Classified gene: AMPD2 as Green List (high evidence)
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4126 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Intellectual disability syndromic and non-syndromic v0.4126 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4126 AMPD2 Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809
Intellectual disability syndromic and non-syndromic v0.4125 AMPD2 Zornitza Stark Publications for gene: AMPD2 were set to
Intellectual disability syndromic and non-syndromic v0.4124 AMPD2 Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4123 AMPD2 Zornitza Stark reviewed gene: AMPD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23911318, 27066553; Phenotypes: Pontocerebellar hypoplasia, type 9, MIM#615809; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9189 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Mendeliome v0.9189 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Mendeliome v0.9189 AMPD2 Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809
Mendeliome v0.9188 AMPD2 Zornitza Stark Publications for gene: AMPD2 were set to
Mendeliome v0.9187 AMPD2 Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9186 AMPD2 Zornitza Stark Deleted their comment
Mendeliome v0.9186 AMPD2 Zornitza Stark edited their review of gene: AMPD2: Added comment: Well established gene-disease association. Clinical features include severely delayed psychomotor development, progressive microcephaly, spasticity, seizures, and brain abnormalities, including brain atrophy, thin corpus callosum, and delayed myelination.; Changed rating: GREEN; Changed publications: 23911318, 27066553
Cerebral Palsy v0.81 AMPD2 Zornitza Stark gene: AMPD2 was added
gene: AMPD2 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: AMPD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AMPD2 were set to 23911318; 27066553; 29761117
Phenotypes for gene: AMPD2 were set to Pontocerebellar hypoplasia, type 9, MIM# 615809
Review for gene: AMPD2 was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap: ID and spastic paraplegia. Reported in CP cohort.
Sources: Expert Review
Incidentalome v0.79 Zornitza Stark removed gene:ALS2 from the panel
Mendeliome v0.9186 ALS2 Zornitza Stark Marked gene: ALS2 as ready
Mendeliome v0.9186 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Mendeliome v0.9186 ALS2 Zornitza Stark Classified gene: ALS2 as Green List (high evidence)
Mendeliome v0.9186 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.80 ALS2 Zornitza Stark Marked gene: ALS2 as ready
Cerebral Palsy v0.80 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.80 ALS2 Zornitza Stark Classified gene: ALS2 as Green List (high evidence)
Cerebral Palsy v0.80 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.79 ALS2 Zornitza Stark gene: ALS2 was added
gene: ALS2 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALS2 were set to 12145748; 33409823; 30128655
Phenotypes for gene: ALS2 were set to Spastic paralysis, infantile onset ascending, MIM# 607225
Review for gene: ALS2 was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap with CP.
Sources: Expert Review
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Marked gene: ALDH3A2 as ready
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Classified gene: ALDH3A2 as Green List (high evidence)
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.77 ALDH3A2 Zornitza Stark gene: ALDH3A2 was added
gene: ALDH3A2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALDH3A2 were set to 9027499; 9829906; 28543186
Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome, MIM# 270200
Review for gene: ALDH3A2 was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap with CP: ID and spastic paraplegia.
Sources: Expert list
Red cell disorders v1.0 Zornitza Stark promoted panel to version 1.0
Red cell disorders v0.222 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Mendeliome v0.9185 HBG2 Zornitza Stark Marked gene: HBG2 as ready
Mendeliome v0.9185 HBG2 Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence).
Mendeliome v0.9185 HBG2 Zornitza Stark Phenotypes for gene: HBG2 were changed from to Fetal hemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977
Mendeliome v0.9184 HBG2 Zornitza Stark Publications for gene: HBG2 were set to
Mendeliome v0.9183 HBG2 Zornitza Stark Mode of inheritance for gene: HBG2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9182 HBG2 Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26500940; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.221 HBG2 Zornitza Stark Marked gene: HBG2 as ready
Red cell disorders v0.221 HBG2 Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence).
Red cell disorders v0.221 HBG2 Zornitza Stark Phenotypes for gene: HBG2 were changed from Cyanosis, transient neonatal, 613977; 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1,141749 to Fetal haemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977
Red cell disorders v0.220 HBG2 Zornitza Stark Mode of inheritance for gene: HBG2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.219 HBG2 Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9182 HBG1 Zornitza Stark Marked gene: HBG1 as ready
Mendeliome v0.9182 HBG1 Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence).
Mendeliome v0.9182 HBG1 Zornitza Stark Classified gene: HBG1 as Green List (high evidence)
Mendeliome v0.9182 HBG1 Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence).
Mendeliome v0.9181 HBG1 Zornitza Stark gene: HBG1 was added
gene: HBG1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: HBG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HBG1 were set to 26500940
Phenotypes for gene: HBG1 were set to Fetal haemoglobin quantitative trait locus 1, 141749
Review for gene: HBG1 was set to GREEN
Added comment: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations.
Sources: Expert Review
Red cell disorders v0.219 HBG1 Zornitza Stark Marked gene: HBG1 as ready
Red cell disorders v0.219 HBG1 Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence).
Red cell disorders v0.219 HBG1 Zornitza Stark Phenotypes for gene: HBG1 were changed from 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1, 141749 to Fetal haemoglobin quantitative trait locus 1, 141749
Red cell disorders v0.218 HBG1 Zornitza Stark changed review comment from: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or hematologic manifestations.; to: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations.
Red cell disorders v0.218 HBG1 Zornitza Stark reviewed gene: HBG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal haemoglobin quantitative trait locus 1 141749; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.218 RPS24 Zornitza Stark Marked gene: RPS24 as ready
Red cell disorders v0.218 RPS24 Zornitza Stark Gene: rps24 has been classified as Green List (High Evidence).
Red cell disorders v0.218 RPS24 Zornitza Stark Phenotypes for gene: RPS24 were changed from Inherited Bone Marrow Failure Syndromes; Diamond-blackfan anemia 3, 610629; Diamond-Blackfan Anemia 3; Diamond Blackfan anemia; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 3; Diamond_Blackfan Anemia 3; 610629 Diamond_Blackfan Anemia 3; 610629 Diamond-blackfan anemia 3 to Diamond-Blackfan anaemia 3, MIM# 610629
Red cell disorders v0.217 RPS24 Zornitza Stark Publications for gene: RPS24 were set to 17186470; 23812780
Red cell disorders v0.216 RPS19 Zornitza Stark Marked gene: RPS19 as ready
Red cell disorders v0.216 RPS19 Zornitza Stark Gene: rps19 has been classified as Green List (High Evidence).
Red cell disorders v0.216 RPS19 Zornitza Stark Phenotypes for gene: RPS19 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 105650 Diamond-Blackfan anemia 1; 105650 Diamond_Blackfan Anemia 1; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 1; Diamond-Blackfan anemia 1, 105650; Diamond_Blackfan Anemia to Diamond-Blackfan anaemia 1, MIM# 105650; MONDO:0007110
Red cell disorders v0.215 RPS19 Zornitza Stark Publications for gene: RPS19 were set to 9988267
Red cell disorders v0.214 RPS17 Zornitza Stark Marked gene: RPS17 as ready
Red cell disorders v0.214 RPS17 Zornitza Stark Gene: rps17 has been classified as Green List (High Evidence).
Red cell disorders v0.214 RPS17 Zornitza Stark Phenotypes for gene: RPS17 were changed from Diamond-Blackfan anemia 4, 612527; 612527 Diamond-Blackfan anemia 4 to Diamond-Blackfan anaemia 4, MIM# 612527
Red cell disorders v0.213 RPS10 Zornitza Stark Marked gene: RPS10 as ready
Red cell disorders v0.213 RPS10 Zornitza Stark Gene: rps10 has been classified as Green List (High Evidence).
Red cell disorders v0.213 RPS10 Zornitza Stark Phenotypes for gene: RPS10 were changed from 613308 Diamond-Blackfan anemia 9; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; DIAMOND-BLACKFAN ANEMIA 9; Diamond-Blackfan Anemia 9; Diamond-Blackfan Anemia; Diamond-Blackfan anemia 9, 613308; 613308 Diamond_Blackfan Anemia 9; Diamond_Blackfan Anemia 9 to Diamond-Blackfan anaemia 9, MIM# 613308
Red cell disorders v0.212 RPS10 Zornitza Stark Publications for gene: RPS10 were set to 20116044
Red cell disorders v0.211 RPL9 Zornitza Stark Marked gene: RPL9 as ready
Red cell disorders v0.211 RPL9 Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.211 RPL9 Zornitza Stark Phenotypes for gene: RPL9 were changed from Diamond-Blackfan anemia; N/A Diamond-Blackfan anemia; ?Diamond-Blackfan anaemia to Diamond Blackfan anaemia
Red cell disorders v0.210 RPL9 Zornitza Stark Publications for gene: RPL9 were set to 29114930
Red cell disorders v0.209 RPL9 Zornitza Stark Classified gene: RPL9 as Amber List (moderate evidence)
Red cell disorders v0.209 RPL9 Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9180 WNT9B Zornitza Stark Marked gene: WNT9B as ready
Mendeliome v0.9180 WNT9B Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9180 WNT9B Zornitza Stark Phenotypes for gene: WNT9B were changed from to Renal agenesis/hypoplasia/dysplasia
Mendeliome v0.9179 WNT9B Zornitza Stark Publications for gene: WNT9B were set to
Mendeliome v0.9178 WNT9B Zornitza Stark Mode of inheritance for gene: WNT9B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9177 WNT9B Zornitza Stark Classified gene: WNT9B as Amber List (moderate evidence)
Mendeliome v0.9177 WNT9B Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9176 WNT9B Zornitza Stark reviewed gene: WNT9B: Rating: AMBER; Mode of pathogenicity: None; Publications: 34145744; Phenotypes: Renal agenesis/hypoplasia/dysplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9176 DDX23 Zornitza Stark Marked gene: DDX23 as ready
Mendeliome v0.9176 DDX23 Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence).
Mendeliome v0.9176 DDX23 Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder
Mendeliome v0.9175 DDX23 Zornitza Stark Publications for gene: DDX23 were set to 33057194
Mendeliome v0.9174 DDX23 Zornitza Stark Classified gene: DDX23 as Green List (high evidence)
Mendeliome v0.9174 DDX23 Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence).
Mendeliome v0.9173 DDX23 Zornitza Stark reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: 34050707; Phenotypes: DDX23-associated neurodevelopmental disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4123 DDX23 Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder
Intellectual disability syndromic and non-syndromic v0.4122 DDX23 Zornitza Stark Publications for gene: DDX23 were set to 33057194
Pituitary hormone deficiency v0.17 CHD7 Belinda Chong edited their review of gene: CHD7: Changed publications: PMID: 29152903, PMID: 30733481
Pituitary hormone deficiency v0.17 CHD7 Belinda Chong reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29152903, 30733481; Phenotypes: CHARGE syndrome MIM# 214800, Hypogonadotropic hypogonadism 5 with or without anosmia MIM# 612370; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9173 TAF2 Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204; 24084144
Mendeliome v0.9172 TAF2 Zornitza Stark Classified gene: TAF2 as Green List (high evidence)
Mendeliome v0.9172 TAF2 Zornitza Stark Gene: taf2 has been classified as Green List (High Evidence).
Mendeliome v0.9171 TAF2 Zornitza Stark edited their review of gene: TAF2: Added comment: New report of 4 individuals from 2 unrelated families, with severe intellectual disability, global developmental delay, postnatal microcephaly, feet deformities and thin corpus callosum. They had homozygous TAF2 missense variants detected by Exome Sequencing.; Changed rating: GREEN; Changed publications: 21937992, 22633631, 26350204, 24084144, 34474177
Microcephaly v1.52 TAF2 Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204
Intellectual disability syndromic and non-syndromic v0.4121 TAF2 Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204
Mendeliome v0.9171 ERGIC1 Zornitza Stark Marked gene: ERGIC1 as ready
Mendeliome v0.9171 ERGIC1 Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9171 ERGIC1 Zornitza Stark Classified gene: ERGIC1 as Amber List (moderate evidence)
Mendeliome v0.9171 ERGIC1 Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9170 ERGIC1 Zornitza Stark gene: ERGIC1 was added
gene: ERGIC1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERGIC1 were set to 28317099; 34037256
Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100
Review for gene: ERGIC1 was set to AMBER
Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi.

Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents.
Sources: Literature
Arthrogryposis v0.296 ERGIC1 Zornitza Stark Marked gene: ERGIC1 as ready
Arthrogryposis v0.296 ERGIC1 Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9169 HMGB1 Zornitza Stark Phenotypes for gene: HMGB1 were changed from Mirror image foot polydactyly to Mirror image foot polydactyly; Developmental delay and microcephaly, no OMIM #
Mendeliome v0.9168 HMGB1 Zornitza Stark Publications for gene: HMGB1 were set to 34159400
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 Zornitza Stark Marked gene: HMGB1 as ready
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence).
Microcephaly v1.51 HMGB1 Zornitza Stark Marked gene: HMGB1 as ready
Microcephaly v1.51 HMGB1 Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 SGCE Anna Le Fevre reviewed gene: SGCE: Rating: GREEN; Mode of pathogenicity: None; Publications: 11528394, 12325078, 17200151, 16227522, 20301587, 33200041; Phenotypes: myoclonus, dystonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9167 HMGB1 chirag patel reviewed gene: HMGB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34164801; Phenotypes: Developmental delay and microcephaly, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9167 HMGB1 chirag patel Classified gene: HMGB1 as Green List (high evidence)
Mendeliome v0.9167 HMGB1 chirag patel Gene: hmgb1 has been classified as Green List (High Evidence).
Microcephaly v1.51 HMGB1 chirag patel Phenotypes for gene: HMGB1 were changed from Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM #
Microcephaly v1.51 HMGB1 chirag patel Phenotypes for gene: HMGB1 were changed from 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM #
Microcephaly v1.50 HMGB1 chirag patel edited their review of gene: HMGB1: Changed phenotypes: Developmental delay and microcephaly, no OMIM #
Microcephaly v1.50 HMGB1 chirag patel Classified gene: HMGB1 as Green List (high evidence)
Microcephaly v1.50 HMGB1 chirag patel Gene: hmgb1 has been classified as Green List (High Evidence).
Microcephaly v1.49 HMGB1 chirag patel gene: HMGB1 was added
gene: HMGB1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HMGB1 were set to PMID: 34164801
Phenotypes for gene: HMGB1 were set to 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM #
Review for gene: HMGB1 was set to GREEN
Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 chirag patel Classified gene: HMGB1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 chirag patel Gene: hmgb1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4119 HMGB1 chirag patel gene: HMGB1 was added
gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HMGB1 were set to PMID: 34164801
Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM #
Review for gene: HMGB1 was set to GREEN
Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome.
Sources: Literature
Arthrogryposis v0.296 ERGIC1 chirag patel Classified gene: ERGIC1 as Amber List (moderate evidence)
Arthrogryposis v0.296 ERGIC1 chirag patel Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Arthrogryposis v0.295 ERGIC1 chirag patel gene: ERGIC1 was added
gene: ERGIC1 was added to Arthrogryposis. Sources: Literature
Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERGIC1 were set to PMID: 28317099, 34037256
Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100
Review for gene: ERGIC1 was set to AMBER
Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi.

Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents.
Sources: Literature
Imprinting disorders v0.3 UBE3A Anna Le Fevre reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 8988171, 16470747; Phenotypes: Angelman syndrome OMIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Microcephaly v1.48 TAF2 chirag patel Classified gene: TAF2 as Green List (high evidence)
Microcephaly v1.48 TAF2 chirag patel Gene: taf2 has been classified as Green List (High Evidence).
Microcephaly v1.47 TAF2 chirag patel Classified gene: TAF2 as Green List (high evidence)
Microcephaly v1.47 TAF2 chirag patel Gene: taf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4118 TAF2 chirag patel Classified gene: TAF2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4118 TAF2 chirag patel Gene: taf2 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 ZFP57 Anna Le Fevre reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393, 27075368, 23150280, 30315371, 31399135, 33053156; Phenotypes: Transient Neonatal Diabetes Mellitus Type 1, Multi Locus Imprinting Disturbance, IUGR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v1.46 TAF2 chirag patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4117 TAF2 chirag patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 chirag patel Classified gene: DDX23 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 chirag patel Gene: ddx23 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 chirag patel Classified gene: DDX23 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 chirag patel Gene: ddx23 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4116 DDX23 chirag patel reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34050707; Phenotypes: Neurodevelopmental disorder, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.208 RPL5 Zornitza Stark Marked gene: RPL5 as ready
Red cell disorders v0.208 RPL5 Zornitza Stark Gene: rpl5 has been classified as Green List (High Evidence).
Red cell disorders v0.208 RPL5 Zornitza Stark Phenotypes for gene: RPL5 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 612561 Diamond-Blackfan anemia 6; Diamond-Blackfan anemia 6, 612561; Diamond-Blackfan Anemia 6; 612561 Diamond_Blackfan Anemia 6; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 6; Diamond_Blackfan Anemia 6 to Diamond-Blackfan anemia 6, MIM# 612561; MONDO:0012937
Red cell disorders v0.207 RPL35A Zornitza Stark Marked gene: RPL35A as ready
Red cell disorders v0.207 RPL35A Zornitza Stark Gene: rpl35a has been classified as Green List (High Evidence).
Red cell disorders v0.207 RPL35A Zornitza Stark Phenotypes for gene: RPL35A were changed from Inherited Bone Marrow Failure Syndromes; DIAMOND-BLACKFAN ANEMIA 5; Diamond-Blackfan anemia 5, 612528; 612528 Diamond-Blackfan anemia 5; Diamond Blackfan anemia; Diamond-Blackfan Anemia; Diamond-Blackfan Anemia 5; 612528 Diamond_Blackfan Anemia 5; Diamond_Blackfan Anemia 5 to Diamond-Blackfan anaemia 5, MIM# 612528
Red cell disorders v0.206 RPL35A Zornitza Stark Publications for gene: RPL35A were set to 18535205
Red cell disorders v0.205 RPL35A Zornitza Stark Tag SV/CNV tag was added to gene: RPL35A.
Red cell disorders v0.205 RPL31 Zornitza Stark Marked gene: RPL31 as ready
Red cell disorders v0.205 RPL31 Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.205 RPL31 Zornitza Stark Phenotypes for gene: RPL31 were changed from N/A ? Diamond-Blackfan Anaemia to Diamond Blackfan anaemia
Red cell disorders v0.204 RPL31 Zornitza Stark Classified gene: RPL31 as Amber List (moderate evidence)
Red cell disorders v0.204 RPL31 Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.203 RPL27 Zornitza Stark Marked gene: RPL27 as ready
Red cell disorders v0.203 RPL27 Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence).
Red cell disorders v0.203 RPL27 Zornitza Stark Phenotypes for gene: RPL27 were changed from Diamond-Blackfan anemia; Diamond-Blackfan anemia 16, 617408 to Diamond-Blackfan anemia 16, MIM# 617408
Red cell disorders v0.202 RPL27 Zornitza Stark Classified gene: RPL27 as Red List (low evidence)
Red cell disorders v0.202 RPL27 Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence).
Mendeliome v0.9166 FCGR2B Zornitza Stark Marked gene: FCGR2B as ready
Mendeliome v0.9166 FCGR2B Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence).
Mendeliome v0.9166 FCGR2B Zornitza Stark Phenotypes for gene: FCGR2B were changed from to {Systemic lupus erythematosus, susceptibility to} MIM#152700
Mendeliome v0.9165 FCGR2B Zornitza Stark Publications for gene: FCGR2B were set to
Mendeliome v0.9164 FCGR2B Zornitza Stark Mode of inheritance for gene: FCGR2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9163 FCGR2B Zornitza Stark Classified gene: FCGR2B as Red List (low evidence)
Mendeliome v0.9163 FCGR2B Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence).
Red cell disorders v0.201 RPS26 Zornitza Stark Marked gene: RPS26 as ready
Red cell disorders v0.201 RPS26 Zornitza Stark Gene: rps26 has been classified as Green List (High Evidence).
Red cell disorders v0.201 RPS26 Zornitza Stark Phenotypes for gene: RPS26 were changed from Diamond-Blackfan anemia 10, 613309; Inherited Bone Marrow Failure Syndromes; Diamond-Blackfan anemia 10; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 613309 Diamond_Blackfan Anemia 10; Diamond_Blackfan Anemia 10; 613309 Diamond-Blackfan anemia 10 to Diamond-Blackfan anemia 10, MIM# 613309; MONDO:0013217
Red cell disorders v0.200 RPS27 Zornitza Stark Marked gene: RPS27 as ready
Red cell disorders v0.200 RPS27 Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence).
Red cell disorders v0.200 RPS27 Zornitza Stark Phenotypes for gene: RPS27 were changed from Diamond-Blackfan anemia; ?Diamond-Blackfan anemia 17, 617409; 617409 ?Diamond-Blackfan anemia 17, to Diamond-Blackfan anemia 17, MIM# 617409
Red cell disorders v0.199 RPS27 Zornitza Stark Publications for gene: RPS27 were set to 25424902; 23718193
Red cell disorders v0.198 RPS27 Zornitza Stark Classified gene: RPS27 as Red List (low evidence)
Red cell disorders v0.198 RPS27 Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence).
Red cell disorders v0.197 RPS29 Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, MIM# 615909 to Diamond-Blackfan anaemia 13, MIM# 615909
Red cell disorders v0.196 RPS29 Zornitza Stark Marked gene: RPS29 as ready
Red cell disorders v0.196 RPS29 Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.196 RPS29 Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, 615909; 615909 Diamond-Blackfan anemia 13 to Diamond-Blackfan anemia 13, MIM# 615909
Red cell disorders v0.195 RPS29 Zornitza Stark Classified gene: RPS29 as Amber List (moderate evidence)
Red cell disorders v0.195 RPS29 Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.194 RPS7 Zornitza Stark Marked gene: RPS7 as ready
Red cell disorders v0.194 RPS7 Zornitza Stark Gene: rps7 has been classified as Green List (High Evidence).
Red cell disorders v0.194 RPS7 Zornitza Stark Phenotypes for gene: RPS7 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan anemia 8, 612563; 612563 Diamond_Blackfan Anemia 8; DIAMOND-BLACKFAN ANEMIA 8; Diamond-Blackfan Anemia; 612563 Diamond-Blackfan anemia 8; Diamond_Blackfan Anemia 8 to Diamond-Blackfan anaemia 8, MIM# 612563; MONDO:0012939
Red cell disorders v0.193 RPS7 Zornitza Stark Publications for gene: RPS7 were set to 19061985; 27882484; 23718193
Red cell disorders v0.192 SBDS Zornitza Stark Marked gene: SBDS as ready
Red cell disorders v0.192 SBDS Zornitza Stark Gene: sbds has been classified as Green List (High Evidence).
Red cell disorders v0.192 SBDS Zornitza Stark Phenotypes for gene: SBDS were changed from 260400 Shwachman-Diamond syndrome; Shwachman-Diamond syndrome to Shwachman-Diamond syndrome, MIM# 260400
Red cell disorders v0.191 SEC23B Zornitza Stark Marked gene: SEC23B as ready
Red cell disorders v0.191 SEC23B Zornitza Stark Gene: sec23b has been classified as Green List (High Evidence).
Red cell disorders v0.191 SEC23B Zornitza Stark Phenotypes for gene: SEC23B were changed from Congenital Dyserythropoietic Anemia; ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; 224100 ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; Anemia, dyserythropoieticcongenital, type II, 224100; Congenital dyserythropoietic anemia type II; 224100 Congenital dyserythropoietic anaemia type 2 to Dyserythropoietic anaemia, congenital, type II , MIM#224100
Red cell disorders v0.190 SEC23B Zornitza Stark Publications for gene: SEC23B were set to 19561605
Red cell disorders v0.189 SLC19A2 Zornitza Stark Marked gene: SLC19A2 as ready
Red cell disorders v0.189 SLC19A2 Zornitza Stark Gene: slc19a2 has been classified as Green List (High Evidence).
Red cell disorders v0.189 SLC19A2 Zornitza Stark Phenotypes for gene: SLC19A2 were changed from 249270 Thiamine-Responsive Megaloblastic Anemia syndrome; Thiamine-Responsive Megaloblastic Anemia syndrome, 249270; 249270 Thiamine-responsive megaloblastic anemia syndrome to Thiamine-responsive megaloblastic anaemia syndrome, MIM# 249270
Red cell disorders v0.188 SLC25A38 Zornitza Stark Marked gene: SLC25A38 as ready
Red cell disorders v0.188 SLC25A38 Zornitza Stark Gene: slc25a38 has been classified as Green List (High Evidence).
Red cell disorders v0.188 SLC25A38 Zornitza Stark Phenotypes for gene: SLC25A38 were changed from Anemia, sideroblastic, 2, pyridoxine-refractory, 205950; 205950 Pyridoxine refractory sideroblastic anaemia 2; 205950 Anemia, sideroblastic, 2, pyridoxine-refractory to Anaemia, sideroblastic, 2, pyridoxine-refractory, MIM# 205950
Red cell disorders v0.187 XK Zornitza Stark Marked gene: XK as ready
Red cell disorders v0.187 XK Zornitza Stark Gene: xk has been classified as Green List (High Evidence).
Red cell disorders v0.187 XK Zornitza Stark Phenotypes for gene: XK were changed from 300842 McLeod syndrome to McLeod syndrome with or without chronic granulomatous disease MIM# 300842; absence of red blood cell Kx antigen; weak expression of Kell red blood cell antigens; neuroacanthocytosis (peripheral and central nervous systems); cardiovascular abnormalities; myopathy
Red cell disorders v0.186 XK Zornitza Stark Publications for gene: XK were set to 17683354; 11761473
Red cell disorders v0.185 NHP2 Zornitza Stark Marked gene: NHP2 as ready
Red cell disorders v0.185 NHP2 Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence).
Red cell disorders v0.185 NHP2 Zornitza Stark Phenotypes for gene: NHP2 were changed from 613987 Dyskeratosis congenita, autosomal recessive 2 to Dyskeratosis congenita, autosomal recessive 2, MIM# 613987
Red cell disorders v0.184 NHP2 Zornitza Stark Publications for gene: NHP2 were set to
Red cell disorders v0.183 NHP2 Zornitza Stark Classified gene: NHP2 as Red List (low evidence)
Red cell disorders v0.183 NHP2 Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence).
Red cell disorders v0.182 NHP2 Zornitza Stark changed review comment from: Dyskeratosis congenita is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features. Three unrelated families reported.; to: Pancytopaenia.
Red cell disorders v0.182 NHP2 Zornitza Stark edited their review of gene: NHP2: Changed rating: RED
Red cell disorders v0.182 RPL18 Zornitza Stark Marked gene: RPL18 as ready
Red cell disorders v0.182 RPL18 Zornitza Stark Gene: rpl18 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.182 RPL18 Zornitza Stark Phenotypes for gene: RPL18 were changed from Diamond-Blackfan anaemia to Diamond-Blackfan anemia 18, MIM# 618310
Red cell disorders v0.181 RPL18 Zornitza Stark Publications for gene: RPL18 were set to 28280134
Red cell disorders v0.180 RPS28 Zornitza Stark Marked gene: RPS28 as ready
Red cell disorders v0.180 RPS28 Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.180 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 to Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164
Red cell disorders v0.179 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from 606164 Diamond Blackfan anemia 15 with mandibulofacial dysostosis; Diamond Blackfan anemia 15 with mandibulofacial dysostosis, 606164 to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164
Red cell disorders v0.178 TSR2 Zornitza Stark Marked gene: TSR2 as ready
Red cell disorders v0.178 TSR2 Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence).
Red cell disorders v0.178 TSR2 Zornitza Stark Phenotypes for gene: TSR2 were changed from 300946 ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis; ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, 300946 to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946
Red cell disorders v0.177 TSR2 Zornitza Stark Classified gene: TSR2 as Red List (low evidence)
Red cell disorders v0.177 TSR2 Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence).
Red cell disorders v0.176 ATRX Zornitza Stark Marked gene: ATRX as ready
Red cell disorders v0.176 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Red cell disorders v0.176 ATRX Zornitza Stark Phenotypes for gene: ATRX were changed from 301040 Alpha-thalassemia/mental retardation syndrome to Alpha-thalassaemia/mental retardation syndrome, MIM# 301040
Red cell disorders v0.175 ATRX Zornitza Stark Publications for gene: ATRX were set to 19444090; 17579672; 11449489
Red cell disorders v0.174 ATRX Zornitza Stark Mode of inheritance for gene: ATRX was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Red cell disorders v0.173 ATRX Zornitza Stark Classified gene: ATRX as Green List (high evidence)
Red cell disorders v0.173 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Red cell disorders v0.172 ATRX Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 7697714; Phenotypes: Alpha-thalassaemia/mental retardation syndrome, MIM# 301040; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Red cell disorders v0.172 DKC1 Zornitza Stark Marked gene: DKC1 as ready
Red cell disorders v0.172 DKC1 Zornitza Stark Gene: dkc1 has been classified as Red List (Low Evidence).
Red cell disorders v0.172 DKC1 Zornitza Stark Phenotypes for gene: DKC1 were changed from 305000 Dyskeratosis congenita, X-linked to Dyskeratosis congenita, X-linked 305000; Hoyeraal-Hreidarsson Syndrome
Red cell disorders v0.171 DKC1 Zornitza Stark Publications for gene: DKC1 were set to
Red cell disorders v0.170 DKC1 Zornitza Stark changed review comment from: Dyskeratosis congenita is classically defined by the triad of abnormal skin pigmentation, nail dystrophy, and leukoplakia of the oral mucosa. It is characterized by short telomeres. Progressive bone marrow failure occurs in over 80% of cases and is the main cause of early mortality. The phenotype is highly variable, and affected individuals may have multiple additional features, including pulmonary fibrosis, liver cirrhosis, premature hair loss and/or graying, osteoporosis, atresia of the lacrimal ducts, and learning difficulties. Males may have testicular atrophy. Predisposition to malignancy is an important feature.

Hoyeraal-Hreidarsson syndrome (HHS) refers to a clinically severe variant of DKC that is characterized by multisystem involvement and early onset in utero. Patients with HHS show intrauterine growth retardation, microcephaly, delayed development, and bone marrow failure resulting in immunodeficiency, cerebellar hypoplasia, and sometimes enteropathy. Death often occurs in childhood.

PMID: 25940403, at least 13 of the variants associated with dyskeratosis congenita were also reported to cause HHS: P10L, I38T, T66A, T67I, H68Q, H68Y, S121G, R158W, K314R, A353V, R378Q, A386T and IVS12+1, so NOT only variants in exon 11. Two mutations were only found in HH, T49M and S304N.; to: Pancytopaenia rather than a red cell disorder.
Red cell disorders v0.170 DKC1 Zornitza Stark edited their review of gene: DKC1: Changed rating: RED
Red cell disorders v0.170 Zornitza Stark removed gene:HBE1 from the panel
Red cell disorders v0.169 SF3B1 Zornitza Stark Marked gene: SF3B1 as ready
Red cell disorders v0.169 SF3B1 Zornitza Stark Gene: sf3b1 has been classified as Red List (Low Evidence).
Red cell disorders v0.169 SF3B1 Zornitza Stark Phenotypes for gene: SF3B1 were changed from 605590 Refractory anaemia with ring sideroblasts to Myelodysplastic syndrome, somatic MIM# 614286
Red cell disorders v0.168 SF3B1 Zornitza Stark Mode of inheritance for gene: SF3B1 was changed from Unknown to Other
Red cell disorders v0.167 SF3B1 Zornitza Stark Tag somatic tag was added to gene: SF3B1.
Mendeliome v0.9162 FCGR2B Paul De Fazio reviewed gene: FCGR2B: Rating: RED; Mode of pathogenicity: None; Publications: 12115230, 15153543, 20385827; Phenotypes: {Systemic lupus erythematosus, susceptibility to} MIM#152700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v0.9162 GPX1 Zornitza Stark Marked gene: GPX1 as ready
Mendeliome v0.9162 GPX1 Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence).
Mendeliome v0.9162 GPX1 Zornitza Stark gene: GPX1 was added
gene: GPX1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: GPX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GPX1 were set to 1131421; 476008; 5766310; 2492138
Phenotypes for gene: GPX1 were set to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164
Review for gene: GPX1 was set to RED
Added comment: No individuals reported with GPX1 variants identified as the cause of Haemolytic anaemia due to glutathione peroxidase deficiency. Multiple papers report a number of cases of Haemolytic anaemia due to glutathione peroxidase deficiency, however there is no defined link or variant to GPX1 (PMID: 5766310. PMID: 1131421, PMID: 2492138, PMID: 476008)

Overall, lowered glutathione peroxidase activity has been observed in a number of individuals with haemolytic anaemia however the evidence for a cause-and-effect relationship between the enzyme deficiency and the presenting anaemia is not evident.
Sources: Expert Review
Red cell disorders v0.167 GPX1 Zornitza Stark Marked gene: GPX1 as ready
Red cell disorders v0.167 GPX1 Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence).
Red cell disorders v0.167 GPX1 Zornitza Stark Phenotypes for gene: GPX1 were changed from 614164 Hemolytic anemia due to glutathione peroxidase deficiency to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164
Red cell disorders v0.166 GPX1 Zornitza Stark Publications for gene: GPX1 were set to 1131421
Mendeliome v0.9161 CYP51A1 Bryony Thompson Mode of inheritance for gene: CYP51A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9160 CYP51A1 Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cataract v0.289 CYP51A1 Bryony Thompson Phenotypes for gene: CYP51A1 were changed from to Congenital cataract; infantile liver disease
Cataract v0.288 CYP51A1 Bryony Thompson Publications for gene: CYP51A1 were set to
Cataract v0.287 CYP51A1 Bryony Thompson Marked gene: CYP51A1 as ready
Cataract v0.287 CYP51A1 Bryony Thompson Gene: cyp51a1 has been classified as Green List (High Evidence).
Cataract v0.287 CYP51A1 Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9160 CYB5A Zornitza Stark Marked gene: CYB5A as ready
Mendeliome v0.9160 CYB5A Zornitza Stark Gene: cyb5a has been classified as Green List (High Evidence).
Mendeliome v0.9160 CYB5A Zornitza Stark Phenotypes for gene: CYB5A were changed from to Methemoglobinaemia and ambiguous genitalia, MIM# 250790
Mendeliome v0.9159 CYB5A Zornitza Stark Publications for gene: CYB5A were set to
Mendeliome v0.9158 CYB5A Zornitza Stark Mode of inheritance for gene: CYB5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9157 CYB5A Zornitza Stark reviewed gene: CYB5A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22170710, 32051920; Phenotypes: Methemoglobinemia and ambiguous genitalia 250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.165 CYB5A Zornitza Stark Marked gene: CYB5A as ready
Red cell disorders v0.165 CYB5A Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.165 CYB5A Zornitza Stark Phenotypes for gene: CYB5A were changed from 250790 Methemoglobinemia and ambiguous genitalia to Methemoglobinaemia and ambiguous genitalia MIM#250790
Red cell disorders v0.164 CYB5A Zornitza Stark Publications for gene: CYB5A were set to 8168836; 20080843
Red cell disorders v0.163 CYB5A Zornitza Stark Classified gene: CYB5A as Amber List (moderate evidence)
Red cell disorders v0.163 CYB5A Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.162 FTCD Zornitza Stark Marked gene: FTCD as ready
Red cell disorders v0.162 FTCD Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.162 FTCD Zornitza Stark Phenotypes for gene: FTCD were changed from 229100 Glutamate formiminotransferase deficiency to Glutamate formiminotransferase deficiency MIM# 229100
Red cell disorders v0.161 FTCD Zornitza Stark Publications for gene: FTCD were set to 12815595
Red cell disorders v0.160 FTCD Zornitza Stark Classified gene: FTCD as Amber List (moderate evidence)
Red cell disorders v0.160 FTCD Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.159 GPX1 Danielle Ariti reviewed gene: GPX1: Rating: RED; Mode of pathogenicity: None; Publications: 1131421, 476008, 5766310, 2492138; Phenotypes: Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.159 SH2B3 Zornitza Stark Marked gene: SH2B3 as ready
Red cell disorders v0.159 SH2B3 Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.159 SH2B3 Zornitza Stark Classified gene: SH2B3 as Amber List (moderate evidence)
Red cell disorders v0.159 SH2B3 Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.158 SH2B3 Zornitza Stark gene: SH2B3 was added
gene: SH2B3 was added to Red cell disorders. Sources: Expert Review
somatic tags were added to gene: SH2B3.
Mode of inheritance for gene: SH2B3 was set to Other
Publications for gene: SH2B3 were set to 34349782; 23812944; 20843259
Phenotypes for gene: SH2B3 were set to Erythrocytosis, somatic, MIM# 133100
Mode of pathogenicity for gene: SH2B3 was set to Other
Review for gene: SH2B3 was set to AMBER
Added comment: Limited reports, variants appear to be somatic.
Sources: Expert Review
Red cell disorders v0.157 JAK2 Zornitza Stark Marked gene: JAK2 as ready
Red cell disorders v0.157 JAK2 Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.157 JAK2 Zornitza Stark Classified gene: JAK2 as Amber List (moderate evidence)
Red cell disorders v0.157 JAK2 Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.156 JAK2 Zornitza Stark gene: JAK2 was added
gene: JAK2 was added to Red cell disorders. Sources: Expert Review
somatic tags were added to gene: JAK2.
Mode of inheritance for gene: JAK2 was set to Other
Publications for gene: JAK2 were set to 27389715
Phenotypes for gene: JAK2 were set to Erythrocytosis, somatic, 133100
Mode of pathogenicity for gene: JAK2 was set to Other
Review for gene: JAK2 was set to AMBER
Added comment: There is limited evidence to support an association of JAK2 variants with hereditary/congenital erythrocytosis. Typically, variants are somatic/acquired; and to date, only one report has described a patient with germline compound het variants (p.E846D and p.R1063H) in JAK2, who exhibited polyclonal erythrocytosis and megakaryocytic atypia but normal platelet number (PMID:27389715).

GoF somatic variants in this gene are also associated with polycythaemia vera (PV), particularly p.V617F, but also with reports of some familial clustering due to inheritance of the JAK2 46/1 predisposition haplotype.

Amber rating due to the somatic nature of variants.
Sources: Expert Review
Red cell disorders v0.155 VHL Zornitza Stark Marked gene: VHL as ready
Red cell disorders v0.155 VHL Zornitza Stark Gene: vhl has been classified as Green List (High Evidence).
Red cell disorders v0.155 VHL Zornitza Stark Classified gene: VHL as Green List (high evidence)
Red cell disorders v0.155 VHL Zornitza Stark Gene: vhl has been classified as Green List (High Evidence).
Red cell disorders v0.154 VHL Zornitza Stark gene: VHL was added
gene: VHL was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: VHL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VHL were set to 12844285; 21454469; 24729484; 23403324
Phenotypes for gene: VHL were set to Erythrocytosis, familial, 2, MIM# 263400
Mode of pathogenicity for gene: VHL was set to Other
Review for gene: VHL was set to GREEN
Added comment: Well established gene-disease association. Bi-allelic missense variants, postulated to be hypomorphic.

Note mono-allelic variants associated with Von Hippel Lindau syndrome.
Sources: Expert list
Red cell disorders v0.153 SF3B1 Danielle Ariti reviewed gene: SF3B1: Rating: RED; Mode of pathogenicity: Other; Publications: 21995386, 21909114; Phenotypes: Myelodysplastic syndrome, somatic MIM# 614286; Mode of inheritance: Other
Red cell disorders v0.153 CYB5A Danielle Ariti reviewed gene: CYB5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 22170710, 20080843, 32051920, 3951505; Phenotypes: Methemoglobinaemia and ambiguous genitalia MIM#250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.153 EPOR Zornitza Stark Marked gene: EPOR as ready
Red cell disorders v0.153 EPOR Zornitza Stark Gene: epor has been classified as Green List (High Evidence).
Red cell disorders v0.153 EPOR Zornitza Stark Classified gene: EPOR as Green List (high evidence)
Red cell disorders v0.153 EPOR Zornitza Stark Gene: epor has been classified as Green List (High Evidence).
Red cell disorders v0.152 EPOR Zornitza Stark gene: EPOR was added
gene: EPOR was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EPOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPOR were set to 8506290; 9292543; 30507031; 33061762
Phenotypes for gene: EPOR were set to [Erythrocytosis, familial, 1], MIM# 133100
Review for gene: EPOR was set to GREEN
Added comment: Well established gene-disease association.
Sources: Expert list
Red cell disorders v0.151 FTCD Danielle Ariti reviewed gene: FTCD: Rating: AMBER; Mode of pathogenicity: None; Publications: 29178637, 30740726, 5301410; Phenotypes: Glutamate formiminotransferase deficiency MIM# 229100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 ALOX12B Zornitza Stark Marked gene: ALOX12B as ready
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 ALOX12B Zornitza Stark Gene: alox12b has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 ALOX12B Zornitza Stark Phenotypes for gene: ALOX12B were changed from to Ichthyosis, congenital, autosomal recessive 2, MIM# 242100
Palmoplantar Keratoderma and Erythrokeratoderma v0.106 ALOX12B Zornitza Stark Mode of inheritance for gene: ALOX12B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 ALOX12B Zornitza Stark reviewed gene: ALOX12B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, congenital, autosomal recessive 2, MIM# 242100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9157 COL14A1 Zornitza Stark Marked gene: COL14A1 as ready
Mendeliome v0.9157 COL14A1 Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence).
Mendeliome v0.9157 COL14A1 Zornitza Stark gene: COL14A1 was added
gene: COL14A1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL14A1 were set to 22972947
Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B
Review for gene: COL14A1 was set to RED
Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species.
Sources: Expert Review
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 COL14A1 Zornitza Stark Marked gene: COL14A1 as ready
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 COL14A1 Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 SMARCAD1 Zornitza Stark Phenotypes for gene: SMARCAD1 were changed from Basan syndrome (MIM#129200) to Basan syndrome, MIM#129200; Huriez syndrome, OMIM #181600
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 NLRP1 Zornitza Stark Marked gene: NLRP1 as ready
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 NLRP1 Zornitza Stark Gene: nlrp1 has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 chirag patel Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Royal Melbourne Hospital; Rare Disease
Palmoplantar Keratoderma and Erythrokeratoderma v0.103 NLRP1 chirag patel Classified gene: NLRP1 as Green List (high evidence)
Palmoplantar Keratoderma and Erythrokeratoderma v0.103 NLRP1 chirag patel Gene: nlrp1 has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.102 NLRP1 chirag patel gene: NLRP1 was added
gene: NLRP1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature
Mode of inheritance for gene: NLRP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NLRP1 were set to PMID: 27662089
Phenotypes for gene: NLRP1 were set to Palmoplantar carcinoma, multiple self-healing, OMIM # 615225
Review for gene: NLRP1 was set to GREEN
Added comment: Multiple self-healing palmoplantar carcinoma (MSPC) is characterised by recurrent keratoacanthomas in palmoplantar skin and conjunctival and corneal epithelia. Patients experience a high susceptibility to malignant squamous cell carcinoma.

Zhong et al. (2016) reported 3 families with variants in NLRP1
a) Affected mother and son with MSPC from a Caucasian French family. Whole exome sequencing (+ Sanger sequencing) identified a heterozygous missense mutation in NLRP1 gene (M77T), that appeared de novo in the mother and segregated with disease in the family. The variant was not found in 672 controls or 61 exome-sequenced subjects' DNA.
b) Large 5-generation Tunisian family segregating autosomal dominant MSPC. Whole exome sequencing identified a heterozygous missense mutation in exon 1 of NLRP1 gene (A54T), that segregated with disease in 16 family members.
c) 4-generation kindred with MSPC. Sanger sequencing of NLRP1 exon 1 identified heterozygosity for a missense mutation (A66V, that segregated with disease in the family.
d) 2 sibs in a consanguineous family with features of MSPC, with homozygous in-frame deletion in NLRP1 gene.
Functional analysis demonstrated that all 3 MSPC-associated missense mutations are gain-of-function variants that cause increased inflammasome activation.
Sources: Literature
Palmoplantar Keratoderma and Erythrokeratoderma v0.101 SMARCAD1 chirag patel Classified gene: SMARCAD1 as Green List (high evidence)
Palmoplantar Keratoderma and Erythrokeratoderma v0.101 SMARCAD1 chirag patel Gene: smarcad1 has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.100 SMARCAD1 chirag patel reviewed gene: SMARCAD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29409814; Phenotypes: Huriez syndrome, OMIM #181600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Palmoplantar Keratoderma and Erythrokeratoderma v0.100 COL14A1 chirag patel gene: COL14A1 was added
gene: COL14A1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature
Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL14A1 were set to PMID: 22972947
Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B
Review for gene: COL14A1 was set to RED
Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species.
Sources: Literature
Red cell disorders v0.151 EPO Zornitza Stark Marked gene: EPO as ready
Red cell disorders v0.151 EPO Zornitza Stark Gene: epo has been classified as Green List (High Evidence).
Red cell disorders v0.151 EPO Zornitza Stark Classified gene: EPO as Green List (high evidence)
Red cell disorders v0.151 EPO Zornitza Stark Gene: epo has been classified as Green List (High Evidence).
Red cell disorders v0.150 EPO Zornitza Stark gene: EPO was added
gene: EPO was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPO were set to 27651169; 29514032; 32130275; 20700488; 30507031; 28283061
Phenotypes for gene: EPO were set to Erythrocytosis, familial, 5, MIM# 617907; Diamond-Blackfan anaemia-like, MIM# 617911
Review for gene: EPO was set to GREEN
Added comment: More than 5 unrelated families reported, though note one paper has been retracted.

Single family with bi-allelic variants and a DBA phenotype.
Sources: Expert list
Red cell disorders v0.149 EPAS1 Zornitza Stark Marked gene: EPAS1 as ready
Red cell disorders v0.149 EPAS1 Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence).
Red cell disorders v0.149 EPAS1 Zornitza Stark Classified gene: EPAS1 as Green List (high evidence)
Red cell disorders v0.149 EPAS1 Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence).
Red cell disorders v0.148 EPAS1 Zornitza Stark gene: EPAS1 was added
gene: EPAS1 was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EPAS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPAS1 were set to 18184961; 18378852; 22367913; 18650473
Phenotypes for gene: EPAS1 were set to Erythrocytosis, familial, 4, MIM# 611783
Mode of pathogenicity for gene: EPAS1 was set to Other
Review for gene: EPAS1 was set to GREEN
Added comment: Most mutations are gain-of-function missense variants in exon 12, but variants in exon 9 have also been described, in association with paraganglioma.
Sources: Expert list
Mendeliome v0.9156 EGLN1 Zornitza Stark Marked gene: EGLN1 as ready
Mendeliome v0.9156 EGLN1 Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence).
Mendeliome v0.9156 EGLN1 Zornitza Stark Phenotypes for gene: EGLN1 were changed from to Erythrocytosis, familial, 3, MIM# 609820
Mendeliome v0.9155 EGLN1 Zornitza Stark Publications for gene: EGLN1 were set to
Mendeliome v0.9154 EGLN1 Zornitza Stark Mode of inheritance for gene: EGLN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9153 EGLN1 Zornitza Stark reviewed gene: EGLN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19092153, 16407130, 17579185; Phenotypes: Erythrocytosis, familial, 3, MIM# 609820; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.147 EGLN1 Zornitza Stark Marked gene: EGLN1 as ready
Red cell disorders v0.147 EGLN1 Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence).
Red cell disorders v0.147 EGLN1 Zornitza Stark Classified gene: EGLN1 as Green List (high evidence)
Red cell disorders v0.147 EGLN1 Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence).
Red cell disorders v0.146 EGLN1 Zornitza Stark gene: EGLN1 was added
gene: EGLN1 was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EGLN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EGLN1 were set to 19092153; 16407130; 17579185
Phenotypes for gene: EGLN1 were set to Erythrocytosis, familial, 3, MIM# 609820
Review for gene: EGLN1 was set to GREEN
Added comment: At least 3 unrelated families reported.
Sources: Expert list
Red cell disorders v0.145 BPGM Zornitza Stark Marked gene: BPGM as ready
Red cell disorders v0.145 BPGM Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.145 BPGM Zornitza Stark Classified gene: BPGM as Amber List (moderate evidence)
Red cell disorders v0.145 BPGM Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.144 BPGM Zornitza Stark gene: BPGM was added
gene: BPGM was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: BPGM was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: BPGM were set to 1421379; 27651169; 25015942
Phenotypes for gene: BPGM were set to Erythrocytosis, familial, 8, MIM# 222800
Review for gene: BPGM was set to AMBER
Added comment: Mixture of mono-allelic and bi-allelic variants reported, MOI uncertain.
Sources: Expert list
Holoprosencephaly and septo-optic dysplasia v1.2 RAD21 Zornitza Stark Publications for gene: RAD21 were set to 31334757
Holoprosencephaly and septo-optic dysplasia v1.1 RAD21 Arina Puzriakova reviewed gene: RAD21: Rating: ; Mode of pathogenicity: None; Publications: 32696056; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.9153 FGFR2 Zornitza Stark Marked gene: FGFR2 as ready
Mendeliome v0.9153 FGFR2 Zornitza Stark Gene: fgfr2 has been classified as Green List (High Evidence).
Mendeliome v0.9153 FGFR2 Zornitza Stark Phenotypes for gene: FGFR2 were changed from to Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis,MIM# 207410; Apert syndrome, MIM# 101200; Beare-Stevenson cutis gyrata syndrome, MIM# 123790; Bent bone dysplasia syndrome, MIM# 614592; Craniofacial-skeletal-dermatologic dysplasia, MIM# 101600; Craniosynostosis, nonspecific; Crouzon syndrome , MIM#123500; Jackson-Weiss syndrome,MIM# 123150; LADD syndrome, MIM# 149730; Pfeiffer syndrome,MIM# 101600; Saethre-Chotzen syndrome 101400
Mendeliome v0.9152 FGFR2 Zornitza Stark Publications for gene: FGFR2 were set to
Mendeliome v0.9151 FGFR2 Zornitza Stark Mode of inheritance for gene: FGFR2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9150 SLC4A1 Zornitza Stark Marked gene: SLC4A1 as ready
Mendeliome v0.9150 SLC4A1 Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence).
Mendeliome v0.9150 SLC4A1 Zornitza Stark Phenotypes for gene: SLC4A1 were changed from to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653; Distal renal tubular acidosis 1 MIM# 179800
Mendeliome v0.9149 SLC4A1 Zornitza Stark Publications for gene: SLC4A1 were set to
Mendeliome v0.9148 SLC4A1 Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9147 FGFR2 Chern Lim reviewed gene: FGFR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29848297, 32879300, 27323706; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Mendeliome v0.9147 SLC4A1 Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 7949112, 8640229, 16227998, 8640229, 16227998, 33881640, 32632909; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653, Distal renal tubular acidosis 1 MIM# 179800; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.143 TRNT1 Zornitza Stark Marked gene: TRNT1 as ready
Red cell disorders v0.143 TRNT1 Zornitza Stark Gene: trnt1 has been classified as Green List (High Evidence).
Red cell disorders v0.143 TRNT1 Zornitza Stark Phenotypes for gene: TRNT1 were changed from sideroblastic anaemia; 616084 Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay to Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084
Red cell disorders v0.142 TRNT1 Zornitza Stark Publications for gene: TRNT1 were set to
Red cell disorders v0.141 TRNT1 Zornitza Stark reviewed gene: TRNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25193871, 23553769, 29170023, 27389523; Phenotypes: Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.27 STEAP3 Zornitza Stark Marked gene: STEAP3 as ready
Metal Metabolism Disorders v0.27 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Metal Metabolism Disorders v0.27 STEAP3 Zornitza Stark Phenotypes for gene: STEAP3 were changed from 615234 ?Anemia, hypochromic microcytic, with iron overload 2 to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234
Metal Metabolism Disorders v0.26 STEAP3 Zornitza Stark Publications for gene: STEAP3 were set to 22031863
Metal Metabolism Disorders v0.25 STEAP3 Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Metal Metabolism Disorders v0.24 STEAP3 Zornitza Stark Classified gene: STEAP3 as Red List (low evidence)
Metal Metabolism Disorders v0.24 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Metal Metabolism Disorders v0.23 STEAP3 Zornitza Stark reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9147 STEAP3 Zornitza Stark Phenotypes for gene: STEAP3 were changed from Anemia, hypochromic microcytic, with iron overload 2, MIM# 615234 to Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234
Mendeliome v0.9146 STEAP3 Zornitza Stark Publications for gene: STEAP3 were set to 22031863; 25515317
Mendeliome v0.9145 STEAP3 Zornitza Stark Classified gene: STEAP3 as Red List (low evidence)
Mendeliome v0.9145 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Mendeliome v0.9144 STEAP3 Zornitza Stark changed review comment from: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence.; to: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence.

Conflicting evidence (PMID 26675350): Large Chinese study (of normal and α-thalassemia subjects) investigated the prevalence of STEAP3 mutations in humans and their physiologic consequences. Discovered a relatively high prevalence of potentially harmful recessive alleles. However, whilst the identified STEAP3 mutations exhibited impaired ferrireductase activity in vitro, they had little or no effect on erythrocyte phenotypes
Mendeliome v0.9144 STEAP3 Zornitza Stark edited their review of gene: STEAP3: Changed rating: RED; Changed publications: 22031863, 25515317, 26675350; Changed phenotypes: Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234
Red cell disorders v0.141 STEAP3 Zornitza Stark Marked gene: STEAP3 as ready
Red cell disorders v0.141 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Red cell disorders v0.141 STEAP3 Zornitza Stark Phenotypes for gene: STEAP3 were changed from hypochromic anaemia to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234
Red cell disorders v0.140 STEAP3 Zornitza Stark Publications for gene: STEAP3 were set to
Red cell disorders v0.139 STEAP3 Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.138 STEAP3 Zornitza Stark Classified gene: STEAP3 as Red List (low evidence)
Red cell disorders v0.138 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Red cell disorders v0.137 PGK1 Zornitza Stark Marked gene: PGK1 as ready
Red cell disorders v0.137 PGK1 Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence).
Red cell disorders v0.137 PGK1 Zornitza Stark Phenotypes for gene: PGK1 were changed from 300653 Phosphoglycerate kinase 1 deficiency to Phosphoglycerate kinase 1 deficiency MIM# 300653
Red cell disorders v0.136 PGK1 Zornitza Stark Publications for gene: PGK1 were set to 16740138; 6412025
Red cell disorders v0.135 PGK1 Zornitza Stark Classified gene: PGK1 as Green List (high evidence)
Red cell disorders v0.135 PGK1 Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence).
Red cell disorders v0.134 LARS2 Zornitza Stark Marked gene: LARS2 as ready
Red cell disorders v0.134 LARS2 Zornitza Stark Gene: lars2 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.134 LARS2 Zornitza Stark Phenotypes for gene: LARS2 were changed from hydrops/sideroblastic anaemia to Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021
Red cell disorders v0.133 LARS2 Zornitza Stark Publications for gene: LARS2 were set to
Red cell disorders v0.132 LARS2 Zornitza Stark Mode of inheritance for gene: LARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.131 SLC4A1 Zornitza Stark Marked gene: SLC4A1 as ready
Red cell disorders v0.131 SLC4A1 Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence).
Red cell disorders v0.131 SLC4A1 Zornitza Stark Phenotypes for gene: SLC4A1 were changed from 166900 Ovalocytosis, SA type, 185020 Cryohydrocytosis; RBC membrane abnormality; 166900 Ovalocytosis, SA type; Haemolytic Anemia; Cryohydrocytosis,185020; 612653 Spherocytosis, type 4; Ovalocytosis, SA type, 166900; Spherocytosis, type 4, 612653 to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653
Red cell disorders v0.130 SLC4A1 Zornitza Stark Publications for gene: SLC4A1 were set to 1722314
Red cell disorders v0.129 SLC4A1 Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.128 STEAP3 Danielle Ariti reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.128 PGK1 Danielle Ariti reviewed gene: PGK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28580215, 20151463; Phenotypes: Phosphoglycerate kinase 1 deficiency MIM# 300653; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.128 LARS2 Danielle Ariti reviewed gene: LARS2: Rating: AMBER; Mode of pathogenicity: None; Publications: 26537577, 32442335; Phenotypes: Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.128 SLC4A1 Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 10926824, 7949112, 16392641, 8640229, 16227998, 8640229, 16227998; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.128 RPL26 Zornitza Stark Marked gene: RPL26 as ready
Red cell disorders v0.128 RPL26 Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence).
Red cell disorders v0.128 RPL26 Zornitza Stark Phenotypes for gene: RPL26 were changed from Diamond-Blackfan anemia 11, MIM# 614900 to Diamond-Blackfan anaemia 11, MIM# 614900
Red cell disorders v0.127 RPL26 Zornitza Stark Phenotypes for gene: RPL26 were changed from ?Diamond-Blackfan anemia 11, 614900; 614900 ?Diamond-Blackfan anemia 11 to Diamond-Blackfan anemia 11, MIM# 614900
Red cell disorders v0.126 RPL26 Zornitza Stark Classified gene: RPL26 as Red List (low evidence)
Red cell disorders v0.126 RPL26 Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence).
Red cell disorders v0.125 RPL15 Zornitza Stark Marked gene: RPL15 as ready
Red cell disorders v0.125 RPL15 Zornitza Stark Gene: rpl15 has been classified as Green List (High Evidence).
Red cell disorders v0.125 RPL15 Zornitza Stark Phenotypes for gene: RPL15 were changed from Diamond-Blackfan anemia 12, MIM# 615550 to Diamond-Blackfan anaemia 12, MIM# 615550
Red cell disorders v0.124 RPL15 Zornitza Stark Phenotypes for gene: RPL15 were changed from 615550 ?Diamond-Blackfan anaemia 12; ?Diamond-Blackfan anemia 12, 615550; 615550 ?Diamond-Blackfan anemia 1 to Diamond-Blackfan anemia 12, MIM# 615550
Red cell disorders v0.123 RPL15 Zornitza Stark Publications for gene: RPL15 were set to 23812780
Red cell disorders v0.122 RPL15 Zornitza Stark Mode of inheritance for gene: RPL15 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.121 RPL11 Zornitza Stark Marked gene: RPL11 as ready
Red cell disorders v0.121 RPL11 Zornitza Stark Gene: rpl11 has been classified as Green List (High Evidence).
Red cell disorders v0.121 RPL11 Zornitza Stark Phenotypes for gene: RPL11 were changed from Diamond_Blackfan Anemia 7; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 612562 Diamond-Blackfan anemia 7; Diamond-Blackfan Anemia 7; 612562 Diamond_Blackfan Anemia 7; DIAMOND-BLACKFAN ANEMIA 7; Diamond-Blackfan anemia 7, 612562 to Diamond-Blackfan anemia 7, MIM# 612562; MONDO:0012938
Red cell disorders v0.120 PKLR Zornitza Stark Marked gene: PKLR as ready
Red cell disorders v0.120 PKLR Zornitza Stark Gene: pklr has been classified as Green List (High Evidence).
Red cell disorders v0.120 PKLR Zornitza Stark Phenotypes for gene: PKLR were changed from 266200 PYRUVATE KINASE DEFICIENCY; Enzyme Disorder; PYRUVATE KINASE DEFICIENCY; 266200 Pyruvate kinase deficiency; Pyruvate kinase deficiency, 266200; Pyruvate kinase deficiency to Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900; Pyruvate kinase deficiency, MIM# 266200
Red cell disorders v0.119 PKLR Zornitza Stark Mode of inheritance for gene: PKLR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.118 PKLR Zornitza Stark reviewed gene: PKLR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900, Pyruvate kinase deficiency, MIM# 266200; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.118 PIEZO1 Zornitza Stark Marked gene: PIEZO1 as ready
Red cell disorders v0.118 PIEZO1 Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence).
Red cell disorders v0.118 PIEZO1 Zornitza Stark Phenotypes for gene: PIEZO1 were changed from Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema, 194380; 194380 Stomatocytosis; Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Stomatocytosis; Dehydrated hereditary stomatocytosis; 616843 Lymphatic malformation 6; 194380 Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Hereditary xerocytosis to Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380
Red cell disorders v0.117 PIEZO1 Zornitza Stark Publications for gene: PIEZO1 were set to 22529292; 23695678
Red cell disorders v0.116 PIEZO1 Zornitza Stark Mode of inheritance for gene: PIEZO1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.115 PIEZO1 Zornitza Stark reviewed gene: PIEZO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21944700, 23695678, 23479567; Phenotypes: Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.115 PFKM Zornitza Stark Marked gene: PFKM as ready
Red cell disorders v0.115 PFKM Zornitza Stark Gene: pfkm has been classified as Green List (High Evidence).
Red cell disorders v0.115 PFKM Zornitza Stark Phenotypes for gene: PFKM were changed from Glycogen storage disease VII, 232800; 232800 Glycogen storage disease VII to Glycogen storage disease VII, MIM# 232800
Red cell disorders v0.114 PFKM Zornitza Stark Publications for gene: PFKM were set to 7513946; 2140573
Red cell disorders v0.113 PFKM Zornitza Stark reviewed gene: PFKM: Rating: GREEN; Mode of pathogenicity: None; Publications: 24427140, 27066546, 30792690; Phenotypes: Glycogen storage disease VII, MIM# 232800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9144 NT5C3A Zornitza Stark Marked gene: NT5C3A as ready
Mendeliome v0.9144 NT5C3A Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence).
Mendeliome v0.9144 NT5C3A Zornitza Stark Phenotypes for gene: NT5C3A were changed from to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120
Mendeliome v0.9143 NT5C3A Zornitza Stark Publications for gene: NT5C3A were set to
Mendeliome v0.9142 NT5C3A Zornitza Stark Mode of inheritance for gene: NT5C3A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9141 NT5C3A Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.113 NT5C3A Zornitza Stark Marked gene: NT5C3A as ready
Red cell disorders v0.113 NT5C3A Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence).
Red cell disorders v0.113 NT5C3A Zornitza Stark Phenotypes for gene: NT5C3A were changed from Anemia, hemolytic, due to UMPH1 deficiency, 266120; 266120 Anemia, hemolytic, due to UMPH1 deficiency to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120
Red cell disorders v0.112 NT5C3A Zornitza Stark Publications for gene: NT5C3A were set to 11369620; 12714505
Red cell disorders v0.111 NT5C3A Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Oligodontia v0.6 WNT10B Zornitza Stark Marked gene: WNT10B as ready
Oligodontia v0.6 WNT10B Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence).
Oligodontia v0.6 WNT10B Zornitza Stark Classified gene: WNT10B as Green List (high evidence)
Oligodontia v0.6 WNT10B Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence).
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Marked gene: RHOBTB2 as ready
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence).
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Classified gene: RHOBTB2 as Green List (high evidence)
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence).
Alternating Hemiplegia and Hemiplegic Migraine v0.50 RHOBTB2 Zornitza Stark gene: RHOBTB2 was added
gene: RHOBTB2 was added to Alternating Hemiplegia and Hemiplegic Migraine. Sources: Literature
Mode of inheritance for gene: RHOBTB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RHOBTB2 were set to 33504645
Phenotypes for gene: RHOBTB2 were set to Developmental and epileptic encephalopathy 64 618004; Alternating hemiplegia
Review for gene: RHOBTB2 was set to GREEN
Added comment: Eleven affected patients were identified. All had heterozygous missense variants involving exon 9 of RHOBTB2, confirmed as de novo in 9 cases. All had a complex motor phenotype, including at least 2 different kinds of movement disorder, e.g., ataxia and dystonia. Many patients demonstrated several features fulfilling the criteria for AHC: 10 patients had a movement disorder including paroxysmal elements, and 8 experienced hemiplegic episodes. In contrast to classic AHC, commonly caused by mutations in ATP1A3, these events were reported later only in RHOBTB2 mutation-positive patients from 20 months of age.

All had ID, and many had seizures, so this represents an expansion of the phenotype rather than a distinct disorder.
Sources: Literature
Microcephaly v1.46 COPB2 Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence)
Microcephaly v1.46 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 COPB2 Zornitza Stark edited their review of gene: COPB2: Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported.
All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data.

Note one of the individuals with heterozygous variant had significant microcephaly in addition to the two sibs with bi-allelic variants.; Changed rating: AMBER; Changed publications: 29036432, 34450031; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Marked gene: COPB2 as ready
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Classified gene: COPB2 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.64 COPB2 Zornitza Stark gene: COPB2 was added
gene: COPB2 was added to Osteogenesis Imperfecta. Sources: Literature
Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COPB2 were set to 34450031
Phenotypes for gene: COPB2 were set to Osteoporosis, recurrent fractures and developmental delay
Review for gene: COPB2 was set to GREEN
Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported.
All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4116 COPB2 Zornitza Stark Classified gene: COPB2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4116 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4115 COPB2 Zornitza Stark reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Oligodontia v0.5 WNT10B Ain Roesley gene: WNT10B was added
gene: WNT10B was added to Oligodontia. Sources: Literature
Mode of inheritance for gene: WNT10B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: WNT10B were set to 27321946; 29364501; 21554266; 31050392
Phenotypes for gene: WNT10B were set to Tooth agenesis, selective, 8 MIM#617073
Penetrance for gene: WNT10B were set to unknown
Review for gene: WNT10B was set to GREEN
Added comment: PMID: 27321946; 4 unrelated families (including 1 with 3 affecteds). 3x missense and 1x truncating. Luciferase assays demonstrated LoF compared to WT.


PMID: 29364501; 7 unrelated families all missense. Arg159Pro identified in 4 families and family#5 also had variants in WNT10A.
Re-evaluation of a previously reported family #8 - 1 heterozygote who only had tooth agenesis while 6 other relatives who were homozygotes also had split hand-foot malformation

NOTE: No genotype phenotype correlation between AD tooth agenesis and AR split hand-foot malformation - missense have also been reported in SHFM (PMID: 31050392). While it's noted that most reports of SHFM did not investigate oligodontia in their patients or carrier parents, PMID: 21554266 noted their carrier parents were healthy and clinically distinguishable
Sources: Literature
Congenital Disorders of Glycosylation v1.18 SLC37A4 Zornitza Stark Phenotypes for gene: SLC37A4 were changed from Congenital disorder of glycosylation type II to Congenital disorder of glycosylation, type IIw, MIM# 619525
Congenital Disorders of Glycosylation v1.17 SLC37A4 Zornitza Stark edited their review of gene: SLC37A4: Changed phenotypes: Congenital disorder of glycosylation, type IIw 619525
Mendeliome v0.9141 IMPG1 Zornitza Stark Phenotypes for gene: IMPG1 were changed from Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200 to Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870
Mendeliome v0.9140 IMPG1 Zornitza Stark reviewed gene: IMPG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 91, MIM# 153870; Mode of inheritance: None
Retinitis pigmentosa v0.100 IMPG1 Zornitza Stark Phenotypes for gene: IMPG1 were changed from Retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870
Retinitis pigmentosa v0.99 IMPG1 Zornitza Stark edited their review of gene: IMPG1: Changed phenotypes: Retinitis pigmentosa, MONDO:0019200, Retinitis pigmentosa 91, MIM# 153870
Mendeliome v0.9140 ABCC11 Zornitza Stark Marked gene: ABCC11 as ready
Mendeliome v0.9140 ABCC11 Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence).
Mendeliome v0.9140 ABCC11 Zornitza Stark Phenotypes for gene: ABCC11 were changed from to [Axillary odor, variation in] 117800; [Colostrum secretion, variation in] 117800; [Earwax, wet/dry] 117800
Mendeliome v0.9139 ABCC11 Zornitza Stark Classified gene: ABCC11 as Red List (low evidence)
Mendeliome v0.9139 ABCC11 Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence).
Mendeliome v0.9138 ABCC11 Zornitza Stark reviewed gene: ABCC11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: [Axillary odor, variation in] 117800, [Colostrum secretion, variation in] 117800, [Earwax, wet/dry] 117800; Mode of inheritance: None
Red cell disorders v0.111 PUS1 Zornitza Stark Marked gene: PUS1 as ready
Red cell disorders v0.111 PUS1 Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence).
Red cell disorders v0.111 PUS1 Zornitza Stark Phenotypes for gene: PUS1 were changed from 600462 Myopathy, lactic acidosis, and sideroblastic anemia 1; Myopathy, Lactic Acidosis, and Sideroblastic Anemia, 600462; 600462 Myopathy, Lactic Acidosis, and Sideroblastic Anemia to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Red cell disorders v0.110 PUS1 Zornitza Stark Publications for gene: PUS1 were set to 15108122; 15772074
Red cell disorders v0.109 PUS1 Zornitza Stark edited their review of gene: PUS1: Changed phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Red cell disorders v0.109 HSPA9 Zornitza Stark Marked gene: HSPA9 as ready
Red cell disorders v0.109 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence).
Red cell disorders v0.109 HSPA9 Zornitza Stark Phenotypes for gene: HSPA9 were changed from sideroblastic anaemia; 182170 Sideroblastic anaemia 4; 182170 sideroblastic anaemia type 4; Sideroblastic anaemia type 4, 182170 to Anaemia, sideroblastic, 4, MIM# 182170
Red cell disorders v0.108 HSPA9 Zornitza Stark reviewed gene: HSPA9: Rating: GREEN; Mode of pathogenicity: None; Publications: 26491070; Phenotypes: Anaemia, sideroblastic, 4, MIM# 182170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9138 KCNN4 Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26198474; 26178367
Mendeliome v0.9137 KCNN4 Zornitza Stark changed review comment from: At least three families reported.
Sources: Expert list; to: Well established gene-disease association, more than 10 families and functional data.
Mendeliome v0.9137 KCNN4 Zornitza Stark edited their review of gene: KCNN4: Changed publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Changed phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689
Red cell disorders v0.108 KCNN4 Zornitza Stark Marked gene: KCNN4 as ready
Red cell disorders v0.108 KCNN4 Zornitza Stark Gene: kcnn4 has been classified as Green List (High Evidence).
Red cell disorders v0.108 KCNN4 Zornitza Stark Phenotypes for gene: KCNN4 were changed from Hereditary Xerocytosis; 616689 Dehydrated hereditary stomatocytosis 2 to Dehydrated hereditary stomatocytosis 2, MIM# 616689
Red cell disorders v0.107 KCNN4 Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26178367
Red cell disorders v0.106 KCNN4 Zornitza Stark Mode of inheritance for gene: KCNN4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.105 KCNN4 Zornitza Stark reviewed gene: KCNN4: Rating: GREEN; Mode of pathogenicity: None; Publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.105 KLF1 Zornitza Stark Marked gene: KLF1 as ready
Red cell disorders v0.105 KLF1 Zornitza Stark Gene: klf1 has been classified as Green List (High Evidence).
Red cell disorders v0.105 KLF1 Zornitza Stark Phenotypes for gene: KLF1 were changed from 613673 Congenital dyserythropoietic anaemia type 4; Congenital Dyserythropoietic Anemia; 613673 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type IV, 613673; Dyserythropoietic anemia, congenital, type IV to Dyserythropoietic anaemia, congenital, type IV, MIM# 613673; MONDO:0013355
Red cell disorders v0.104 KLF1 Zornitza Stark Publications for gene: KLF1 were set to 21055716; 29200155
Red cell disorders v0.103 HK1 Zornitza Stark Marked gene: HK1 as ready
Red cell disorders v0.103 HK1 Zornitza Stark Gene: hk1 has been classified as Green List (High Evidence).
Red cell disorders v0.103 HK1 Zornitza Stark Phenotypes for gene: HK1 were changed from 235700 Enzyme Disorder; Hemolytic anemia due to hexokinase deficiency, 235700; 235700 Hemolytic anemia due to hexokinase deficiency; Hemolytic anemia due to hexokinase deficiency; Enzyme Disorder to Haemolytic anaemia due to hexokinase deficiency, MIM# 235700
Red cell disorders v0.102 HK1 Zornitza Stark Publications for gene: HK1 were set to 7655856; 12393545
Red cell disorders v0.101 HK1 Zornitza Stark reviewed gene: HK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7655856, 12393545, 33361148, 31119733, 27282571; Phenotypes: Haemolytic anaemia due to hexokinase deficiency, MIM# 235700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1193 HCN4 Zornitza Stark Marked gene: HCN4 as ready
Genetic Epilepsy v0.1193 HCN4 Zornitza Stark Gene: hcn4 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1193 HCN4 Zornitza Stark gene: HCN4 was added
gene: HCN4 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for gene: HCN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HCN4 were set to 30127718; 29588962
Phenotypes for gene: HCN4 were set to {Epilepsy, idiopathic generalized, susceptibility to, 18}, MIM# 619521
Review for gene: HCN4 was set to RED
Added comment: Two families reported. Variant did not segregate with disease in one (PMID 29588962), and was present in two affected sibs from another family reported in PMID 30127718, some functional data to support impact of variant on protein function.
Sources: Expert list
Red cell disorders v0.101 KIF23 Zornitza Stark Marked gene: KIF23 as ready
Red cell disorders v0.101 KIF23 Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence).
Red cell disorders v0.101 KIF23 Zornitza Stark Phenotypes for gene: KIF23 were changed from Enzyme Disorder; Anaemia, dyserythropoietic congenital, type III; Congenital dyserythropoietic anemia (CDA); Congenital dyserythropoietic anemia type III; 605064 Congenital dyserythropoietic anaemia type 3; CDA III to Congenital dyserythropoietic anemia type III
Red cell disorders v0.100 KIF23 Zornitza Stark Classified gene: KIF23 as Red List (low evidence)
Red cell disorders v0.100 KIF23 Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4115 MTRR Zornitza Stark Marked gene: MTRR as ready
Intellectual disability syndromic and non-syndromic v0.4115 MTRR Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4115 MTRR Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270
Intellectual disability syndromic and non-syndromic v0.4114 MTRR Zornitza Stark Publications for gene: MTRR were set to
Intellectual disability syndromic and non-syndromic v0.4113 MTRR Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4112 MTRR Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9137 MTRR Zornitza Stark Marked gene: MTRR as ready
Mendeliome v0.9137 MTRR Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence).
Mendeliome v0.9137 MTRR Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270
Mendeliome v0.9136 MTRR Zornitza Stark Publications for gene: MTRR were set to
Mendeliome v0.9135 MTRR Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9134 MTRR Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.99 MTRR Zornitza Stark Marked gene: MTRR as ready
Red cell disorders v0.99 MTRR Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence).
Red cell disorders v0.99 MTRR Zornitza Stark Phenotypes for gene: MTRR were changed from Homocystinuria-megaloblastic anemia, cbl E type, 236270; 236270 Homocystinuria-megaloblastic anemia, cbl E type to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270
Red cell disorders v0.98 MTRR Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4112 MTR Zornitza Stark Marked gene: MTR as ready
Intellectual disability syndromic and non-syndromic v0.4112 MTR Zornitza Stark Gene: mtr has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4112 MTR Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940
Intellectual disability syndromic and non-syndromic v0.4111 MTR Zornitza Stark Publications for gene: MTR were set to
Intellectual disability syndromic and non-syndromic v0.4110 MTR Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4109 MTR Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9134 MTR Zornitza Stark Marked gene: MTR as ready
Mendeliome v0.9134 MTR Zornitza Stark Gene: mtr has been classified as Green List (High Evidence).
Mendeliome v0.9134 MTR Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940
Mendeliome v0.9133 MTR Zornitza Stark Publications for gene: MTR were set to
Mendeliome v0.9132 MTR Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9131 MTR Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.98 MTR Zornitza Stark Marked gene: MTR as ready
Red cell disorders v0.98 MTR Zornitza Stark Gene: mtr has been classified as Green List (High Evidence).
Red cell disorders v0.98 MTR Zornitza Stark Phenotypes for gene: MTR were changed from Homocystinuria-megaloblastic anemia, cblG complementation type, 250940; 250940 Homocystinuria-megaloblastic anemia, cblG complementation type to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940
Red cell disorders v0.97 MTR Zornitza Stark Publications for gene: MTR were set to 9683607; 12068375
Red cell disorders v0.96 MTR Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Autoinflammatory Disorders v0.121 LPIN2 Zornitza Stark Marked gene: LPIN2 as ready
Autoinflammatory Disorders v0.121 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Autoinflammatory Disorders v0.121 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Autoinflammatory Disorders v0.120 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to
Autoinflammatory Disorders v0.119 LPIN2 Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Autoinflammatory Disorders v0.118 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9131 LPIN2 Zornitza Stark Marked gene: LPIN2 as ready
Mendeliome v0.9131 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Mendeliome v0.9131 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Mendeliome v0.9130 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to
Mendeliome v0.9129 LPIN2 Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9128 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.96 LPIN2 Zornitza Stark Marked gene: LPIN2 as ready
Red cell disorders v0.96 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Red cell disorders v0.96 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from Congenital dyserythropoietic anemia; Microcytic anemia; Majeed syndrome, 609628; 609628 Microcytic anemia; CDA; Majeed syndrome; 609628 Majeed syndrome to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Red cell disorders v0.95 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to 17330256; 15994876
Red cell disorders v0.94 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark Marked gene: KCNQ1 as ready
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark Gene: kcnq1 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark gene: KCNQ1 was added
gene: KCNQ1 was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: KCNQ1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNQ1 were set to 27539165
Phenotypes for gene: KCNQ1 were set to Long QT syndrome 1, 192500
Review for gene: KCNQ1 was set to RED
Added comment: Can present antenatally with bradycardia, but no specific mention of hydrops.
Sources: Expert Review
Hydrops fetalis v0.205 KCNH2 Zornitza Stark Marked gene: KCNH2 as ready
Hydrops fetalis v0.205 KCNH2 Zornitza Stark Gene: kcnh2 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.205 KCNH2 Zornitza Stark gene: KCNH2 was added
gene: KCNH2 was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNH2 were set to 27492745
Phenotypes for gene: KCNH2 were set to long QT syndrome
Review for gene: KCNH2 was set to RED
Added comment: Single case report identified of presentation with hydrops.
Sources: Expert Review
Hydrops fetalis v0.204 SCN5A Zornitza Stark Marked gene: SCN5A as ready
Hydrops fetalis v0.204 SCN5A Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence).
Hydrops fetalis v0.204 SCN5A Zornitza Stark Classified gene: SCN5A as Green List (high evidence)
Hydrops fetalis v0.204 SCN5A Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence).
Hydrops fetalis v0.203 SCN5A Zornitza Stark gene: SCN5A was added
gene: SCN5A was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SCN5A were set to 22064211; 15184283; 19419784
Phenotypes for gene: SCN5A were set to Long QT syndrome 3 (MIM#603830)
Review for gene: SCN5A was set to GREEN
Added comment: Three families reported with severe perinatal presentation, including hydrops.
Sources: Expert Review
Repeat Disorders v0.147 OPDM1 Zornitza Stark Tag adult-onset tag was added to STR: OPDM1.
Repeat Disorders v0.147 NIID Zornitza Stark Tag adult-onset tag was added to STR: NIID.
Repeat Disorders v0.147 Zornitza Stark Panel types changed to Australian Genomics; Royal Melbourne Hospital; Rare Disease
Repeat Disorders v0.146 VACTERLX Zornitza Stark Tag paediatric-onset tag was added to STR: VACTERLX.
Repeat Disorders v0.146 OPML1 Zornitza Stark Tag adult-onset tag was added to STR: OPML1.
Repeat Disorders v0.146 NIPA1 Zornitza Stark Marked STR: NIPA1 as ready
Repeat Disorders v0.146 NIPA1 Zornitza Stark Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 NIPA1 Zornitza Stark Tag adult-onset tag was added to STR: NIPA1.
Repeat Disorders v0.146 FRAXF Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXF.
Repeat Disorders v0.146 FRA7A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA7A.
Repeat Disorders v0.146 FRA11B Zornitza Stark Marked STR: FRA11B as ready
Repeat Disorders v0.146 FRA11B Zornitza Stark Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 FRA11B Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11B.
Repeat Disorders v0.146 FRA11A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11A.
Repeat Disorders v0.146 FAME7 Zornitza Stark Tag adult-onset tag was added to STR: FAME7.
Repeat Disorders v0.146 FAME6 Zornitza Stark Tag adult-onset tag was added to STR: FAME6.
Repeat Disorders v0.146 FAME4 Zornitza Stark Tag adult-onset tag was added to STR: FAME4.
Repeat Disorders v0.146 DMD Zornitza Stark Tag adult-onset tag was added to STR: DMD.
Tag paediatric-onset tag was added to STR: DMD.
Repeat Disorders v0.146 FRA2A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA2A.
Repeat Disorders v0.146 FRA12A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA12A.
Repeat Disorders v0.146 CCD Zornitza Stark Marked STR: CCD as ready
Repeat Disorders v0.146 CCD Zornitza Stark Str: ccd has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CCD Zornitza Stark Tag paediatric-onset tag was added to STR: CCD.
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Marked STR: CANVAS_ACAGG as ready
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Tag adult-onset tag was added to STR: CANVAS_ACAGG.
Repeat Disorders v0.146 XDP Zornitza Stark Tag adult-onset tag was added to STR: XDP.
Repeat Disorders v0.146 TOF Zornitza Stark Tag paediatric-onset tag was added to STR: TOF.
Repeat Disorders v0.146 SPD1 Zornitza Stark Tag paediatric-onset tag was added to STR: SPD1.
Repeat Disorders v0.146 SCA8 Zornitza Stark Tag adult-onset tag was added to STR: SCA8.
Repeat Disorders v0.146 SCA7 Zornitza Stark Tag adult-onset tag was added to STR: SCA7.
Repeat Disorders v0.146 SCA6 Zornitza Stark Tag adult-onset tag was added to STR: SCA6.
Repeat Disorders v0.146 SCA37 Zornitza Stark Tag adult-onset tag was added to STR: SCA37.
Repeat Disorders v0.146 SCA36 Zornitza Stark Tag adult-onset tag was added to STR: SCA36.
Repeat Disorders v0.146 SCA31 Zornitza Stark Tag adult-onset tag was added to STR: SCA31.
Repeat Disorders v0.146 SCA3 Zornitza Stark Tag adult-onset tag was added to STR: SCA3.
Tag paediatric-onset tag was added to STR: SCA3.
Repeat Disorders v0.146 SCA2 Zornitza Stark Tag adult-onset tag was added to STR: SCA2.
Tag paediatric-onset tag was added to STR: SCA2.
Repeat Disorders v0.146 SCA17 Zornitza Stark Tag adult-onset tag was added to STR: SCA17.
Tag paediatric-onset tag was added to STR: SCA17.
Repeat Disorders v0.146 SCA12 Zornitza Stark Tag adult-onset tag was added to STR: SCA12.
Tag paediatric-onset tag was added to STR: SCA12.
Repeat Disorders v0.146 SCA10 Zornitza Stark Tag adult-onset tag was added to STR: SCA10.
Mendeliome v0.9128 FOXE3 Zornitza Stark Marked gene: FOXE3 as ready
Mendeliome v0.9128 FOXE3 Zornitza Stark Gene: foxe3 has been classified as Green List (High Evidence).
Mendeliome v0.9128 FOXE3 Zornitza Stark Phenotypes for gene: FOXE3 were changed from to Anterior segment dysgenesis 2, multiple subtypes, MIM#610256; Cataract 34, multiple types, MIM#612968; Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349
Mendeliome v0.9127 FOXE3 Zornitza Stark Publications for gene: FOXE3 were set to
Mendeliome v0.9126 FOXE3 Zornitza Stark Mode of inheritance for gene: FOXE3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.9125 FOXE3 Eleanor Williams reviewed gene: FOXE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 26854927, 27218149, 16826526, 19708017, 20140963, 20664696, 20361012, 24019743, 27669367, 29878917, 32436650, 34046667, 11159941, 19708017, 20806047, 21150893, 11980846, 34046667; Phenotypes: Anterior segment dysgenesis 2, multiple subtypes, MIM#610256, Cataract 34, multiple types, MIM#612968, Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.9125 SLC26A1 Zornitza Stark Phenotypes for gene: SLC26A1 were changed from to Nephrolithiasis, calcium oxalate, MIM#167030
Mendeliome v0.9124 SLC26A1 Zornitza Stark Publications for gene: SLC26A1 were set to
Mendeliome v0.9123 SLC26A1 Zornitza Stark Mode of inheritance for gene: SLC26A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9122 SLC26A1 Zornitza Stark Classified gene: SLC26A1 as Amber List (moderate evidence)
Mendeliome v0.9122 SLC26A1 Zornitza Stark Gene: slc26a1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9121 SLC26A1 Zornitza Stark reviewed gene: SLC26A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27210743, 20160351, 30383413, 27125215; Phenotypes: Nephrolithiasis, calcium oxalate, MIM#167030; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9121 RHAG Zornitza Stark Marked gene: RHAG as ready
Mendeliome v0.9121 RHAG Zornitza Stark Gene: rhag has been classified as Green List (High Evidence).
Mendeliome v0.9121 RHAG Zornitza Stark Phenotypes for gene: RHAG were changed from to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000
Mendeliome v0.9120 RHAG Zornitza Stark Publications for gene: RHAG were set to
Mendeliome v0.9119 RHAG Zornitza Stark Mode of inheritance for gene: RHAG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9118 SPTA1 Zornitza Stark Marked gene: SPTA1 as ready
Mendeliome v0.9118 SPTA1 Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence).
Mendeliome v0.9118 SPTA1 Zornitza Stark Phenotypes for gene: SPTA1 were changed from to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970
Mendeliome v0.9117 SPTA1 Zornitza Stark Publications for gene: SPTA1 were set to
Mendeliome v0.9116 SPTA1 Zornitza Stark Mode of inheritance for gene: SPTA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9115 SPTA1 Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.94 RHAG Zornitza Stark Marked gene: RHAG as ready
Red cell disorders v0.94 RHAG Zornitza Stark Gene: rhag has been classified as Green List (High Evidence).
Red cell disorders v0.94 RHAG Zornitza Stark Phenotypes for gene: RHAG were changed from Stomatocytosis; Anemia, hemolytic, Rh-null, regulator type (BIALLELIC, autosomal or pseudoautosomal), 268150; 185000 Overhydrated hereditary stomatocytosis; Overhydrated hereditary stomatocytosis (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 185000; 268150 Anemia, hemolytic, Rh-null, regulator type to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000
Red cell disorders v0.93 RHAG Zornitza Stark Publications for gene: RHAG were set to 18931342
Red cell disorders v0.92 SLC11A2 Zornitza Stark Marked gene: SLC11A2 as ready
Red cell disorders v0.92 SLC11A2 Zornitza Stark Gene: slc11a2 has been classified as Green List (High Evidence).
Red cell disorders v0.92 SLC11A2 Zornitza Stark Phenotypes for gene: SLC11A2 were changed from 206100 Anemia, hypochromic microcytic, with iron overload 1; Anemia, hypochromic microcytic, with iron overload 1, 206100 to Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100
Red cell disorders v0.91 SLC11A2 Zornitza Stark Publications for gene: SLC11A2 were set to 16160008; 16439678; 15459009
Red cell disorders v0.90 SLC2A1 Zornitza Stark Marked gene: SLC2A1 as ready
Red cell disorders v0.90 SLC2A1 Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence).
Red cell disorders v0.90 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from Stomatocytosis; 612126 GLUT1 deficiency without epilepsy and/or hemolytic anemia; 608885 Stomatin-deficient cryohydrocytosis with neurologic defects; Pyridoxine-refractory sideroblastic anemia to Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885; delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia; haemolytic anaemia
Red cell disorders v0.89 SLC2A1 Zornitza Stark Publications for gene: SLC2A1 were set to 22492876; 21791420
Mendeliome v0.9115 SPTB Zornitza Stark Marked gene: SPTB as ready
Mendeliome v0.9115 SPTB Zornitza Stark Gene: sptb has been classified as Green List (High Evidence).
Red cell disorders v0.88 SPTA1 Zornitza Stark Marked gene: SPTA1 as ready
Red cell disorders v0.88 SPTA1 Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence).
Red cell disorders v0.88 SPTA1 Zornitza Stark Phenotypes for gene: SPTA1 were changed from 270970 Spherocytosis, type 3; 266140 Pyropoikilocytosis; RBC membrane abnormality; Pyropoikilocytosis (BIALLELIC, autosomal or pseudoautosomal), 266140; 266140 Pyropoikilocytosis, 270970 Spherocytosis, type 3; Spherocytosis, type 3 (BIALLELIC, autosomal or pseudoautosomal), 270970; 130600 Elliptocytosis-2; Elliptocytosis-2 (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 130600 to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970
Red cell disorders v0.87 SPTA1 Zornitza Stark Publications for gene: SPTA1 were set to 1679439; 3940543; 4077050
Mendeliome v0.9115 SPTB Zornitza Stark Phenotypes for gene: SPTB were changed from to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948
Mendeliome v0.9114 SPTB Zornitza Stark Publications for gene: SPTB were set to
Mendeliome v0.9113 SPTB Zornitza Stark Mode of inheritance for gene: SPTB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.86 SPTB Zornitza Stark Marked gene: SPTB as ready
Red cell disorders v0.86 SPTB Zornitza Stark Gene: sptb has been classified as Green List (High Evidence).
Red cell disorders v0.86 SPTB Zornitza Stark Phenotypes for gene: SPTB were changed from 617948 Elliptocytosis-3; Spherocytosis,616649; Anemia, neonatal hemolytic, fatal and near-fatal; RBC membrane abnormality; 616649 Spherocytosis, type 2; 616649 Anemia, neonatal hemolytic, fatal and near-fatal; Elliptocytosis to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948
Red cell disorders v0.85 SPTB Zornitza Stark Publications for gene: SPTB were set to 8226774; 3276733
Red cell disorders v0.84 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Red cell disorders v0.84 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Red cell disorders v0.84 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from megaloblastic bone marrow; neutropenia; thrombocytopenia; 275350 Transcobalamin II deficiency; Agammaglobulinemia; pancytopenia; neutropenic colitis; failure to thrive; Transcobalamin II deficiency; can have a presentation similar to severe combined immunodeficiency; hypotonia, myoclonic like movements, pallor, purpura, anaemia, thrombocytopenia, megaloblastosis, aplastic bone marrow to Transcobalamin II deficiency MIM# 275350; Decreased Ig levels; Megaloblastic anaemia; pancytopaenia; Reticulocytopaenia; failure to thrive; diarrhoea; hypogammaglobulinaemia; pallor; hypotonia; respiratory infection; if untreated (B12) for prolonged periods results in intellectual disability
Red cell disorders v0.83 TCN2 Zornitza Stark Publications for gene: TCN2 were set to 10518276; 7849710
Mendeliome v0.9112 TF Zornitza Stark Marked gene: TF as ready
Mendeliome v0.9112 TF Zornitza Stark Gene: tf has been classified as Green List (High Evidence).
Mendeliome v0.9112 TF Zornitza Stark Phenotypes for gene: TF were changed from to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure
Mendeliome v0.9111 TF Zornitza Stark Publications for gene: TF were set to
Mendeliome v0.9110 TF Zornitza Stark Mode of inheritance for gene: TF was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.82 TF Zornitza Stark Marked gene: TF as ready
Red cell disorders v0.82 TF Zornitza Stark Gene: tf has been classified as Green List (High Evidence).
Red cell disorders v0.82 TF Zornitza Stark Phenotypes for gene: TF were changed from Congenital hypotransferrinemia; Atransferrinemia, 209300; 209300 Congenital hypotransferrinemia to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure
Mendeliome v0.9109 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9109 RHAG Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9109 SPTB Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9109 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.81 RHAG Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.81 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.81 SLC2A1 Danielle Ariti reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27353637; Phenotypes: Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885, delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia, haemolytic anaemia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.81 HBD Zornitza Stark Marked gene: HBD as ready
Red cell disorders v0.81 HBD Zornitza Stark Gene: hbd has been classified as Green List (High Evidence).
Red cell disorders v0.81 HBD Zornitza Stark Phenotypes for gene: HBD were changed from Thalassemia due to Hb Lepore; Thalassemia,delta; Thalassemiadue to HbLepore; 141749 Delta-beta thalassaemia, thalassaemia due to Hb Lepore; Thalassemia, delta to Thalassaemia, delta-; Thalassaemia due to Hb Lepore
Red cell disorders v0.80 HBD Zornitza Stark reviewed gene: HBD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassaemia, delta-, Thalassaemia due to Hb Lepore; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.80 HBB Zornitza Stark Marked gene: HBB as ready
Red cell disorders v0.80 HBB Zornitza Stark Gene: hbb has been classified as Green List (High Evidence).
Red cell disorders v0.80 HBB Zornitza Stark Phenotypes for gene: HBB were changed from Sickle cell anemia (BIALLELIC, autosomal or pseudoautosomal),603903; 613985 Thalassemia, beta; Erythremias, beta-; 603902 Thalassemia-beta, dominant inclusion-body; Thalassemias, beta-,(BIALLELIC, autosomal or pseudoautosomal), 613985; Hereditary persistence of fetal hemoglobin,(MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown),141749; 603902 Dominand inclusion body beta thalassaemia; 603903 Sickle cell disease; 141749 Delta-beta thalassaemia; Heinz body anemias, beta- (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 140700; Globin Disorder; Thalassemia-beta, dominant inclusion-body, 603902; Delta-beta thalassemia (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 141749; 613985 Beta thalassaemia; Methemoglobinemias, beta- to Thalassemia, beta, MIM# 613985; Sickle cell anaemia, MIM# 603903; Methaemoglobinaemia, beta type, MIM# 617971; Hereditary persistence of fetal haemoglobin, MIM# 141749; Heinz body anaemia, MIM# 140700; Erythrocytosis 6, MIM# 617980
Red cell disorders v0.79 HBB Zornitza Stark reviewed gene: HBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, beta, MIM# 613985, Sickle cell anaemia, MIM# 603903, Methaemoglobinaemia, beta type, MIM# 617971, Hereditary persistence of fetal haemoglobin, MIM# 141749, Heinz body anaemia, MIM# 140700, Erythrocytosis 6, MIM# 617980; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.79 HBA2 Zornitza Stark Marked gene: HBA2 as ready
Red cell disorders v0.79 HBA2 Zornitza Stark Gene: hba2 has been classified as Green List (High Evidence).
Red cell disorders v0.79 HBA2 Zornitza Stark Phenotypes for gene: HBA2 were changed from Hypochromic microcytic anemia; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Erythrocytosis; 60413 Thalassemia, alpha; Heinz body anemia,140700; Thalassemia, alpha-, 604131 to Thalassemia, alpha-, MIM# 604131; Heinz body anaemia, MIM# 140700; Erythrocytosis 7, MIM# 617981
Red cell disorders v0.78 HBA2 Zornitza Stark reviewed gene: HBA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, alpha-, MIM# 604131, Heinz body anaemia, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.78 HBA1 Zornitza Stark Marked gene: HBA1 as ready
Red cell disorders v0.78 HBA1 Zornitza Stark Gene: hba1 has been classified as Green List (High Evidence).
Red cell disorders v0.78 HBA1 Zornitza Stark Phenotypes for gene: HBA1 were changed from Thalassemias, alpha-, 604131; 604131 Thalassemias, alpha; Erythremias, alpha-; Heinz body anemias, alpha-, 140700; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Methemoglobinemias, alpha- to Thalassemias, alpha-, MIM# 604131; Heinz body anemias, alpha-, MIM# 140700; Erythrocytosis 7, MIM# 617981
Red cell disorders v0.77 HBA1 Zornitza Stark reviewed gene: HBA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemias, alpha-, MIM# 604131, Heinz body anemias, alpha-, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.77 GSS Zornitza Stark Marked gene: GSS as ready
Red cell disorders v0.77 GSS Zornitza Stark Gene: gss has been classified as Green List (High Evidence).
Red cell disorders v0.77 GSS Zornitza Stark Phenotypes for gene: GSS were changed from 231900 Enzyme Disorder; Hemolytic anemia due to glutathione synthetase deficiency, 231900; 266130 Glutathione synthetase deficiency; Enzyme Disorder; Glutathione synthetase deficiency, 266130; Hemolytic anemia due to glutathione synthetase deficiency to Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900
Red cell disorders v0.76 GSS Zornitza Stark Publications for gene: GSS were set to 8896573
Red cell disorders v0.75 GSS Zornitza Stark reviewed gene: GSS: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896573, 31198081, 29395598, 29340523, 28267090; Phenotypes: Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.195 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; deafness; ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; deafness; ovarian insufficiency
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.194 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Deafness_IsolatedAndComplex v1.92 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Deafness_IsolatedAndComplex v1.91 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Muscular dystrophy and myopathy_Paediatric v0.93 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Muscular dystrophy and myopathy_Paediatric v0.92 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Mendeliome v0.9109 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Mendeliome v0.9108 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Red cell disorders v0.75 SPTA1 Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.75 SPTB Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.75 TCN2 Danielle Ariti reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency MIM# 275350, Decreased Ig levels, Megaloblastic anaemia, pancytopaenia, Reticulocytopaenia, failure to thrive, diarrhoea, hypogammaglobulinaemia, pallor, hypotonia, respiratory infection, if untreated (B12) for prolonged periods results in intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.75 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.146 SCA1 Zornitza Stark Tag adult-onset tag was added to STR: SCA1.
Repeat Disorders v0.146 SBMA Zornitza Stark Tag adult-onset tag was added to STR: SBMA.
Repeat Disorders v0.146 RCPS Zornitza Stark Tag paediatric-onset tag was added to STR: RCPS.
Repeat Disorders v0.146 CCHS Zornitza Stark Marked STR: CCHS as ready
Repeat Disorders v0.146 CCHS Zornitza Stark Str: cchs has been classified as Green List (High Evidence).
Mendeliome v0.9108 GSR Zornitza Stark Marked gene: GSR as ready
Mendeliome v0.9108 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9108 GSR Zornitza Stark Phenotypes for gene: GSR were changed from to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660
Mendeliome v0.9107 GSR Zornitza Stark Publications for gene: GSR were set to
Mendeliome v0.9106 GSR Zornitza Stark Mode of inheritance for gene: GSR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9105 GSR Zornitza Stark Classified gene: GSR as Amber List (moderate evidence)
Mendeliome v0.9105 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9104 GSR Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.75 GSR Zornitza Stark Marked gene: GSR as ready
Red cell disorders v0.75 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.75 GSR Zornitza Stark Phenotypes for gene: GSR were changed from Hemolytic anemia due to glutathione reductase deficiency; Enzyme Disorder; NA Enzyme Disorder to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660
Red cell disorders v0.74 GSR Zornitza Stark Publications for gene: GSR were set to 8533822
Red cell disorders v0.73 GSR Zornitza Stark Classified gene: GSR as Amber List (moderate evidence)
Red cell disorders v0.73 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.72 GSR Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.146 Bryony Thompson Panel status changed from internal to public
Arthrogryposis v0.294 MAGEL2 Zornitza Stark Publications for gene: MAGEL2 were set to 24076603; 27195816; 26365340
Arthrogryposis v0.293 MAGEL2 Zornitza Stark Mode of inheritance for gene: MAGEL2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9104 MKRN3 Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405 33214675 31041429 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Imprinting disorders v0.3 MKRN3 Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405, 33214675, 31041429, 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9104 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33820833, 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Arthrogryposis v0.292 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26365340, 33820833, 34128869; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Repeat Disorders v0.145 OPMD Zornitza Stark Tag adult-onset tag was added to STR: OPMD.
Repeat Disorders v0.145 OPDM2 Zornitza Stark Tag adult-onset tag was added to STR: OPDM2.
Repeat Disorders v0.145 MEDPSACH Zornitza Stark Tag paediatric-onset tag was added to STR: MEDPSACH.
Repeat Disorders v0.145 HSAN8 Zornitza Stark Tag paediatric-onset tag was added to STR: HSAN8.
Repeat Disorders v0.145 FRA2A Bryony Thompson Marked STR: FRA2A as ready
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.145 FRA2A Bryony Thompson Classified STR: FRA2A as Amber List (moderate evidence)
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.144 FRA2A Bryony Thompson STR: FRA2A was added
STR: FRA2A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA2A were set to 24763282
Phenotypes for STR: FRA2A were set to Neurodevelopmental delay
Review for STR: FRA2A was set to AMBER
Added comment: Three families with a wide spectrum of neurodevelopmental phenotypes with expression of folate-sensitive fragile site FRA2A. The CGG repeat is in an alternative promoter for AFF3, active in the brain. Expansion of >300 repeats causes expression of FRA2A and is associated with hypermethylation and silencing of AFF3 in at least one individual. There were 3-20 repeats in normal controls.
Sources: Literature
Red cell disorders v0.72 GPI Zornitza Stark Marked gene: GPI as ready
Red cell disorders v0.72 GPI Zornitza Stark Gene: gpi has been classified as Green List (High Evidence).
Red cell disorders v0.72 GPI Zornitza Stark Phenotypes for gene: GPI were changed from 613470 Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency; Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency, 613470 to Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470
Red cell disorders v0.71 GPI Zornitza Stark Publications for gene: GPI were set to 411100
Red cell disorders v0.70 GPI Zornitza Stark reviewed gene: GPI: Rating: GREEN; Mode of pathogenicity: None; Publications: 8499925, 9856489, 32103498; Phenotypes: Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Marked gene: UMPS as ready
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria MIM# 258900
Intellectual disability syndromic and non-syndromic v0.4108 UMPS Zornitza Stark Publications for gene: UMPS were set to
Intellectual disability syndromic and non-syndromic v0.4107 UMPS Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4106 UMPS Zornitza Stark reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9104 UMPS Zornitza Stark Marked gene: UMPS as ready
Mendeliome v0.9104 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Mendeliome v0.9104 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria, MIM# 258900
Mendeliome v0.9103 UMPS Zornitza Stark Publications for gene: UMPS were set to
Mendeliome v0.9102 UMPS Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9101 UMPS Zornitza Stark edited their review of gene: UMPS: Added comment: 20 unrelated patients have been reported with biallelic missense variants; one mouse model

Orotic aciduria is characterised by megaloblastic anaemia and orotic acid crystalluria, frequently associated with a degree of physical and intellectual disability. Other features include, congenital malformations (Atrial/ Ventricular septal defect) and immunodeficiencies (T-cell dysfunction, failure to thrive, recurrent infections).

Haematology features
- Megaloblastic anaemia
- Low to normal reticulocyte count
- Anisocytosis
- Poikilocytosis
- Hypochromia; Changed publications: 9042911, 33489760; Changed phenotypes: Orotic aciduria, MIM# 258900
Red cell disorders v0.70 UMPS Zornitza Stark Marked gene: UMPS as ready
Red cell disorders v0.70 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Red cell disorders v0.70 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from 258900 Orotic aciduria with megaloblastic anaemia to Orotic aciduria MIM# 258900; megaloblastic anaemia; orotic acid crystalluria; ID; immunodeficiencies
Red cell disorders v0.69 UMPS Zornitza Stark Publications for gene: UMPS were set to 9042911
Imprinting disorders v0.3 MAGEL2 Anna Le Fevre gene: MAGEL2 was added
gene: MAGEL2 was added to Imprinting disorders. Sources: Literature
Mode of inheritance for gene: MAGEL2 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Publications for gene: MAGEL2 were set to 24076603; 31397880; 29599419; 30302899
Phenotypes for gene: MAGEL2 were set to Schaaf-Yang syndrome; Chitayat-Hall Syndrome
Review for gene: MAGEL2 was set to GREEN
Added comment: MAGEL2 is a single-exon gene.
Frameshift mutations may not cause nonsense-mediated decay, but instead a variety of truncated or elongated protein products.
The pathogenicity of haploinsufficiency of the paternal allele is uncertain (ClinGen review 2018). A dominant-negative effect has been suggested. Haploinsufficiency may play a role.
Sources: Literature
Autism v0.167 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Marked gene: TMPRSS6 as ready
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence).
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia
Mendeliome v0.9100 TMPRSS6 Zornitza Stark Publications for gene: TMPRSS6 were set to
Mendeliome v0.9099 TMPRSS6 Zornitza Stark Mode of inheritance for gene: TMPRSS6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Marked gene: TMPRSS6 as ready
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence).
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from Iron refractoryirondeficiencyanemia,206200; Iron-Refractory Iron Deficiency Anemia; 206200 Iron refractoryirondeficiencyanemia to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia
Red cell disorders v0.67 TMPRSS6 Zornitza Stark Publications for gene: TMPRSS6 were set to 18408718
Mendeliome v0.9098 TPI1 Zornitza Stark changed review comment from: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; to: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital haemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.
Mendeliome v0.9098 TPI1 Zornitza Stark edited their review of gene: TPI1: Added comment: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; Changed publications: 9338582, 32873690, 8503454; Changed phenotypes: Haemolytic anaemia due to triosephosphate isomerase deficiency, MIM# 615512
Red cell disorders v0.66 TPI1 Zornitza Stark Marked gene: TPI1 as ready
Red cell disorders v0.66 TPI1 Zornitza Stark Gene: tpi1 has been classified as Green List (High Evidence).
Red cell disorders v0.66 TPI1 Zornitza Stark Phenotypes for gene: TPI1 were changed from 615512 Hemolytic anemia due to triosephosphate isomerase deficiency; Enzyme Disorder; Hemolytic anemia due to triosephosphate isomerase deficiency,615512 to Haemolytic anaemia due to triosephosphate isomerase deficiency MIM# 615512; chronic haemolytic anaemia; neuromuscular dysfunction; intracellular accumulation of dihydroxyacetone phosphate (DHAP)
Red cell disorders v0.65 TPI1 Zornitza Stark Publications for gene: TPI1 were set to 11698297; 9338582
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre Deleted their review
Mitochondrial disease v0.648 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Mitochondrial disease v0.648 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Mitochondrial disease v0.648 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Mitochondrial disease v0.647 YARS2 Zornitza Stark Publications for gene: YARS2 were set to
Mitochondrial disease v0.646 YARS2 Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.645 YARS2 Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9098 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Mendeliome v0.9098 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: ; Mode of pathogenicity: None; Publications: 24076603, 30302899, 31397880; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9098 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Mendeliome v0.9097 YARS2 Zornitza Stark Publications for gene: YARS2 were set to
Mendeliome v0.9096 YARS2 Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 YARS2 Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 TPI1 Danielle Ariti reviewed gene: TPI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9338582, 32873690, 8503454; Phenotypes: Hemolytic anemia due to triosephosphate isomerase deficiency MIM# 615512, chronic hemolytic anaemia, neuromuscular dysfunction, intracellular accumulation of dihydroxyacetone phosphate (DHAP); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 GLRX5 Zornitza Stark Marked gene: GLRX5 as ready
Red cell disorders v0.64 GLRX5 Zornitza Stark Gene: glrx5 has been classified as Green List (High Evidence).
Red cell disorders v0.64 GLRX5 Zornitza Stark Phenotypes for gene: GLRX5 were changed from 616860 Pyridoxine refractory sideroblastic anaemia 3; Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive, 205950; 205950 Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive to Anaemia, sideroblastic, 3, pyridoxine-refractory, MIM# 616860
Red cell disorders v0.63 GLRX5 Zornitza Stark Publications for gene: GLRX5 were set to 20364084; 25342667; 17485548
Red cell disorders v0.62 GLRX5 Zornitza Stark changed review comment from: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.; to: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anaemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.
Red cell disorders v0.62 GIF Zornitza Stark Marked gene: GIF as ready
Red cell disorders v0.62 GIF Zornitza Stark Gene: gif has been classified as Green List (High Evidence).
Red cell disorders v0.62 GIF Zornitza Stark Phenotypes for gene: GIF were changed from 261000 Intrinsic factor deficiency to Intrinsic factor deficiency, MIM# 261000
Red cell disorders v0.61 GIF Zornitza Stark Publications for gene: GIF were set to 15738392; 14576042
Red cell disorders v0.60 GIF Zornitza Stark reviewed gene: GIF: Rating: GREEN; Mode of pathogenicity: None; Publications: 14695536, 14576042, 15738392; Phenotypes: Intrinsic factor deficiency, MIM# 261000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Regression v0.371 GCLC Zornitza Stark Marked gene: GCLC as ready
Regression v0.371 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Regression v0.371 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Regression v0.370 GCLC Zornitza Stark Publications for gene: GCLC were set to
Regression v0.369 GCLC Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.368 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28571779, 10515893; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 GCLC Zornitza Stark Marked gene: GCLC as ready
Mendeliome v0.9095 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Red cell disorders v0.60 UMPS Danielle Ariti reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900, megaloblastic anaemia, orotic acid crystalluria, ID, immunodeficiencies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450; Disorders of the gamma-glutamyl cycle
Mendeliome v0.9094 GCLC Zornitza Stark Publications for gene: GCLC were set to
Mendeliome v0.9093 GCLC Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9092 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.60 GCLC Zornitza Stark Marked gene: GCLC as ready
Red cell disorders v0.60 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Red cell disorders v0.60 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Red cell disorders v0.59 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from 230450 Glutamate-cysteine ligase deficiency; Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, 230450; Enzyme Disorder; Glutamate-cysteine ligase deficiency; 230450 Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency to Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Red cell disorders v0.58 GCLC Zornitza Stark Publications for gene: GCLC were set to 10515893
Red cell disorders v0.57 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.143 FRA7A Bryony Thompson Marked STR: FRA7A as ready
Repeat Disorders v0.143 FRA7A Bryony Thompson Str: fra7a has been classified as Red List (Low Evidence).
Repeat Disorders v0.143 FRA7A Bryony Thompson STR: FRA7A was added
STR: FRA7A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA7A were set to 25196122
Phenotypes for STR: FRA7A were set to Autism spectrum disorder
Review for STR: FRA7A was set to AMBER
Added comment: A de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. The expanded allele showed hypermethylation of the adjacent CpG island and reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line. The probands mother had a pre-mutation with 85 repeats. Controls showed a CGG-repeat range of 5 to 22. In a second family a pre-mutation (66-72) was identified in 3 siblings with ASD and an unaffected father. One of the siblings had mitotic instability.
Sources: Literature
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Marked gene: MAP1B as ready
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Gene: map1b has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Classified gene: MAP1B as Green List (high evidence)
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Gene: map1b has been classified as Green List (High Evidence).
Mendeliome v0.9092 PDGFRL Zornitza Stark Marked gene: PDGFRL as ready
Mendeliome v0.9092 PDGFRL Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence).
Mendeliome v0.9092 PDGFRL Zornitza Stark Classified gene: PDGFRL as Red List (low evidence)
Mendeliome v0.9092 PDGFRL Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence).
Red cell disorders v0.57 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Red cell disorders v0.57 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Red cell disorders v0.57 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from 613561 Myopathy, lactic acidosis, and sideroblastic anemia 2; Myopathy, lactic acidosis, and sideroblastic anemia 2, 613561 to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Red cell disorders v0.56 YARS2 Zornitza Stark Publications for gene: YARS2 were set to 23918765; 22504945; 20598274
Repeat Disorders v0.142 VACTERLX Bryony Thompson Marked STR: VACTERLX as ready
Repeat Disorders v0.142 VACTERLX Bryony Thompson Str: vacterlx has been classified as Red List (Low Evidence).
Repeat Disorders v0.142 VACTERLX Bryony Thompson STR: VACTERLX was added
STR: VACTERLX was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: VACTERLX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: VACTERLX were set to 20452998; 32639022
Phenotypes for STR: VACTERLX were set to VACTERL association, X-linked MIM#314390
Review for STR: VACTERLX was set to RED
Added comment: NM_003413.4(ZIC3):c.163GCC[X]
PMID: 20452998 - reports a single case with VACTERL association and an expansion of the poly-Ala tract from 10 to 12 alanines.
PMID: 32639022 - a family with Oculo-auriculo-vertebral spectrum (OAVS) segregates the 11 alanine expansion in affected males
This polyalanine tract is highly polymorphic in gnomAD v2.1, there are 86 hemizygote 12 alanine expansions present and 65 hemizygotes with the 11 alanine expansion. The 13 polyalanine expansion is also present in 13 hemizygotes.
Sources: Literature
Mendeliome v0.9091 PDGFRL Michelle Torres reviewed gene: PDGFRL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown; Current diagnostic: yes
Repeat Disorders v0.141 FRA12A Bryony Thompson Marked STR: FRA12A as ready
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.141 FRA12A Bryony Thompson Classified STR: FRA12A as Amber List (moderate evidence)
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.140 FRA12A Bryony Thompson STR: FRA12A was added
STR: FRA12A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA12A were set to 17236128
Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630
Review for STR: FRA12A was set to AMBER
Added comment: NM_173602.2:c.-137CGG[X]
All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp.
70 controls used to determine the "normal" repeat range.
Sources: Literature
Red cell disorders v0.55 XK Danielle Ariti reviewed gene: XK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8004674, 30128557, 30800707; Phenotypes: McLeod syndrome with or without chronic granulomatous disease MIM# 300842, absence of red blood cell Kx antigen, weak expression of Kell red blood cell antigens, neuroacanthocytosis (peripheral and central nervous systems), cardiovascular abnormalities, myopathy; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Repeat Disorders v0.139 FRA11A Bryony Thompson Marked STR: FRA11A as ready
Repeat Disorders v0.139 FRA11A Bryony Thompson Str: fra11a has been classified as Red List (Low Evidence).
Repeat Disorders v0.139 FRA11A Bryony Thompson STR: FRA11A was added
STR: FRA11A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11A was set to Unknown
Publications for STR: FRA11A were set to 18160775; 453198
Phenotypes for STR: FRA11A were set to Intellectual disability
Review for STR: FRA11A was set to RED
Added comment: Expansion of a polymorphic CGG-repeat located at the 5' end of the C11orf80 gene causes expression of the folate-sensitive fragile site FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. The expansion was identified in the 15-year-old proband with intellectual disability as well as in phenotypically normal members of the family.
Sources: Literature
Red cell disorders v0.55 YARS2 Danielle Ariti reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.138 TOF Bryony Thompson Marked STR: TOF as ready
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.138 TOF Bryony Thompson Classified STR: TOF as Green List (high evidence)
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.137 TOF Bryony Thompson STR: TOF was added
STR: TOF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: TOF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TOF were set to 19948535; 11748311
Phenotypes for STR: TOF were set to Tetralogy of Fallot MIM#187500
Review for STR: TOF was set to GREEN
STR: TOF was marked as clinically relevant
Added comment: Poly-alanine tract expansion. In vitro functional assays demonstrated the expansion lead to protein aggregation in cells. Two unrelated cases reported with 25 repeats, one case with isolated interrupted aortic arch and one case with scoliosis, facial asymmetry, upslanting
palpebral fissures, absent PV, isolated left pulmonary artery (expected de novo - excluded in mother and father not available for testing). Other variant types cause disease in this gene.
Sources: Literature
Deafness_IsolatedAndComplex v1.90 MAP1B Elena Savva gene: MAP1B was added
gene: MAP1B was added to Deafness_IsolatedAndComplex. Sources: Literature
Mode of inheritance for gene: MAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAP1B were set to PMID: 33268592
Phenotypes for gene: MAP1B were set to Periventricular nodular heterotopia 9 MIM#618918; sensorineural hearing loss
Review for gene: MAP1B was set to GREEN
Added comment: PMID: 33268592 - three unrelated patients with heterozygous missense variants and nonsyndromic sensorineural hearing loss. Functional studies on one missense show reduced protein expression and less phosphorylation.
Variant correction via CRISPR rescued cell dysfunction, and K/O mice show hearing loss
Sources: Literature
Repeat Disorders v0.136 FRAXF Bryony Thompson Marked STR: FRAXF as ready
Repeat Disorders v0.136 FRAXF Bryony Thompson Str: fraxf has been classified as Red List (Low Evidence).
Repeat Disorders v0.136 FRAXF Bryony Thompson STR: FRAXF was added
STR: FRAXF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRAXF was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXF were set to 7874164; 10094554; 8651274
Phenotypes for STR: FRAXF were set to Intellectual disability
Review for STR: FRAXF was set to RED
Added comment: FRAXF is a folate-sensitive fragile site, where expansion was identified in a male with developmental delay. However, further studies found that expression of the fragile site through expansion is not associated with a disease phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Cataract v0.287 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Cataract v0.287 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Cataract v0.287 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Cataract v0.287 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Mendeliome v0.9091 IFIH1 Zornitza Stark Marked gene: IFIH1 as ready
Mendeliome v0.9091 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Mendeliome v0.9091 IFIH1 Zornitza Stark Phenotypes for gene: IFIH1 were changed from to Aicardi-Goutieres syndrome 7, MIM#615846; Early-onset Inflammatory Bowel Disease
Mendeliome v0.9090 IFIH1 Zornitza Stark Publications for gene: IFIH1 were set to
Mendeliome v0.9089 IFIH1 Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence)
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1191 PRICKLE2 Zornitza Stark gene: PRICKLE2 was added
gene: PRICKLE2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Repeat Disorders v0.135 FRA11B Bryony Thompson Classified STR: FRA11B as Red List (low evidence)
Repeat Disorders v0.135 FRA11B Bryony Thompson Added comment: Comment on list classification: Low evidence of clinical relevance of expression of the fragile site.
Repeat Disorders v0.135 FRA11B Bryony Thompson Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.134 FRA11B Bryony Thompson STR: FRA11B was added
STR: FRA11B was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA11B were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933
Phenotypes for STR: FRA11B were set to Jacobsen syndrome MIM#147791
Review for STR: FRA11B was set to AMBER
Added comment: FRA11B is a rare folate sensitive fragile site caused by expansion of (CCG)n in the 5'UTR of CBL, and hypermethylation of adjacent CpG islands. There are commonly 11 repeats. The pre-mutation ranges from 80-100, while >100 leads to expression of the fragile site. Two cases of Jacobsen (llq-) syndrome, which is the clinical presentation of the loss of part of the long arm of chromosome 11, have been associated with the FRA11B repeat expansion (expected breakpoint). The estimated prevalence of the FRA11B expansion is 1 in 5,000, which the estimated prevalence of Jacobsen syndrome is <1 in 100,000.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4104 PRICKLE2 Hazel Phillimore gene: PRICKLE2 was added
gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to PMID: 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.

Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Inflammatory bowel disease v0.59 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Sources: Literature; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified.
Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant.
Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis.
Sources: Literature
Mendeliome v0.9088 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified.
Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant.
Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis.
Mendeliome v0.9088 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Mendeliome v0.9088 PRICKLE2 Hazel Phillimore changed review comment from: Six subjects from four unrelated families with heterozygous variants (two de novo missense (c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg)), one de novo nonsense variant (c.214 C>T; p.(Arg72*) and one frameshift variant (c.1286_1287delGT; p.(Ser429Thrfs*56)) which segregated with the disease in three affected females.

Loss-of-function (homozygous) variants cause seizures in flies, and both heterozygous and homozygous mice showed behavioral abnormalities including altered social interaction, learning abnormalities, and behavioural inflexibility. PubMed: 21276947.; to: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.
Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PubMed: 21276947).
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Marked gene: IFIH1 as ready
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Classified gene: IFIH1 as Green List (high evidence)
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Mendeliome v0.9088 IFIH1 Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Inflammatory bowel disease v0.58 IFIH1 Sarah Pantaleo gene: IFIH1 was added
gene: IFIH1 was added to Inflammatory bowel disease. Sources: Literature
Mode of inheritance for gene: IFIH1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: IFIH1 were set to 34185153
Phenotypes for gene: IFIH1 were set to Inflammatory Bowel Disease
Penetrance for gene: IFIH1 were set to Incomplete
Review for gene: IFIH1 was set to GREEN
Added comment: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Sources: Literature
Mendeliome v0.9088 FGF8 Zornitza Stark Marked gene: FGF8 as ready
Mendeliome v0.9088 FGF8 Zornitza Stark Gene: fgf8 has been classified as Green List (High Evidence).
Mendeliome v0.9088 FGF8 Zornitza Stark Phenotypes for gene: FGF8 were changed from to Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Femoral hypoplasia
Mendeliome v0.9087 FGF8 Zornitza Stark Publications for gene: FGF8 were set to
Mendeliome v0.9086 FGF8 Zornitza Stark Mode of inheritance for gene: FGF8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Susceptibility to Viral Infections v0.77 IFIH1 Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9085 FGF8 Zornitza Stark Tag SV/CNV tag was added to gene: FGF8.
Mendeliome v0.9085 FGF8 Zornitza Stark reviewed gene: FGF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cataract v0.286 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Cataract. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Mendeliome v0.9085 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Mendeliome v0.9085 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Phenotypes for gene: PRICKLE2 were changed from to Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.
Mendeliome v0.9084 PRICKLE2 Zornitza Stark Publications for gene: PRICKLE2 were set to
Intellectual disability syndromic and non-syndromic v0.4104 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Mendeliome v0.9083 PRICKLE2 Zornitza Stark Mode of inheritance for gene: PRICKLE2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Marked gene: COPB2 as ready
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9082 PRICKLE2 Hazel Phillimore reviewed gene: PRICKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34092786; Phenotypes: Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9082 UBE2U Ee Ming Wong changed review comment from: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature; to: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9082 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Mendeliome v0.9082 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 COPB2 Belinda Chong gene: COPB2 was added
gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COPB2 were set to PMID: 34450031
Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay
Review for gene: COPB2 was set to AMBER
Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis

3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous).
Sources: Literature
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Classified gene: GRIK2 as Green List (high evidence)
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9081 FGF8 Dean Phelan reviewed gene: FGF8: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 34433009; Phenotypes: Femoral hypoplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9081 LRP1 Seb Lunke Marked gene: LRP1 as ready
Mendeliome v0.9081 LRP1 Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence).
Growth failure v1.4 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Growth failure v1.4 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1188 GRIK2 Zornitza Stark Classified gene: GRIK2 as Green List (high evidence)
Genetic Epilepsy v0.1188 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9081 LRP1 Seb Lunke Classified gene: LRP1 as Red List (low evidence)
Mendeliome v0.9081 LRP1 Seb Lunke Added comment: Comment on list classification: Two papers without related phenotypes and little overall evidence for gene disease association.
Mendeliome v0.9081 LRP1 Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence).
Growth failure v1.4 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Growth failure v1.4 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9080 COPB2 Zornitza Stark Phenotypes for gene: COPB2 were changed from Microcephaly 19, primary, autosomal recessive, MIM# 617800 to Microcephaly 19, primary, autosomal recessive, MIM# 617800; Osteoporosis and developmental delay
Mendeliome v0.9079 COPB2 Zornitza Stark Publications for gene: COPB2 were set to 29036432
Mendeliome v0.9078 COPB2 Zornitza Stark Mode of inheritance for gene: COPB2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1187 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9077 COPB2 Zornitza Stark Classified gene: COPB2 as Green List (high evidence)
Mendeliome v0.9077 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9076 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Mendeliome v0.9076 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1187 GRIK2 Danielle Ariti gene: GRIK2 was added
gene: GRIK2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: GRIK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: GRIK2 were set to 34375587; 17847003; 25039795
Phenotypes for gene: GRIK2 were set to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD)
Review for gene: GRIK2 was set to GREEN
Added comment: Over 10 individuals with variants in GRIK2; Bi-allelic and mono-allelic; loss of function

2 (sibs) with bi-allelic truncating variants and 1 family with bi-allelic deletion (removing exons 7 and 8).
11 individuals with de novo mono-allelic missense variants
(5x with the same missense variant c.1969G>A (p.Ala657Thr) all the others were near this location).

Associated with nonsyndromic neurodevelopmental disorder (NDD) with intellectual disability and developmental delay as core features with 30-50% individuals experiencing seizures.
Sources: Literature
Mendeliome v0.9076 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Mendeliome v0.9076 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant
Mendeliome v0.9075 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4101 GRIK2 Zornitza Stark Publications for gene: GRIK2 were set to
Growth failure v1.3 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Growth failure. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to AMBER
gene: ZNF668 was marked as current diagnostic
Added comment: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9075 LRP1 Elena Savva reviewed gene: LRP1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 26142438, 33776059; Phenotypes: ?Keratosis pilaris atrophicans MIM#604093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4100 GRIK2 Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9075 COPB2 Belinda Chong reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34450031; Phenotypes: Osteoporosis and developmental delay; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4099 GRIK2 Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9075 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Mendeliome v0.9075 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9075 CFAP206 Seb Lunke Marked gene: CFAP206 as ready
Mendeliome v0.9075 CFAP206 Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9075 GRIK2 Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; Nonsyndromic neurodevelopmental disorder, autosomal dominant
Mendeliome v0.9074 CFAP206 Seb Lunke Publications for gene: CFAP206 were set to
Mendeliome v0.9073 GRIK2 Zornitza Stark Publications for gene: GRIK2 were set to
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9072 GRIK2 Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9071 CFAP206 Seb Lunke Classified gene: CFAP206 as Amber List (moderate evidence)
Mendeliome v0.9071 CFAP206 Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9070 CFAP206 Seb Lunke Phenotypes for gene: CFAP206 were changed from Multiple morphological abnormalities of the fagella to Multiple morphological abnormalities of the flagella
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Microcephaly v1.45 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Microcephaly v1.45 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9069 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Mendeliome v0.9069 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9069 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Mendeliome v0.9069 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9068 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9068 GRIK2 Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER
Microcephaly v1.44 ZNF668 Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER
Microcephaly v1.44 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9068 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Marked gene: LAMA1 as ready
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Classified gene: LAMA1 as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Classified gene: LAMA1 as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Mendeliome v0.9068 GLIS1 Seb Lunke Marked gene: GLIS1 as ready
Mendeliome v0.9068 GLIS1 Seb Lunke Gene: glis1 has been classified as Red List (Low Evidence).
Microcephaly v1.44 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9068 GLIS1 Seb Lunke Phenotypes for gene: GLIS1 were changed from Increased ocular pressure to Increased ocular pressure; Glaucoma
Joubert syndrome and other neurological ciliopathies v1.13 LAMA1 Zornitza Stark gene: LAMA1 was added
gene: LAMA1 was added to Joubert syndrome and other neurological ciliopathies. Sources: Literature
Mode of inheritance for gene: LAMA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LAMA1 were set to 34423300
Phenotypes for gene: LAMA1 were set to Poretti-Boltshauser syndrome, MIM# 615960
Review for gene: LAMA1 was set to GREEN
Added comment: Four families with Poretti-Bolthauser syndrome identified in a cohort of 'unsolved' Joubert syndrome patients -- included due to phenotypic overlap.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9067 GLIS1 Seb Lunke changed review comment from: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.
Sources: Literature; to: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.

The authors did show dysregulation of GLIS1 in a human cell line study, and performed linkage analysis suggesting an association of the GLIS1 locus with Glaucoma in UK biobank samples.
Sources: Literature
Mendeliome v0.9067 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9067 CFAP206 Ain Roesley gene: CFAP206 was added
gene: CFAP206 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CFAP206 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFAP206 were set to Multiple morphological abnormalities of the fagella
Penetrance for gene: CFAP206 were set to unknown
Review for gene: CFAP206 was set to AMBER
Added comment: 1x hom with a fs variant

Sperm from knockout mouse model mainly had a fagellum of normal length but most of them showed abnormal forms including bent and coiled fagella. There was also a significant increase of sperm cells with absent or short fagella compared to the WT mice.
Sources: Literature
Mendeliome v0.9067 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Marked gene: SLC32A1 as ready
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence)
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1186 SLC32A1 Zornitza Stark gene: SLC32A1 was added
gene: SLC32A1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC32A1 were set to 34038384
Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus
Review for gene: SLC32A1 was set to GREEN
Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition.
Sources: Literature
Mendeliome v0.9067 SLC32A1 Zornitza Stark Marked gene: SLC32A1 as ready
Mendeliome v0.9067 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Mendeliome v0.9067 GLIS1 Seb Lunke gene: GLIS1 was added
gene: GLIS1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GLIS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLIS1 were set to 34385434
Phenotypes for gene: GLIS1 were set to Increased ocular pressure
Review for gene: GLIS1 was set to RED
Added comment: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.
Sources: Literature
Mendeliome v0.9066 SLC32A1 Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence)
Mendeliome v0.9066 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Mendeliome v0.9065 SLC32A1 Zornitza Stark gene: SLC32A1 was added
gene: SLC32A1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC32A1 were set to 34038384
Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus
Review for gene: SLC32A1 was set to GREEN
Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition.
Sources: Literature
Red cell disorders v0.55 GATA1 Zornitza Stark Marked gene: GATA1 as ready
Red cell disorders v0.55 GATA1 Zornitza Stark Gene: gata1 has been classified as Green List (High Evidence).
Red cell disorders v0.55 GATA1 Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 to Thrombocytopaenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Red cell disorders v0.54 GATA1 Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anemia 300367; 300367 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; Myelodysplastic syndrome (MDS), Paediatric; Diamond-Blackfan anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities 300835; Diamond Blackfan Anaemia; 300835 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; 300367 Diamond Blackfan Anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities; Thrombocytopenia, X-linked, with or without dyserythropoietic anemia, 300367 to Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Red cell disorders v0.53 GATA1 Zornitza Stark edited their review of gene: GATA1: Changed publications: 30228860, 24766296, 22706301
Red cell disorders v0.53 GATA1 Zornitza Stark edited their review of gene: GATA1: Changed phenotypes: Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Mendeliome v0.9064 G6PD Zornitza Stark Marked gene: G6PD as ready
Mendeliome v0.9064 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Mendeliome v0.9064 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908
Mendeliome v0.9063 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from to Haemolytic anemia, G6PD deficient (favism), MIM# 300908
Mendeliome v0.9062 G6PD Zornitza Stark Publications for gene: G6PD were set to
Mendeliome v0.9061 G6PD Zornitza Stark Mode of inheritance for gene: G6PD was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9060 G6PD Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: 18177777; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Red cell disorders v0.53 G6PD Zornitza Stark Marked gene: G6PD as ready
Red cell disorders v0.53 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Red cell disorders v0.53 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908
Red cell disorders v0.52 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from 300908 Hemolytic anemia, G6PD deficient (favism); Enzyme Disorder; 300908 Hemolytic anemia due to G6PD deficiency; Hemolytic anemia due to G6PD deficiency, 300908 to Haemolytic anemia, G6PD deficient (favism), MIM# 300908
Red cell disorders v0.51 G6PD Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9060 EPB42 Zornitza Stark Marked gene: EPB42 as ready
Mendeliome v0.9060 EPB42 Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence).
Mendeliome v0.9060 EPB42 Zornitza Stark Phenotypes for gene: EPB42 were changed from to Spherocytosis, type 5, MIM# 612690
Mendeliome v0.9059 EPB42 Zornitza Stark Publications for gene: EPB42 were set to
Mendeliome v0.9058 EPB42 Zornitza Stark Mode of inheritance for gene: EPB42 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9057 EPB42 Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.51 EPB42 Zornitza Stark Marked gene: EPB42 as ready
Red cell disorders v0.51 EPB42 Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence).
Red cell disorders v0.51 EPB42 Zornitza Stark Phenotypes for gene: EPB42 were changed from Spherocytosis, type 5, 612690; 612690 Hereditary spherocytosis type 5; RBC membrane abnormality; Hereditary spherocytosis type 5; 612690 Spherocytosis, type 5; EPB42-related hereditary spherocytosis; Minkowski-Chauffard disease; Spherocytosis, Recessive; Elliptocytosis to Spherocytosis, type 5, MIM# 612690
Red cell disorders v0.50 EPB42 Zornitza Stark Publications for gene: EPB42 were set to 12176912; 7772513; 1558976
Red cell disorders v0.49 EPB42 Zornitza Stark edited their review of gene: EPB42: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.49 EPB42 Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: None
Mendeliome v0.9057 EPB41 Zornitza Stark Marked gene: EPB41 as ready
Mendeliome v0.9057 EPB41 Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence).
Mendeliome v0.9057 EPB41 Zornitza Stark Phenotypes for gene: EPB41 were changed from to Elliptocytosis-1, MIM# 611804
Mendeliome v0.9056 EPB41 Zornitza Stark Publications for gene: EPB41 were set to
Mendeliome v0.9055 EPB41 Zornitza Stark Mode of inheritance for gene: EPB41 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9054 EPB41 Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.49 EPB41 Zornitza Stark Marked gene: EPB41 as ready
Red cell disorders v0.49 EPB41 Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence).
Red cell disorders v0.49 EPB41 Zornitza Stark Phenotypes for gene: EPB41 were changed from Elliptocytosis-1,611804; RBC membrane abnormality; 611804 Hereditary elliptocytosis; 611804 Elliptocytosis-1; Elliptocytosis; Hereditary elliptocytosis to Elliptocytosis-1, MIM# 611804
Red cell disorders v0.48 EPB41 Zornitza Stark Publications for gene: EPB41 were set to 8423235; 1430200; 3134067
Red cell disorders v0.47 EPB41 Zornitza Stark Mode of inheritance for gene: EPB41 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.46 EPB41 Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9054 DHFR Zornitza Stark Marked gene: DHFR as ready
Mendeliome v0.9054 DHFR Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence).
Mendeliome v0.9054 DHFR Zornitza Stark Phenotypes for gene: DHFR were changed from to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839
Mendeliome v0.9053 DHFR Zornitza Stark Publications for gene: DHFR were set to
Mendeliome v0.9052 DHFR Zornitza Stark Mode of inheritance for gene: DHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9051 DHFR Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.46 DHFR Zornitza Stark Marked gene: DHFR as ready
Red cell disorders v0.46 DHFR Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence).
Red cell disorders v0.46 DHFR Zornitza Stark Phenotypes for gene: DHFR were changed from Megaloblastic anemia due to dihydrofolate reductase deficiency, 613839; 613839 Megaloblastic anemia due to dihydrofolate reductase deficiency to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839
Red cell disorders v0.45 DHFR Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9051 CYB5R3 Zornitza Stark Marked gene: CYB5R3 as ready
Mendeliome v0.9051 CYB5R3 Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence).
Mendeliome v0.9051 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from to Methaemoglobinaemia, type I and II, MIM# 250800
Mendeliome v0.9050 CYB5R3 Zornitza Stark Publications for gene: CYB5R3 were set to
Mendeliome v0.9049 CYB5R3 Zornitza Stark Mode of inheritance for gene: CYB5R3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9048 CYB5R3 Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methaemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.45 CYB5R3 Zornitza Stark Marked gene: CYB5R3 as ready
Red cell disorders v0.45 CYB5R3 Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence).
Red cell disorders v0.45 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methemoglobinaemia, type I and II, MIM# 250800 to Methaemoglobinaemia, type I and II, MIM# 250800
Red cell disorders v0.44 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methaemoglobinaemia; 250800 Methemoglobinemia; Methaemoglobinaemia type I and II, 250800; 250800 Methaemoglobinaemia type I and II to Methemoglobinaemia, type I and II, MIM# 250800
Red cell disorders v0.43 CYB5R3 Zornitza Stark Publications for gene: CYB5R3 were set to 18318771; 15921385
Red cell disorders v0.42 CYB5R3 Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.133 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.133 NIPA1 Bryony Thompson Added comment: Comment on list classification: This is an association/risk allele rather than high-risk disease-causing expansion, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.133 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.132 NIPA1 Bryony Thompson Deleted their comment
Repeat Disorders v0.132 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.132 NIPA1 Bryony Thompson Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.132 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.131 NIPA1 Bryony Thompson STR: NIPA1 was added
STR: NIPA1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIPA1 was set to Unknown
Publications for STR: NIPA1 were set to 30342764; 22378146
Phenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis
Review for STR: NIPA1 was set to GREEN
Added comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5.
Sources: Literature
Red cell disorders v0.42 CUBN Zornitza Stark Marked gene: CUBN as ready
Red cell disorders v0.42 CUBN Zornitza Stark Gene: cubn has been classified as Green List (High Evidence).
Red cell disorders v0.42 CUBN Zornitza Stark Phenotypes for gene: CUBN were changed from Megaloblastic anemia-1, Finnish type, 261100; Megaloblastic Anemia; 261100 Megaloblastic anemia-1, Finnish type to Imerslund-Grasbeck syndrome 1, MIM# 261100
Red cell disorders v0.41 CUBN Zornitza Stark Publications for gene: CUBN were set to 17285242; 15024727
Red cell disorders v0.40 CUBN Zornitza Stark reviewed gene: CUBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10080186, 21208123, 17668238]; Phenotypes: Imerslund-Grasbeck syndrome 1, MIM# 261100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.40 COX4I2 Zornitza Stark changed review comment from: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs).; to: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs). Note no other variants reported in this gene since original report in 2009. All variants submitted to ClinVar are VOUS/LB/B.
Red cell disorders v0.40 COX4I2 Zornitza Stark Marked gene: COX4I2 as ready
Red cell disorders v0.40 COX4I2 Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence).
Red cell disorders v0.40 COX4I2 Zornitza Stark Phenotypes for gene: COX4I2 were changed from Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, 612714; 612714 Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, andCalvarial Hyperostosis; 612714 Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714
Red cell disorders v0.39 COX4I2 Zornitza Stark Publications for gene: COX4I2 were set to 19268275
Red cell disorders v0.38 COX4I2 Zornitza Stark Classified gene: COX4I2 as Red List (low evidence)
Red cell disorders v0.38 COX4I2 Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence).
Red cell disorders v0.37 COX4I2 Zornitza Stark reviewed gene: COX4I2: Rating: RED; Mode of pathogenicity: None; Publications: 19268275, 22730437; Phenotypes: Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.37 CDAN1 Zornitza Stark Marked gene: CDAN1 as ready
Red cell disorders v0.37 CDAN1 Zornitza Stark Gene: cdan1 has been classified as Green List (High Evidence).
Red cell disorders v0.37 CDAN1 Zornitza Stark Phenotypes for gene: CDAN1 were changed from 224120 Dyserythropoietic anemia, congenital, type Ia; 224120 Congenital dyserythropoietic anaemia type 1a; Dyserythropoietic anemia, congenital, type Ia, 224120 to Dyserythropoietic anaemia, congenital, type Ia, 224120
Red cell disorders v0.36 CDAN1 Zornitza Stark Publications for gene: CDAN1 were set to 16098079; 12434312
Red cell disorders v0.35 CDAN1 Zornitza Stark edited their review of gene: CDAN1: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ia, 224120
Red cell disorders v0.35 ALDOA Zornitza Stark Marked gene: ALDOA as ready
Red cell disorders v0.35 ALDOA Zornitza Stark Gene: aldoa has been classified as Green List (High Evidence).
Red cell disorders v0.35 ALDOA Zornitza Stark Phenotypes for gene: ALDOA were changed from Enzyme Disorder; Glycogen storage disease; Aldolase A deficiency; 611881 Aldolase A deficiency; 611881 Glycogen storage disease XII; Glycogen storage disease XII, 611881; Glycogen storage disease due to aldolase A deficiency to Glycogen storage disease XII , MIM#611881
Red cell disorders v0.34 ALDOA Zornitza Stark Publications for gene: ALDOA were set to 8598869; 7331996
Red cell disorders v0.33 ALDOA Zornitza Stark reviewed gene: ALDOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7331996, 8598869, 25392908; Phenotypes: Glycogen storage disease XII , MIM#611881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9048 CD59 Zornitza Stark Marked gene: CD59 as ready
Mendeliome v0.9048 CD59 Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence).
Mendeliome v0.9048 CD59 Zornitza Stark Phenotypes for gene: CD59 were changed from to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300
Mendeliome v0.9047 CD59 Zornitza Stark Publications for gene: CD59 were set to
Mendeliome v0.9046 CD59 Zornitza Stark Mode of inheritance for gene: CD59 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.33 CD59 Zornitza Stark changed review comment from: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.; to: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.

More than 5 unrelated families reported.
Mendeliome v0.9045 CD59 Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.33 CD59 Zornitza Stark Marked gene: CD59 as ready
Red cell disorders v0.33 CD59 Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence).
Red cell disorders v0.33 CD59 Zornitza Stark Phenotypes for gene: CD59 were changed from Dyskeratosis congenita, X-linked, 305000; 305000 Dyskeratosis congenita, X-linked to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300
Red cell disorders v0.32 CD59 Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.32 C15orf41 Zornitza Stark Marked gene: C15orf41 as ready
Red cell disorders v0.32 C15orf41 Zornitza Stark Gene: c15orf41 has been classified as Green List (High Evidence).
Red cell disorders v0.32 C15orf41 Zornitza Stark Phenotypes for gene: C15orf41 were changed from 615631 Congenital dyserythropoietic anaemia type 1b; Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib; 615631 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib, 615631 to Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631
Red cell disorders v0.31 C15orf41 Zornitza Stark Publications for gene: C15orf41 were set to 29031773; 23716552; 29885034
Red cell disorders v0.30 C15orf41 Zornitza Stark edited their review of gene: C15orf41: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631
Repeat Disorders v0.130 HSAN8 Bryony Thompson Marked STR: HSAN8 as ready
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.130 HSAN8 Bryony Thompson Classified STR: HSAN8 as Green List (high evidence)
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.129 HSAN8 Bryony Thompson STR: HSAN8 was added
STR: HSAN8 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: HSAN8 were set to 26005867
Phenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488
Review for STR: HSAN8 was set to GREEN
STR: HSAN8 was marked as clinically relevant
Added comment: NM_021619.3(PRDM12):c.1041CGC[X]
Poly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson Marked STR: RCPS as ready
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.128 RCPS Bryony Thompson Classified STR: RCPS as Green List (high evidence)
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.127 RCPS Bryony Thompson STR: RCPS was added
STR: RCPS was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RCPS were set to 24360810; 29112243
Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: RCPS was set to GREEN
STR: RCPS was marked as clinically relevant
Added comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Periventricular Grey Matter Heterotopia v1.0 Zornitza Stark promoted panel to version 1.0
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark Marked gene: SYNCRIP as ready
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark Gene: syncrip has been classified as Red List (Low Evidence).
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark gene: SYNCRIP was added
gene: SYNCRIP was added to Periventricular Grey Matter Heterotopia. Sources: Literature
Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SYNCRIP were set to 34157790
Phenotypes for gene: SYNCRIP were set to SYNCRIP-related neurodevelopmental disorder
Review for gene: SYNCRIP was set to RED
Added comment: One of 8 individuals reported so far had PVNH.
Sources: Literature
Mendeliome v0.9045 NEDD4L Zornitza Stark Marked gene: NEDD4L as ready
Mendeliome v0.9045 NEDD4L Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence).
Mendeliome v0.9045 NEDD4L Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201
Mendeliome v0.9044 NEDD4L Zornitza Stark Publications for gene: NEDD4L were set to
Mendeliome v0.9043 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9042 NEDD4L Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Marked gene: NEDD4L as ready
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201
Periventricular Grey Matter Heterotopia v0.28 NEDD4L Zornitza Stark Publications for gene: NEDD4L were set to
Periventricular Grey Matter Heterotopia v0.27 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.27 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.26 NEDD4L Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Marked STR: MEDPSACH as ready
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Classified STR: MEDPSACH as Green List (high evidence)
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.125 MEDPSACH Bryony Thompson STR: MEDPSACH was added
STR: MEDPSACH was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MEDPSACH were set to 9887340; 17133256; 21922596
Phenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170
Review for STR: MEDPSACH was set to GREEN
STR: MEDPSACH was marked as clinically relevant
STR: MEDPSACH was marked as current diagnostic
Added comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene.
Sources: Literature
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Marked gene: FLNA as ready
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Gene: flna has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Phenotypes for gene: FLNA were changed from to Heterotopia, periventricular, 1 , MIM#300049
Periventricular Grey Matter Heterotopia v0.25 FLNA Zornitza Stark Publications for gene: FLNA were set to
Periventricular Grey Matter Heterotopia v0.24 FLNA Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Periventricular Grey Matter Heterotopia v0.23 FLNA Zornitza Stark reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: 9883725, 15668422, 15994863; Phenotypes: Heterotopia, periventricular, 1 , MIM#300049; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Marked gene: ARF1 as ready
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Marked gene: DCHS1 as ready
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Gene: dchs1 has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Phenotypes for gene: DCHS1 were changed from to Van Maldergem syndrome 1, MIM# 601390
Periventricular Grey Matter Heterotopia v0.21 DCHS1 Zornitza Stark Publications for gene: DCHS1 were set to
Periventricular Grey Matter Heterotopia v0.20 DCHS1 Zornitza Stark Mode of inheritance for gene: DCHS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Periventricular Grey Matter Heterotopia v0.19 DCHS1 Zornitza Stark reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Classified gene: ARF1 as Green List (high evidence)
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1184 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Marked gene: ARF1 as ready
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Classified gene: ARF1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4097 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark changed review comment from: Additional reported of affected parent and child.; to: Additional report of affected parent and child.
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark commented on gene: ARF1: Additional reported of affected parent and child.
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark edited their review of gene: ARF1: Changed publications: 28868155, 34353862; Changed phenotypes: Periventricular nodular heterotopia 8, MIM# 618185
Mendeliome v0.9042 ARF1 Zornitza Stark Publications for gene: ARF1 were set to 28868155
Craniosynostosis v1.25 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Craniosynostosis v1.25 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Craniosynostosis v1.25 GINS2 Zornitza Stark gene: GINS2 was added
gene: GINS2 was added to Craniosynostosis. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included.

GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Growth failure v1.3 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Growth failure v1.3 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Growth failure v1.3 GINS2 Zornitza Stark gene: GINS2 was added
gene: GINS2 was added to Growth failure. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Mendeliome v0.9041 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Mendeliome v0.9041 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Mendeliome v0.9041 GINS2 Zornitza Stark Classified gene: GINS2 as Red List (low evidence)
Mendeliome v0.9041 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Red cell disorders v0.30 ANK1 Zornitza Stark Marked gene: ANK1 as ready
Red cell disorders v0.30 ANK1 Zornitza Stark Gene: ank1 has been classified as Green List (High Evidence).
Red cell disorders v0.30 ANK1 Zornitza Stark Phenotypes for gene: ANK1 were changed from Spherocytosis, type 1; Spherocytosis, type 1,182900; RBC membrane abnormality; 182900 Spherocytosis, type 1; 182900 RBC membrane abnormality to Spherocytosis, type 1, MIM# 182900
Red cell disorders v0.29 ANK1 Zornitza Stark Publications for gene: ANK1 were set to 7883994; 9590147; 11167760
Red cell disorders v0.28 ANK1 Zornitza Stark reviewed gene: ANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8640229; Phenotypes: Spherocytosis, type 1, MIM# 182900; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9040 AMN Zornitza Stark Marked gene: AMN as ready
Mendeliome v0.9040 AMN Zornitza Stark Gene: amn has been classified as Green List (High Evidence).
Mendeliome v0.9040 AMN Zornitza Stark Phenotypes for gene: AMN were changed from to Imerslund-Grasbeck syndrome 2, MIM# 618882
Mendeliome v0.9039 AMN Zornitza Stark Publications for gene: AMN were set to
Mendeliome v0.9038 AMN Zornitza Stark Mode of inheritance for gene: AMN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9037 AMN Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.28 AMN Zornitza Stark Marked gene: AMN as ready
Red cell disorders v0.28 AMN Zornitza Stark Gene: amn has been classified as Green List (High Evidence).
Red cell disorders v0.28 AMN Zornitza Stark Phenotypes for gene: AMN were changed from 261100 Megaloblastic anemia-1, Norwegian type; Megaloblastic anemia-1, Norwegian type, 261100 to Imerslund-Grasbeck syndrome 2, MIM# 618882
Red cell disorders v0.27 AMN Zornitza Stark Publications for gene: AMN were set to 17285242; 12590260
Red cell disorders v0.26 AMN Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.124 DMD Bryony Thompson Marked STR: DMD as ready
Repeat Disorders v0.124 DMD Bryony Thompson Str: dmd has been classified as Red List (Low Evidence).
Repeat Disorders v0.124 DMD Bryony Thompson STR: DMD was added
STR: DMD was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: DMD was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: DMD were set to 27417533
Phenotypes for STR: DMD were set to Duchenne muscular dystrophy MIM#310200; Becker muscular dystrophy MIM#300376
Review for STR: DMD was set to RED
Added comment: Single family reported with GAA repeat expansion in intron 62. Normal repeat range 11-33 in healthy controls. Expanded repeats range from 59-82 in the family, with 2 female carriers manifesting symptoms, a male foetus, 2 asymptomatic female carriers, and 2 male asymptomatic carriers ages 6 and 4 years.
Sources: Literature
Mendeliome v0.9037 AK1 Zornitza Stark Marked gene: AK1 as ready
Mendeliome v0.9037 AK1 Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence).
Mendeliome v0.9037 AK1 Zornitza Stark Phenotypes for gene: AK1 were changed from to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631
Mendeliome v0.9036 AK1 Zornitza Stark Publications for gene: AK1 were set to
Mendeliome v0.9035 AK1 Zornitza Stark Mode of inheritance for gene: AK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9034 AK1 Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.26 AK1 Zornitza Stark Marked gene: AK1 as ready
Red cell disorders v0.26 AK1 Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence).
Red cell disorders v0.26 AK1 Zornitza Stark Phenotypes for gene: AK1 were changed from 612631 Hemolytic anemia due to adenylate kinase deficiency; Hemolytic anemia due to adenylate kinase deficiency, 612631 to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631
Red cell disorders v0.25 AK1 Zornitza Stark Publications for gene: AK1 were set to 28211224
Red cell disorders v0.24 AK1 Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9034 ALAS2 Zornitza Stark Marked gene: ALAS2 as ready
Mendeliome v0.9034 ALAS2 Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence).
Mendeliome v0.9034 ALAS2 Zornitza Stark Phenotypes for gene: ALAS2 were changed from to Anaemia, sideroblastic, 1, MIM# 300751; Protoporphyria, erythropoietic, X-linked, MIM# 300752
Mendeliome v0.9033 ALAS2 Zornitza Stark Publications for gene: ALAS2 were set to
Mendeliome v0.9032 ALAS2 Zornitza Stark Mode of inheritance for gene: ALAS2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9031 ALAS2 Zornitza Stark reviewed gene: ALAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10029606, 7949148, 10029606, 25615817; Phenotypes: Anaemia, sideroblastic, 1, MIM# 300751, Protoporphyria, erythropoietic, X-linked, MIM# 300752; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.24 ALAS2 Zornitza Stark Marked gene: ALAS2 as ready
Red cell disorders v0.24 ALAS2 Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence).
Red cell disorders v0.24 ALAS2 Zornitza Stark Phenotypes for gene: ALAS2 were changed from Anemia, sideroblastic, 1 300751; Anemia, sideroblastic, 1, 300751; 300751 Sideroblastic anaemia 1; 300751 Anemia, sideroblastic, 1 to Anaemia, sideroblastic, 1, MIM# 300751
Red cell disorders v0.23 ALAS2 Zornitza Stark Publications for gene: ALAS2 were set to 10029606
Red cell disorders v0.22 ALAS2 Zornitza Stark edited their review of gene: ALAS2: Added comment: The essential features of X-linked sideroblastic anemia include: (1) a hypochromic microcytic anaemia and 2 discrete populations of red blood cells, one microcytic and the other normocytic; (2) marrow ringed sideroblasts, particularly prominent in the late erythroid precursors; (3) a variable haematologic response to pharmacologic doses of pyridoxine; and (4) systemic iron overload secondary to chronic ineffective erythropoiesis. The age of clinical onset of the disorder can vary from in utero to the ninth decade.

Well established gene-disease association.; Changed publications: 10029606, 7949148, 10029606
Red cell disorders v0.22 ALAS2 Zornitza Stark edited their review of gene: ALAS2: Changed phenotypes: Anaemia, sideroblastic, 1, MIM# 300751
Red cell disorders v0.22 ABCG8 Zornitza Stark Marked gene: ABCG8 as ready
Red cell disorders v0.22 ABCG8 Zornitza Stark Gene: abcg8 has been classified as Green List (High Evidence).
Red cell disorders v0.22 ABCG8 Zornitza Stark Phenotypes for gene: ABCG8 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolemia 1, MIM# 210250
Red cell disorders v0.21 ABCG8 Zornitza Stark Publications for gene: ABCG8 were set to
Red cell disorders v0.20 ABCG8 Zornitza Stark reviewed gene: ABCG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 33807969; Phenotypes: Sitosterolemia 1, MIM# 210250; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.20 ADA2 Zornitza Stark Marked gene: ADA2 as ready
Red cell disorders v0.20 ADA2 Zornitza Stark Gene: ada2 has been classified as Green List (High Evidence).
Red cell disorders v0.20 ADA2 Zornitza Stark Phenotypes for gene: ADA2 were changed from Diamond Blackfan anaemia to Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome, MIM# 615688
Red cell disorders v0.19 ADA2 Zornitza Stark Publications for gene: ADA2 were set to
Red cell disorders v0.18 ADA2 Zornitza Stark changed review comment from: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency.

At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.; to: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency.

At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.

Anaemia is a reported feature.
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666
Familial hypercholesterolaemia v0.17 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Familial hypercholesterolaemia v0.16 ABCG5 Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Familial hypercholesterolaemia v0.15 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9031 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Mendeliome v0.9031 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Mendeliome v0.9031 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666
Mendeliome v0.9030 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Mendeliome v0.9029 ABCG5 Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9028 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.18 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Red cell disorders v0.18 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Red cell disorders v0.18 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to 32546081; 23556150
Red cell disorders v0.17 ABCG5 Zornitza Stark edited their review of gene: ABCG5: Changed publications: 34304999, 33907061, 32546081, 23556150
Red cell disorders v0.17 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolaemia 2, MIM# 618666
Red cell disorders v0.16 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Red cell disorders v0.15 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v1.2 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Rare Disease
Regression v0.368 ABCB7 Zornitza Stark Marked gene: ABCB7 as ready
Regression v0.368 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence).
Regression v0.368 ABCB7 Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Regression v0.367 ABCB7 Zornitza Stark Phenotypes for gene: ABCB7 were changed from to Anaemia, sideroblastic, with ataxia, MIM# 301310
Regression v0.366 ABCB7 Zornitza Stark Publications for gene: ABCB7 were set to
Regression v0.366 ABCB7 Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Regression v0.365 ABCB7 Zornitza Stark Classified gene: ABCB7 as Red List (low evidence)
Regression v0.365 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence).
Regression v0.364 ABCB7 Zornitza Stark reviewed gene: ABCB7: Rating: RED; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.14 ABCB7 Zornitza Stark Marked gene: ABCB7 as ready
Red cell disorders v0.14 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Green List (High Evidence).
Red cell disorders v0.14 ABCB7 Zornitza Stark Phenotypes for gene: ABCB7 were changed from 301310 Sideroblastic anaemia; Anemia, sideroblastic, with ataxia; Anemia, sideroblastic, with ataxia, 301310; 301310 Sideroblastic Anemia and Ataxia; Sideroblastic Anemia and Ataxia to Anaemia, sideroblastic, with ataxia, MIM# 301310
Red cell disorders v0.13 ABCB7 Zornitza Stark Publications for gene: ABCB7 were set to 11843825; 4045952; 11050011
Red cell disorders v0.12 ABCB7 Zornitza Stark reviewed gene: ABCB7: Rating: GREEN; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.11 Zornitza Stark Panel name changed from Rare anaemia_GEL to Red cell disorders
Callosome v0.320 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Genetic Epilepsy v0.1183 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Genetic Epilepsy v0.1182 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Mendeliome v0.9028 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Mendeliome v0.9027 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4096 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Callosome v0.320 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Callosome v0.319 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Genetic Epilepsy v0.1182 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Genetic Epilepsy v0.1181 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Mendeliome v0.9027 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Mendeliome v0.9026 CLCN3 Zornitza Stark reviewed gene: CLCN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Mode of inheritance: None
Mendeliome v0.9026 TOM1 Zornitza Stark Marked gene: TOM1 as ready
Mendeliome v0.9026 TOM1 Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence).
Mendeliome v0.9026 TOM1 Zornitza Stark gene: TOM1 was added
gene: TOM1 was added to Mendeliome. Sources: Expert list
Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TOM1 were set to 31263572
Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510
Review for gene: TOM1 was set to RED
Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data.
Sources: Expert list
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark Marked gene: TOM1 as ready
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence).
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark gene: TOM1 was added
gene: TOM1 was added to Combined Immunodeficiency. Sources: Expert list
Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TOM1 were set to 31263572
Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510
Review for gene: TOM1 was set to RED
Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data.
Sources: Expert list
Mendeliome v0.9025 ARF1 Arina Puzriakova reviewed gene: ARF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28868155, 34353862; Phenotypes: Periventricular nodular heterotopia 8, OMIM:618185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9025 GINS2 Arina Puzriakova gene: GINS2 was added
gene: GINS2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included.

GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Mendeliome v0.9025 DNAH10 Zornitza Stark Phenotypes for gene: DNAH10 were changed from primary male infertility with asthenoteratozoospermia to Spermatogenic failure 56, MIM# 619515
Mendeliome v0.9024 DNAH10 Zornitza Stark reviewed gene: DNAH10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 56, MIM# 619515; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4095 GNB2 Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503
Intellectual disability syndromic and non-syndromic v0.4094 GNB2 Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503
Mendeliome v0.9024 GNB2 Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503
Mendeliome v0.9023 GNB2 Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503
Mendeliome v0.9023 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; cerebral ventriculomegaly; limb contractures to Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; Ventriculomegaly and arthrogryposis, MIM# 619501
Mendeliome v0.9022 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296, Ventriculomegaly and arthrogryposis, MIM# 619501
Hydrocephalus_Ventriculomegaly v0.94 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures
Hydrocephalus_Ventriculomegaly v0.93 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures
Arthrogryposis v0.292 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures
Arthrogryposis v0.291 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures
Growth failure v1.1 Zornitza Stark Panel name changed from Growth failure in early childhood to Growth failure
Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Growth failure v1.0 Zornitza Stark promoted panel to version 1.0
Growth failure v0.404 ZFP57 Zornitza Stark edited their review of gene: ZFP57: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.404 ZFP57 Zornitza Stark Marked gene: ZFP57 as ready
Growth failure v0.404 ZFP57 Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence).
Growth failure v0.404 ZFP57 Zornitza Stark Phenotypes for gene: ZFP57 were changed from diabetes mellitus, transient neonatal, 1MONDO:0011073; Diabetes mellitus, transient neonatal 1 OMIM:601410; IUGR; Multi Locus Imprinting Disturbance to Diabetes mellitus, transient neonatal 1, MIM# 601410
Growth failure v0.403 ZFP57 Zornitza Stark Classified gene: ZFP57 as Green List (high evidence)
Growth failure v0.403 ZFP57 Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence).
Growth failure v0.402 ZFP57 Zornitza Stark reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393; Phenotypes: Diabetes mellitus, transient neonatal 1, MIM# 601410; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Classified gene: GOSR2 as Green List (high evidence)
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Added comment: Comment on list classification: Additional cases reported with muscular dystrophy
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Gene: gosr2 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.91 GOSR2 Bryony Thompson reviewed gene: GOSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34167170, 33639315, 33639315, 29855340, DOI:https://doi.org/10.1016/j.nmd.2013.06.404; Phenotypes: Epilepsy, progressive myoclonic 6 MIM#614018, congenital muscluar dystrophy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.402 PADI6 Zornitza Stark Marked gene: PADI6 as ready
Growth failure v0.402 PADI6 Zornitza Stark Gene: padi6 has been classified as Amber List (Moderate Evidence).
Growth failure v0.402 PADI6 Zornitza Stark Phenotypes for gene: PADI6 were changed from miscarriages in the family; Preimplantation embryonic lethality 2 OMIM:617234; Short stature; preimplantation embryonic lethality 2 MONDO:0014978; Multi Locus Imprinting Disturbance; IUGR; Beckwith-Wiedemann syndrome to IUGR
Growth failure v0.401 PADI6 Zornitza Stark Mode of inheritance for gene: PADI6 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.400 PADI6 Zornitza Stark reviewed gene: PADI6: Rating: AMBER; Mode of pathogenicity: None; Publications: 33221824, 32928291, 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.400 NLRP7 Zornitza Stark Marked gene: NLRP7 as ready
Growth failure v0.400 NLRP7 Zornitza Stark Gene: nlrp7 has been classified as Amber List (Moderate Evidence).
Growth failure v0.400 NLRP7 Zornitza Stark Phenotypes for gene: NLRP7 were changed from hydatidiform mole, recurrent, 1 MONDO:0009273; Short stature; fetal wastage; Hydatidiform mole, recurrent, 1 OMIM:231090; IUGR; Multi Locus Imprinting Disturbance to IUGR
Growth failure v0.399 NLRP7 Zornitza Stark Mode of inheritance for gene: NLRP7 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.398 NLRP7 Zornitza Stark reviewed gene: NLRP7: Rating: AMBER; Mode of pathogenicity: None; Publications: 28561018; Phenotypes: IUGR; Mode of inheritance: Other
Myopathy Superpanel v1.43 Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Myopathy - adult onset; Muscular dystrophy_Paediatric; Rhabdomyolysis; Limb Girdle Muscular Dystrophy
Mendeliome v0.9022 CHRM1 Bryony Thompson Marked gene: CHRM1 as ready
Mendeliome v0.9022 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Marked gene: CHRM1 as ready
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4093 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Mendeliome v0.9022 CHRM1 Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence)
Mendeliome v0.9022 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9021 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Mendeliome v0.9020 FGF20 Zornitza Stark Marked gene: FGF20 as ready
Mendeliome v0.9020 FGF20 Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9020 FGF20 Zornitza Stark Classified gene: FGF20 as Amber List (moderate evidence)
Mendeliome v0.9020 FGF20 Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9019 FGF20 Zornitza Stark gene: FGF20 was added
gene: FGF20 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: FGF20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FGF20 were set to 22698282
Phenotypes for gene: FGF20 were set to Renal hypodysplasia/aplasia 2, MIM#615721
Review for gene: FGF20 was set to AMBER
Added comment: Multiple affected fetuses in a consanguineous family; functional data.
Sources: Expert Review
Mendeliome v0.9018 ITGA8 Zornitza Stark Marked gene: ITGA8 as ready
Mendeliome v0.9018 ITGA8 Zornitza Stark Gene: itga8 has been classified as Green List (High Evidence).
Mendeliome v0.9018 ITGA8 Zornitza Stark Phenotypes for gene: ITGA8 were changed from to Renal hypodysplasia/aplasia 1, MIM# 191830
Mendeliome v0.9017 ITGA8 Zornitza Stark Publications for gene: ITGA8 were set to
Mendeliome v0.9016 ITGA8 Zornitza Stark Mode of inheritance for gene: ITGA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9015 ITGA8 Zornitza Stark reviewed gene: ITGA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 24439109; Phenotypes: Renal hypodysplasia/aplasia 1, MIM# 191830; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.398 NLRP5 Zornitza Stark Marked gene: NLRP5 as ready
Growth failure v0.398 NLRP5 Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence).
Growth failure v0.398 NLRP5 Zornitza Stark Phenotypes for gene: NLRP5 were changed from body asymmetry; Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR to Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR
Growth failure v0.397 NLRP5 Zornitza Stark Mode of inheritance for gene: NLRP5 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.396 NLRP5 Zornitza Stark Classified gene: NLRP5 as Amber List (moderate evidence)
Growth failure v0.396 NLRP5 Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence).
Growth failure v0.395 NLRP5 Zornitza Stark changed review comment from: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP2 in the MOTHER of the patient.

Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother.

Current trio filtering protocols may not account for this adequately.; to: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP5 in the MOTHER of the patient.

Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother.

Current trio filtering protocols may not account for this adequately.
Growth failure v0.395 NLRP5 Zornitza Stark reviewed gene: NLRP5: Rating: AMBER; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.395 STAT3 Zornitza Stark Marked gene: STAT3 as ready
Growth failure v0.395 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Growth failure v0.395 STAT3 Zornitza Stark Classified gene: STAT3 as Green List (high evidence)
Growth failure v0.395 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Growth failure v0.394 Zornitza Stark removed gene:NPR2 from the panel
Mendeliome v0.9015 NPR2 Zornitza Stark Marked gene: NPR2 as ready
Mendeliome v0.9015 NPR2 Zornitza Stark Gene: npr2 has been classified as Green List (High Evidence).
Mendeliome v0.9015 NPR2 Zornitza Stark Phenotypes for gene: NPR2 were changed from to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Epiphyseal chondrodysplasia, Miura type, MIM# 615923; Short stature with nonspecific skeletal abnormalities, MIM# 616255
Mendeliome v0.9014 NPR2 Zornitza Stark Publications for gene: NPR2 were set to
Mendeliome v0.9013 NPR2 Zornitza Stark Mode of inheritance for gene: NPR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9012 NPR2 Zornitza Stark changed review comment from: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.; to: Bi-allelic variants: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.

Mono-allelic variants have been linked to both tall stature and short stature disorders. Multiple families.
Mendeliome v0.9012 NPR2 Zornitza Stark edited their review of gene: NPR2: Changed publications: 31555216, 16384845, 15146390, 22870295, 24057292, 24259409, 16384845, 24471569; Changed phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Epiphyseal chondrodysplasia, Miura type, MIM# 615923, Short stature with nonspecific skeletal abnormalities, MIM# 616255; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9012 NPR2 Zornitza Stark reviewed gene: NPR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31555216, 16384845, 15146390; Phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Short stature, disproportionate, Oval vertebral bodies in infancy, Progressive shortening of humerus, radius and ulna in first year, dwarfism, Prominent forehead; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.393 Zornitza Stark removed gene:RAPSN from the panel
Arthrogryposis v0.291 RAPSN Zornitza Stark Marked gene: RAPSN as ready
Arthrogryposis v0.291 RAPSN Zornitza Stark Gene: rapsn has been classified as Green List (High Evidence).
Arthrogryposis v0.291 RAPSN Zornitza Stark Phenotypes for gene: RAPSN were changed from to Fetal akinesia deformation sequence 2 MIM# 618388; AChR deficiency; fetal akinesia; IUGR; micrognathia; hypokinesia; contractures; muscular hypotonia; feeding difficulties; severe respiratory insufficiency; history of miscarriage
Arthrogryposis v0.290 RAPSN Zornitza Stark Publications for gene: RAPSN were set to
Arthrogryposis v0.289 RAPSN Zornitza Stark Mode of inheritance for gene: RAPSN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Arthrogryposis v0.288 RAPSN Zornitza Stark reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region)
Mendeliome v0.9011 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Mendeliome v0.9010 RPS6KA3 Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9009 RPS6KA3 Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.392 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Growth failure v0.392 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Growth failure v0.392 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from Coffin Lowry to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region)
Growth failure v0.391 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Growth failure v0.390 RPS6KA3 Zornitza Stark Classified gene: RPS6KA3 as Green List (high evidence)
Growth failure v0.390 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark gene: SHOX2 was added
gene: SHOX2 was added to Atrial Fibrillation. Sources: Expert Review
Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHOX2 were set to 30443179
Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation
Review for gene: SHOX2 was set to RED
Added comment: Single family reported with LoF in this gene and AF.
Sources: Expert Review
Mendeliome v0.9009 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Mendeliome v0.9009 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Mendeliome v0.9009 SHOX2 Zornitza Stark gene: SHOX2 was added
gene: SHOX2 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHOX2 were set to 30443179
Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation
Review for gene: SHOX2 was set to RED
Added comment: Single family reported with LoF in this gene and AF.
Sources: Expert Review
Growth failure v0.389 SHOX2 Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.388 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Growth failure v0.388 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Growth failure v0.388 SHOX2 Zornitza Stark Phenotypes for gene: SHOX2 were changed from to Sinus Node Dysfunction; Atrial Fibrillation
Growth failure v0.387 SHOX2 Zornitza Stark Publications for gene: SHOX2 were set to
Growth failure v0.386 SHOX2 Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.385 SMARCAL1 Zornitza Stark Marked gene: SMARCAL1 as ready
Growth failure v0.385 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Growth failure v0.385 SMARCAL1 Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from to Schimke immune-osseous dysplasia MIM# 242900; T cell deficiency; Short stature; IUGR; spondyloepiphyseal dysplasia; growth retardation; renal dysfunction; lymphocytopaenia; nephropathy; bacterial/viral/fungal infections; may present as SCID; bone marrow failure
Growth failure v0.384 SMARCAL1 Zornitza Stark Publications for gene: SMARCAL1 were set to
Growth failure v0.383 SMARCAL1 Zornitza Stark Mode of inheritance for gene: SMARCAL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.382 SMARCAL1 Zornitza Stark Classified gene: SMARCAL1 as Green List (high evidence)
Growth failure v0.382 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Growth failure v0.381 NPR2 Danielle Ariti gene: NPR2 was added
gene: NPR2 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: NPR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NPR2 were set to 31555216; 16384845; 15146390
Phenotypes for gene: NPR2 were set to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Short stature, disproportionate; Oval vertebral bodies in infancy; Progressive shortening of humerus, radius and ulna in first year; dwarfism; Prominent forehead
Review for gene: NPR2 was set to GREEN
Added comment: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.
Sources: Literature
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Marked gene: EPHB4 as ready
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence).
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Classified gene: EPHB4 as Amber List (moderate evidence)
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence).
Vascular Malformations_Somatic v1.5 EPHB4 Bryony Thompson gene: EPHB4 was added
gene: EPHB4 was added to Vascular Malformations_Somatic. Sources: Other
Mode of inheritance for gene: EPHB4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHB4 were set to 31300548; 30760892
Phenotypes for gene: EPHB4 were set to Capillary malformation-arteriovenous malformation
Review for gene: EPHB4 was set to AMBER
Added comment: A single CV-AVM case has been reported with mosaicism of an EPHB4 variant. Mosaicism has also been reported for the other CV-AVM gene, RASA1.
Sources: Other
Growth failure v0.381 STAT3 Danielle Ariti gene: STAT3 was added
gene: STAT3 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: STAT3 were set to 25349174; 25038750; 25359994
Phenotypes for gene: STAT3 were set to Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Lymphoproliferation; solid organ autoimmunity; growth failure; recurrent infections; short stature; IUGR; eczema; delayed puberty; dental abnormalities; autoimmune interstitial lung disease; juvenile-onset arthritis; primary hypothyroidism
Mode of pathogenicity for gene: STAT3 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: STAT3 was set to GREEN
Added comment: 18 individuals from 15 unrelated families; monoallelic (missense or in-frame del) variants; gain of function; Multiple mouse models

Individuals exhibited various clinical features, with most presenting with early-onset autoimmunity and growth failure (IUGR, lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, recurrent infections, and short stature (<2SDS)).
Sources: Literature
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Marked gene: HS2ST1 as ready
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Classified gene: HS2ST1 as Green List (high evidence)
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.84 HS2ST1 Zornitza Stark gene: HS2ST1 was added
gene: HS2ST1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review
Mode of inheritance for gene: HS2ST1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HS2ST1 were set to 33159882
Phenotypes for gene: HS2ST1 were set to Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194
Review for gene: HS2ST1 was set to GREEN
Added comment: 4 individuals from 3 unrelated families reported.
Sources: Expert Review
Repeat Disorders v0.123 PHPX Zornitza Stark Tag paediatric-onset tag was added to STR: PHPX.
Growth failure v0.381 RAPSN Danielle Ariti reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mirror movements v1.0 Bryony Thompson promoted panel to version 1.0
Mirror movements v0.9 Bryony Thompson Panel status changed from internal to public
Mirror movements v0.8 DNAL4 Bryony Thompson gene: DNAL4 was added
gene: DNAL4 was added to Mirror movements. Sources: Other
Mode of inheritance for gene: DNAL4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAL4 were set to 25098561; 25236653
Phenotypes for gene: DNAL4 were set to Mirror movements 3 MIM#616059
Review for gene: DNAL4 was set to RED
Added comment: Only a single large consanguineous Pakastani family with a homozygous variant reported.
Sources: Other
Mirror movements v0.7 RAD51 Bryony Thompson Marked gene: RAD51 as ready
Mirror movements v0.7 RAD51 Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence).
Mirror movements v0.7 RAD51 Bryony Thompson Classified gene: RAD51 as Green List (high evidence)
Mirror movements v0.7 RAD51 Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence).
Mirror movements v0.6 RAD51 Bryony Thompson gene: RAD51 was added
gene: RAD51 was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAD51 were set to 25763452; 22305526; 27830107; 24808016
Phenotypes for gene: RAD51 were set to Mirror movements 2 MIM#614508
Review for gene: RAD51 was set to GREEN
gene: RAD51 was marked as current diagnostic
Added comment: >3 families/probands reported with mirror movements
Sources: Expert list
Growth failure v0.381 RPS6KA3 Danielle Ariti reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.381 SHOX2 Danielle Ariti reviewed gene: SHOX2: Rating: RED; Mode of pathogenicity: None; Publications: 30443179, 16537395, 16537395; Phenotypes: Linked to Sinus Node Dysfunction, Linked to Atrial Fibrillation; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.381 SMARCAL1 Danielle Ariti reviewed gene: SMARCAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301550, 17089404, 20036229; Phenotypes: Schimke immune-osseous dysplasia MIM# 242900, T cell deficiency, Short stature, IUGR, spondyloepiphyseal dysplasia, growth retardation, renal dysfunction, lymphocytopaenia, nephropathy, bacterial/viral/fungal infections, may present as SCID, bone marrow failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mirror movements v0.5 NTN1 Bryony Thompson Marked gene: NTN1 as ready
Mirror movements v0.5 NTN1 Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence).
Mirror movements v0.5 NTN1 Bryony Thompson Classified gene: NTN1 as Green List (high evidence)
Mirror movements v0.5 NTN1 Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence).
Mirror movements v0.4 NTN1 Bryony Thompson gene: NTN1 was added
gene: NTN1 was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: NTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NTN1 were set to 25763452; 28945198; 33472083
Phenotypes for gene: NTN1 were set to Mirror movements 4 MIM#618264
Review for gene: NTN1 was set to GREEN
gene: NTN1 was marked as current diagnostic
Added comment: Two unrelated families and an unrelated proband with mirror movements. Also, a mouse model recapitulates the human phenotype.
Sources: Expert list
Repeat Disorders v0.123 HPE5 Zornitza Stark Tag paediatric-onset tag was added to STR: HPE5.
Repeat Disorders v0.123 HMNMYO Zornitza Stark Tag paediatric-onset tag was added to STR: HMNMYO.
Repeat Disorders v0.123 HFGS_tract3 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract3.
Repeat Disorders v0.123 HFGS_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract2.
Repeat Disorders v0.123 HFGS_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract1.
Repeat Disorders v0.123 HDL2 Zornitza Stark Tag adult-onset tag was added to STR: HDL2.
Repeat Disorders v0.123 HD Zornitza Stark Tag adult-onset tag was added to STR: HD.
Repeat Disorders v0.123 GDPAG Zornitza Stark Tag paediatric-onset tag was added to STR: GDPAG.
Repeat Disorders v0.123 FXTAS Zornitza Stark Tag adult-onset tag was added to STR: FXTAS.
Repeat Disorders v0.123 FXS Zornitza Stark Tag paediatric-onset tag was added to STR: FXS.
Repeat Disorders v0.123 FXPOI Zornitza Stark Tag adult-onset tag was added to STR: FXPOI.
Mirror movements v0.3 DCC Bryony Thompson Classified gene: DCC as Green List (high evidence)
Mirror movements v0.3 DCC Bryony Thompson Gene: dcc has been classified as Green List (High Evidence).
Mirror movements v0.2 DCC Bryony Thompson gene: DCC was added
gene: DCC was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: DCC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DCC were set to 20431009; 25763452; 28250454
Phenotypes for gene: DCC were set to Mirror movements 1 and/or agenesis of the corpus callosum MIM#157600
Review for gene: DCC was set to GREEN
gene: DCC was marked as current diagnostic
Added comment: Well-established and most common cause of congenital mirror movements. >20 cases reported.
Sources: Expert list
Mirror movements v0.1 Bryony Thompson Panel name changed from Osteoporosis to Mirror movements
Panel status changed from deleted to internal
Repeat Disorders v0.123 FTDALS Zornitza Stark Tag adult-onset tag was added to STR: FTDALS.
Repeat Disorders v0.123 FRDA Zornitza Stark Tag paediatric-onset tag was added to STR: FRDA.
Repeat Disorders v0.123 FRAXE Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXE.
Repeat Disorders v0.123 FECD3 Zornitza Stark Tag adult-onset tag was added to STR: FECD3.
Repeat Disorders v0.123 FAME3 Zornitza Stark Tag adult-onset tag was added to STR: FAME3.
Repeat Disorders v0.123 FAME2 Zornitza Stark Tag adult-onset tag was added to STR: FAME2.
Repeat Disorders v0.123 FAME1 Zornitza Stark Tag adult-onset tag was added to STR: FAME1.
Repeat Disorders v0.123 EPM1 Zornitza Stark Tag paediatric-onset tag was added to STR: EPM1.
Repeat Disorders v0.123 EIEE1_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract2.
Repeat Disorders v0.123 EIEE1_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract1.
Repeat Disorders v0.123 DRPLA Zornitza Stark Tag adult-onset tag was added to STR: DRPLA.
Tag paediatric-onset tag was added to STR: DRPLA.
Repeat Disorders v0.123 DM2 Zornitza Stark Tag adult-onset tag was added to STR: DM2.
Repeat Disorders v0.123 DM1 Zornitza Stark Tag adult-onset tag was added to STR: DM1.
Tag paediatric-onset tag was added to STR: DM1.
Repeat Disorders v0.123 DBQD2 Zornitza Stark Tag paediatric-onset tag was added to STR: DBQD2.
Repeat Disorders v0.123 CJD Zornitza Stark Tag adult-onset tag was added to STR: CJD.
Repeat Disorders v0.123 CCHS Zornitza Stark Tag paediatric-onset tag was added to STR: CCHS.
Repeat Disorders v0.123 CANVAS Zornitza Stark Tag adult-onset tag was added to STR: CANVAS.
Repeat Disorders v0.123 BPES Zornitza Stark Tag paediatric-onset tag was added to STR: BPES.
Growth failure v0.381 MSTO1 Zornitza Stark Marked gene: MSTO1 as ready
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.381 MSTO1 Zornitza Stark Classified gene: MSTO1 as Green List (high evidence)
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.380 MSTO1 Zornitza Stark reviewed gene: MSTO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28544275, 29339779, 30684668; Phenotypes: Myopathy, mitochondrial, and ataxia, MIM# 617675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9007 KCTD7 Zornitza Stark Marked gene: KCTD7 as ready
Mendeliome v0.9007 KCTD7 Zornitza Stark Gene: kctd7 has been classified as Green List (High Evidence).
Mendeliome v0.9007 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726)
Mendeliome v0.9006 KCTD7 Zornitza Stark Publications for gene: KCTD7 were set to
Mendeliome v0.9005 KCTD7 Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9004 KCTD7 Kristin Rigbye reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 22693283, 22748208; Phenotypes: Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.139 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Clefting disorders v0.138 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4092 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4091 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Genetic Epilepsy v0.1181 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Genetic Epilepsy v0.1180 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Mendeliome v0.9004 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Mendeliome v0.9003 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Growth failure v0.380 RPL10 Zornitza Stark Marked gene: RPL10 as ready
Growth failure v0.380 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Growth failure v0.380 RPL10 Zornitza Stark Phenotypes for gene: RPL10 were changed from Mental retardation, X-linked, syndromic, 35 to Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998; severe growth retardation; intrauterine growth restriction; short stature; dysmorphic facial features (prognathism, dental crowding, thin upper lip); microcephaly; seizures; hypotonia; genitourinary abnormalities; cerebellar hypoplasia
Growth failure v0.379 RPL10 Zornitza Stark Publications for gene: RPL10 were set to 25316788
Growth failure v0.378 RPL10 Zornitza Stark Classified gene: RPL10 as Green List (high evidence)
Growth failure v0.378 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Mendeliome v0.9003 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face; Brachydactyly, type B1 MIM# 113000; hypoplasia/aplasia of distal phalanges and nails (2-5)
Mendeliome v0.9002 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Mendeliome v0.9001 ROR2 Zornitza Stark Mode of inheritance for gene: ROR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9000 ROR2 Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.377 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Growth failure v0.377 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Growth failure v0.377 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face
Growth failure v0.376 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Growth failure v0.375 ROR2 Zornitza Stark Classified gene: ROR2 as Green List (high evidence)
Growth failure v0.375 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Mendeliome v0.9000 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Mendeliome v0.8999 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Mendeliome v0.8998 PROP1 Zornitza Stark Mode of inheritance for gene: PROP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 PROP1 Zornitza Stark reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.374 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Growth failure v0.374 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.374 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from Pituitary hormone deficiency, combined to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Growth failure v0.373 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Growth failure v0.372 PROP1 Zornitza Stark Classified gene: PROP1 as Green List (high evidence)
Growth failure v0.372 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Marked gene: PROKR2 as ready
Growth failure v0.371 PROKR2 Zornitza Stark Gene: prokr2 has been classified as Red List (Low Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Phenotypes for gene: PROKR2 were changed from hypopituitarism, Hypoplastic corpus callosum, normal or small anterior pituitary, Club foot, syrinx spinal cord, microcephaly, epilepsy to Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200; Kallmann syndrome (KS); normosmic idiopathic hypogonadotropic hypogonadism (nIHH); Anosmia; GnRH deficiency; cleft lip and palate; renal agenesis; Hypogonadotropic hypogonadism; low testosterone/ estradiol; Absent/ partial Puberty; Hearing loss
Growth failure v0.370 PROKR2 Zornitza Stark Publications for gene: PROKR2 were set to 22319038
Growth failure v0.369 PROKR2 Zornitza Stark Mode of inheritance for gene: PROKR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 RPL10 Danielle Ariti Deleted their comment
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti edited their review of gene: RPL10: Added comment: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; Changed phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, short stature, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, severe growth restriction (IUGR), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti reviewed gene: RPL10: Rating: GREEN; Mode of pathogenicity: None; Publications: 25316788, 25846674, 26290468; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature in early childhood is not a prominent feature; Changed rating: RED
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 ROR2 Danielle Ariti reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.368 PROP1 Danielle Ariti reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/ partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their review
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), Normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Marked gene: WRN as ready
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Cancer Predisposition_Paediatric v0.112 WRN Zornitza Stark Publications for gene: WRN were set to
Cancer Predisposition_Paediatric v0.111 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cancer Predisposition_Paediatric v0.110 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 WRN Zornitza Stark Marked gene: WRN as ready
Mendeliome v0.8997 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Mendeliome v0.8997 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Mendeliome v0.8996 WRN Zornitza Stark Publications for gene: WRN were set to
Mendeliome v0.8995 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8994 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 WRN Zornitza Stark Marked gene: WRN as ready
Growth failure v0.368 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.368 WRN Zornitza Stark Phenotypes for gene: WRN were changed from Werner syndrome to Werner syndrome, MIM# 277700; MONDO:0010196
Growth failure v0.367 WRN Zornitza Stark Publications for gene: WRN were set to
Growth failure v0.366 WRN Zornitza Stark Classified gene: WRN as Green List (high evidence)
Growth failure v0.366 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.365 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from Pituitary hormone deficiency, combined, 1 (613038) to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Pituitary hormone deficiency v0.16 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Pituitary hormone deficiency v0.15 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.148 CJD Bryony Thompson Marked STR: CJD as ready
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.148 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.147 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8994 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Mendeliome v0.8994 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8994 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Mendeliome v0.8993 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Mendeliome v0.8992 POU1F1 Zornitza Stark Mode of inheritance for gene: POU1F1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8991 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.146 Bryony Thompson removed STR:PRNP from the panel
Repeat Disorders v0.123 CJD Bryony Thompson Marked STR: CJD as ready
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.123 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.122 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8991 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Growth failure v0.365 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from GH, PRL deficiencies; variable degree of TSH deficiency to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Growth failure v0.364 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Growth failure v0.363 POU1F1 Zornitza Stark Classified gene: POU1F1 as Green List (high evidence)
Growth failure v0.363 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8991 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.363 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Regression. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Growth failure v0.362 POU1F1 Danielle Ariti reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Regression v0.362 NOP56 Bryony Thompson Classified gene: NOP56 as No list
Regression v0.362 NOP56 Bryony Thompson Added comment: Comment on list classification: STR expansion is the only reported cause of disease for this gene. An STR has been added to this panel under SCA36
Regression v0.362 NOP56 Bryony Thompson Gene: nop56 has been removed from the panel.
Mendeliome v0.8990 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Literature
Repeat Disorders v0.121 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.121 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.120 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Expert list
Mendeliome v0.8989 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Mendeliome v0.8989 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Mendeliome v0.8989 GIPC1 Bryony Thompson Classified gene: GIPC1 as No list
Mendeliome v0.8989 GIPC1 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under OPDM2
Mendeliome v0.8989 GIPC1 Bryony Thompson Gene: gipc1 has been removed from the panel.
Mendeliome v0.8988 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Mendeliome v0.8988 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Marked STR: FAME3 as ready
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Classified STR: FAME3 as Green List (high evidence)
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.118 FAME3 Bryony Thompson STR: FAME3 was added
STR: FAME3 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME3 were set to 31664039
Phenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: FAME3 was set to GREEN
STR: FAME3 was marked as clinically relevant
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Mendeliome v0.8987 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.85 BRWD3 chirag patel Classified gene: BRWD3 as Green List (high evidence)
Macrocephaly_Megalencephaly v0.85 BRWD3 chirag patel Gene: brwd3 has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.84 BRWD3 chirag patel gene: BRWD3 was added
gene: BRWD3 was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: BRWD3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: BRWD3 were set to PMID: 30628072, 24462886
Phenotypes for gene: BRWD3 were set to Intellectual developmental disorder, X-linked 93; OMIM # 300659
Review for gene: BRWD3 was set to GREEN
Added comment: 10 patients (from 6 unrelated families) with ID, macrocephaly and dysmorphic facial features.
Sources: Literature
Mendeliome v0.8986 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Mendeliome v0.8986 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Mendeliome v0.8986 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Overgrowth v1.4 BRWD3 chirag patel Classified gene: BRWD3 as Green List (high evidence)
Overgrowth v1.4 BRWD3 chirag patel Gene: brwd3 has been classified as Green List (High Evidence).
Overgrowth v1.3 BRWD3 chirag patel reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, OMIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1179 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Repeat Disorders v0.117 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.117 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.116 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.83 PPP2R5D chirag patel Classified gene: PPP2R5D as Green List (high evidence)
Macrocephaly_Megalencephaly v0.83 PPP2R5D chirag patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Overgrowth v1.3 PPP2R5D chirag patel Classified gene: PPP2R5D as Green List (high evidence)
Overgrowth v1.3 PPP2R5D chirag patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.82 PPP2R5D chirag patel gene: PPP2R5D was added
gene: PPP2R5D was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: PPP2R5D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5D were set to PMID: 26168268, 25972378, 25533962; 34448180
Phenotypes for gene: PPP2R5D were set to Mental retardation, autosomal dominant 35, MIM# 616355
Review for gene: PPP2R5D was set to GREEN
Added comment: Phenotype of macrocephaly is consistent, and multiple patients reported
Sources: Literature
Overgrowth v1.2 PPP2R5D chirag patel reviewed gene: PPP2R5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Repeat Disorders v0.115 FAME4 Bryony Thompson Marked STR: FAME4 as ready
Repeat Disorders v0.115 FAME4 Bryony Thompson Str: fame4 has been classified as Red List (Low Evidence).
Repeat Disorders v0.115 FAME4 Bryony Thompson STR: FAME4 was added
STR: FAME4 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME4 were set to 31539032
Phenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127
Review for STR: FAME4 was set to RED
Added comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease.
Sources: Literature
Repeat Disorders v0.114 OPML1 Bryony Thompson Marked STR: OPML1 as ready
Repeat Disorders v0.114 OPML1 Bryony Thompson Str: opml1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.114 OPML1 Bryony Thompson STR: OPML1 was added
STR: OPML1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPML1 were set to 31332380
Phenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637
Review for STR: OPML1 was set to RED
Added comment: NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Mendeliome v0.8985 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986; 24355708
Mendeliome v0.8984 PNPLA6 Zornitza Stark changed review comment from: Ataxia is part of the phenotype.
Sources: Expert list; to: Variants in this gene are associated with multiple phenotypes.

Oliver-McFarlane syndrome is a rare congenital disorder characterized by trichomegaly, severe chorioretinal atrophy and multiple pituitary hormone deficiencies, including growth hormone. At least 10 families reported.

Laurence-Moon syndrome has a clinical presentation similar to that of Oliver-McFarlane syndrome, including chorioretinopathy and pituitary dysfunction, but with childhood onset of ataxia, peripheral neuropathy, and spastic paraplegia and without trichomegaly. Single family reported.
Mendeliome v0.8984 PNPLA6 Zornitza Stark edited their review of gene: PNPLA6: Changed publications: 25480986, 33818269, 32758583, 30097146; Changed phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800
Growth failure v0.362 PNPLA6 Zornitza Stark Marked gene: PNPLA6 as ready
Growth failure v0.362 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.362 PNPLA6 Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Oliver-Mcfarlane syndrome, Trichomegaly, GH deficiency, retinal dystrophy, hypogonadotrophic hypogonadism to Oliver-McFarlane syndrome, MIM# 275400; Laurence-Moon syndrome, MIM# 245800
Growth failure v0.361 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986
Growth failure v0.360 PNPLA6 Zornitza Stark Classified gene: PNPLA6 as Green List (high evidence)
Growth failure v0.360 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.359 PNPLA6 Zornitza Stark reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480986, 33818269, 32758583, 30097146; Phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8984 PI4KA Zornitza Stark Phenotypes for gene: PI4KA were changed from Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531 to Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531; Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Mendeliome v0.8983 PI4KA Zornitza Stark Publications for gene: PI4KA were set to 25855803
Mendeliome v0.8982 PI4KA Zornitza Stark Classified gene: PI4KA as Green List (high evidence)
Mendeliome v0.8982 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Mendeliome v0.8981 PI4KA Zornitza Stark changed review comment from: Single family reported, aware of at least one other yet to be published family identified internally.; to: PMG: Single family reported, aware of at least one other yet to be published family identified internally.
Mendeliome v0.8981 PI4KA Zornitza Stark edited their review of gene: PI4KA: Added comment: Neurodevelopmental syndrome with hypomyelinating leukodystrophy: 10 unrelated patients harbouring biallelic variants in PI4KA reported with a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.; Changed rating: GREEN; Changed publications: 25855803, 34415322; Changed phenotypes: Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531, Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Hereditary Spastic Paraplegia v1.17 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Hereditary Spastic Paraplegia v1.17 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy v0.232 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Leukodystrophy v0.232 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.17 PI4KA chirag patel Classified gene: PI4KA as Green List (high evidence)
Hereditary Spastic Paraplegia v1.17 PI4KA chirag patel Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.16 PI4KA chirag patel gene: PI4KA was added
gene: PI4KA was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA chirag patel Classified gene: PI4KA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA chirag patel Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy v0.232 PI4KA chirag patel Classified gene: PI4KA as Green List (high evidence)
Leukodystrophy v0.232 PI4KA chirag patel Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4090 PI4KA chirag patel gene: PI4KA was added
gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Leukodystrophy v0.231 PI4KA chirag patel gene: PI4KA was added
gene: PI4KA was added to Leukodystrophy - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Repeat Disorders v0.113 OPDM1 Bryony Thompson Marked STR: OPDM1 as ready
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.113 OPDM1 Bryony Thompson Classified STR: OPDM1 as Green List (high evidence)
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.112 OPDM1 Bryony Thompson STR: OPDM1 was added
STR: OPDM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM1 were set to 31332380; 34047774
Phenotypes for STR: OPDM1 were set to Oculopharyngodistal myopathy 1 MIM#164310
Review for STR: OPDM1 was set to GREEN
STR: OPDM1 was marked as clinically relevant
Added comment: NM_013437.5:c.-102CGG[X]
RNA-mediated toxicity is thought to be the mechanism of disease. Sixty-five Japanese patients with oculopharyngodistal myopathy (OPDM) from 59 families with CGG repeat expansions in LRP12. This represents the most common OPDM subtype among all patients in Japan with genetically diagnosed OPDM.
Normal: 13 to 45 repeats.
Pathogenic: 85 to 289 repeats.
Sources: Expert list
Early-onset Dementia v0.145 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.145 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.144 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.143 Bryony Thompson removed STR:NIID from the panel
Hereditary Neuropathy v0.117 NIID Bryony Thompson Marked STR: NIID as ready
Hereditary Neuropathy v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy v0.117 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Hereditary Neuropathy v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy v0.116 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Hereditary Neuropathy - complex. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Hereditary Neuropathy v0.115 Bryony Thompson removed STR:NIID from the panel
Regression v0.361 NIID Bryony Thompson Marked STR: NIID as ready
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.361 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.360 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Regression. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Regression v0.359 Bryony Thompson removed STR:NIID from the panel
Mendeliome v0.8981 NIID Bryony Thompson Marked STR: NIID as ready
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8981 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8980 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Mendeliome v0.8979 Bryony Thompson removed STR:NIID from the panel
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.119 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Parkinson disease v0.118 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.111 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.111 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.110 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Expert list
Repeat Disorders v0.109 Bryony Thompson removed STR:NIID from the panel
Growth failure v0.359 PITX2 Zornitza Stark Marked gene: PITX2 as ready
Growth failure v0.359 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.359 PITX2 Zornitza Stark Phenotypes for gene: PITX2 were changed from AXENFELD-RIEGER SYNDROME to Axenfeld-Rieger syndrome, type 1, MIM# 180500
Growth failure v0.358 PITX2 Zornitza Stark Classified gene: PITX2 as Green List (high evidence)
Growth failure v0.358 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.357 PITX2 Zornitza Stark reviewed gene: PITX2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Axenfeld-Rieger syndrome, type 1, MIM# 180500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8978 SUCO Bryony Thompson Marked gene: SUCO as ready
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8978 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8977 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Literature
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Marked gene: SUCO as ready
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.62 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Classified gene: ANO5 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Gene: ano5 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.60 ANO5 Bryony Thompson gene: ANO5 was added
gene: ANO5 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: ANO5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANO5 were set to 30712070; 15124103; 30641283; 29175271
Phenotypes for gene: ANO5 were set to Gnathodiaphyseal dysplasia MIM#166260
Review for gene: ANO5 was set to GREEN
gene: ANO5 was marked as current diagnostic
Added comment: Bone fragility is a feature of the condition, which is an overlapping feature with OI and could be a differential diagnosis. >3 families/probands and a null mouse model reported.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Classified gene: XYLT2 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.58 XYLT2 Bryony Thompson gene: XYLT2 was added
gene: XYLT2 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: XYLT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: XYLT2 were set to 26027496; 26987875
Phenotypes for gene: XYLT2 were set to Spondyloocular syndrome MIM#605822
Review for gene: XYLT2 was set to GREEN
gene: XYLT2 was marked as current diagnostic
Added comment: Generalised osteoporosis and recurrent fractures are a feature of the condition, which overlaps with the OI phenotype. >3 families reported.
Sources: Expert list
Growth failure v0.357 OTX2 Zornitza Stark Marked gene: OTX2 as ready
Growth failure v0.357 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.357 OTX2 Zornitza Stark Phenotypes for gene: OTX2 were changed from Microcephaly, bilateral anopthalmia, developmental delay, cleft palate to Pituitary hormone deficiency, combined, 6, MIM# 613986; Microphthalmia, syndromic 5, MIM# 610125
Growth failure v0.356 OTX2 Zornitza Stark Publications for gene: OTX2 were set to 18728160
Growth failure v0.355 OTX2 Zornitza Stark Classified gene: OTX2 as Green List (high evidence)
Growth failure v0.355 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.354 OTX2 Zornitza Stark reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 18728160, 33950863, 15846561; Phenotypes: Pituitary hormone deficiency, combined, 6, MIM# 613986, Microphthalmia, syndromic 5, MIM# 610125; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.354 MCM5 Zornitza Stark Marked gene: MCM5 as ready
Growth failure v0.354 MCM5 Zornitza Stark Gene: mcm5 has been classified as Red List (Low Evidence).
Growth failure v0.354 MCM5 Zornitza Stark Phenotypes for gene: MCM5 were changed from ?Meier-Gorlin syndrome 8 to Meier-Gorlin syndrome 8 (MIM#617564)
Growth failure v0.353 MCM5 Zornitza Stark reviewed gene: MCM5: Rating: RED; Mode of pathogenicity: None; Publications: 28198391; Phenotypes: Meier-Gorlin syndrome 8 (MIM#617564); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.353 LIG1 Zornitza Stark Marked gene: LIG1 as ready
Growth failure v0.353 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.353 LIG1 Zornitza Stark Phenotypes for gene: LIG1 were changed from immunodeficiency, sun sensitivity, growth reatrdation to Combined immunodeficiency; Lymphopaenia; Hypogammaglobulinaemia; Recurrent bacterial and viral infections; Growth retardation; Sun sensitivity, radiation sensitivity; Macrocytosis
Growth failure v0.352 LIG1 Zornitza Stark Publications for gene: LIG1 were set to 1581963, 1351188
Growth failure v0.351 LIG1 Zornitza Stark Classified gene: LIG1 as Green List (high evidence)
Growth failure v0.351 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.350 LIG1 Zornitza Stark reviewed gene: LIG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30395541; Phenotypes: Combined immunodeficiency, Lymphopaenia, Hypogammaglobulinaemia, Recurrent bacterial and viral infections, Growth retardation, Sun sensitivity, radiation sensitivity, Macrocytosis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v0.57 WNT4 Bryony Thompson gene: WNT4 was added
gene: WNT4 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: WNT4 was set to Unknown
Publications for gene: WNT4 were set to 25108526; 26733379
Phenotypes for gene: WNT4 were set to Osteoporosis
Review for gene: WNT4 was set to RED
Added comment: Mouse model where recombinant Wnt4 alleviated bone loss and inflammation by inhibiting NF-κB in vivo in mouse models of bone disease. However, no reported association with Mendelian disease. A common SNP (rs10917157) has been associated with bone mineral density.
Sources: Expert list
Mirror movements v0.0 Bryony Thompson Panel deleted
Growth failure v0.350 LHX4 Zornitza Stark Marked gene: LHX4 as ready
Growth failure v0.350 LHX4 Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence).
Growth failure v0.350 LHX4 Zornitza Stark Phenotypes for gene: LHX4 were changed from hypopituitarism to Pituitary hormone deficiency, combined, 4, MIM# 262700
Growth failure v0.349 LHX4 Zornitza Stark Publications for gene: LHX4 were set to 11567216, 18073311
Growth failure v0.348 LHX4 Zornitza Stark Classified gene: LHX4 as Green List (high evidence)
Growth failure v0.348 LHX4 Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence).
Growth failure v0.347 LHX4 Zornitza Stark reviewed gene: LHX4: Rating: GREEN; Mode of pathogenicity: None; Publications: 11567216, 17527005, 18073311; Phenotypes: Pituitary hormone deficiency, combined, 4, MIM# 262700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.347 LHX3 Zornitza Stark Marked gene: LHX3 as ready
Growth failure v0.347 LHX3 Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence).
Growth failure v0.347 LHX3 Zornitza Stark Phenotypes for gene: LHX3 were changed from GH, TSH, LH, FSH, PRL deficiencies to Pituitary hormone deficiency, combined, 3, MIM# 221750
Growth failure v0.346 LHX3 Zornitza Stark Publications for gene: LHX3 were set to
Growth failure v0.345 LHX3 Zornitza Stark Classified gene: LHX3 as Green List (high evidence)
Growth failure v0.345 LHX3 Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence).
Growth failure v0.344 LHX3 Zornitza Stark reviewed gene: LHX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10835633, 16394081, 17327381, 18407919; Phenotypes: Pituitary hormone deficiency, combined, 3, MIM# 221750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.344 KHDC3L Zornitza Stark Marked gene: KHDC3L as ready
Growth failure v0.344 KHDC3L Zornitza Stark Gene: khdc3l has been classified as Red List (Low Evidence).
Growth failure v0.344 KHDC3L Zornitza Stark Phenotypes for gene: KHDC3L were changed from pregnancy loss; Hydatidiform mole, recurrent, 2 OMIM:614293; hydatidiform mole, recurrent, 2 MONDO:0013671; Failure to thrive; IUGR to Silver-Russell syndrome
Growth failure v0.343 KHDC3L Zornitza Stark Mode of inheritance for gene: KHDC3L was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.342 KHDC3L Zornitza Stark reviewed gene: KHDC3L: Rating: RED; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: Silver-Russell syndrome; Mode of inheritance: Other
Growth failure v0.342 Zornitza Stark removed gene:INTS8 from the panel
Growth failure v0.341 INSR Zornitza Stark Marked gene: INSR as ready
Growth failure v0.341 INSR Zornitza Stark Gene: insr has been classified as Green List (High Evidence).
Growth failure v0.341 INSR Zornitza Stark Phenotypes for gene: INSR were changed from Leprechaunism to Leprechaunism, MIM# 246200; Rabson-Mendenhall syndrome, MIM# 262190
Growth failure v0.340 INSR Zornitza Stark Publications for gene: INSR were set to
Growth failure v0.339 INSR Zornitza Stark Classified gene: INSR as Green List (high evidence)
Growth failure v0.339 INSR Zornitza Stark Gene: insr has been classified as Green List (High Evidence).
Growth failure v0.338 INSR Zornitza Stark reviewed gene: INSR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8105179, 7815442, 33995269, 33224016, 33048476, 2121734, 9449692; Phenotypes: Leprechaunism, MIM# 246200, Rabson-Mendenhall syndrome, MIM# 262190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Motor Neurone Disease v0.131 Bryony Thompson removed STR:NIID from the panel
Early-onset Dementia v0.142 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.142 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.141 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.140 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.108 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.108 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.107 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Marked STR: GDPAG as ready
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Classified STR: GDPAG as Green List (high evidence)
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.7 GDPAG Bryony Thompson STR: GDPAG was added
STR: GDPAG was added to Miscellaneous Metabolic Disorders. Sources: Literature
Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GDPAG were set to 30970188
Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GDPAG was set to GREEN
STR: GDPAG was marked as clinically relevant
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Literature
Repeat Disorders v0.106 GDPAG Bryony Thompson Marked STR: GDPAG as ready
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Repeat Disorders v0.106 GDPAG Bryony Thompson Classified STR: GDPAG as Green List (high evidence)
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.6 Bryony Thompson removed STR:GLS from the panel
Repeat Disorders v0.105 GDPAG Bryony Thompson STR: GDPAG was added
STR: GDPAG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GDPAG were set to 30970188
Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GDPAG was set to GREEN
STR: GDPAG was marked as clinically relevant
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Literature
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Marked STR: FAME1_TTTGA as ready
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Str: fame1_tttga has been classified as Red List (Low Evidence).
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson STR: FAME1_TTTGA was added
STR: FAME1_TTTGA was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME1_TTTGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME1_TTTGA were set to 31483537
Phenotypes for STR: FAME1_TTTGA were set to familial cortical myoclonic tremor with epilepsy
Review for STR: FAME1_TTTGA was set to RED
Added comment: A single family with 2 cases and 1 asymptomatic carrier with the repeat allele (TTTTA)114-123 (TTTGA)108-116, instead of the TTTCA FAME1 repeat.
Sources: Literature
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Classified STR: CANVAS_ACAGG as Amber List (moderate evidence)
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Added comment: Comment on list classification: Used the pathogenic cut-off of 400 repeats from original CANVAS repeat
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.102 CANVAS_ACAGG Bryony Thompson STR: CANVAS_ACAGG was added
STR: CANVAS_ACAGG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: CANVAS_ACAGG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS_ACAGG were set to 33237689; 32694621; 33103729
Phenotypes for STR: CANVAS_ACAGG were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome; fasciculations; elevated serum creatine kinase levels; denervation
Review for STR: CANVAS_ACAGG was set to AMBER
Added comment: A novel RFC1 repeat expansion motif, (ACAGG)exp, identified in three affected individuals from 2 families in an Asian-Pacific cohort and one Japanese individual for CANVAS. Southern blot was used to identify the repeat was ~1000kb in one of the cases, equivalent to ~1000 repeats.
Sources: Literature
Repeat Disorders v0.101 CANVAS Bryony Thompson Marked STR: CANVAS as ready
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.101 CANVAS Bryony Thompson Classified STR: CANVAS as Green List (high evidence)
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.100 CANVAS Bryony Thompson STR: CANVAS was added
STR: CANVAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS were set to 30926972; 32851396; 33237689; 31230722
Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575
Review for STR: CANVAS was set to GREEN
STR: CANVAS was marked as clinically relevant
Added comment: NM_001204747​.1:c.132+2923_2927AAAAG[X]
Simple tandem repeat (AAAAG)n replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Maori population-specific CANVAS configuration (AAAGG)10-25(AAGGG)exp. (AAAGG)n repeat alone is not pathogenic. Mechanism of disease is unknown.
Normal: AAAAG 11 repeats (allele frequency = 0.75); AAAAG 12-200 (allele frequency = 0.13); AAAGG 40-1000 (allele frequency = 0.08)
Pathogenic: AAGGG repeat expansion, most frequently ranging from 400 to more than 2000 repeats (allele frequency = 0.01-0.04)
Sources: Expert list
Mendeliome v0.8976 IGFALS Zornitza Stark Marked gene: IGFALS as ready
Mendeliome v0.8976 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Mendeliome v0.8976 IGFALS Zornitza Stark Phenotypes for gene: IGFALS were changed from to Acid-labile subunit, deficiency of, MIM# 615961
Mendeliome v0.8975 IGFALS Zornitza Stark Publications for gene: IGFALS were set to
Repeat Disorders v0.99 DBQD2 Bryony Thompson Marked STR: DBQD2 as ready
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.99 DBQD2 Bryony Thompson Classified STR: DBQD2 as Green List (high evidence)
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.98 DBQD2 Bryony Thompson STR: DBQD2 was added
STR: DBQD2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DBQD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: DBQD2 were set to 30554721
Phenotypes for STR: DBQD2 were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: DBQD2 was set to GREEN
STR: DBQD2 was marked as clinically relevant
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Expert list
Mendeliome v0.8974 IGFALS Zornitza Stark Mode of inheritance for gene: IGFALS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8973 IGFALS Zornitza Stark reviewed gene: IGFALS: Rating: GREEN; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.338 IGFALS Zornitza Stark Marked gene: IGFALS as ready
Growth failure v0.338 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Growth failure v0.338 IGFALS Zornitza Stark Phenotypes for gene: IGFALS were changed from very low IGF-I levels; Short stature; delayed puberty to Acid-labile subunit, deficiency of, MIM# 615961
Growth failure v0.337 IGFALS Zornitza Stark Publications for gene: IGFALS were set to 14762184
Growth failure v0.336 IGFALS Zornitza Stark Classified gene: IGFALS as Green List (high evidence)
Growth failure v0.336 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Growth failure v0.335 IGFALS Zornitza Stark edited their review of gene: IGFALS: Changed rating: GREEN
Growth failure v0.335 IGFALS Zornitza Stark reviewed gene: IGFALS: Rating: ; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.335 IFT172 Zornitza Stark Marked gene: IFT172 as ready
Growth failure v0.335 IFT172 Zornitza Stark Gene: ift172 has been classified as Red List (Low Evidence).
Growth failure v0.335 IFT172 Zornitza Stark reviewed gene: IFT172: Rating: RED; Mode of pathogenicity: None; Publications: 25664603; Phenotypes: GH deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.335 SAMD9 Zornitza Stark Marked gene: SAMD9 as ready
Growth failure v0.335 SAMD9 Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence).
Growth failure v0.335 SAMD9 Zornitza Stark Classified gene: SAMD9 as Green List (high evidence)
Growth failure v0.335 SAMD9 Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence).
Growth failure v0.334 SAMD9 Zornitza Stark reviewed gene: SAMD9: Rating: GREEN; Mode of pathogenicity: None; Publications: 27182967; Phenotypes: MIRAGE syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Repeat Disorders v0.97 FAME7 Bryony Thompson Marked STR: FAME7 as ready
Repeat Disorders v0.97 FAME7 Bryony Thompson Str: fame7 has been classified as Red List (Low Evidence).
Repeat Disorders v0.97 FAME7 Bryony Thompson STR: FAME7 was added
STR: FAME7 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME7 were set to 29507423
Phenotypes for STR: FAME7 were set to Epilepsy, familial adult myoclonic, 7 MIM#618075
Review for STR: FAME7 was set to RED
Added comment: The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Repeat Disorders v0.96 FAME6 Bryony Thompson Marked STR: FAME6 as ready
Repeat Disorders v0.96 FAME6 Bryony Thompson Str: fame6 has been classified as Red List (Low Evidence).
Repeat Disorders v0.96 FAME6 Bryony Thompson STR: FAME6 was added
STR: FAME6 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME6 were set to 29507423
Phenotypes for STR: FAME6 were set to Epilepsy, familial adult myoclonic, 6 MIM#618074
Review for STR: FAME6 was set to RED
Added comment: The expanded (TTTTA)22(TTTCA)exp(TTTTA)exp allele was identified 5 affected carriers in a single family. (TTTTA)18 is the reference repeats. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Incidentalome v0.78 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Incidentalome v0.78 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Incidentalome v0.78 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Incidentalome v0.78 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Incidentalome v0.77 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Incidentalome. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Incidentalome v0.76 C9orf72 Bryony Thompson Classified gene: C9orf72 as No list
Incidentalome v0.76 C9orf72 Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FTDALS
Incidentalome v0.76 C9orf72 Bryony Thompson Gene: c9orf72 has been removed from the panel.
Mendeliome v0.8973 FAME1 Bryony Thompson Marked STR: FAME1 as ready
Mendeliome v0.8973 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Mendeliome v0.8973 FAME1 Bryony Thompson Classified STR: FAME1 as Green List (high evidence)
Mendeliome v0.8973 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Mendeliome v0.8972 FAME1 Bryony Thompson STR: FAME1 was added
STR: FAME1 was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for STR: FAME1 were set to 30194086; 29507423
Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068
Review for STR: FAME1 was set to GREEN
STR: FAME1 was marked as clinically relevant
Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Mendeliome v0.8971 SAMD12 Bryony Thompson Classified gene: SAMD12 as No list
Mendeliome v0.8971 SAMD12 Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FAME1.
Mendeliome v0.8971 SAMD12 Bryony Thompson Gene: samd12 has been removed from the panel.
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Classified gene: SAMD12 as No list
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel.
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Gene: samd12 has been removed from the panel.
Repeat Disorders v0.95 FAME1 Bryony Thompson changed review comment from: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list; to: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Repeat Disorders v0.95 FAME1 Bryony Thompson Marked STR: FAME1 as ready
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.95 FAME1 Bryony Thompson Classified STR: FAME1 as Green List (high evidence)
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.94 FAME1 Bryony Thompson STR: FAME1 was added
STR: FAME1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for STR: FAME1 were set to 30194086; 29507423
Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068
Review for STR: FAME1 was set to GREEN
STR: FAME1 was marked as clinically relevant
Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Growth failure v0.334 HESX1 Zornitza Stark Marked gene: HESX1 as ready
Growth failure v0.334 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Growth failure v0.334 HESX1 Zornitza Stark Phenotypes for gene: HESX1 were changed from Septo-optic dysplasia; variable involvement of pituitary hormones to Septooptic dysplasia, MIM# 182230; Growth hormone deficiency with pituitary anomalies, MIM#182230
Growth failure v0.333 HESX1 Zornitza Stark Publications for gene: HESX1 were set to
Growth failure v0.332 HESX1 Zornitza Stark Classified gene: HESX1 as Green List (high evidence)
Growth failure v0.332 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Growth failure v0.331 HESX1 Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14561704, 26781211, 11136712, 16940453; Phenotypes: Septooptic dysplasia, MIM# 182230, Growth hormone deficiency with pituitary anomalies, MIM#182230; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.331 H19 Zornitza Stark Marked gene: H19 as ready
Growth failure v0.331 H19 Zornitza Stark Gene: h19 has been classified as Red List (Low Evidence).
Growth failure v0.331 H19 Zornitza Stark Phenotypes for gene: H19 were changed from Russell-Silver syndrome to Silver-Russell syndrome, MIM# 180860
Growth failure v0.330 H19 Zornitza Stark Mode of inheritance for gene: H19 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Growth failure v0.329 H19 Zornitza Stark reviewed gene: H19: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Silver-Russell syndrome, MIM# 180860; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Growth failure v0.329 GPR161 Zornitza Stark Marked gene: GPR161 as ready
Growth failure v0.329 GPR161 Zornitza Stark Gene: gpr161 has been classified as Red List (Low Evidence).
Growth failure v0.329 GPR161 Zornitza Stark Phenotypes for gene: GPR161 were changed from Short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk to Pituitary stalk interruption syndrome
Growth failure v0.328 GPR161 Zornitza Stark changed review comment from: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk.; to: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyly. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk.
Growth failure v0.328 GPR161 Zornitza Stark reviewed gene: GPR161: Rating: RED; Mode of pathogenicity: None; Publications: 25322266; Phenotypes: Pituitary stalk interruption syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.319 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Callosome v0.319 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Callosome v0.318 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Callosome v0.317 Bryony Thompson removed STR:DAB1 from the panel
Callosome v0.316 SCA10 Bryony Thompson Marked STR: SCA10 as ready
Callosome v0.316 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Callosome v0.316 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Callosome v0.316 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Callosome v0.315 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354; 11017075
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
Review for STR: SCA10 was set to GREEN
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Callosome v0.314 ATXN10 Bryony Thompson Classified gene: ATXN10 as No list
Callosome v0.314 ATXN10 Bryony Thompson Added comment: Comment on list classification: STR is the only reported cause of disease. Added as an STR to the panel.
Callosome v0.314 ATXN10 Bryony Thompson Gene: atxn10 has been removed from the panel.
Repeat Disorders v0.93 SPD1 Bryony Thompson Marked STR: SPD1 as ready
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.93 SPD1 Bryony Thompson Classified STR: SPD1 as Green List (high evidence)
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.92 SPD1 Bryony Thompson STR: SPD1 was added
STR: SPD1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SPD1 were set to 8817328; 33811808; 33533119
Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000
Review for STR: SPD1 was set to GREEN
STR: SPD1 was marked as clinically relevant
Added comment: NM_000523.4(HOXD13):c.212_213GCG[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
Normal repeat number: 15
Pathogenic repeat number: 24
Truncation of repeat also reported
Sources: Expert list
Repeat Disorders v0.91 Bryony Thompson removed STR:SPD1 from the panel
Callosome v0.313 DAB1 Bryony Thompson Marked STR: DAB1 as ready
Callosome v0.313 DAB1 Bryony Thompson Str: dab1 has been classified as Green List (High Evidence).
Callosome v0.313 DAB1 Bryony Thompson Classified STR: DAB1 as Green List (high evidence)
Callosome v0.313 DAB1 Bryony Thompson Str: dab1 has been classified as Green List (High Evidence).
Callosome v0.312 DAB1 Bryony Thompson STR: DAB1 was added
STR: DAB1 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: DAB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DAB1 were set to 28686858; 31145571
Phenotypes for STR: DAB1 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: DAB1 was set to GREEN
STR: DAB1 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Repeat Disorders v0.90 SCA37 Bryony Thompson Marked STR: SCA37 as ready
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.90 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.89 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Callosome v0.311 DAB1 Bryony Thompson Classified gene: DAB1 as No list
Callosome v0.311 DAB1 Bryony Thompson Added comment: Comment on list classification: STR expansion is the mechanism of disease for this gene. It has been added as an STR to this panel.
Callosome v0.311 DAB1 Bryony Thompson Gene: dab1 has been removed from the panel.
Repeat Disorders v0.88 XDP Bryony Thompson changed review comment from: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list; to: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within intron 32. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Repeat Disorders v0.88 XDP Bryony Thompson Marked STR: XDP as ready
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Classified gene: TAF1 as No list
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Added comment: Comment on list classification: Added as an STR to the panel
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Gene: taf1 has been removed from the panel.
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Marked STR: XDP as ready
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.115 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Early-onset Parkinson disease. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Growth failure v0.328 GLI3 Zornitza Stark Marked gene: GLI3 as ready
Growth failure v0.328 GLI3 Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence).
Growth failure v0.328 GLI3 Zornitza Stark Phenotypes for gene: GLI3 were changed from Pallister-Hall syndrome to Pallister-Hall syndrome, MIM# 146510
Growth failure v0.327 GLI3 Zornitza Stark Publications for gene: GLI3 were set to 9054938
Growth failure v0.326 GLI3 Zornitza Stark Classified gene: GLI3 as Green List (high evidence)
Growth failure v0.326 GLI3 Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence).
Growth failure v0.325 GLI3 Zornitza Stark reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9054938, 10945658, 11693785; Phenotypes: Pallister-Hall syndrome, MIM# 146510; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.325 TRIM37 Zornitza Stark Marked gene: TRIM37 as ready
Growth failure v0.325 TRIM37 Zornitza Stark Gene: trim37 has been classified as Green List (High Evidence).
Growth failure v0.325 TRIM37 Zornitza Stark Phenotypes for gene: TRIM37 were changed from Mulibrey nanism; Mulibery Nanism, 253250 to Mulibery nanism, MIM#253250
Growth failure v0.324 TRIM37 Zornitza Stark Publications for gene: TRIM37 were set to
Repeat Disorders v0.88 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Repeat Disorders v0.87 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Repeat Disorders. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Marked STR: FECD3 as ready
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Classified STR: FECD3 as Green List (high evidence)
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Corneal Dystrophy v1.4 FECD3 Bryony Thompson STR: FECD3 was added
STR: FECD3 was added to Corneal Dystrophy. Sources: Expert list
Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FECD3 were set to 25722209; 24255041
Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267
Review for STR: FECD3 was set to GREEN
STR: FECD3 was marked as clinically relevant
Added comment: NG_011716.2:g.54765TGC[X]
Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance.
Normal: 5-31 repeats
Pathogenic: >50 repeats
Sources: Expert list
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Classified gene: TCF4 as No list
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel.
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Gene: tcf4 has been removed from the panel.
Repeat Disorders v0.86 FECD3 Bryony Thompson Marked STR: FECD3 as ready
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.86 FECD3 Bryony Thompson Classified STR: FECD3 as Green List (high evidence)
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.85 FECD3 Bryony Thompson STR: FECD3 was added
STR: FECD3 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FECD3 were set to 25722209; 24255041
Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267
Review for STR: FECD3 was set to GREEN
STR: FECD3 was marked as clinically relevant
Added comment: NG_011716.2:g.54765TGC[X]
Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance.
Normal: 5-31 repeats
Pathogenic: >50 repeats
Sources: Expert list
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Dystonia and Chorea v0.191 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 26166205; 24363131; 26187722; 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Dystonia and Chorea v0.190 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.113 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778; 31779815
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Parkinson disease v0.112 Bryony Thompson removed STR:C9orf72 from the panel
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.129 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Motor Neurone Disease. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.139 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.128 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Dementia v0.139 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Dementia v0.138 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.137 Bryony Thompson removed STR:C9orf72 from the panel
Repeat Disorders v0.84 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.84 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.83 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Repeat Disorders v0.82 SCA12 Bryony Thompson Publications for STR: SCA12 were set to 27864267; 33811808
Repeat Disorders v0.81 SCA12 Bryony Thompson edited their review of STR: SCA12: Changed publications: 27864267, 33811808, 10581021
Repeat Disorders v0.81 SCA8 Bryony Thompson Publications for STR: SCA8 were set to 20301445
Repeat Disorders v0.80 SCA8 Bryony Thompson edited their review of STR: SCA8: Changed publications: 20301445, 10192387
Repeat Disorders v0.80 FXPOI Bryony Thompson Publications for STR: FXPOI were set to 20301558
Repeat Disorders v0.79 FXPOI Bryony Thompson edited their review of STR: FXPOI: Changed publications: 20301558, 9647544
Repeat Disorders v0.79 EPM1 Bryony Thompson Publications for STR: EPM1 were set to 29325606; 20301321
Repeat Disorders v0.78 EPM1 Bryony Thompson edited their review of STR: EPM1: Changed publications: 29325606, 20301321, 9126745
Repeat Disorders v0.78 FRDA Bryony Thompson Publications for STR: FRDA were set to 20301458
Repeat Disorders v0.77 FRDA Bryony Thompson edited their review of STR: FRDA: Changed publications: 20301458, 8596916
Repeat Disorders v0.77 DM1 Bryony Thompson Publications for STR: DM1 were set to 20301344; 29325606
Repeat Disorders v0.76 DM1 Bryony Thompson edited their review of STR: DM1: Changed publications: 20301344, 29325606, 1546325
Repeat Disorders v0.76 FXS Bryony Thompson Publications for STR: FXS were set to 33795824; 25227148
Repeat Disorders v0.75 FXS Bryony Thompson edited their review of STR: FXS: Changed publications: 33795824, 25227148, 1710175, 2031184
Mendeliome v0.8970 SCA36 Bryony Thompson Publications for STR: SCA36 were set to 25101480
Mendeliome v0.8969 SCA36 Bryony Thompson edited their review of STR: SCA36: Changed publications: 21683323
Repeat Disorders v0.75 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.75 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.74 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Early-onset Parkinson disease v0.111 PSAP Zornitza Stark Phenotypes for gene: PSAP were changed from Parkinson Disease, AD to Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491
Early-onset Parkinson disease v0.110 PSAP Zornitza Stark reviewed gene: PSAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491; Mode of inheritance: None
Mirror movements v0.0 Bryony Thompson Added Panel Osteoporosis
Set panel types to: Royal Melbourne Hospital; Rare Disease
Mendeliome v0.8969 MYO1H Zornitza Stark Marked gene: MYO1H as ready
Mendeliome v0.8969 MYO1H Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence).
Mendeliome v0.8969 MYO1H Zornitza Stark gene: MYO1H was added
gene: MYO1H was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO1H were set to 28779001
Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482
Review for gene: MYO1H was set to RED
Added comment: Single family reported with three affected children, homozygous LoF variant.
Sources: Literature
Central Hypoventilation v1.1 MYO1H Zornitza Stark Marked gene: MYO1H as ready
Central Hypoventilation v1.1 MYO1H Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence).
Central Hypoventilation v1.1 MYO1H Zornitza Stark gene: MYO1H was added
gene: MYO1H was added to Central Hypoventilation. Sources: Literature
Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO1H were set to 28779001
Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482
Review for gene: MYO1H was set to RED
Added comment: Single family reported with three affected children, homozygous LoF variant.
Sources: Literature
Repeat Disorders v0.73 SCA31 Bryony Thompson Marked STR: SCA31 as ready
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.73 SCA31 Bryony Thompson Classified STR: SCA31 as Green List (high evidence)
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.72 SCA31 Bryony Thompson STR: SCA31 was added
STR: SCA31 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA31 were set to 19878914; 31755042
Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210
Review for STR: SCA31 was set to GREEN
STR: SCA31 was marked as clinically relevant
Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested.
2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease
Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042)
Sources: Expert list
Repeat Disorders v0.71 FXTAS Bryony Thompson Marked STR: FXTAS as ready
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.71 FXTAS Bryony Thompson Classified STR: FXTAS as Green List (high evidence)
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.70 FXTAS Bryony Thompson STR: FXTAS was added
STR: FXTAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXTAS were set to 23765048; 25227148; 11445641
Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623
Review for STR: FXTAS was set to GREEN
STR: FXTAS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Expert list
Repeat Disorders v0.69 DM2 Bryony Thompson Marked STR: DM2 as ready
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.69 DM2 Bryony Thompson Classified STR: DM2 as Green List (high evidence)
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.68 DM2 Bryony Thompson STR: DM2 was added
STR: DM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM2 were set to 20301639; 11486088
Phenotypes for STR: DM2 were set to Myotonic dystrophy 2 MIM#602668
Review for STR: DM2 was set to GREEN
STR: DM2 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X]
Toxic gain of function RNA expected mechanism of disease
Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions
Unknown significance (normal vs. mutable): 27-29 CCTG repeats
Mutable normal (premutation) alleles. ~30-~54 CCTG repeats
Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats
Pathogenic: ~75-11,000 CCTG repeats
Sources: Expert list
Repeat Disorders v0.67 SCA10 Bryony Thompson Marked STR: SCA10 as ready
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.67 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.66 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354; 11017075
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
Review for STR: SCA10 was set to GREEN
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Marked gene: FBXW7 as ready
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Phenotypes for gene: FBXW7 were changed from to Predisposition to cancer
Cancer Predisposition_Paediatric v0.109 FBXW7 Zornitza Stark Classified gene: FBXW7 as Green List (high evidence)
Cancer Predisposition_Paediatric v0.109 FBXW7 Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Marked gene: BLM as ready
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies
Cancer Predisposition_Paediatric v0.107 BLM Zornitza Stark Publications for gene: BLM were set to
Cancer Predisposition_Paediatric v0.106 BLM Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cancer Predisposition_Paediatric v0.105 BLM Zornitza Stark reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8968 BLM Zornitza Stark Marked gene: BLM as ready
Mendeliome v0.8968 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Mendeliome v0.8968 BLM Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies
Mendeliome v0.8967 BLM Zornitza Stark Publications for gene: BLM were set to
Mendeliome v0.8966 BLM Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8965 PRKDC Zornitza Stark Marked gene: PRKDC as ready
Mendeliome v0.8965 PRKDC Zornitza Stark Gene: prkdc has been classified as Green List (High Evidence).
Mendeliome v0.8965 PRKDC Zornitza Stark Phenotypes for gene: PRKDC were changed from to Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966; Absent T and B cells; normal NK cells; SCID; recurrent respiratory infections; microcephaly; seizures; developmental delay
Mendeliome v0.8964 PRKDC Zornitza Stark Publications for gene: PRKDC were set to
Mendeliome v0.8963 PRKDC Zornitza Stark Mode of inheritance for gene: PRKDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8962 PRKDC Zornitza Stark reviewed gene: PRKDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 19075392, 23722905; Phenotypes: Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966, Absent T and B cells, normal NK cells, SCID, recurrent respiratory infections, microcephaly, seizures, developmental delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v1.0 Zornitza Stark promoted panel to version 1.0
Combined Immunodeficiency v0.394 WAS Zornitza Stark Marked gene: WAS as ready
Combined Immunodeficiency v0.394 WAS Zornitza Stark Gene: was has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.394 WAS Zornitza Stark Phenotypes for gene: WAS were changed from to Neutropaenia, severe congenital, X-linked MIM# 300299; Wiskott-Aldrich syndrome MIM# 301000; Thrombocytopaenia, X-linked MIM# 313900
Combined Immunodeficiency v0.393 WAS Zornitza Stark Publications for gene: WAS were set to
Combined Immunodeficiency v0.392 WAS Zornitza Stark Mode of pathogenicity for gene: WAS was changed from to Other
Combined Immunodeficiency v0.391 WAS Zornitza Stark Mode of inheritance for gene: WAS was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8962 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Mendeliome v0.8962 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Mendeliome v0.8962 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity
Mendeliome v0.8961 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Mendeliome v0.8960 TBX1 Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8959 TBX1 Zornitza Stark Tag SV/CNV tag was added to gene: TBX1.
Mendeliome v0.8959 TBX1 Zornitza Stark reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Tag SV/CNV tag was added to gene: TBX1.
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity
Combined Immunodeficiency v0.389 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Combined Immunodeficiency v0.388 TBX1 Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8959 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Mendeliome v0.8959 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Mendeliome v0.8959 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373
Mendeliome v0.8958 RTEL1 Zornitza Stark Publications for gene: RTEL1 were set to
Mendeliome v0.8957 RTEL1 Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8956 RTEL1 Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373
Combined Immunodeficiency v0.386 RTEL1 Zornitza Stark Publications for gene: RTEL1 were set to
Combined Immunodeficiency v0.385 RTEL1 Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8956 RMRP Zornitza Stark changed review comment from: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models

Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function.
*Founder variant g.70A>G (Amish and Finnish populations)

CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency.; to: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models

Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function.
*Founder variant g.70A>G (Amish and Finnish populations)

CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency.

Anauxetic dysplasia 1, MIM# 607095 is a more severe phenotype, whereas Metaphyseal dysplasia without hypotrichosis, MIM# 250460 is milder.
Mendeliome v0.8956 RMRP Zornitza Stark edited their review of gene: RMRP: Changed publications: 16244706, 21396580, 22420014, 11940090, 16252239
Mendeliome v0.8956 RMRP Zornitza Stark edited their review of gene: RMRP: Changed phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, Anauxetic dysplasia 1, MIM# 607095, Metaphyseal dysplasia without hypotrichosis, MIM# 250460
Mendeliome v0.8956 RMRP Zornitza Stark Marked gene: RMRP as ready
Mendeliome v0.8956 RMRP Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence).
Mendeliome v0.8956 RMRP Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage-hair hypoplasia MIM#250250
Mendeliome v0.8955 RMRP Zornitza Stark Publications for gene: RMRP were set to
Mendeliome v0.8954 RMRP Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8953 RMRP Zornitza Stark reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Marked gene: RMRP as ready
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage hair hypoplasia (CHH) MIM#250250; shortened limbs; short stature; metaphysical dysplasia; fine, sparse and/or light-coloured hair; hematologic abnormalities; CID; impaired lymphocyte proliferation; low Ig levels; antibodies variably decreased; bone marrow failure; autoimmunity; susceptibility to lymphoma and other cancers; impaired spermatogenesis; neuronal dysplasia of the intestine
Combined Immunodeficiency v0.383 RMRP Zornitza Stark Publications for gene: RMRP were set to
Combined Immunodeficiency v0.382 RMRP Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8953 BLM Danielle Ariti reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.28 IL7R Danielle Ariti reviewed gene: IL7R: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843216, 19890784, 26123418, 11023514, 7964471; Phenotypes: Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type MIM# 608971, low T-cell numbers, normal-high B and NK-cell numbers, fever, rash, failure to thrive, recurrent respiratory and gastric infections, Hepatomegaly, Splenomegaly, diarrhoea, lymphadenopathy, pneumonitis, Pancytopaenia, decreased immunoglobulins; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.381 LIG4 Danielle Ariti edited their review of gene: LIG4: Changed phenotypes: LIG4 syndrome MIM# 606593, T-/B- lymphocytopaenia, Normal NK, radiation sensitivity, Microcephaly, low/ absent B and T cells, low Ig, raised IgM, failure to thrive, bacterial/viral/fungal infections, hypogammaglobulinaemia, neurodevelopmental delay, microcephaly, pancytopaenia
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 11242109, 11047757, 29855039, 15833888, 28993958, 15577852; Phenotypes: Ectodermal dysplasia and immunodeficiency 1 MIM# 300291, Immunodeficiency 33 MIM# 300636; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti Deleted their review
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti edited their review of gene: IKBKG: Added comment: Ectodermal dysplasia with immunodeficiency
Over 12 families have been identified with IKBKG variants
Individuals typically present within the first year of life with recurrent infections (pneumonia, bacterial infections of the bone and soft tissue), elevated IgM and ectodermal dysplasia features (sparse scalp and body hair, reduced ability to sweat, and conical teeth)
------
Immunodeficiency-33 and no ectodermal dysplasia
10 unrelated individuals been reported with IKBKG variants
Characterised by early-onset severe infections, hypogammaglobulinaemia, decreased IgG and impaired antibody response to multiple vaccinations.
-------
Multiple null IKBKG mouse models demonstrating both disease phenotypes AND
Hemizygous (insertion, slice site, deletion and missense) variants have been reported in association with both diseases, causing premature stop codons; most common variants are splice-site; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.381 CD40LG Danielle Ariti changed review comment from: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome.
Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119)

Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF.

Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections.; to: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome.
Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119)

Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF.

Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections.
Combined Immunodeficiency v0.381 WAS Danielle Ariti reviewed gene: WAS: Rating: GREEN; Mode of pathogenicity: Other; Publications: 11242115, 19006568, 16804117, 8069912, 10575547, 7579329, 7795648, 23807894; Phenotypes: Neutropenia, severe congenital, X-linked MIM# 300299, Wiskott-Aldrich syndrome MIM# 301000, Thrombocytopenia, X-linked MIM# 313900; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.8953 RFX5 Zornitza Stark Marked gene: RFX5 as ready
Mendeliome v0.8953 RFX5 Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence).
Mendeliome v0.8953 RFX5 Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920
Mendeliome v0.8952 RFX5 Zornitza Stark Publications for gene: RFX5 were set to
Mendeliome v0.8951 RFX5 Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8950 RFX5 Zornitza Stark reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Marked gene: RFX5 as ready
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920
Combined Immunodeficiency v0.380 RFX5 Zornitza Stark Publications for gene: RFX5 were set to
Combined Immunodeficiency v0.379 RFX5 Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 TBX1 Danielle Ariti changed review comment from: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models

Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc).

Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients.; to: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models

Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc).

Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients.
Combined Immunodeficiency v0.378 TBX1 Danielle Ariti reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.378 RTEL1 Danielle Ariti reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RMRP Danielle Ariti reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RFX5 Danielle Ariti reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Deafness_IsolatedAndComplex v1.90 ELMOD3 Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500
Deafness_IsolatedAndComplex v1.89 ELMOD3 Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500
Mendeliome v0.8950 ELMOD3 Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500
Mendeliome v0.8949 ELMOD3 Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Marked gene: TYK2 as ready
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence).
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521
Defects of intrinsic and innate immunity v0.79 TYK2 Zornitza Stark Publications for gene: TYK2 were set to
Defects of intrinsic and innate immunity v0.78 TYK2 Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Defects of intrinsic and innate immunity v0.77 TYK2 Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8949 TYK2 Zornitza Stark Marked gene: TYK2 as ready
Mendeliome v0.8949 TYK2 Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence).
Mendeliome v0.8949 TYK2 Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521
Mendeliome v0.8948 TYK2 Zornitza Stark Publications for gene: TYK2 were set to
Mendeliome v0.8947 TYK2 Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8946 TYK2 Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8946 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Mendeliome v0.8946 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Mendeliome v0.8946 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Mendeliome v0.8945 RAG1 Zornitza Stark Publications for gene: RAG1 were set to
Mendeliome v0.8944 RAG1 Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8943 RAG2 Zornitza Stark Marked gene: RAG2 as ready
Mendeliome v0.8943 RAG2 Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence).
Mendeliome v0.8943 RAG2 Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650
Mendeliome v0.8942 RAG2 Zornitza Stark Publications for gene: RAG2 were set to
Mendeliome v0.8941 RAG2 Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4089 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Intellectual disability syndromic and non-syndromic v0.4088 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Mendeliome v0.8940 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Mendeliome v0.8939 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Congenital Disorders of Glycosylation v1.17 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Congenital Disorders of Glycosylation v1.16 EDEM3 Zornitza Stark edited their review of gene: EDEM3: Changed rating: GREEN
Congenital Disorders of Glycosylation v1.16 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Mendeliome v0.8939 RAG2 Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8939 RAC2 Zornitza Stark Marked gene: RAC2 as ready
Mendeliome v0.8939 RAC2 Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence).
Mendeliome v0.8939 RAC2 Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986
Mendeliome v0.8938 RAC2 Zornitza Stark Publications for gene: RAC2 were set to
Mendeliome v0.8937 RAG1 Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8937 RAC2 Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other
Mendeliome v0.8936 RAC2 Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Marked gene: RAG2 as ready
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650
Combined Immunodeficiency v0.377 RAG2 Zornitza Stark Publications for gene: RAG2 were set to
Combined Immunodeficiency v0.376 RAG2 Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Combined Immunodeficiency v0.374 RAG1 Zornitza Stark Publications for gene: RAG1 were set to
Combined Immunodeficiency v0.373 RAG1 Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8935 RAC2 Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Marked gene: RAC2 as ready
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Publications for gene: RAC2 were set to 21167572; 10758162; 10072071; 25512081; 32542921; 31919089
Combined Immunodeficiency v0.371 RAC2 Zornitza Stark Publications for gene: RAC2 were set to
Combined Immunodeficiency v0.370 RAC2 Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other
Combined Immunodeficiency v0.369 RAC2 Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Marked gene: MTHFD1 as ready
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Gene: mthfd1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Phenotypes for gene: MTHFD1 were changed from to Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780; Decreased Ig levels; poor antibody responses to conjugated polysaccharide antigens; low B/T/NK cells; Recurrent bacterial infection; megaloblastic anaemia; failure to thrive; neutropenia; seizures; intellectual disability; folate-responsive; Lymphopaenia
Mendeliome v0.8935 MTHFD1 Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Phenotypes: 32414565, 19033438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.367 MTHFD1 Zornitza Stark Publications for gene: MTHFD1 were set to
Combined Immunodeficiency v0.366 MTHFD1 Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.366 MTHFD1 Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8935 GLI2 Zornitza Stark Marked gene: GLI2 as ready
Mendeliome v0.8935 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Mendeliome v0.8935 GLI2 Zornitza Stark Phenotypes for gene: GLI2 were changed from to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082)
Mendeliome v0.8934 GLI2 Zornitza Stark Publications for gene: GLI2 were set to
Mendeliome v0.8933 GLI2 Zornitza Stark Mode of inheritance for gene: GLI2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8932 GLI2 Zornitza Stark changed review comment from: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported, short stature is a feature as a result of GH deficiency.

Variants in GLI2 are also associated with HPE, at least 5 families reported. Short stature is observed more rarely, as a result of midline defect.; to: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported.

Variants in GLI2 are also associated with HPE, at least 5 families reported.
Mendeliome v0.8932 GLI2 Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.323 GLI2 Zornitza Stark Marked gene: GLI2 as ready
Growth failure v0.323 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Growth failure v0.323 GLI2 Zornitza Stark Phenotypes for gene: GLI2 were changed from Holoprosencephaly, hypopituitarism to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082
Growth failure v0.322 GLI2 Zornitza Stark Publications for gene: GLI2 were set to
Growth failure v0.321 GLI2 Zornitza Stark Classified gene: GLI2 as Green List (high evidence)
Growth failure v0.321 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Growth failure v0.320 GLI2 Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Marked gene: GHSR as ready
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Publications for gene: GHSR were set to 19789204; 25557026
Pituitary hormone deficiency v0.14 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Pituitary hormone deficiency v0.14 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Pituitary hormone deficiency v0.13 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8932 GHSR Zornitza Stark Marked gene: GHSR as ready
Mendeliome v0.8932 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8932 GHSR Zornitza Stark Phenotypes for gene: GHSR were changed from to Growth hormone deficiency, isolated partial, MIM# 615925
Mendeliome v0.8931 GHSR Zornitza Stark Publications for gene: GHSR were set to
Mendeliome v0.8930 GHSR Zornitza Stark Mode of inheritance for gene: GHSR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8929 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Mendeliome v0.8929 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8928 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.320 GHSR Zornitza Stark edited their review of gene: GHSR: Changed publications: 25557026, 19789204, 16511605
Growth failure v0.320 GHSR Zornitza Stark Marked gene: GHSR as ready
Growth failure v0.320 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Growth failure v0.320 GHSR Zornitza Stark Phenotypes for gene: GHSR were changed from Idiopathic short stature, GH deficiency to Growth hormone deficiency, isolated partial, MIM# 615925
Growth failure v0.319 GHSR Zornitza Stark Publications for gene: GHSR were set to 16511605
Growth failure v0.318 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Growth failure v0.318 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Growth failure v0.317 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAG2 Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAC2 Danielle Ariti changed review comment from: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis
2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies

Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function.

Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia.
--------
Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia
Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model.

They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function.

Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism.

Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID.
---------
Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia
13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models

Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R)

These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia.
-----
Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (loss of function)
Amber- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (loss of function)
Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (gain of function); to: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis
2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies

Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function.

Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia.
--------
Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia
Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model.

They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function.

Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism.

Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID.
---------
Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia
13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models

Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R)

These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia.
-----
Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (Mono-allelic; loss of function)
Red- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (Bi-allelic; loss of function)
Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (Mono-allelic; gain of function)
Intellectual disability syndromic and non-syndromic v0.4088 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4088 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4087 PDE6D Zornitza Stark changed review comment from: Two families and functional data.; to: Two families and good functional data.
Intellectual disability syndromic and non-syndromic v0.4087 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Polydactyly v0.236 PDE6D Zornitza Stark changed review comment from: Comment on publications: Second family identified; to: Comment on publications: Second family identified.
Polydactyly v0.236 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: AMBER
Polydactyly v0.236 PDE6D Zornitza Stark Deleted their comment
Mendeliome v0.8928 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed publications: 30423442, 24166846
Mendeliome v0.8928 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Mendeliome v0.8928 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Mendeliome v0.8927 PDE6D Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified in the literature.; to: Comment when marking as ready: Second family identified in the literature. Good functional data.
Mendeliome v0.8927 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Ciliopathies v1.11 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Ciliopathies v1.11 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Ciliopathies v1.10 PDE6D Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified PMID 30423442; to: Comment when marking as ready: Second family identified PMID 30423442. Good functional data.
Ciliopathies v1.10 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Mendeliome v0.8927 GHRHR Zornitza Stark Marked gene: GHRHR as ready
Mendeliome v0.8927 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Mendeliome v0.8927 GHRHR Zornitza Stark Phenotypes for gene: GHRHR were changed from to Growth hormone deficiency, isolated, type IV, MIM# 618157
Mendeliome v0.8926 GHRHR Zornitza Stark Publications for gene: GHRHR were set to
Mendeliome v0.8925 GHRHR Zornitza Stark Mode of inheritance for gene: GHRHR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8924 GHRHR Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.317 GHRHR Zornitza Stark Marked gene: GHRHR as ready
Growth failure v0.317 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Growth failure v0.317 GHRHR Zornitza Stark Phenotypes for gene: GHRHR were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IV, MIM# 618157
Growth failure v0.316 GHRHR Zornitza Stark Publications for gene: GHRHR were set to
Growth failure v0.315 GHRHR Zornitza Stark Classified gene: GHRHR as Green List (high evidence)
Growth failure v0.315 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Growth failure v0.314 GHRHR Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8924 GHR Zornitza Stark Marked gene: GHR as ready
Mendeliome v0.8924 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Mendeliome v0.8924 GHR Zornitza Stark Phenotypes for gene: GHR were changed from to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500
Mendeliome v0.8923 GHR Zornitza Stark Publications for gene: GHR were set to
Mendeliome v0.8922 GHR Zornitza Stark Mode of inheritance for gene: GHR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8921 GHR Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.314 GHR Zornitza Stark Marked gene: GHR as ready
Growth failure v0.314 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Growth failure v0.314 GHR Zornitza Stark Phenotypes for gene: GHR were changed from Laron syndrome to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500
Growth failure v0.313 GHR Zornitza Stark Publications for gene: GHR were set to
Growth failure v0.312 GHR Zornitza Stark Mode of inheritance for gene: GHR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.311 GHR Zornitza Stark Classified gene: GHR as Green List (high evidence)
Growth failure v0.311 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Growth failure v0.310 GHR Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAG1 Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAC2 Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 MTHFD1 Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32414565, 19033438; Phenotypes: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Joubert syndrome and other neurological ciliopathies v1.12 PDE6D chirag patel Classified gene: PDE6D as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.12 PDE6D chirag patel Gene: pde6d has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.11 PDE6D chirag patel reviewed gene: PDE6D: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24166846; Phenotypes: Joubert syndrome 22, OMIM #615665; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8921 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Mendeliome v0.8921 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Mendeliome v0.8921 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Mendeliome v0.8921 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Mendeliome v0.8920 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Hereditary Spastic Paraplegia v1.15 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Hereditary Spastic Paraplegia v1.14 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Dystonia and Chorea v0.189 RNU7-1 Zornitza Stark Marked gene: RNU7-1 as ready
Dystonia and Chorea v0.189 RNU7-1 Zornitza Stark Gene: rnu7-1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.189 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Dystonia and Chorea v0.188 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4087 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Intellectual disability syndromic and non-syndromic v0.4086 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Regression v0.358 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Regression v0.357 RNU7-1 Zornitza Stark edited their review of gene: RNU7-1: Changed phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487
Mendeliome v0.8919 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Mendeliome v0.8918 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Brain Calcification v1.12 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Brain Calcification v1.11 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4086 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Intellectual disability syndromic and non-syndromic v0.4085 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Regression v0.357 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Regression v0.356 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Mendeliome v0.8918 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Mendeliome v0.8917 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Brain Calcification v1.11 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Brain Calcification v1.10 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Microcephaly v1.44 WDR11 Zornitza Stark Marked gene: WDR11 as ready
Microcephaly v1.44 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Microcephaly v1.44 WDR11 Zornitza Stark Classified gene: WDR11 as Green List (high evidence)
Microcephaly v1.44 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Microcephaly v1.43 WDR11 Zornitza Stark gene: WDR11 was added
gene: WDR11 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: WDR11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR11 were set to 34413497
Phenotypes for gene: WDR11 were set to Intellectual disability; Microcephaly; Short stature
Review for gene: WDR11 was set to GREEN
Added comment: Haag et al (2021 - PMID: 34413497) report on 6 individuals from 3 unrelated families, harboring biallelic LoF WDR11 variants.

Common features included microcephaly (6/6 - range: -2.43 SD to -4.93SD) and intellectual disability (6/6, in 5 cases mild, in 1 severe) with some individuals presenting also with mild short stature.

Homozygosity or compound heterozygosity for LoF variants in affected individuals was identified following exome sequencing (fam1: NM_018117.12:c.1255C>T/p.Q419* hmz, fam2:c.3033_3036del/D1011Efs*21 in trans with c.1439del/p.N480Tfs*32, fam3:c.2931+1G>A hmz).

Segregation studies supported carrier state of parents and unaffected sibs (or homozygosity for wt allele in the latter).

Variable previous investigations incl. standard karyotype and CMA were normal in several subjects (notably index cases from each family).
-----
As the authors comment WDR11 encodes for the WD repeat domain 11 protein and has broad expression in the developing mouse CNS. Mutations in other genes encoding for WD repeat proteins have been associated with neurological, endocrine or other disorders incl. ciliopathies.

Heterozygous missense WDR11 variants are associated with hypogonadotropic hypogonadism (HH) 14 with or without anosmia (MIM #614858). [Gene2Phenotype : monoallelic, all missense/in-frame].

The authors performed extensive hormonal studies and argue that the phenotype associated with biallelic variants differs significantly from the dominantly inherited variants (HH) suggesting that biallelic variants result in a clinically distinct entity. In addition, carrier parents of the individuals reported by Haag et al had no obvious signs of congenital HH. However, there was no endocrinological examination performed.
-----
Variant effect:
Immunofluorescence studies demonstrated strong juxtanuclear WDR11 staining in control fibroblasts , but only cell-ubiquitous background labeling in patient fibroblasts (for Q419*). There was also evidence for colocalization of wt WDR11 to the trans-Golgi network (TGN) with loss of this pattern in patient fibroblasts (Q419*).

Western blot in whole cell lysates of cultured patient fibroblasts (same variant) proved loss of WDR11 irrespectively of the antibody used (against N- or C-terminal epitopes of WDR11). There was no indication of a truncated protein.
-----
Animal models:
The authors discuss previous evidence from mice/zebrafish models suggesting abnormal Hedgehog signaling in the primary cilium and impaired ciliogenesis due to loss of WDR11.

Wdr11-null mice display features of holoprosencephaly incl. microcephaly, hypotelorism, micro/anophthalmia, abnormal pituitary gland, growth retardation, heart defects, hypoplasia of reproductive organs and infertility. There was evidence of reduced length of the ciliary axoneme and reduced frequency of ciliated cells.

Knockdown of wdr11 in zebrafish led to microcephaly, aberrant head cartilage formation, microphthalmia, curved body axis, motility defects.

Overall the authors consider that the phenotype of microcephaly, variable growth delay and/or some visual/skeletal anomalies are recapitulated to some degree in animal models, although a more severe phenotype is observed in mice.

In the cohort presented by Haag et al there was no evidence of congenital heart defects, brain malformations, abnormal sexual hormone profiles or pituitary (MRI) abnormalities based on the investigations performed.
-----
The authors discuss briefly on the previously proposed role for WDR11 in endosome to trans Golgi network vesicular trafficking which might also be supported by their colocalization experiments in patient fibroblasts.
Sources: Literature
Mendeliome v0.8917 WDR11 Zornitza Stark Marked gene: WDR11 as ready
Mendeliome v0.8917 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Mendeliome v0.8917 WDR11 Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858
Mendeliome v0.8916 WDR11 Zornitza Stark Publications for gene: WDR11 were set to
Mendeliome v0.8915 WDR11 Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8914 WDR11 Zornitza Stark reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4085 WDR11 Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Microcephaly; Short stature
Intellectual disability syndromic and non-syndromic v0.4084 WDR11 Zornitza Stark Publications for gene: WDR11 were set to
Intellectual disability syndromic and non-syndromic v0.4083 WDR11 Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4082 WDR11 Zornitza Stark Classified gene: WDR11 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4082 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Mendeliome v0.8914 Bryony Thompson removed STR:SCA12 from the panel
Repeat Disorders v0.65 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.65 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.64 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4081 WDR11 Konstantinos Varvagiannis reviewed gene: WDR11: Rating: AMBER; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Microcephaly, Short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8913 GH1 Zornitza Stark Marked gene: GH1 as ready
Mendeliome v0.8913 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Mendeliome v0.8913 GH1 Zornitza Stark Phenotypes for gene: GH1 were changed from to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650
Mendeliome v0.8912 GH1 Zornitza Stark Publications for gene: GH1 were set to
Mendeliome v0.8911 GH1 Zornitza Stark Mode of inheritance for gene: GH1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8910 GH1 Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.310 GH1 Zornitza Stark Marked gene: GH1 as ready
Growth failure v0.310 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Growth failure v0.310 GH1 Zornitza Stark Phenotypes for gene: GH1 were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650
Growth failure v0.309 GH1 Zornitza Stark Publications for gene: GH1 were set to
Growth failure v0.308 GH1 Zornitza Stark Classified gene: GH1 as Green List (high evidence)
Growth failure v0.308 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Growth failure v0.307 GH1 Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.307 Zornitza Stark removed gene:FGFR1 from the panel
Growth failure v0.306 Zornitza Stark removed gene:FGF8 from the panel
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Monogenic Diabetes v0.22 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Monogenic Diabetes. Sources: Literature
Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHX1 were set to 34342583
Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes
Review for gene: EPHX1 was set to AMBER
Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts.
Sources: Literature
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Growth failure v0.305 Zornitza Stark removed gene:EPHX1 from the panel
Mendeliome v0.8910 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Mendeliome v0.8910 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Lipodystrophy_Lipoatrophy v1.2 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Lipodystrophy_Lipoatrophy. Sources: Literature
Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHX1 were set to 34342583
Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes
Review for gene: EPHX1 was set to AMBER
Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts.
Sources: Literature
Mendeliome v0.8910 EPHX1 Zornitza Stark Phenotypes for gene: EPHX1 were changed from to Lipoatrophic diabetes
Mendeliome v0.8909 EPHX1 Zornitza Stark Publications for gene: EPHX1 were set to
Mendeliome v0.8908 EPHX1 Zornitza Stark Mode of inheritance for gene: EPHX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8907 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Mendeliome v0.8907 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8906 EPHX1 Zornitza Stark reviewed gene: EPHX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 34342583; Phenotypes: Lipoatrophic diabetes; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.304 EP300 Zornitza Stark Marked gene: EP300 as ready
Growth failure v0.304 EP300 Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence).
Growth failure v0.304 EP300 Zornitza Stark Phenotypes for gene: EP300 were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 2, MIM# 613684; Menke-Hennekam syndrome , MIM#2 618333
Growth failure v0.303 EP300 Zornitza Stark Publications for gene: EP300 were set to
Growth failure v0.302 EP300 Zornitza Stark Classified gene: EP300 as Green List (high evidence)
Growth failure v0.302 EP300 Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence).
Growth failure v0.301 EP300 Zornitza Stark reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: 29506490, 29460469; Phenotypes: Rubinstein-Taybi syndrome 2, MIM# 613684, Menke-Hennekam syndrome , MIM#2 618333; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.301 Zornitza Stark removed gene:COL1A1 from the panel
Growth failure v0.300 Zornitza Stark removed gene:DOK7 from the panel
Growth failure v0.299 DHCR7 Zornitza Stark Marked gene: DHCR7 as ready
Growth failure v0.299 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Growth failure v0.299 DHCR7 Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith Lemli Opitz to Smith-Lemli-Opitz syndrome, MIM#270400
Growth failure v0.298 DHCR7 Zornitza Stark Classified gene: DHCR7 as Green List (high evidence)
Growth failure v0.298 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Growth failure v0.297 DHCR7 Zornitza Stark reviewed gene: DHCR7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Smith-Lemli-Opitz syndrome, MIM#270400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.297 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Growth failure v0.297 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Growth failure v0.297 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Growth failure v0.296 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Growth failure v0.295 CREBBP Zornitza Stark Classified gene: CREBBP as Green List (high evidence)
Growth failure v0.295 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Growth failure v0.294 CREBBP Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8906 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Mendeliome v0.8906 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Mendeliome v0.8906 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Growth failure v0.294 ATRX Zornitza Stark Marked gene: ATRX as ready
Growth failure v0.294 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Growth failure v0.294 ATRX Zornitza Stark Phenotypes for gene: ATRX were changed from SGA, which is sometimes called intrauterine growth restriction (IUGR), to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580
Growth failure v0.293 ATRX Zornitza Stark Publications for gene: ATRX were set to
Growth failure v0.292 ATRX Zornitza Stark Mode of inheritance for gene: ATRX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.291 ATRX Zornitza Stark Classified gene: ATRX as Green List (high evidence)
Growth failure v0.291 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Growth failure v0.290 ATRX Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301622; Phenotypes: Alpha-thalassemia/mental retardation syndrome, MIM# 301040, Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.290 ZBTB24 Zornitza Stark Marked gene: ZBTB24 as ready
Growth failure v0.290 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Growth failure v0.290 ZBTB24 Zornitza Stark Classified gene: ZBTB24 as Green List (high evidence)
Growth failure v0.290 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Growth failure v0.289 ZBTB24 Zornitza Stark gene: ZBTB24 was added
gene: ZBTB24 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ZBTB24 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZBTB24 were set to 21596365; 21906047; 23486536
Phenotypes for gene: ZBTB24 were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 2, MIM# 614069; MONDO:0013553
Review for gene: ZBTB24 was set to GREEN
Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is characterized by facial dysmorphism, immunoglobulin deficiency resulting in recurrent infections, and intellectual disability. Laboratory studies of patient cells show hypomethylation of satellite regions of chromosomes 1, 9, and 16, as well as pericentromeric chromosomal instability in response to phytohaemagglutinin stimulation.

20 unrelated families reported. Short stature is a feature.
Sources: Expert Review
Growth failure v0.288 SPRTN Zornitza Stark Marked gene: SPRTN as ready
Growth failure v0.288 SPRTN Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence).
Growth failure v0.288 SPRTN Zornitza Stark Classified gene: SPRTN as Green List (high evidence)
Growth failure v0.288 SPRTN Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence).
Growth failure v0.287 SPRTN Zornitza Stark gene: SPRTN was added
gene: SPRTN was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: SPRTN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPRTN were set to 25261934
Phenotypes for gene: SPRTN were set to Ruijs-Aalfs syndrome, MIM# 616200; MONDO:0014527
Review for gene: SPRTN was set to GREEN
Added comment: Two families with functional evidence for a DNA repair disorder; progeroid features and hepatocellular carcinoma reported as key features, as is short stature.
Sources: Expert Review
Growth failure v0.286 RNF168 Zornitza Stark Marked gene: RNF168 as ready
Growth failure v0.286 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Growth failure v0.286 RNF168 Zornitza Stark Classified gene: RNF168 as Green List (high evidence)
Growth failure v0.286 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Growth failure v0.285 RNF168 Zornitza Stark gene: RNF168 was added
gene: RNF168 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RNF168 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF168 were set to 19203578; 21394101; 29255463; 21552324
Phenotypes for gene: RNF168 were set to RIDDLE syndrome MIM# 611943; Radiosensitivity; Immune Deficiency; Dysmorphic Features; Learning difficulties; Low IgG or IgA; Short stature; mild defect of motor control to ataxia; normal intelligence to learning difficulties; mild facial dysmorphism to microcephaly
Review for gene: RNF168 was set to GREEN
Added comment: 4 individuals from 3 unrelated families have been reported with RNF168 variants and display RIDDLE syndrome phenotype.

One mouse model; demonstrated RNF168 deficient mice are immunodeficient and exhibit increased radiosensitivity.

Homozygous and Compound heterozygous (duplications, deletions and nonsense) variants identified resulting in frameshift, aberrant protein and alteration of binding motifs.

Typically presents with increased radiosensitivity, immunodeficiency (decrease IgA), mild motor control and learning difficulties, facial dysmorphism, and short stature.
Sources: Expert Review
Growth failure v0.284 RECQL4 Zornitza Stark Marked gene: RECQL4 as ready
Growth failure v0.284 RECQL4 Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence).
Growth failure v0.284 RECQL4 Zornitza Stark Classified gene: RECQL4 as Green List (high evidence)
Growth failure v0.284 RECQL4 Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence).
Growth failure v0.283 RECQL4 Zornitza Stark gene: RECQL4 was added
gene: RECQL4 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RECQL4 were set to 10319867; 12952869; 15964893
Phenotypes for gene: RECQL4 were set to Rothmund-Thomson syndrome, type 2, MIM# 268400; RAPADILINO syndrome, MIM# 266280; Baller-Gerold syndrome, MIM# 218600
Review for gene: RECQL4 was set to GREEN
Added comment: Gene encodes DNA helicase involved in DNA repair. Bi-allelic variants associated with a range of phenotypes. Short stature is a feature of these disorders.
Sources: Expert Review
Growth failure v0.282 RAD51C Zornitza Stark Marked gene: RAD51C as ready
Growth failure v0.282 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Growth failure v0.282 RAD51C Zornitza Stark Classified gene: RAD51C as Green List (high evidence)
Growth failure v0.282 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Growth failure v0.281 RAD51C Zornitza Stark gene: RAD51C was added
gene: RAD51C was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD51C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAD51C were set to 20400963; 29278735
Phenotypes for gene: RAD51C were set to Fanconi anaemia, complementation group O, MIM# 613390
Review for gene: RAD51C was set to GREEN
Added comment: Two unrelated families reported, excellent biological candidate for FA.
Sources: Expert Review
Growth failure v0.280 RAD51 Zornitza Stark Marked gene: RAD51 as ready
Growth failure v0.280 RAD51 Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence).
Growth failure v0.280 RAD51 Zornitza Stark Classified gene: RAD51 as Green List (high evidence)
Growth failure v0.280 RAD51 Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence).
Growth failure v0.279 RAD51 Zornitza Stark gene: RAD51 was added
gene: RAD51 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAD51 were set to 26253028; 26681308; 30907510
Phenotypes for gene: RAD51 were set to Fanconi anaemia, complementation group R, MIM# 617244
Review for gene: RAD51 was set to GREEN
Added comment: Three unrelated individuals reported with de novo missense variants in this gene.
Sources: Expert Review
Growth failure v0.278 RAD50 Zornitza Stark Marked gene: RAD50 as ready
Growth failure v0.278 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Growth failure v0.278 RAD50 Zornitza Stark Classified gene: RAD50 as Green List (high evidence)
Growth failure v0.278 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Growth failure v0.277 RAD50 Zornitza Stark gene: RAD50 was added
gene: RAD50 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAD50 were set to 19409520; 32212377; 33378670
Phenotypes for gene: RAD50 were set to Nijmegen breakage syndrome-like disorder, MIM# 613078; MONDO:0013118
Review for gene: RAD50 was set to GREEN
Added comment: Three unrelated families reported, short stature is a key feature.
Sources: Expert Review
Growth failure v0.276 NHEJ1 Zornitza Stark Marked gene: NHEJ1 as ready
Growth failure v0.276 NHEJ1 Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence).
Growth failure v0.276 NHEJ1 Zornitza Stark Classified gene: NHEJ1 as Green List (high evidence)
Growth failure v0.276 NHEJ1 Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence).
Growth failure v0.275 NHEJ1 Zornitza Stark gene: NHEJ1 was added
gene: NHEJ1 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: NHEJ1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NHEJ1 were set to 16439204; 16439205
Phenotypes for gene: NHEJ1 were set to Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation, MIM# 611291; MONDO:0012650
Review for gene: NHEJ1 was set to GREEN
Added comment: More than 5 unrelated families reported, poor growth is a key feature.
Sources: Expert Review
Growth failure v0.274 MPLKIP Zornitza Stark Marked gene: MPLKIP as ready
Growth failure v0.274 MPLKIP Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence).
Growth failure v0.274 MPLKIP Zornitza Stark Classified gene: MPLKIP as Green List (high evidence)
Growth failure v0.274 MPLKIP Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence).
Growth failure v0.273 MPLKIP Zornitza Stark gene: MPLKIP was added
gene: MPLKIP was added to Growth failure in early childhood. Sources: Expert list
Mode of inheritance for gene: MPLKIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MPLKIP were set to 15645389; 16977596
Phenotypes for gene: MPLKIP were set to Trichothiodystrophy 4, nonphotosensitive, MIM# 234050; MONDO:0021013
Review for gene: MPLKIP was set to GREEN
Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections.

Gene previously known as c7orf11.

More than 5 unrelated families reported.
Sources: Expert list
Growth failure v0.272 GTF2H5 Zornitza Stark Marked gene: GTF2H5 as ready
Growth failure v0.272 GTF2H5 Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence).
Growth failure v0.272 GTF2H5 Zornitza Stark Classified gene: GTF2H5 as Green List (high evidence)
Growth failure v0.272 GTF2H5 Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence).
Growth failure v0.271 GTF2H5 Zornitza Stark gene: GTF2H5 was added
gene: GTF2H5 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: GTF2H5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF2H5 were set to 15220921; 30359777; 24986372
Phenotypes for gene: GTF2H5 were set to Trichothiodystrophy 3, photosensitive, MIM# 616395; MONDO:0014619
Review for gene: GTF2H5 was set to GREEN
Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections.

Established gene-disease association, at least 5 families reported.
Sources: Expert Review
Growth failure v0.270 ERCC5 Zornitza Stark Marked gene: ERCC5 as ready
Growth failure v0.270 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Growth failure v0.270 ERCC5 Zornitza Stark Classified gene: ERCC5 as Green List (high evidence)
Growth failure v0.270 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Growth failure v0.269 ERCC5 Zornitza Stark gene: ERCC5 was added
gene: ERCC5 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC5 were set to 7951246; 9096355; 9096355; 24700531; 33766032; 33219753
Phenotypes for gene: ERCC5 were set to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216
Review for gene: ERCC5 was set to GREEN
Added comment: Well established gene-disease association, spectrum of severity. Poor growth is a feature of COFS but is also present in some individuals with xeroderma pigmentosa.
Sources: Expert Review
Growth failure v0.268 ERCC3 Zornitza Stark Marked gene: ERCC3 as ready
Growth failure v0.268 ERCC3 Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence).
Growth failure v0.268 ERCC3 Zornitza Stark Classified gene: ERCC3 as Green List (high evidence)
Growth failure v0.268 ERCC3 Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence).
Growth failure v0.267 ERCC3 Zornitza Stark gene: ERCC3 was added
gene: ERCC3 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC3 were set to 2167179; 10447254; 16947863; 9012405; 32557569; 27004399
Phenotypes for gene: ERCC3 were set to Trichothiodystrophy 2, photosensitive, MIM# 616390; Xeroderma pigmentosum, group B 61, MIM#0651
Review for gene: ERCC3 was set to GREEN
Added comment: Nucleotide excision repair disorder, variable severity, short stature associated with both disorders.
Sources: Expert Review
Growth failure v0.266 ERCC2 Zornitza Stark Marked gene: ERCC2 as ready
Growth failure v0.266 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Growth failure v0.266 ERCC2 Zornitza Stark Classified gene: ERCC2 as Green List (high evidence)
Growth failure v0.266 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Growth failure v0.265 ERCC2 Zornitza Stark gene: ERCC2 was added
gene: ERCC2 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC2 were set to 7849702; 9758621; 11443545; 33733458
Phenotypes for gene: ERCC2 were set to Cerebrooculofacioskeletal syndrome 2, MIM# 610756; Trichothiodystrophy 1, photosensitive, MIM# 601675
Review for gene: ERCC2 was set to GREEN
Added comment: Bi-allelic inactivation of XPD protein, a nucleotide excision repair (NER) signaling pathway component encoded by ERCC2 gene, has been associated with several defective DNA repair phenotypes, of which photosensitive trichothiodystrophy and cerebro-oculo-facio-skeletal syndrome have short stature as a feature.
Sources: Expert Review
Growth failure v0.264 DNMT3B Zornitza Stark Marked gene: DNMT3B as ready
Growth failure v0.264 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Growth failure v0.264 DNMT3B Zornitza Stark Classified gene: DNMT3B as Green List (high evidence)
Growth failure v0.264 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Growth failure v0.263 DNMT3B Zornitza Stark gene: DNMT3B was added
gene: DNMT3B was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNMT3B were set to 10647011; 23486536
Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1, MIM# 242860
Review for gene: DNMT3B was set to GREEN
Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency, and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes.

More than 20 unrelated families reported.

Short stature is a feature.
Sources: Expert Review
Growth failure v0.262 DDX11 Zornitza Stark Marked gene: DDX11 as ready
Growth failure v0.262 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Growth failure v0.262 DDX11 Zornitza Stark Classified gene: DDX11 as Green List (high evidence)
Growth failure v0.262 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Growth failure v0.261 DDX11 Zornitza Stark gene: DDX11 was added
gene: DDX11 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: DDX11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX11 were set to 20137776; 23033317; 30216658
Phenotypes for gene: DDX11 were set to Warsaw breakage syndrome, MIM# 613398; MONDO:0013252
Review for gene: DDX11 was set to GREEN
Added comment: PMID 30216658 reviews 12 individuals reported to date: severe microcephaly with prenatal onset was identified in all patients, and severe pre- and postnatal growth restriction was observed in 11 of 11 patients. All 12 patients had sensorineural hearing loss, with 10 of 10 having cochlear hypoplasia or functional abnormalities; 1 patient had a posterior labyrinthine anomaly. In all 4 patients who had brain imaging, abnormalities were identified. Some patients had other structural anomalies, including cardiac defects (5/12), recurrent infections (4/9), and skin pigmentation changes (6/12). Craniofacial features included a depressed nasal bridge with a broad nasal tip and overhanging columella. Elevated induced chromosome breakage was observed in 6 of 8 reported patients. Cohesin defects (premature chromatid separation and premature centromere division) were consistent in most metaphases among the patients examined.
Sources: Expert Review
Growth failure v0.260 BRCA1 Zornitza Stark Marked gene: BRCA1 as ready
Growth failure v0.260 BRCA1 Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence).
Growth failure v0.260 BRCA1 Zornitza Stark Classified gene: BRCA1 as Green List (high evidence)
Growth failure v0.260 BRCA1 Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence).
Growth failure v0.259 BRCA1 Zornitza Stark gene: BRCA1 was added
gene: BRCA1 was added to Growth failure in early childhood. Sources: Expert list
Mode of inheritance for gene: BRCA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRCA1 were set to 23269703; 29133208; 25472942; 29712865
Phenotypes for gene: BRCA1 were set to Fanconi anaemia, complementation group S, MIM# 617883
Review for gene: BRCA1 was set to GREEN
Added comment: At least 5 unrelated families with bi-allelic variants reported and FA phenotype. Short stature is a feature.
Sources: Expert list
Mendeliome v0.8905 ATM Zornitza Stark Phenotypes for gene: ATM were changed from to Ataxia-telangiectasia, MIM# 208900
Mendeliome v0.8904 ATM Zornitza Stark Publications for gene: ATM were set to
Mendeliome v0.8903 ATM Zornitza Stark reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: 30137827; Phenotypes: Ataxia-telangiectasia, MIM# 208900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.258 ATM Zornitza Stark Marked gene: ATM as ready
Growth failure v0.258 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Growth failure v0.258 ATM Zornitza Stark Classified gene: ATM as Green List (high evidence)
Growth failure v0.258 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Growth failure v0.257 ATM Zornitza Stark gene: ATM was added
gene: ATM was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ATM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATM were set to 30137827
Phenotypes for gene: ATM were set to Ataxia-telangiectasia, MIM# 208900
Review for gene: ATM was set to GREEN
Added comment: Well established gene-disease association.

Ataxia-telangiectasia (AT) is a chromosome breakage disorder characterized by cerebellar ataxia, telangiectases, immune defects, and a predisposition to malignancy.

Short stature is a feature.
Sources: Expert Review
Growth failure v0.256 TRAIP Zornitza Stark Marked gene: TRAIP as ready
Growth failure v0.256 TRAIP Zornitza Stark Gene: traip has been classified as Green List (High Evidence).
Growth failure v0.256 TRAIP Zornitza Stark Classified gene: TRAIP as Green List (high evidence)
Growth failure v0.256 TRAIP Zornitza Stark Gene: traip has been classified as Green List (High Evidence).
Growth failure v0.255 TRAIP Zornitza Stark gene: TRAIP was added
gene: TRAIP was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: TRAIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAIP were set to 26595769
Phenotypes for gene: TRAIP were set to Seckel syndrome 9, MIM# 616777
Review for gene: TRAIP was set to GREEN
Added comment: Three families reported, though two distantly related (founder); functional data.
Sources: Expert Review
Growth failure v0.254 RNU4ATAC Zornitza Stark Marked gene: RNU4ATAC as ready
Growth failure v0.254 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Growth failure v0.254 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from MOPD I to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Growth failure v0.253 RNU4ATAC Zornitza Stark Publications for gene: RNU4ATAC were set to 21474760
Growth failure v0.252 RNU4ATAC Zornitza Stark Classified gene: RNU4ATAC as Green List (high evidence)
Growth failure v0.252 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Growth failure v0.251 RNU4ATAC Zornitza Stark reviewed gene: RNU4ATAC: Rating: GREEN; Mode of pathogenicity: None; Publications: 23794361, 26522830, 30455926, 29265708, 12605445; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710), Roifman syndrome (MIM# 616651), Lowry-Wood syndrome, MIM# 226960; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8903 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960 to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Mendeliome v0.8902 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651) to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Mendeliome v0.8901 RNU4ATAC Zornitza Stark Publications for gene: RNU4ATAC were set to 23794361; 26522830; 30455926
Mendeliome v0.8900 RNU4ATAC Zornitza Stark edited their review of gene: RNU4ATAC: Added comment: Lowry-Wood syndrome (LWS) is characterized by multiple epiphyseal dysplasia and microcephaly. Patients exhibit intrauterine growth retardation and short stature, as well as developmental delay and intellectual disability. Retinal degeneration has been reported in some patients.

Four unrelated families reported.

Note features between the three RNU4ATAC-related conditions overlap and they may not represent distinct disorders.; Changed rating: GREEN; Changed publications: 29265708, 12605445; Changed phenotypes: Lowry-Wood syndrome, MIM# 226960; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.251 RBBP8 Zornitza Stark Marked gene: RBBP8 as ready
Growth failure v0.251 RBBP8 Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence).
Growth failure v0.251 RBBP8 Zornitza Stark Phenotypes for gene: RBBP8 were changed from seckel syndrome but with proportionate head/height impairment, cafe au lair macules to Seckel syndrome 2, MIM# 606744
Growth failure v0.250 RBBP8 Zornitza Stark Publications for gene: RBBP8 were set to 24389050, 21998596
Growth failure v0.249 RBBP8 Zornitza Stark Classified gene: RBBP8 as Amber List (moderate evidence)
Growth failure v0.249 RBBP8 Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence).
Growth failure v0.248 RBBP8 Zornitza Stark reviewed gene: RBBP8: Rating: AMBER; Mode of pathogenicity: None; Publications: 21998596, 24389050; Phenotypes: Seckel syndrome 2, MIM# 606744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.248 POLE Zornitza Stark Marked gene: POLE as ready
Growth failure v0.248 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Growth failure v0.248 POLE Zornitza Stark Classified gene: POLE as Green List (high evidence)
Growth failure v0.248 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Growth failure v0.247 POLE Zornitza Stark Tag deep intronic tag was added to gene: POLE.
Growth failure v0.247 POLE Zornitza Stark gene: POLE was added
gene: POLE was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: POLE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLE were set to 30503519; 23230001; 25948378
Phenotypes for gene: POLE were set to FILS syndrome, MIM# 615139; IMAGE-I syndrome, MIM# 618336
Review for gene: POLE was set to GREEN
Added comment: Both the FILS and IMAGE-I phenotypes have short stature as a feature, although it is more severe in IMAGE-I. Note recurrent intronic variant, c.1686+32C-G (intron 15) in IMAGE-I, found in combination with multiple other variants.
Sources: Expert Review
Growth failure v0.246 PCNT Zornitza Stark Marked gene: PCNT as ready
Growth failure v0.246 PCNT Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence).
Growth failure v0.246 PCNT Zornitza Stark Phenotypes for gene: PCNT were changed from Seckel syndrome, MOPD type II - growth restrction, microcephaly, prominent nose, micrognathia, squeaky voice, insulin resistance, 210720; MOPDII to Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720; MONDO:0008872
Growth failure v0.245 PCNT Zornitza Stark Publications for gene: PCNT were set to 18157127; 18174396
Growth failure v0.244 PCNT Zornitza Stark Classified gene: PCNT as Green List (high evidence)
Growth failure v0.244 PCNT Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence).
Growth failure v0.243 PCNT Zornitza Stark reviewed gene: PCNT: Rating: GREEN; Mode of pathogenicity: None; Publications: 18174396, 12210304, 30922925, 33460028, 32557621, 32267100; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720, MONDO:0008872; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.243 LARP7 Zornitza Stark Marked gene: LARP7 as ready
Growth failure v0.243 LARP7 Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence).
Growth failure v0.243 LARP7 Zornitza Stark Classified gene: LARP7 as Green List (high evidence)
Growth failure v0.243 LARP7 Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence).
Growth failure v0.242 LARP7 Zornitza Stark gene: LARP7 was added
gene: LARP7 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: LARP7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LARP7 were set to 22865833; 21937992; 30006060; 33569879
Phenotypes for gene: LARP7 were set to Alazami syndrome, MIM# 615071; Microcephalic primordial dwarfism, Alazami type MONDO:0014031
Review for gene: LARP7 was set to GREEN
Added comment: Alazami syndrome is an autosomal recessive disorder characterized by severe growth restriction present at birth, severely impaired intellectual development, and distinctive facial features. Five unrelated families reported.
Sources: Expert Review
Growth failure v0.241 FAM111A Zornitza Stark Marked gene: FAM111A as ready
Growth failure v0.241 FAM111A Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence).
Growth failure v0.241 FAM111A Zornitza Stark Classified gene: FAM111A as Green List (high evidence)
Growth failure v0.241 FAM111A Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence).
Growth failure v0.240 FAM111A Zornitza Stark gene: FAM111A was added
gene: FAM111A was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: FAM111A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FAM111A were set to 32996714; 23684011
Phenotypes for gene: FAM111A were set to Kenny-Caffey syndrome, type 2, MIM@ 127000
Review for gene: FAM111A was set to GREEN
Added comment: Kenny-Caffey syndrome is characterized by severe proportionate short stature, cortical thickening and medullary stenosis of the tubular bones, delayed closure of the anterior fontanel, eye abnormalities including microphthalmia/nanophthalmos, and transient hypocalcemia.

Note monoallelic variants in this gene are also associated with gracile bone dysplasia, but this is generally perinatal lethal.
Sources: Expert Review
Growth failure v0.239 DNA2 Zornitza Stark Marked gene: DNA2 as ready
Growth failure v0.239 DNA2 Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence).
Growth failure v0.239 DNA2 Zornitza Stark Phenotypes for gene: DNA2 were changed from Seckel syndrome 8, OMIM:615807 to Seckel syndrome 8, MIM:615807
Growth failure v0.238 DNA2 Zornitza Stark Classified gene: DNA2 as Green List (high evidence)
Growth failure v0.238 DNA2 Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence).
Growth failure v0.237 DNA2 Zornitza Stark reviewed gene: DNA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24389050, 31045292; Phenotypes: Seckel syndrome 8, MIM#615807; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8900 TRPS1 Zornitza Stark Marked gene: TRPS1 as ready
Mendeliome v0.8900 TRPS1 Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence).
Mendeliome v0.8900 TRPS1 Zornitza Stark Phenotypes for gene: TRPS1 were changed from to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351
Mendeliome v0.8899 TRPS1 Zornitza Stark Publications for gene: TRPS1 were set to
Mendeliome v0.8898 TRPS1 Zornitza Stark Mode of inheritance for gene: TRPS1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8897 TRPS1 Zornitza Stark reviewed gene: TRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11112658, 10615131; Phenotypes: Trichorhinophalangeal syndrome, type I, OMIM # 190350, Trichorhinophalangeal syndrome, type III, OMIM # 190351; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.237 TRPS1 Zornitza Stark Marked gene: TRPS1 as ready
Growth failure v0.237 TRPS1 Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence).
Growth failure v0.237 TRPS1 Zornitza Stark Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131
Growth failure v0.236 PUF60 Zornitza Stark Marked gene: PUF60 as ready
Growth failure v0.236 PUF60 Zornitza Stark Gene: puf60 has been classified as Green List (High Evidence).
Growth failure v0.236 PUF60 Zornitza Stark Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400
Intellectual disability syndromic and non-syndromic v0.4080 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Intellectual disability syndromic and non-syndromic v0.4079 FGD1 Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4078 FGD1 Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8897 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Mendeliome v0.8897 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Mendeliome v0.8897 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400
Mendeliome v0.8896 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Mendeliome v0.8895 FGD1 Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8894 FGD1 Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.235 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Growth failure v0.235 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Growth failure v0.235 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from Aarskog to Aarskog-Scott syndrome, MIM # 305400
Growth failure v0.234 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia de Lange syndrome 4, MIM # 614701 to Cornelia de Lange syndrome 4, MIM # 614701
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701
Intellectual disability syndromic and non-syndromic v0.4077 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Intellectual disability syndromic and non-syndromic v0.4076 RAD21 Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4075 RAD21 Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701
Hypertrichosis syndromes v0.32 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Hypertrichosis syndromes v0.31 RAD21 Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.30 RAD21 Zornitza Stark commented on gene: RAD21: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in RAD21 gene.

Deardorff et al. (2012) reported 6 patients with CdLS phenotype with heterozygous variants (4 microdeletions incl RAD21, and 2 missense variants), showing functional evidence for the missense variants.

Krab et al. (2020) reported the clinical and molecular data in 29 patients from 22 families with CDLS4 and RAD21 variants

Many other case reports.
Hypertrichosis syndromes v0.30 RAD21 Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.233 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Growth failure v0.233 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Growth failure v0.233 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia De Lange to Cornelia de Lange syndrome 4, MIM # 614701
Growth failure v0.232 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Intellectual disability syndromic and non-syndromic v0.4074 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Intellectual disability syndromic and non-syndromic v0.4073 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4072 BRD4 Zornitza Stark Classified gene: BRD4 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4072 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4071 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v1.42 BRD4 Zornitza Stark Publications for gene: BRD4 were set to 29379197; 30302754
Microcephaly v1.41 BRD4 Zornitza Stark Classified gene: BRD4 as Green List (high evidence)
Microcephaly v1.41 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Microcephaly v1.40 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8894 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Mendeliome v0.8894 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Mendeliome v0.8894 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Mendeliome v0.8893 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Mendeliome v0.8892 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8891 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Hypertrichosis syndromes v0.29 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Hypertrichosis syndromes v0.28 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.27 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.231 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Growth failure v0.231 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Growth failure v0.231 BRD4 Zornitza Stark Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299
Growth failure v0.230 TRPS1 chirag patel Classified gene: TRPS1 as Green List (high evidence)
Growth failure v0.230 TRPS1 chirag patel Gene: trps1 has been classified as Green List (High Evidence).
Growth failure v0.229 TRPS1 chirag patel gene: TRPS1 was added
gene: TRPS1 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: TRPS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131
Phenotypes for gene: TRPS1 were set to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351
Review for gene: TRPS1 was set to GREEN
Added comment: Trichorhinophalangeal syndrome (TRPS) is characterised by sparse, slowly growing scalp hair, laterally sparse eyebrows, bulbous tip of the nose, protruding ears, long flat philtrum, thin upper vermillion border, cone-shaped epiphyses (middle phalanges), and hip malformations (coxa plana, coxa magna, or coxa vara, degenerative arthrosis). TRPS3 differs from TRPS1 by the presence of severe brachydactyly, due to short metacarpals, and severe short stature.

Momeni et al. (2000) identified 6 different nonsense mutations in the TRPS1 gene in 10 unrelated patients. Ludecke et al. (2001) found 35 different mutations in TRPS1 in 44 unrelated patients with TRPS I or TRPS III. The detection rate (86%) indicated that TRPS1 is the major locus for both type I and type III TRPS. They found no mutation in the parents of sporadic patients or in apparently healthy relatives of familial patients, indicating complete penetrance of TRPS1 mutations.
Sources: Literature
Growth failure v0.228 PUF60 chirag patel Classified gene: PUF60 as Green List (high evidence)
Growth failure v0.228 PUF60 chirag patel Gene: puf60 has been classified as Green List (High Evidence).
Growth failure v0.227 PUF60 chirag patel gene: PUF60 was added
gene: PUF60 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: PUF60 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958
Phenotypes for gene: PUF60 were set to Verheij syndrome, OMIM # 615583
Review for gene: PUF60 was set to GREEN
Added comment: Verheij syndrome is characterised by growth retardation, delayed psychomotor development, dysmorphic facial features, skeletal/vertebral abnormalities, coloboma, renal defects, and cardiac defects. Over 25 patients reported in literature with deletions and SNVs involving PUF60.
Sources: Literature
Growth failure v0.226 FGD1 chirag patel Classified gene: FGD1 as Green List (high evidence)
Growth failure v0.226 FGD1 chirag patel Gene: fgd1 has been classified as Green List (High Evidence).
Growth failure v0.225 FGD1 chirag patel reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, OMIM # 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.225 RAD21 chirag patel Classified gene: RAD21 as Green List (high evidence)
Growth failure v0.225 RAD21 chirag patel Gene: rad21 has been classified as Green List (High Evidence).
Growth failure v0.224 RAD21 chirag patel reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, OMIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.224 BRD4 chirag patel Classified gene: BRD4 as Green List (high evidence)
Growth failure v0.224 BRD4 chirag patel Gene: brd4 has been classified as Green List (High Evidence).
Growth failure v0.223 BRD4 chirag patel gene: BRD4 was added
gene: BRD4 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: BRD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299
Phenotypes for gene: BRD4 were set to Cornelia de Lange syndrome (no OMIM# yet)
Review for gene: BRD4 was set to GREEN
Added comment: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in the BRD4 gene.

Olley et al. (2018) report 4 patients with CdLS phenotype with 4 different variants (1 deletion incl BRD4, 1 missense, and 2 frameshift). Alesi et al. (2019) reported a patient with 19p13.12p13.11 deletion including BRD4 with CdLS phenotype.

Olley et al (2021) provided further functional evidence for the previous missense variant, showing it reduces BRD4-occupancy at enhancers it does not affect transcription of the pluripotency network in mouse embryonic stem cells. Rather, it delays the cell cycle, increases DNA damage signalling, and perturbs regulation of DNA repair in mutant cells.

Houzelstein et al. (2002) showed that mice with heterozygous LOF mutations in Brd4 have marked early postnatal mortality, severe prenatal onset growth failure, abnormalities of the craniofacial skeleton and reduced body fat19; all features common in CdLS.
Sources: Literature
Cardiomyopathy_Paediatric v0.106 JPH2 Zornitza Stark Phenotypes for gene: JPH2 were changed from Cardiomyopathy, hypertrophic, MIM#613873 to Cardiomyopathy, hypertrophic, MIM#613873; Cardiomyopathy, dilated, 2E, MIM# 619492