| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Hand and foot malformations v0.0 | FBN1 |
Bryony Thompson gene: FBN1 was added gene: FBN1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FBN1 were set to Marfan syndrome 154700; Weill-Marchesani syndrome 2, dominant 608328; Stiff skin syndrome 184900; Acromicric dysplasia 102370; Geleophysic dysplasia 2 614185 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | FBLN1 |
Bryony Thompson gene: FBLN1 was added gene: FBLN1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: FBLN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: FBLN1 were set to Synpolydactyly, 3/3'4, associated with metacarpal and metatarsal synostoses 608180 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | FAT1 |
Bryony Thompson gene: FAT1 was added gene: FAT1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: FAT1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ESCO2 |
Bryony Thompson gene: ESCO2 was added gene: ESCO2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ESCO2 were set to SC phocomelia syndrome 269000; Roberts syndrome 268300 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | EP300 |
Bryony Thompson gene: EP300 was added gene: EP300 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: EP300 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EP300 were set to Rubinstein-Taybi syndrome 180849 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | EOGT |
Bryony Thompson gene: EOGT was added gene: EOGT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: EOGT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EOGT were set to Adams Oliver syndrome 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DYNC1I1 |
Bryony Thompson gene: DYNC1I1 was added gene: DYNC1I1 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: DYNC1I1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DVL3 |
Bryony Thompson gene: DVL3 was added gene: DVL3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DVL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DVL3 were set to Robinow syndrome, autosomal dominant 3, 616894 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DVL1 |
Bryony Thompson gene: DVL1 was added gene: DVL1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DVL1 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Phenotypes for gene: DVL1 were set to Robinow syndrome, autosomal dominant 2, MIM# 616331 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DPF2 |
Bryony Thompson gene: DPF2 was added gene: DPF2 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: DPF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DPF2 were set to Coffin-Siris syndrome 7 MIM#618027 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DOCK6 |
Bryony Thompson gene: DOCK6 was added gene: DOCK6 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DOCK6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DOCK6 were set to Adams-Oliver syndrome 2 614219 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DLX6 |
Bryony Thompson gene: DLX6 was added gene: DLX6 was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: DLX6 was set to Unknown Phenotypes for gene: DLX6 were set to Split-hand/foot malformation 1 183600; Split-hand/foot malformation 1 with sensorineural hearing loss 220600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DLX5 |
Bryony Thompson gene: DLX5 was added gene: DLX5 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DLX5 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: DLX5 were set to Split-hand/foot malformation 1 with sensorineural hearing loss 220600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DLL4 |
Bryony Thompson gene: DLL4 was added gene: DLL4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DLL4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DLL4 were set to Adams-Oliver syndrome 6, 616589 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DHODH |
Bryony Thompson gene: DHODH was added gene: DHODH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DHODH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHODH were set to Miller syndrome (postaxial acrofacial dysostosis) 263750 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | DHCR7 |
Bryony Thompson gene: DHCR7 was added gene: DHCR7 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome 270400 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | CREBBP |
Bryony Thompson gene: CREBBP was added gene: CREBBP was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CREBBP were set to Rubinstein-Taybi syndrome 180849 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | CHUK |
Bryony Thompson gene: CHUK was added gene: CHUK was added to Hand and foot malformation. Sources: Expert list Mode of inheritance for gene: CHUK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHUK were set to ?Popliteal pterygium syndrome, Bartsocas-Papas type 2 MIM#619339; Cocoon syndrome MIM#613630 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | CHSY1 |
Bryony Thompson gene: CHSY1 was added gene: CHSY1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome 605282 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | CDH3 |
Bryony Thompson gene: CDH3 was added gene: CDH3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CDH3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CDH3 were set to Ectodermal dysplasia, ectrodactyly, and macular dystrophy 225280 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | FAM58A |
Bryony Thompson gene: FAM58A was added gene: FAM58A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: FAM58A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: FAM58A were set to STAR syndrome 300707 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | CACNA1C |
Bryony Thompson gene: CACNA1C was added gene: CACNA1C was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: CACNA1C was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: CACNA1C were set to Timothy syndrome MIM#601005 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | BMPR1B |
Bryony Thompson gene: BMPR1B was added gene: BMPR1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: BMPR1B was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: BMPR1B were set to Acromesomelic dysplasia, Demirhan type 609441; Brachydactyly, type A1, D 616849; Brachydactyly, type A2 112600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | BMP2 |
Bryony Thompson gene: BMP2 was added gene: BMP2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: BMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BMP2 were set to Brachydactyly, type A2 112600; short stature, facial dysmorphism and skeletal anomalies with or without cardiac aomalies 617877. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | B9D1 |
Bryony Thompson gene: B9D1 was added gene: B9D1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: B9D1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B9D1 were set to Meckel syndrome 9 614209 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | B3GLCT |
Bryony Thompson gene: B3GLCT was added gene: B3GLCT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B3GLCT were set to O-fucose-specific beta-1,3-N-glucosyltransferase deficiency (Disorders of protein O-glycosylation, O-mannosylglycan synthesis deficiencies); Peters-plus syndrome 261540 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ARID1B |
Bryony Thompson gene: ARID1B was added gene: ARID1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome type 1 - 135900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ARID1A |
Bryony Thompson gene: ARID1A was added gene: ARID1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARID1A were set to Coffin-Siris |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ARHGAP31 |
Bryony Thompson gene: ARHGAP31 was added gene: ARHGAP31 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARHGAP31 were set to Adams-Oliver syndrome 1 100300 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ANKRD11 |
Bryony Thompson gene: ANKRD11 was added gene: ANKRD11 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ANKRD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANKRD11 were set to KBG syndrome 148050 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | AFF4 |
Bryony Thompson gene: AFF4 was added gene: AFF4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ADAMTS17 |
Bryony Thompson gene: ADAMTS17 was added gene: ADAMTS17 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ADAMTS17 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAMTS17 were set to Weill-Marchesani syndrome type 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ADAMTS10 |
Bryony Thompson gene: ADAMTS10 was added gene: ADAMTS10 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ADAMTS10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAMTS10 were set to Weill-Marchesani syndrome 1, recessive, 277600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | ACVR1 |
Bryony Thompson gene: ACVR1 was added gene: ACVR1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list Mode of inheritance for gene: ACVR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACVR1 were set to Fibrodysplasia ossificans progressiva 135100 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.0 | Bryony Thompson Added panel Hand and foot malformation | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.240 | TMEM107 | Bryony Thompson Classified gene: TMEM107 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.240 | TMEM107 | Bryony Thompson Gene: tmem107 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.239 | TMEM107 |
Bryony Thompson gene: TMEM107 was added gene: TMEM107 was added to Polydactyly. Sources: Expert list Mode of inheritance for gene: TMEM107 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM107 were set to 22698544; 26123494; 26518474 Phenotypes for gene: TMEM107 were set to Meckel syndrome 13 MIM#617562; Orofaciodigital syndrome XVI MIM#617563 Review for gene: TMEM107 was set to GREEN gene: TMEM107 was marked as current diagnostic Added comment: At least four unrelated families with polydactyly as a feature of the condition and a supporting null mouse model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.238 | MAP3K20 | Bryony Thompson Marked gene: MAP3K20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.238 | MAP3K20 | Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.238 | MAP3K20 | Bryony Thompson Classified gene: MAP3K20 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.238 | MAP3K20 | Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.237 | MAP3K20 |
Bryony Thompson gene: MAP3K20 was added gene: MAP3K20 was added to Polydactyly. Sources: Expert list Mode of inheritance for gene: MAP3K20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAP3K20 were set to 26755636; 32266845 Phenotypes for gene: MAP3K20 were set to Split-foot malformation with mesoaxial polydactyly MIM#616890 Review for gene: MAP3K20 was set to GREEN Added comment: PMID: 26755636 - Polydactyly is a feature of the condition in two consanguineous families with homozygous variants. A mouse model recapitulates the phenotype. PMID: 32266845 - A heterozygous missense was identified in a case with split hand/foot malformation (SHFM), but also large deletion including SHFM-causing genes is also present Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Marked gene: ECHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Classified gene: ECHS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.118 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Marked gene: EARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Classified gene: EARS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.117 | EARS2 | Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.121 | ARID1B | Bryony Thompson Marked gene: ARID1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.121 | ARID1B | Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.121 | ARID1B | Bryony Thompson Publications for gene: ARID1B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.120 | ARID1B | Bryony Thompson Mode of inheritance for gene: ARID1B was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.119 | ARID1B | Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported, at least one case identified in a skeletal dysplasia cohort. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.119 | ARID1B | Bryony Thompson Classified gene: ARID1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.119 | ARID1B | Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.118 | ARID1B | Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. > cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.118 | ARID1B | Bryony Thompson reviewed gene: ARID1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 34122524; Phenotypes: Coffin-Siris syndrome 1 MIM#135900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.118 | ARID1A | Bryony Thompson Marked gene: ARID1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.118 | ARID1A | Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.118 | ARID1A | Bryony Thompson Publications for gene: ARID1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.117 | ARID1A | Bryony Thompson Mode of inheritance for gene: ARID1A was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.116 | ARID1A | Bryony Thompson Classified gene: ARID1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.116 | ARID1A | Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.115 | ARID1A | Bryony Thompson changed review comment from: At least 5 cases have been reported with skeletal anomalies as a feature of the condition. Mosaicism is very common for the gene.; to: At least 5 cases have been reported with skeletal anomalies (brachydactyly and polydactyly) as a feature of the condition. Mosaicism is very common for the gene. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.115 | ARID1A | Bryony Thompson reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 32888375; Phenotypes: Coffin-Siris syndrome 2 MM#614607; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.116 | ECHS1 |
Danielle Ariti gene: ECHS1 was added gene: ECHS1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: ECHS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ECHS1 were set to 33528536; 34364746; 32858208 Phenotypes for gene: ECHS1 were set to Cerebral Palsy; Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277 Review for gene: ECHS1 was set to GREEN Added comment: Two cases in CP cohort reported with compound heterozygous ECHS1variants. One of the individuals presented with delayed motor skills with coordination problems, dystonia (at age 11), and spasticity in upper and lower limbs. ECHS1 variants cause an inborn error of metabolism disorder characterised by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Some of these cases display paroxysmal and non-paroxysmal dystonia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.116 | EARS2 |
Danielle Ariti gene: EARS2 was added gene: EARS2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: EARS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EARS2 were set to 33528536; 34364746 Phenotypes for gene: EARS2 were set to Cerebral Palsy; Combined oxidative phosphorylation deficiency 12 MIM# 614924 Review for gene: EARS2 was set to GREEN Added comment: Two individuals in CP cohort reported with bi-allelic EARS2 variants. One of the individuals presented with severe ID, ASD and seizures on top of impaired motor symptoms. Overlapping CP phenotype with COXPD12- mitochondrial neurologic disorder characterised by onset in infancy of hypotonia and delayed psychomotor development, or early developmental regression. Severe cases can present with Dystonia, Spastic tetraparesis and/or lack of speech. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1195 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Classified gene: SPEN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.130 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.168 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.168 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.168 | SPEN | Zornitza Stark Classified gene: SPEN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.168 | SPEN | Zornitza Stark Gene: spen has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Marked gene: SPEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.93 | SPEN | Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Marked gene: AFF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Classified gene: AFF4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.115 | AFF4 | Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.114 | AFF4 |
Bryony Thompson gene: AFF4 was added gene: AFF4 was added to Skeletal dysplasia. Sources: Other Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AFF4 were set to 25730767; 31058441 Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368 Mode of pathogenicity for gene: AFF4 was set to Other Review for gene: AFF4 was set to GREEN gene: AFF4 was marked as current diagnostic Added comment: CHOPS syndrome: C for Cognitive impairment and Coarse facies, H for Heart defects, O for Obesity, P for Pulmonary involvement and S for Short stature and Skeletal dysplasia. 8 out of 11 cases had skeletal dysplasia as a feature of the condition. Gain-of-function is the mechanism of disease. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Marked gene: DDX3X as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Classified gene: DDX3X as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.116 | DDX3X | Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Marked gene: DDHD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Classified gene: DDHD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.115 | DDHD2 | Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.114 | DDX3X |
Danielle Ariti gene: DDX3X was added gene: DDX3X was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: DDX3X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: DDX3X were set to 33528536 Phenotypes for gene: DDX3X were set to Cerebral Palsy; Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958 Review for gene: DDX3X was set to GREEN Added comment: 6 individuals in CP cohort reported with de novo DDX3X variants. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.114 | DDHD2 |
Danielle Ariti gene: DDHD2 was added gene: DDHD2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: DDHD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDHD2 were set to 30705080; 34077496; 34321325 Phenotypes for gene: DDHD2 were set to Cerebral Palsy; Spastic paraplegia 54, autosomal recessive MIM# 615033 Review for gene: DDHD2 was set to GREEN Added comment: Two individuals reported in CP cohort. Phenotype-Spastic diplegia, and ID. Multiple reports of CP-mimic patients with global developmental delay and non-progressive spastic gait. SPG54 individuals display CP-like phenotype such as intellectual disability, early-onset spasticity of the lower limbs and delayed psychomotor development. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.114 | DDC | Zornitza Stark Marked gene: DDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.114 | DDC | Zornitza Stark Added comment: Comment when marking as ready: Phenotypic overlap with CP: ID and movement disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.114 | DDC | Zornitza Stark Gene: ddc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.114 | DDC | Zornitza Stark Classified gene: DDC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.114 | DDC | Zornitza Stark Gene: ddc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Marked gene: CYP2U1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Classified gene: CYP2U1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.113 | CYP2U1 | Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Marked gene: COL4A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Classified gene: COL4A2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.112 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.111 | DDC |
Danielle Ariti gene: DDC was added gene: DDC was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: DDC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDC were set to 33528536; 30799092; 33996177 Phenotypes for gene: DDC were set to Aromatic L-amino acid decarboxylase deficiency MIM# 608643 Review for gene: DDC was set to AMBER Added comment: Single case reported in CP cohort with Dystonic cerebral palsy. Multiple AADCD cases reported as CP- mimics due to phenotype overlap: dystonia and developmental delay. AADCD being is an inborn error in neurotransmitter metabolism disorder that leads to combined serotonin and catecholamine deficiency. Clinically characterised by vegetative symptoms, oculogyric crises, dystonia, and severe neurologic dysfunction (infancy/ early childhood); displays CP-like features. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1194 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to AMBER gene: SPEN was marked as current diagnostic Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Seizures were observed in only 3/32 (~9%) of patients Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.167 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Autism. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to GREEN gene: SPEN was marked as current diagnostic Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.129 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to GREEN gene: SPEN was marked as current diagnostic Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.92 | SPEN |
Elena Savva gene: SPEN was added gene: SPEN was added to Deafness_IsolatedAndComplex. Sources: Literature Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPEN were set to PMID: 33596411 Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312 Review for gene: SPEN was set to AMBER Added comment: PMID: 33596411 - 34 individuals with truncating variants in SPEN reported, most are de novo variants. - Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females. - Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females. Hearing loss reported in ~10% of patients, uncommon phenotype Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.111 | CYP2U1 |
Danielle Ariti changed review comment from: Single case reported in CP cohort (bi-allelic c.A947T variant). SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia. Sources: Expert list; to: Single case reported in CP cohort (bi-allelic p.D316V variant). SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.111 | CYP2U1 |
Danielle Ariti gene: CYP2U1 was added gene: CYP2U1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: CYP2U1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CYP2U1 were set to 33528536; 29761117; 23176821 Phenotypes for gene: CYP2U1 were set to Cerebral Palsy; Spastic paraplegia 56, autosomal recessive MIM# 615030 Review for gene: CYP2U1 was set to GREEN Added comment: Single case reported in CP cohort (bi-allelic c.A947T variant). SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Imprinting disorders v0.3 | NLRP5 | Anna Le Fevre reviewed gene: NLRP5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26323243, 31829238, 29574422, 30877238, 32222962, 34440388; Phenotypes: Miscarriage, Beckwith-Wiedemann syndrome, Multi locus imprinting disturbance in offspring; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.111 | COL4A2 |
Danielle Ariti gene: COL4A2 was added gene: COL4A2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: COL4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COL4A2 were set to 33528536; 33912663 Phenotypes for gene: COL4A2 were set to Cerebral Palsy; Brain small vessel disease 2 MIM# 614483 Review for gene: COL4A2 was set to GREEN Added comment: 7 individuals in CP cohort have been reported with mono-allelic COL4A2 variants. Phenotypic overlap: Spastic Triplegia, ID (no language), porencephaly and seizures. 2 siblings reported with bi-allelic variants; Spastic Cerebral Palsy with ID and Epilepsy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.111 | ATL1 | Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.111 | ATL1 | Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.110 | ATL1 | Zornitza Stark Publications for gene: ATL1 were set to PMID: 32989326 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.109 | ATL1 | Zornitza Stark Classified gene: ATL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.109 | ATL1 | Zornitza Stark Gene: atl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Imprinting disorders v0.3 | ZNF445 |
Anna Le Fevre gene: ZNF445 was added gene: ZNF445 was added to Imprinting disorders. Sources: Literature Mode of inheritance for gene: ZNF445 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF445 were set to PMID: 34039421; 30602440; 30846001 Phenotypes for gene: ZNF445 were set to Temple syndrome; Multi locus imprinting disturbance (MLID) Penetrance for gene: ZNF445 were set to unknown Review for gene: ZNF445 was set to AMBER Added comment: Suggested rating: AMBER Single report (Kagami 2021) of a child with Temple syndrome and MLID found to have a novel homozygous truncating variant in ZNF445. ZNF445 has been shown to play a critical role in the maintenance of postfertilisation methylation imprints (Takahashi 2019). Mechanism and parent of origin effects remain uncertain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Marked gene: NGLY1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Classified gene: NGLY1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.107 | NGLY1 | Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Marked gene: NEXMIF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Classified gene: NEXMIF as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.106 | NEXMIF | Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Marked gene: PANK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Classified gene: PANK2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.105 | PANK2 | Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.104 | NDUFAF2 | Zornitza Stark Marked gene: NDUFAF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.104 | NDUFAF2 | Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.104 | NDUFAF2 | Zornitza Stark Phenotypes for gene: NDUFAF2 were changed from Cerebral palsy to Cerebral palsy; Mitochondrial complex I deficiency nuclear type 10 (OMIM 618233) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.103 | NDUFAF2 | Zornitza Stark Classified gene: NDUFAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.103 | NDUFAF2 | Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Marked gene: NDUFA12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Classified gene: NDUFA12 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.102 | NDUFA12 | Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.101 | NALCN | Zornitza Stark Marked gene: NALCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.101 | NALCN | Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.101 | NALCN | Zornitza Stark Phenotypes for gene: NALCN were changed from Cerebral palsy to Cerebral palsy; Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.100 | NALCN | Zornitza Stark Classified gene: NALCN as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.100 | NALCN | Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | ATL1 | Clare van Eyk reviewed gene: ATL1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33528536, PMID: 34321325; Phenotypes: Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NALCN | Clare van Eyk edited their review of gene: NALCN: Changed phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFA12 | Clare van Eyk Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFA12 | Clare van Eyk edited their review of gene: NDUFA12: Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort.; Changed phenotypes: Mitochondrial complex I deficiency, nuclear type 23 (OMIM 618244) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NEXMIF | Clare van Eyk Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NEXMIF | Clare van Eyk edited their review of gene: NEXMIF: Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date.; Changed phenotypes: X-linked intellectual disability 98 (OMIM:300912) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | PANK2 |
Clare van Eyk gene: PANK2 was added gene: PANK2 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: PANK2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PANK2 were set to PMID: 33098801 Phenotypes for gene: PANK2 were set to HARP syndrome ( OMIM 607236); Neurodegeneration with brain iron accumulation 1 (OMIM 234200) Review for gene: PANK2 was set to AMBER Added comment: One case reported with dystonic cerebral palsy. Dystonia and spasticity are reported in cases with variants in PANK2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NGLY1 |
Clare van Eyk gene: NGLY1 was added gene: NGLY1 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NGLY1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NGLY1 were set to PMID:33528536 Phenotypes for gene: NGLY1 were set to Congenital disorder of deglycosylation (OMIM 615273) Review for gene: NGLY1 was set to GREEN Added comment: Three cases with biallelic P/LP variants reported in Clinical Laboratory Referral Cohort retrospectively analysed for genetic determinants of cerebral palsy. Autosomal recessive, multisystem disorder with some overlapping clinical features with cerebral palsy, but this is a progressive condition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFAF2 | Clare van Eyk reviewed gene: NDUFAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: mitochondrial complex I deficiency nuclear type 10 (OMIM 618233); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFAF2 | Clare van Eyk Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NEXMIF |
Clare van Eyk changed review comment from: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date. Sources: Expert list; to: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NEXMIF |
Clare van Eyk gene: NEXMIF was added gene: NEXMIF was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: NEXMIF was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: NEXMIF were set to X-linked Intellectual disability; epilepsy; autism Penetrance for gene: NEXMIF were set to Incomplete Review for gene: NEXMIF was set to RED Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFAF2 |
Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype. Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Overlapping clinical phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFAF2 |
Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFAF2 |
Clare van Eyk gene: NDUFAF2 was added gene: NDUFAF2 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NDUFAF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFAF2 were set to PMID:33528536; PMID:34364746 Phenotypes for gene: NDUFAF2 were set to Cerebral palsy Review for gene: NDUFAF2 was set to GREEN Added comment: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NDUFA12 |
Clare van Eyk gene: NDUFA12 was added gene: NDUFA12 was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NDUFA12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA12 were set to PMID:34364746 Phenotypes for gene: NDUFA12 were set to Spastic tetraparesis; intellectual disability; encephalopathy Review for gene: NDUFA12 was set to AMBER Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NALCN | Clare van Eyk reviewed gene: NALCN: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: Cerebral palsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NALCN | Clare van Eyk Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | NALCN |
Clare van Eyk gene: NALCN was added gene: NALCN was added to Cerebral Palsy. Sources: Literature Mode of inheritance for gene: NALCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NALCN were set to PMID:33528536; 34364746 Phenotypes for gene: NALCN were set to Cerebral palsy Review for gene: NALCN was set to AMBER Added comment: One case with pathogenic variant from clinical laboratory referral cohort. One additional VUS from tertiary care setting. NALCN variants cause a congenital disorder with contractures of the limbs, abnormal facial features, hypotonia, and developmental delay (OMIM: 611549). Cerebral palsy has not been described previously. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9203 | CARMIL2 | Zornitza Stark Marked gene: CARMIL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9203 | CARMIL2 | Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9203 | CARMIL2 | Zornitza Stark Phenotypes for gene: CARMIL2 were changed from to Immunodeficiency 58, MIM# 618131; Early onset paediatric inflammatory bowel disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9202 | CARMIL2 | Zornitza Stark Publications for gene: CARMIL2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9201 | CARMIL2 | Zornitza Stark Mode of inheritance for gene: CARMIL2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9200 | CARMIL2 | Zornitza Stark reviewed gene: CARMIL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29479355, 28112205, 27896283, 33723309; Phenotypes: Immunodeficiency 58, MIM# 618131, Early onset paediatric inflammatory bowel disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Marked gene: CARMIL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Classified gene: CARMIL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.61 | CARMIL2 | Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.60 | CARMIL2 |
Zornitza Stark gene: CARMIL2 was added gene: CARMIL2 was added to Inflammatory bowel disease. Sources: Expert Review Mode of inheritance for gene: CARMIL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CARMIL2 were set to 33723309 Phenotypes for gene: CARMIL2 were set to Early onset paediatric inflammatory bowel disease Review for gene: CARMIL2 was set to GREEN Added comment: Bi-allelic variants in this gene are associated with immunodeficiency. Four individuals from three families reported with early onset IBD. None manifested overt clinical signs of immunodeficiency before their diagnosis. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v0.23 | SETD5 | Bryony Thompson Classified gene: SETD5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v0.23 | SETD5 | Bryony Thompson Gene: setd5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v0.22 | CHD4 | Bryony Thompson Classified gene: CHD4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v0.22 | CHD4 | Bryony Thompson Gene: chd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v0.21 | ABCC6 | Bryony Thompson Marked gene: ABCC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v0.21 | ABCC6 | Bryony Thompson Gene: abcc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v0.21 | ABCC6 | Bryony Thompson reviewed gene: ABCC6: Rating: RED; Mode of pathogenicity: None; Publications: 16086762; Phenotypes: Moya moya disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Marked gene: PNLDC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Classified gene: PNLDC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9200 | PNLDC1 | Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9199 | PNLDC1 |
Zornitza Stark gene: PNLDC1 was added gene: PNLDC1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: PNLDC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PNLDC1 were set to 34347949 Phenotypes for gene: PNLDC1 were set to Spermatogenic failure 57, MIM# 619528 Review for gene: PNLDC1 was set to GREEN Added comment: Four unrelated individuals reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9198 | FOXP1 | Zornitza Stark Marked gene: FOXP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9198 | FOXP1 | Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9198 | FOXP1 | Zornitza Stark Phenotypes for gene: FOXP1 were changed from to Mental retardation with language impairment and with or without autistic features, MIM# 613670 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 | FOXP1 | Zornitza Stark Marked gene: FOXP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 | FOXP1 | Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 | FOXP1 | Zornitza Stark Classified gene: FOXP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 | FOXP1 | Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.87 | FOXP1 |
Zornitza Stark gene: FOXP1 was added gene: FOXP1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review Mode of inheritance for gene: FOXP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOXP1 were set to 27657687 Phenotypes for gene: FOXP1 were set to Mental retardation with language impairment and with or without autistic features, MIM# 613670 Review for gene: FOXP1 was set to GREEN Added comment: Well established association with syndromic ID. Multiple individuals reported with congenital anomalies of the kidneys and urinary tract in PMID 27657687. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Marked gene: ZMYM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Classified gene: ZMYM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.129 | ZMYM2 | Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.128 | ZMYM2 |
Zornitza Stark gene: ZMYM2 was added gene: ZMYM2 was added to Congenital Heart Defect. Sources: Expert Review Mode of inheritance for gene: ZMYM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZMYM2 were set to 32891193 Phenotypes for gene: ZMYM2 were set to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 Review for gene: ZMYM2 was set to GREEN Added comment: Connaughton et al (2020 - PMID: 32891193) report on 19 individuals (from 15 unrelated families) with heterozygous pathogenic ZMYM2 variants. Affected individuals from 7 families presented with CAKUT while all of them displayed extra-renal features. Neurological manifestations were reported in 16 individuals from 14 families (data not available for 1 fam), among others hypotonia (3/14 fam), speech delay (4/14 fam), global DD (9/14 fam), ID (4/14 fam), microcephaly (4/14 fam). ASD was reported in 4 fam (4 indiv). Seizures were reported in 2 fam (2 indiv). Variable other features included cardiac defects, facial dysmorphisms, small hands and feet with dys-/hypo-plastic nails and clinodactyly. 14 pLoF variants were identified, in most cases as de novo events (8 fam). In 2 families the variant was inherited from an affected parent. Germline mosaicism occurred in 1 family. The human disease features were recapitulated in a X. tropicalis morpholino knockdown, with expression of truncating variants failing to rescue renal and craniofacial defects. Heterozygous Zmym2-deficient mice also recapitulated the features of CAKUT. ZMYM2 (previously ZNF198) encodes a nuclear zinc finger protein localizing to the nucleus (and PML nuclear body). It has previously been identified as transcriptional corepressor interacting with nuclear receptors and the LSD1-CoREST-HDAC1 complex. It has also been shown to interact with FOXP transcription factors. The authors provide evidence for loss of interaction of the truncated ZMYM2 with FOXP1 (mutations in the latter having recently been reported in syndromic CAKUT). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9197 | ZMYM2 | Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.86 | ZMYM2 | Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 | ZMYM2 | Zornitza Stark reviewed gene: ZMYM2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4130 | ZMYM2 | Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4129 | ZMYM2 | Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9197 | HCN2 | Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9196 | HCN2 | Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1194 | HCN2 | Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1193 | HCN2 | Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9196 | HSCB | Zornitza Stark Marked gene: HSCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9196 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9196 | HSCB | Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9196 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9195 | HSCB |
Zornitza Stark gene: HSCB was added gene: HSCB was added to Mendeliome. Sources: Expert list Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSCB were set to 32634119 Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5, MIM# 619523 Review for gene: HSCB was set to AMBER Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v1.2 | HSCB | Zornitza Stark Marked gene: HSCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v1.2 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v1.2 | HSCB | Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v1.2 | HSCB | Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v1.1 | HSCB |
Zornitza Stark gene: HSCB was added gene: HSCB was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSCB were set to 32634119 Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5 619523 Review for gene: HSCB was set to AMBER Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9194 | FAM57B | Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9193 | FAM57B | Zornitza Stark edited their review of gene: FAM57B: Changed phenotypes: Cone-rod dystrophy 22, MIM# 619531, Maculopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Marked gene: FAM57B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Classified gene: FAM57B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.31 | FAM57B | Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.30 | FAM57B |
Zornitza Stark gene: FAM57B was added gene: FAM57B was added to Cone-rod Dystrophy. Sources: Expert Review new gene name tags were added to gene: FAM57B. Mode of inheritance for gene: FAM57B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM57B were set to 33077892 Phenotypes for gene: FAM57B were set to Cone-rod dystrophy 22, MIM# 619531; Maculopathy Review for gene: FAM57B was set to GREEN Added comment: 4 patients with cone-rod dystrophy or maculopathy from 3 families, with LOF pathogenic variants in TLCD3B (ceramide synthase gene). Ceramide is a proapoptotic lipid as high levels of ceramides can lead to apoptosis of neuronal cells, including photoreceptors. Variants segregated with disease. TLCD3B showed high expression in the adult retina with higher expression in the macular than in the peripheral region. Tlcd3bKO/KO mice exhibited a significant reduction of the cone photoreceptor light responses, thinning of the outer nuclear layer, and loss of cone photoreceptors across the retina. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.101 | FAM57B | Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.100 | FAM57B | Zornitza Stark reviewed gene: FAM57B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cone-rod dystrophy 22, MIM# 619531; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9193 | CADM3 | Zornitza Stark Phenotypes for gene: CADM3 were changed from Charcot-Marie-Tooth disease to Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9192 | CADM3 | Zornitza Stark reviewed gene: CADM3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | CAMTA1 |
Zornitza Stark changed review comment from: Combination of ID with ataxia overlaps with CP. Sources: Expert list; to: Combination of ID with ataxia overlaps with CP. At least 3 families reported, intragenic deletions. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Marked gene: CAMTA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Tag SV/CNV tag was added to gene: CAMTA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Classified gene: CAMTA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.99 | CAMTA1 | Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.98 | CAMTA1 |
Zornitza Stark gene: CAMTA1 was added gene: CAMTA1 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: CAMTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CAMTA1 were set to 22693284; 24738973 Phenotypes for gene: CAMTA1 were set to Cerebellar ataxia, nonprogressive, with mental retardation, MIM# 614756 Review for gene: CAMTA1 was set to GREEN Added comment: Combination of ID with ataxia overlaps with CP. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Marked gene: CACNA1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Classified gene: CACNA1A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.97 | CACNA1A | Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.96 | CACNA1A |
Zornitza Stark gene: CACNA1A was added gene: CACNA1A was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: CACNA1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1A were set to 29761117 Phenotypes for gene: CACNA1A were set to Developemental and epileptic encephalopathy 42, MIM# 617106; Episodic ataxia, type 2, MIM# 108500; Migraine, familial hemiplegic, 1, MIM# 141500; Migraine, familial hemiplegic, 1, with progressive cerebellar ataxia 141500; Spinocerebellar ataxia 6, MIM# 183086 Review for gene: CACNA1A was set to AMBER Added comment: Variants in this gene cause a range of phenotypes, including hemiplegia, although this tends to be episodic. Reported in a CP cohort. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.95 | BCL11A | Zornitza Stark Marked gene: BCL11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.95 | BCL11A | Zornitza Stark Gene: bcl11a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.95 | BCL11A |
Zornitza Stark gene: BCL11A was added gene: BCL11A was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: BCL11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BCL11A were set to Dias-Logan syndrome, MIM# 617101 Review for gene: BCL11A was set to RED Added comment: Intellectual disability, microcephaly, dysmorphic features and persistence of fetal haemoglobin but no specific overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.103 | BCAP31 |
Zornitza Stark gene: BCAP31 was added gene: BCAP31 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: BCAP31 were set to 24011989; 31330203; 33603160 Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 Review for gene: BCAP31 was set to GREEN Added comment: More than 20 unrelated families reported. Clinical features include severe intellectual disability (ID), dystonia, deafness, and central hypomyelination. Female carriers are mostly asymptomatic but may present with deafness. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4129 | BCAP31 | Zornitza Stark Marked gene: BCAP31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4129 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4129 | BCAP31 | Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4128 | BCAP31 | Zornitza Stark Publications for gene: BCAP31 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4127 | BCAP31 | Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4126 | BCAP31 | Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9192 | BCAP31 | Zornitza Stark Marked gene: BCAP31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9192 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9192 | BCAP31 | Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9191 | BCAP31 | Zornitza Stark Publications for gene: BCAP31 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9190 | BCAP31 | Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9189 | BCAP31 | Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Marked gene: BCAP31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Classified gene: BCAP31 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.94 | BCAP31 | Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.93 | BCAP31 |
Zornitza Stark gene: BCAP31 was added gene: BCAP31 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: BCAP31 were set to 24011989; 31330203 Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 Review for gene: BCAP31 was set to GREEN Added comment: Phenotypic overlap with CP due to combination of almost no psychomotor development with dystonia and pyramidal signs. At least one patient reported who specifically had a CP diagnosis. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Marked gene: AUTS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Classified gene: AUTS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.91 | AUTS2 | Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.90 | AUTS2 |
Zornitza Stark gene: AUTS2 was added gene: AUTS2 was added to Cerebral Palsy. Sources: Expert list SV/CNV tags were added to gene: AUTS2. Mode of inheritance for gene: AUTS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AUTS2 were set to 23332918; 27075013 Phenotypes for gene: AUTS2 were set to Mental retardation, autosomal dominant 26, MIM# 615834 Review for gene: AUTS2 was set to GREEN Added comment: Multiple individuals reported with ID/autism, but 'cerebral palsy' was the original clinical diagnosis in some. Predominantly deletions reported, so may not be tractable by all NGS assays. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Marked gene: AFF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Classified gene: AFF4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.33 | AFF4 | Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.32 | AFF4 |
Zornitza Stark gene: AFF4 was added gene: AFF4 was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Expert Review Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AFF4 were set to 31058441; 25730767 Phenotypes for gene: AFF4 were set to CHOPS syndrome, MIM# 616368 Review for gene: AFF4 was set to GREEN Added comment: Chronic interstitial lung disease is a feature of this condition. More than 15 unrelated individuals reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.89 | ATRX | Zornitza Stark Marked gene: ATRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.89 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.89 | ATRX | Zornitza Stark Classified gene: ATRX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.89 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.88 | ATRX |
Zornitza Stark gene: ATRX was added gene: ATRX was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ATRX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ATRX were set to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580 Review for gene: ATRX was set to GREEN Added comment: ID and hypotonia/hypertonia/spasticity: phenotypic overlap with CP. Well established gene-disease association. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Marked gene: ATP1A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark edited their review of gene: ATP1A3: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Classified gene: ATP1A3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.87 | ATP1A3 | Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.86 | ATP1A3 |
Zornitza Stark gene: ATP1A3 was added gene: ATP1A3 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ATP1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ATP1A3 were set to Alternating hemiplegia of childhood 2, MIM# 614820; CAPOS syndrome, MIM# 601338; Dystonia-12, MIM# 128235 Review for gene: ATP1A3 was set to GREEN Added comment: The disorders associated with variants in this gene tend to have episodic symptoms, insufficient overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.85 | ASXL3 | Zornitza Stark Marked gene: ASXL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.85 | ASXL3 | Zornitza Stark Gene: asxl3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.85 | ASXL3 |
Zornitza Stark gene: ASXL3 was added gene: ASXL3 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ASXL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ASXL3 were set to Bainbridge-Ropers syndrome, MIM# 615485 Review for gene: ASXL3 was set to RED Added comment: Severe neurodevelopmental disorder but no strong overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.84 | ARX | Zornitza Stark Marked gene: ARX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.84 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.84 | ARX | Zornitza Stark Classified gene: ARX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.84 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.83 | ARX |
Zornitza Stark gene: ARX was added gene: ARX was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ARX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ARX were set to Developmental and epileptic encephalopathy 1, MIM# 308350; Lissencephaly, X-linked 2, MIM# 300215; Proud syndrome, MIM# 300004 Review for gene: ARX was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap: ID/seizures/abnormal tone. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Classified gene: AMPD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.82 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4126 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4126 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4126 | AMPD2 | Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4125 | AMPD2 | Zornitza Stark Publications for gene: AMPD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4124 | AMPD2 | Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4123 | AMPD2 | Zornitza Stark reviewed gene: AMPD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23911318, 27066553; Phenotypes: Pontocerebellar hypoplasia, type 9, MIM#615809; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9189 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9189 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9189 | AMPD2 | Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9188 | AMPD2 | Zornitza Stark Publications for gene: AMPD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9187 | AMPD2 | Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9186 | AMPD2 | Zornitza Stark Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9186 | AMPD2 | Zornitza Stark edited their review of gene: AMPD2: Added comment: Well established gene-disease association. Clinical features include severely delayed psychomotor development, progressive microcephaly, spasticity, seizures, and brain abnormalities, including brain atrophy, thin corpus callosum, and delayed myelination.; Changed rating: GREEN; Changed publications: 23911318, 27066553 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.81 | AMPD2 |
Zornitza Stark gene: AMPD2 was added gene: AMPD2 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: AMPD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AMPD2 were set to 23911318; 27066553; 29761117 Phenotypes for gene: AMPD2 were set to Pontocerebellar hypoplasia, type 9, MIM# 615809 Review for gene: AMPD2 was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap: ID and spastic paraplegia. Reported in CP cohort. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.79 | Zornitza Stark removed gene:ALS2 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9186 | ALS2 | Zornitza Stark Marked gene: ALS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9186 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9186 | ALS2 | Zornitza Stark Classified gene: ALS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9186 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Marked gene: ALS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Classified gene: ALS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.80 | ALS2 | Zornitza Stark Gene: als2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.79 | ALS2 |
Zornitza Stark gene: ALS2 was added gene: ALS2 was added to Cerebral Palsy. Sources: Expert Review Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALS2 were set to 12145748; 33409823; 30128655 Phenotypes for gene: ALS2 were set to Spastic paralysis, infantile onset ascending, MIM# 607225 Review for gene: ALS2 was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap with CP. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Marked gene: ALDH3A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Classified gene: ALDH3A2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.78 | ALDH3A2 | Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.77 | ALDH3A2 |
Zornitza Stark gene: ALDH3A2 was added gene: ALDH3A2 was added to Cerebral Palsy. Sources: Expert list Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ALDH3A2 were set to 9027499; 9829906; 28543186 Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome, MIM# 270200 Review for gene: ALDH3A2 was set to GREEN Added comment: Well established gene-disease association. Phenotypic overlap with CP: ID and spastic paraplegia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.222 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9185 | HBG2 | Zornitza Stark Marked gene: HBG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9185 | HBG2 | Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9185 | HBG2 | Zornitza Stark Phenotypes for gene: HBG2 were changed from to Fetal hemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9184 | HBG2 | Zornitza Stark Publications for gene: HBG2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9183 | HBG2 | Zornitza Stark Mode of inheritance for gene: HBG2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9182 | HBG2 | Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26500940; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.221 | HBG2 | Zornitza Stark Marked gene: HBG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.221 | HBG2 | Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.221 | HBG2 | Zornitza Stark Phenotypes for gene: HBG2 were changed from Cyanosis, transient neonatal, 613977; 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1,141749 to Fetal haemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.220 | HBG2 | Zornitza Stark Mode of inheritance for gene: HBG2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.219 | HBG2 | Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9182 | HBG1 | Zornitza Stark Marked gene: HBG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9182 | HBG1 | Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9182 | HBG1 | Zornitza Stark Classified gene: HBG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9182 | HBG1 | Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9181 | HBG1 |
Zornitza Stark gene: HBG1 was added gene: HBG1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: HBG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HBG1 were set to 26500940 Phenotypes for gene: HBG1 were set to Fetal haemoglobin quantitative trait locus 1, 141749 Review for gene: HBG1 was set to GREEN Added comment: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.219 | HBG1 | Zornitza Stark Marked gene: HBG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.219 | HBG1 | Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.219 | HBG1 | Zornitza Stark Phenotypes for gene: HBG1 were changed from 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1, 141749 to Fetal haemoglobin quantitative trait locus 1, 141749 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.218 | HBG1 | Zornitza Stark changed review comment from: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or hematologic manifestations.; to: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.218 | HBG1 | Zornitza Stark reviewed gene: HBG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal haemoglobin quantitative trait locus 1 141749; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.218 | RPS24 | Zornitza Stark Marked gene: RPS24 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.218 | RPS24 | Zornitza Stark Gene: rps24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.218 | RPS24 | Zornitza Stark Phenotypes for gene: RPS24 were changed from Inherited Bone Marrow Failure Syndromes; Diamond-blackfan anemia 3, 610629; Diamond-Blackfan Anemia 3; Diamond Blackfan anemia; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 3; Diamond_Blackfan Anemia 3; 610629 Diamond_Blackfan Anemia 3; 610629 Diamond-blackfan anemia 3 to Diamond-Blackfan anaemia 3, MIM# 610629 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.217 | RPS24 | Zornitza Stark Publications for gene: RPS24 were set to 17186470; 23812780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.216 | RPS19 | Zornitza Stark Marked gene: RPS19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.216 | RPS19 | Zornitza Stark Gene: rps19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.216 | RPS19 | Zornitza Stark Phenotypes for gene: RPS19 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 105650 Diamond-Blackfan anemia 1; 105650 Diamond_Blackfan Anemia 1; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 1; Diamond-Blackfan anemia 1, 105650; Diamond_Blackfan Anemia to Diamond-Blackfan anaemia 1, MIM# 105650; MONDO:0007110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.215 | RPS19 | Zornitza Stark Publications for gene: RPS19 were set to 9988267 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.214 | RPS17 | Zornitza Stark Marked gene: RPS17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.214 | RPS17 | Zornitza Stark Gene: rps17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.214 | RPS17 | Zornitza Stark Phenotypes for gene: RPS17 were changed from Diamond-Blackfan anemia 4, 612527; 612527 Diamond-Blackfan anemia 4 to Diamond-Blackfan anaemia 4, MIM# 612527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.213 | RPS10 | Zornitza Stark Marked gene: RPS10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.213 | RPS10 | Zornitza Stark Gene: rps10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.213 | RPS10 | Zornitza Stark Phenotypes for gene: RPS10 were changed from 613308 Diamond-Blackfan anemia 9; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; DIAMOND-BLACKFAN ANEMIA 9; Diamond-Blackfan Anemia 9; Diamond-Blackfan Anemia; Diamond-Blackfan anemia 9, 613308; 613308 Diamond_Blackfan Anemia 9; Diamond_Blackfan Anemia 9 to Diamond-Blackfan anaemia 9, MIM# 613308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.212 | RPS10 | Zornitza Stark Publications for gene: RPS10 were set to 20116044 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.211 | RPL9 | Zornitza Stark Marked gene: RPL9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.211 | RPL9 | Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.211 | RPL9 | Zornitza Stark Phenotypes for gene: RPL9 were changed from Diamond-Blackfan anemia; N/A Diamond-Blackfan anemia; ?Diamond-Blackfan anaemia to Diamond Blackfan anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.210 | RPL9 | Zornitza Stark Publications for gene: RPL9 were set to 29114930 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.209 | RPL9 | Zornitza Stark Classified gene: RPL9 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.209 | RPL9 | Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9180 | WNT9B | Zornitza Stark Marked gene: WNT9B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9180 | WNT9B | Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9180 | WNT9B | Zornitza Stark Phenotypes for gene: WNT9B were changed from to Renal agenesis/hypoplasia/dysplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9179 | WNT9B | Zornitza Stark Publications for gene: WNT9B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9178 | WNT9B | Zornitza Stark Mode of inheritance for gene: WNT9B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9177 | WNT9B | Zornitza Stark Classified gene: WNT9B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9177 | WNT9B | Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9176 | WNT9B | Zornitza Stark reviewed gene: WNT9B: Rating: AMBER; Mode of pathogenicity: None; Publications: 34145744; Phenotypes: Renal agenesis/hypoplasia/dysplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9176 | DDX23 | Zornitza Stark Marked gene: DDX23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9176 | DDX23 | Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9176 | DDX23 | Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9175 | DDX23 | Zornitza Stark Publications for gene: DDX23 were set to 33057194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9174 | DDX23 | Zornitza Stark Classified gene: DDX23 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9174 | DDX23 | Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9173 | DDX23 | Zornitza Stark reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: 34050707; Phenotypes: DDX23-associated neurodevelopmental disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4123 | DDX23 | Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4122 | DDX23 | Zornitza Stark Publications for gene: DDX23 were set to 33057194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.17 | CHD7 | Belinda Chong edited their review of gene: CHD7: Changed publications: PMID: 29152903, PMID: 30733481 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.17 | CHD7 | Belinda Chong reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29152903, 30733481; Phenotypes: CHARGE syndrome MIM# 214800, Hypogonadotropic hypogonadism 5 with or without anosmia MIM# 612370; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9173 | TAF2 | Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204; 24084144 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9172 | TAF2 | Zornitza Stark Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9172 | TAF2 | Zornitza Stark Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9171 | TAF2 | Zornitza Stark edited their review of gene: TAF2: Added comment: New report of 4 individuals from 2 unrelated families, with severe intellectual disability, global developmental delay, postnatal microcephaly, feet deformities and thin corpus callosum. They had homozygous TAF2 missense variants detected by Exome Sequencing.; Changed rating: GREEN; Changed publications: 21937992, 22633631, 26350204, 24084144, 34474177 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.52 | TAF2 | Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4121 | TAF2 | Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Marked gene: ERGIC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Classified gene: ERGIC1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9171 | ERGIC1 | Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9170 | ERGIC1 |
Zornitza Stark gene: ERGIC1 was added gene: ERGIC1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERGIC1 were set to 28317099; 34037256 Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100 Review for gene: ERGIC1 was set to AMBER Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi. Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.296 | ERGIC1 | Zornitza Stark Marked gene: ERGIC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.296 | ERGIC1 | Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9169 | HMGB1 | Zornitza Stark Phenotypes for gene: HMGB1 were changed from Mirror image foot polydactyly to Mirror image foot polydactyly; Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9168 | HMGB1 | Zornitza Stark Publications for gene: HMGB1 were set to 34159400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | Zornitza Stark Marked gene: HMGB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.51 | HMGB1 | Zornitza Stark Marked gene: HMGB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.51 | HMGB1 | Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Imprinting disorders v0.3 | SGCE | Anna Le Fevre reviewed gene: SGCE: Rating: GREEN; Mode of pathogenicity: None; Publications: 11528394, 12325078, 17200151, 16227522, 20301587, 33200041; Phenotypes: myoclonus, dystonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9167 | HMGB1 | chirag patel reviewed gene: HMGB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34164801; Phenotypes: Developmental delay and microcephaly, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9167 | HMGB1 | chirag patel Classified gene: HMGB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9167 | HMGB1 | chirag patel Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.51 | HMGB1 | chirag patel Phenotypes for gene: HMGB1 were changed from Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.51 | HMGB1 | chirag patel Phenotypes for gene: HMGB1 were changed from 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.50 | HMGB1 | chirag patel edited their review of gene: HMGB1: Changed phenotypes: Developmental delay and microcephaly, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.50 | HMGB1 | chirag patel Classified gene: HMGB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.50 | HMGB1 | chirag patel Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.49 | HMGB1 |
chirag patel gene: HMGB1 was added gene: HMGB1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HMGB1 were set to PMID: 34164801 Phenotypes for gene: HMGB1 were set to 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM # Review for gene: HMGB1 was set to GREEN Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | chirag patel Classified gene: HMGB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4120 | HMGB1 | chirag patel Gene: hmgb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4119 | HMGB1 |
chirag patel gene: HMGB1 was added gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HMGB1 were set to PMID: 34164801 Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM # Review for gene: HMGB1 was set to GREEN Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.296 | ERGIC1 | chirag patel Classified gene: ERGIC1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.296 | ERGIC1 | chirag patel Gene: ergic1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.295 | ERGIC1 |
chirag patel gene: ERGIC1 was added gene: ERGIC1 was added to Arthrogryposis. Sources: Literature Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERGIC1 were set to PMID: 28317099, 34037256 Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100 Review for gene: ERGIC1 was set to AMBER Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi. Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Imprinting disorders v0.3 | UBE3A | Anna Le Fevre reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 8988171, 16470747; Phenotypes: Angelman syndrome OMIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.48 | TAF2 | chirag patel Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.48 | TAF2 | chirag patel Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.47 | TAF2 | chirag patel Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.47 | TAF2 | chirag patel Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4118 | TAF2 | chirag patel Classified gene: TAF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4118 | TAF2 | chirag patel Gene: taf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Imprinting disorders v0.3 | ZFP57 | Anna Le Fevre reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393, 27075368, 23150280, 30315371, 31399135, 33053156; Phenotypes: Transient Neonatal Diabetes Mellitus Type 1, Multi Locus Imprinting Disturbance, IUGR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.46 | TAF2 | chirag patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4117 | TAF2 | chirag patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | chirag patel Classified gene: DDX23 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | chirag patel Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | chirag patel Classified gene: DDX23 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4117 | DDX23 | chirag patel Gene: ddx23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4116 | DDX23 | chirag patel reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34050707; Phenotypes: Neurodevelopmental disorder, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.208 | RPL5 | Zornitza Stark Marked gene: RPL5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.208 | RPL5 | Zornitza Stark Gene: rpl5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.208 | RPL5 | Zornitza Stark Phenotypes for gene: RPL5 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 612561 Diamond-Blackfan anemia 6; Diamond-Blackfan anemia 6, 612561; Diamond-Blackfan Anemia 6; 612561 Diamond_Blackfan Anemia 6; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 6; Diamond_Blackfan Anemia 6 to Diamond-Blackfan anemia 6, MIM# 612561; MONDO:0012937 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.207 | RPL35A | Zornitza Stark Marked gene: RPL35A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.207 | RPL35A | Zornitza Stark Gene: rpl35a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.207 | RPL35A | Zornitza Stark Phenotypes for gene: RPL35A were changed from Inherited Bone Marrow Failure Syndromes; DIAMOND-BLACKFAN ANEMIA 5; Diamond-Blackfan anemia 5, 612528; 612528 Diamond-Blackfan anemia 5; Diamond Blackfan anemia; Diamond-Blackfan Anemia; Diamond-Blackfan Anemia 5; 612528 Diamond_Blackfan Anemia 5; Diamond_Blackfan Anemia 5 to Diamond-Blackfan anaemia 5, MIM# 612528 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.206 | RPL35A | Zornitza Stark Publications for gene: RPL35A were set to 18535205 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.205 | RPL35A | Zornitza Stark Tag SV/CNV tag was added to gene: RPL35A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.205 | RPL31 | Zornitza Stark Marked gene: RPL31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.205 | RPL31 | Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.205 | RPL31 | Zornitza Stark Phenotypes for gene: RPL31 were changed from N/A ? Diamond-Blackfan Anaemia to Diamond Blackfan anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.204 | RPL31 | Zornitza Stark Classified gene: RPL31 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.204 | RPL31 | Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.203 | RPL27 | Zornitza Stark Marked gene: RPL27 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.203 | RPL27 | Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.203 | RPL27 | Zornitza Stark Phenotypes for gene: RPL27 were changed from Diamond-Blackfan anemia; Diamond-Blackfan anemia 16, 617408 to Diamond-Blackfan anemia 16, MIM# 617408 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.202 | RPL27 | Zornitza Stark Classified gene: RPL27 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.202 | RPL27 | Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9166 | FCGR2B | Zornitza Stark Marked gene: FCGR2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9166 | FCGR2B | Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9166 | FCGR2B | Zornitza Stark Phenotypes for gene: FCGR2B were changed from to {Systemic lupus erythematosus, susceptibility to} MIM#152700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9165 | FCGR2B | Zornitza Stark Publications for gene: FCGR2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9164 | FCGR2B | Zornitza Stark Mode of inheritance for gene: FCGR2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9163 | FCGR2B | Zornitza Stark Classified gene: FCGR2B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9163 | FCGR2B | Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.201 | RPS26 | Zornitza Stark Marked gene: RPS26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.201 | RPS26 | Zornitza Stark Gene: rps26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.201 | RPS26 | Zornitza Stark Phenotypes for gene: RPS26 were changed from Diamond-Blackfan anemia 10, 613309; Inherited Bone Marrow Failure Syndromes; Diamond-Blackfan anemia 10; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 613309 Diamond_Blackfan Anemia 10; Diamond_Blackfan Anemia 10; 613309 Diamond-Blackfan anemia 10 to Diamond-Blackfan anemia 10, MIM# 613309; MONDO:0013217 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.200 | RPS27 | Zornitza Stark Marked gene: RPS27 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.200 | RPS27 | Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.200 | RPS27 | Zornitza Stark Phenotypes for gene: RPS27 were changed from Diamond-Blackfan anemia; ?Diamond-Blackfan anemia 17, 617409; 617409 ?Diamond-Blackfan anemia 17, to Diamond-Blackfan anemia 17, MIM# 617409 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.199 | RPS27 | Zornitza Stark Publications for gene: RPS27 were set to 25424902; 23718193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.198 | RPS27 | Zornitza Stark Classified gene: RPS27 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.198 | RPS27 | Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.197 | RPS29 | Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, MIM# 615909 to Diamond-Blackfan anaemia 13, MIM# 615909 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.196 | RPS29 | Zornitza Stark Marked gene: RPS29 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.196 | RPS29 | Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.196 | RPS29 | Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, 615909; 615909 Diamond-Blackfan anemia 13 to Diamond-Blackfan anemia 13, MIM# 615909 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.195 | RPS29 | Zornitza Stark Classified gene: RPS29 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.195 | RPS29 | Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.194 | RPS7 | Zornitza Stark Marked gene: RPS7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.194 | RPS7 | Zornitza Stark Gene: rps7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.194 | RPS7 | Zornitza Stark Phenotypes for gene: RPS7 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan anemia 8, 612563; 612563 Diamond_Blackfan Anemia 8; DIAMOND-BLACKFAN ANEMIA 8; Diamond-Blackfan Anemia; 612563 Diamond-Blackfan anemia 8; Diamond_Blackfan Anemia 8 to Diamond-Blackfan anaemia 8, MIM# 612563; MONDO:0012939 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.193 | RPS7 | Zornitza Stark Publications for gene: RPS7 were set to 19061985; 27882484; 23718193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.192 | SBDS | Zornitza Stark Marked gene: SBDS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.192 | SBDS | Zornitza Stark Gene: sbds has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.192 | SBDS | Zornitza Stark Phenotypes for gene: SBDS were changed from 260400 Shwachman-Diamond syndrome; Shwachman-Diamond syndrome to Shwachman-Diamond syndrome, MIM# 260400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.191 | SEC23B | Zornitza Stark Marked gene: SEC23B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.191 | SEC23B | Zornitza Stark Gene: sec23b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.191 | SEC23B | Zornitza Stark Phenotypes for gene: SEC23B were changed from Congenital Dyserythropoietic Anemia; ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; 224100 ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; Anemia, dyserythropoieticcongenital, type II, 224100; Congenital dyserythropoietic anemia type II; 224100 Congenital dyserythropoietic anaemia type 2 to Dyserythropoietic anaemia, congenital, type II , MIM#224100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.190 | SEC23B | Zornitza Stark Publications for gene: SEC23B were set to 19561605 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.189 | SLC19A2 | Zornitza Stark Marked gene: SLC19A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.189 | SLC19A2 | Zornitza Stark Gene: slc19a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.189 | SLC19A2 | Zornitza Stark Phenotypes for gene: SLC19A2 were changed from 249270 Thiamine-Responsive Megaloblastic Anemia syndrome; Thiamine-Responsive Megaloblastic Anemia syndrome, 249270; 249270 Thiamine-responsive megaloblastic anemia syndrome to Thiamine-responsive megaloblastic anaemia syndrome, MIM# 249270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.188 | SLC25A38 | Zornitza Stark Marked gene: SLC25A38 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.188 | SLC25A38 | Zornitza Stark Gene: slc25a38 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.188 | SLC25A38 | Zornitza Stark Phenotypes for gene: SLC25A38 were changed from Anemia, sideroblastic, 2, pyridoxine-refractory, 205950; 205950 Pyridoxine refractory sideroblastic anaemia 2; 205950 Anemia, sideroblastic, 2, pyridoxine-refractory to Anaemia, sideroblastic, 2, pyridoxine-refractory, MIM# 205950 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.187 | XK | Zornitza Stark Marked gene: XK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.187 | XK | Zornitza Stark Gene: xk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.187 | XK | Zornitza Stark Phenotypes for gene: XK were changed from 300842 McLeod syndrome to McLeod syndrome with or without chronic granulomatous disease MIM# 300842; absence of red blood cell Kx antigen; weak expression of Kell red blood cell antigens; neuroacanthocytosis (peripheral and central nervous systems); cardiovascular abnormalities; myopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.186 | XK | Zornitza Stark Publications for gene: XK were set to 17683354; 11761473 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.185 | NHP2 | Zornitza Stark Marked gene: NHP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.185 | NHP2 | Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.185 | NHP2 | Zornitza Stark Phenotypes for gene: NHP2 were changed from 613987 Dyskeratosis congenita, autosomal recessive 2 to Dyskeratosis congenita, autosomal recessive 2, MIM# 613987 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.184 | NHP2 | Zornitza Stark Publications for gene: NHP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.183 | NHP2 | Zornitza Stark Classified gene: NHP2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.183 | NHP2 | Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.182 | NHP2 | Zornitza Stark changed review comment from: Dyskeratosis congenita is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features. Three unrelated families reported.; to: Pancytopaenia. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.182 | NHP2 | Zornitza Stark edited their review of gene: NHP2: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.182 | RPL18 | Zornitza Stark Marked gene: RPL18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.182 | RPL18 | Zornitza Stark Gene: rpl18 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.182 | RPL18 | Zornitza Stark Phenotypes for gene: RPL18 were changed from Diamond-Blackfan anaemia to Diamond-Blackfan anemia 18, MIM# 618310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.181 | RPL18 | Zornitza Stark Publications for gene: RPL18 were set to 28280134 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.180 | RPS28 | Zornitza Stark Marked gene: RPS28 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.180 | RPS28 | Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.180 | RPS28 | Zornitza Stark Phenotypes for gene: RPS28 were changed from Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 to Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.179 | RPS28 | Zornitza Stark Phenotypes for gene: RPS28 were changed from 606164 Diamond Blackfan anemia 15 with mandibulofacial dysostosis; Diamond Blackfan anemia 15 with mandibulofacial dysostosis, 606164 to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.178 | TSR2 | Zornitza Stark Marked gene: TSR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.178 | TSR2 | Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.178 | TSR2 | Zornitza Stark Phenotypes for gene: TSR2 were changed from 300946 ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis; ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, 300946 to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.177 | TSR2 | Zornitza Stark Classified gene: TSR2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.177 | TSR2 | Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.176 | ATRX | Zornitza Stark Marked gene: ATRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.176 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.176 | ATRX | Zornitza Stark Phenotypes for gene: ATRX were changed from 301040 Alpha-thalassemia/mental retardation syndrome to Alpha-thalassaemia/mental retardation syndrome, MIM# 301040 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.175 | ATRX | Zornitza Stark Publications for gene: ATRX were set to 19444090; 17579672; 11449489 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.174 | ATRX | Zornitza Stark Mode of inheritance for gene: ATRX was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.173 | ATRX | Zornitza Stark Classified gene: ATRX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.173 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.172 | ATRX | Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 7697714; Phenotypes: Alpha-thalassaemia/mental retardation syndrome, MIM# 301040; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.172 | DKC1 | Zornitza Stark Marked gene: DKC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.172 | DKC1 | Zornitza Stark Gene: dkc1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.172 | DKC1 | Zornitza Stark Phenotypes for gene: DKC1 were changed from 305000 Dyskeratosis congenita, X-linked to Dyskeratosis congenita, X-linked 305000; Hoyeraal-Hreidarsson Syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.171 | DKC1 | Zornitza Stark Publications for gene: DKC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.170 | DKC1 |
Zornitza Stark changed review comment from: Dyskeratosis congenita is classically defined by the triad of abnormal skin pigmentation, nail dystrophy, and leukoplakia of the oral mucosa. It is characterized by short telomeres. Progressive bone marrow failure occurs in over 80% of cases and is the main cause of early mortality. The phenotype is highly variable, and affected individuals may have multiple additional features, including pulmonary fibrosis, liver cirrhosis, premature hair loss and/or graying, osteoporosis, atresia of the lacrimal ducts, and learning difficulties. Males may have testicular atrophy. Predisposition to malignancy is an important feature. Hoyeraal-Hreidarsson syndrome (HHS) refers to a clinically severe variant of DKC that is characterized by multisystem involvement and early onset in utero. Patients with HHS show intrauterine growth retardation, microcephaly, delayed development, and bone marrow failure resulting in immunodeficiency, cerebellar hypoplasia, and sometimes enteropathy. Death often occurs in childhood. PMID: 25940403, at least 13 of the variants associated with dyskeratosis congenita were also reported to cause HHS: P10L, I38T, T66A, T67I, H68Q, H68Y, S121G, R158W, K314R, A353V, R378Q, A386T and IVS12+1, so NOT only variants in exon 11. Two mutations were only found in HH, T49M and S304N.; to: Pancytopaenia rather than a red cell disorder. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.170 | DKC1 | Zornitza Stark edited their review of gene: DKC1: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.170 | Zornitza Stark removed gene:HBE1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.169 | SF3B1 | Zornitza Stark Marked gene: SF3B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.169 | SF3B1 | Zornitza Stark Gene: sf3b1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.169 | SF3B1 | Zornitza Stark Phenotypes for gene: SF3B1 were changed from 605590 Refractory anaemia with ring sideroblasts to Myelodysplastic syndrome, somatic MIM# 614286 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.168 | SF3B1 | Zornitza Stark Mode of inheritance for gene: SF3B1 was changed from Unknown to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.167 | SF3B1 | Zornitza Stark Tag somatic tag was added to gene: SF3B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9162 | FCGR2B | Paul De Fazio reviewed gene: FCGR2B: Rating: RED; Mode of pathogenicity: None; Publications: 12115230, 15153543, 20385827; Phenotypes: {Systemic lupus erythematosus, susceptibility to} MIM#152700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9162 | GPX1 | Zornitza Stark Marked gene: GPX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9162 | GPX1 | Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9162 | GPX1 |
Zornitza Stark gene: GPX1 was added gene: GPX1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: GPX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GPX1 were set to 1131421; 476008; 5766310; 2492138 Phenotypes for gene: GPX1 were set to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164 Review for gene: GPX1 was set to RED Added comment: No individuals reported with GPX1 variants identified as the cause of Haemolytic anaemia due to glutathione peroxidase deficiency. Multiple papers report a number of cases of Haemolytic anaemia due to glutathione peroxidase deficiency, however there is no defined link or variant to GPX1 (PMID: 5766310. PMID: 1131421, PMID: 2492138, PMID: 476008) Overall, lowered glutathione peroxidase activity has been observed in a number of individuals with haemolytic anaemia however the evidence for a cause-and-effect relationship between the enzyme deficiency and the presenting anaemia is not evident. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.167 | GPX1 | Zornitza Stark Marked gene: GPX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.167 | GPX1 | Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.167 | GPX1 | Zornitza Stark Phenotypes for gene: GPX1 were changed from 614164 Hemolytic anemia due to glutathione peroxidase deficiency to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.166 | GPX1 | Zornitza Stark Publications for gene: GPX1 were set to 1131421 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9161 | CYP51A1 | Bryony Thompson Mode of inheritance for gene: CYP51A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9160 | CYP51A1 | Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.289 | CYP51A1 | Bryony Thompson Phenotypes for gene: CYP51A1 were changed from to Congenital cataract; infantile liver disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.288 | CYP51A1 | Bryony Thompson Publications for gene: CYP51A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.287 | CYP51A1 | Bryony Thompson Marked gene: CYP51A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.287 | CYP51A1 | Bryony Thompson Gene: cyp51a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.287 | CYP51A1 | Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9160 | CYB5A | Zornitza Stark Marked gene: CYB5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9160 | CYB5A | Zornitza Stark Gene: cyb5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9160 | CYB5A | Zornitza Stark Phenotypes for gene: CYB5A were changed from to Methemoglobinaemia and ambiguous genitalia, MIM# 250790 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9159 | CYB5A | Zornitza Stark Publications for gene: CYB5A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9158 | CYB5A | Zornitza Stark Mode of inheritance for gene: CYB5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9157 | CYB5A | Zornitza Stark reviewed gene: CYB5A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22170710, 32051920; Phenotypes: Methemoglobinemia and ambiguous genitalia 250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.165 | CYB5A | Zornitza Stark Marked gene: CYB5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.165 | CYB5A | Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.165 | CYB5A | Zornitza Stark Phenotypes for gene: CYB5A were changed from 250790 Methemoglobinemia and ambiguous genitalia to Methemoglobinaemia and ambiguous genitalia MIM#250790 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.164 | CYB5A | Zornitza Stark Publications for gene: CYB5A were set to 8168836; 20080843 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.163 | CYB5A | Zornitza Stark Classified gene: CYB5A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.163 | CYB5A | Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.162 | FTCD | Zornitza Stark Marked gene: FTCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.162 | FTCD | Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.162 | FTCD | Zornitza Stark Phenotypes for gene: FTCD were changed from 229100 Glutamate formiminotransferase deficiency to Glutamate formiminotransferase deficiency MIM# 229100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.161 | FTCD | Zornitza Stark Publications for gene: FTCD were set to 12815595 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.160 | FTCD | Zornitza Stark Classified gene: FTCD as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.160 | FTCD | Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.159 | GPX1 | Danielle Ariti reviewed gene: GPX1: Rating: RED; Mode of pathogenicity: None; Publications: 1131421, 476008, 5766310, 2492138; Phenotypes: Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.159 | SH2B3 | Zornitza Stark Marked gene: SH2B3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.159 | SH2B3 | Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.159 | SH2B3 | Zornitza Stark Classified gene: SH2B3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.159 | SH2B3 | Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.158 | SH2B3 |
Zornitza Stark gene: SH2B3 was added gene: SH2B3 was added to Red cell disorders. Sources: Expert Review somatic tags were added to gene: SH2B3. Mode of inheritance for gene: SH2B3 was set to Other Publications for gene: SH2B3 were set to 34349782; 23812944; 20843259 Phenotypes for gene: SH2B3 were set to Erythrocytosis, somatic, MIM# 133100 Mode of pathogenicity for gene: SH2B3 was set to Other Review for gene: SH2B3 was set to AMBER Added comment: Limited reports, variants appear to be somatic. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.157 | JAK2 | Zornitza Stark Marked gene: JAK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.157 | JAK2 | Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.157 | JAK2 | Zornitza Stark Classified gene: JAK2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.157 | JAK2 | Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.156 | JAK2 |
Zornitza Stark gene: JAK2 was added gene: JAK2 was added to Red cell disorders. Sources: Expert Review somatic tags were added to gene: JAK2. Mode of inheritance for gene: JAK2 was set to Other Publications for gene: JAK2 were set to 27389715 Phenotypes for gene: JAK2 were set to Erythrocytosis, somatic, 133100 Mode of pathogenicity for gene: JAK2 was set to Other Review for gene: JAK2 was set to AMBER Added comment: There is limited evidence to support an association of JAK2 variants with hereditary/congenital erythrocytosis. Typically, variants are somatic/acquired; and to date, only one report has described a patient with germline compound het variants (p.E846D and p.R1063H) in JAK2, who exhibited polyclonal erythrocytosis and megakaryocytic atypia but normal platelet number (PMID:27389715). GoF somatic variants in this gene are also associated with polycythaemia vera (PV), particularly p.V617F, but also with reports of some familial clustering due to inheritance of the JAK2 46/1 predisposition haplotype. Amber rating due to the somatic nature of variants. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.155 | VHL | Zornitza Stark Marked gene: VHL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.155 | VHL | Zornitza Stark Gene: vhl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.155 | VHL | Zornitza Stark Classified gene: VHL as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.155 | VHL | Zornitza Stark Gene: vhl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.154 | VHL |
Zornitza Stark gene: VHL was added gene: VHL was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: VHL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VHL were set to 12844285; 21454469; 24729484; 23403324 Phenotypes for gene: VHL were set to Erythrocytosis, familial, 2, MIM# 263400 Mode of pathogenicity for gene: VHL was set to Other Review for gene: VHL was set to GREEN Added comment: Well established gene-disease association. Bi-allelic missense variants, postulated to be hypomorphic. Note mono-allelic variants associated with Von Hippel Lindau syndrome. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.153 | SF3B1 | Danielle Ariti reviewed gene: SF3B1: Rating: RED; Mode of pathogenicity: Other; Publications: 21995386, 21909114; Phenotypes: Myelodysplastic syndrome, somatic MIM# 614286; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.153 | CYB5A | Danielle Ariti reviewed gene: CYB5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 22170710, 20080843, 32051920, 3951505; Phenotypes: Methemoglobinaemia and ambiguous genitalia MIM#250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.153 | EPOR | Zornitza Stark Marked gene: EPOR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.153 | EPOR | Zornitza Stark Gene: epor has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.153 | EPOR | Zornitza Stark Classified gene: EPOR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.153 | EPOR | Zornitza Stark Gene: epor has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.152 | EPOR |
Zornitza Stark gene: EPOR was added gene: EPOR was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EPOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPOR were set to 8506290; 9292543; 30507031; 33061762 Phenotypes for gene: EPOR were set to [Erythrocytosis, familial, 1], MIM# 133100 Review for gene: EPOR was set to GREEN Added comment: Well established gene-disease association. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.151 | FTCD | Danielle Ariti reviewed gene: FTCD: Rating: AMBER; Mode of pathogenicity: None; Publications: 29178637, 30740726, 5301410; Phenotypes: Glutamate formiminotransferase deficiency MIM# 229100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.107 | ALOX12B | Zornitza Stark Marked gene: ALOX12B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.107 | ALOX12B | Zornitza Stark Gene: alox12b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.107 | ALOX12B | Zornitza Stark Phenotypes for gene: ALOX12B were changed from to Ichthyosis, congenital, autosomal recessive 2, MIM# 242100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.106 | ALOX12B | Zornitza Stark Mode of inheritance for gene: ALOX12B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | ALOX12B | Zornitza Stark reviewed gene: ALOX12B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, congenital, autosomal recessive 2, MIM# 242100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9157 | COL14A1 | Zornitza Stark Marked gene: COL14A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9157 | COL14A1 | Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9157 | COL14A1 |
Zornitza Stark gene: COL14A1 was added gene: COL14A1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: COL14A1 were set to 22972947 Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B Review for gene: COL14A1 was set to RED Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | COL14A1 | Zornitza Stark Marked gene: COL14A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | COL14A1 | Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.105 | SMARCAD1 | Zornitza Stark Phenotypes for gene: SMARCAD1 were changed from Basan syndrome (MIM#129200) to Basan syndrome, MIM#129200; Huriez syndrome, OMIM #181600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.104 | NLRP1 | Zornitza Stark Marked gene: NLRP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.104 | NLRP1 | Zornitza Stark Gene: nlrp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.104 | chirag patel Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.103 | NLRP1 | chirag patel Classified gene: NLRP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.103 | NLRP1 | chirag patel Gene: nlrp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.102 | NLRP1 |
chirag patel gene: NLRP1 was added gene: NLRP1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature Mode of inheritance for gene: NLRP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NLRP1 were set to PMID: 27662089 Phenotypes for gene: NLRP1 were set to Palmoplantar carcinoma, multiple self-healing, OMIM # 615225 Review for gene: NLRP1 was set to GREEN Added comment: Multiple self-healing palmoplantar carcinoma (MSPC) is characterised by recurrent keratoacanthomas in palmoplantar skin and conjunctival and corneal epithelia. Patients experience a high susceptibility to malignant squamous cell carcinoma. Zhong et al. (2016) reported 3 families with variants in NLRP1 a) Affected mother and son with MSPC from a Caucasian French family. Whole exome sequencing (+ Sanger sequencing) identified a heterozygous missense mutation in NLRP1 gene (M77T), that appeared de novo in the mother and segregated with disease in the family. The variant was not found in 672 controls or 61 exome-sequenced subjects' DNA. b) Large 5-generation Tunisian family segregating autosomal dominant MSPC. Whole exome sequencing identified a heterozygous missense mutation in exon 1 of NLRP1 gene (A54T), that segregated with disease in 16 family members. c) 4-generation kindred with MSPC. Sanger sequencing of NLRP1 exon 1 identified heterozygosity for a missense mutation (A66V, that segregated with disease in the family. d) 2 sibs in a consanguineous family with features of MSPC, with homozygous in-frame deletion in NLRP1 gene. Functional analysis demonstrated that all 3 MSPC-associated missense mutations are gain-of-function variants that cause increased inflammasome activation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.101 | SMARCAD1 | chirag patel Classified gene: SMARCAD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.101 | SMARCAD1 | chirag patel Gene: smarcad1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.100 | SMARCAD1 | chirag patel reviewed gene: SMARCAD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29409814; Phenotypes: Huriez syndrome, OMIM #181600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.100 | COL14A1 |
chirag patel gene: COL14A1 was added gene: COL14A1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: COL14A1 were set to PMID: 22972947 Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B Review for gene: COL14A1 was set to RED Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.151 | EPO | Zornitza Stark Marked gene: EPO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.151 | EPO | Zornitza Stark Gene: epo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.151 | EPO | Zornitza Stark Classified gene: EPO as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.151 | EPO | Zornitza Stark Gene: epo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.150 | EPO |
Zornitza Stark gene: EPO was added gene: EPO was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPO were set to 27651169; 29514032; 32130275; 20700488; 30507031; 28283061 Phenotypes for gene: EPO were set to Erythrocytosis, familial, 5, MIM# 617907; Diamond-Blackfan anaemia-like, MIM# 617911 Review for gene: EPO was set to GREEN Added comment: More than 5 unrelated families reported, though note one paper has been retracted. Single family with bi-allelic variants and a DBA phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.149 | EPAS1 | Zornitza Stark Marked gene: EPAS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.149 | EPAS1 | Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.149 | EPAS1 | Zornitza Stark Classified gene: EPAS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.149 | EPAS1 | Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.148 | EPAS1 |
Zornitza Stark gene: EPAS1 was added gene: EPAS1 was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EPAS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPAS1 were set to 18184961; 18378852; 22367913; 18650473 Phenotypes for gene: EPAS1 were set to Erythrocytosis, familial, 4, MIM# 611783 Mode of pathogenicity for gene: EPAS1 was set to Other Review for gene: EPAS1 was set to GREEN Added comment: Most mutations are gain-of-function missense variants in exon 12, but variants in exon 9 have also been described, in association with paraganglioma. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9156 | EGLN1 | Zornitza Stark Marked gene: EGLN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9156 | EGLN1 | Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9156 | EGLN1 | Zornitza Stark Phenotypes for gene: EGLN1 were changed from to Erythrocytosis, familial, 3, MIM# 609820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9155 | EGLN1 | Zornitza Stark Publications for gene: EGLN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9154 | EGLN1 | Zornitza Stark Mode of inheritance for gene: EGLN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9153 | EGLN1 | Zornitza Stark reviewed gene: EGLN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19092153, 16407130, 17579185; Phenotypes: Erythrocytosis, familial, 3, MIM# 609820; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.147 | EGLN1 | Zornitza Stark Marked gene: EGLN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.147 | EGLN1 | Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.147 | EGLN1 | Zornitza Stark Classified gene: EGLN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.147 | EGLN1 | Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.146 | EGLN1 |
Zornitza Stark gene: EGLN1 was added gene: EGLN1 was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: EGLN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EGLN1 were set to 19092153; 16407130; 17579185 Phenotypes for gene: EGLN1 were set to Erythrocytosis, familial, 3, MIM# 609820 Review for gene: EGLN1 was set to GREEN Added comment: At least 3 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.145 | BPGM | Zornitza Stark Marked gene: BPGM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.145 | BPGM | Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.145 | BPGM | Zornitza Stark Classified gene: BPGM as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.145 | BPGM | Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.144 | BPGM |
Zornitza Stark gene: BPGM was added gene: BPGM was added to Red cell disorders. Sources: Expert list Mode of inheritance for gene: BPGM was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: BPGM were set to 1421379; 27651169; 25015942 Phenotypes for gene: BPGM were set to Erythrocytosis, familial, 8, MIM# 222800 Review for gene: BPGM was set to AMBER Added comment: Mixture of mono-allelic and bi-allelic variants reported, MOI uncertain. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v1.2 | RAD21 | Zornitza Stark Publications for gene: RAD21 were set to 31334757 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v1.1 | RAD21 | Arina Puzriakova reviewed gene: RAD21: Rating: ; Mode of pathogenicity: None; Publications: 32696056; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9153 | FGFR2 | Zornitza Stark Marked gene: FGFR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9153 | FGFR2 | Zornitza Stark Gene: fgfr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9153 | FGFR2 | Zornitza Stark Phenotypes for gene: FGFR2 were changed from to Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis,MIM# 207410; Apert syndrome, MIM# 101200; Beare-Stevenson cutis gyrata syndrome, MIM# 123790; Bent bone dysplasia syndrome, MIM# 614592; Craniofacial-skeletal-dermatologic dysplasia, MIM# 101600; Craniosynostosis, nonspecific; Crouzon syndrome , MIM#123500; Jackson-Weiss syndrome,MIM# 123150; LADD syndrome, MIM# 149730; Pfeiffer syndrome,MIM# 101600; Saethre-Chotzen syndrome 101400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9152 | FGFR2 | Zornitza Stark Publications for gene: FGFR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9151 | FGFR2 | Zornitza Stark Mode of inheritance for gene: FGFR2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9150 | SLC4A1 | Zornitza Stark Marked gene: SLC4A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9150 | SLC4A1 | Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9150 | SLC4A1 | Zornitza Stark Phenotypes for gene: SLC4A1 were changed from to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653; Distal renal tubular acidosis 1 MIM# 179800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9149 | SLC4A1 | Zornitza Stark Publications for gene: SLC4A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9148 | SLC4A1 | Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9147 | FGFR2 | Chern Lim reviewed gene: FGFR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29848297, 32879300, 27323706; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9147 | SLC4A1 | Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 7949112, 8640229, 16227998, 8640229, 16227998, 33881640, 32632909; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653, Distal renal tubular acidosis 1 MIM# 179800; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.143 | TRNT1 | Zornitza Stark Marked gene: TRNT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.143 | TRNT1 | Zornitza Stark Gene: trnt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.143 | TRNT1 | Zornitza Stark Phenotypes for gene: TRNT1 were changed from sideroblastic anaemia; 616084 Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay to Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.142 | TRNT1 | Zornitza Stark Publications for gene: TRNT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.141 | TRNT1 | Zornitza Stark reviewed gene: TRNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25193871, 23553769, 29170023, 27389523; Phenotypes: Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.27 | STEAP3 | Zornitza Stark Marked gene: STEAP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.27 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.27 | STEAP3 | Zornitza Stark Phenotypes for gene: STEAP3 were changed from 615234 ?Anemia, hypochromic microcytic, with iron overload 2 to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.26 | STEAP3 | Zornitza Stark Publications for gene: STEAP3 were set to 22031863 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.25 | STEAP3 | Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.24 | STEAP3 | Zornitza Stark Classified gene: STEAP3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.24 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.23 | STEAP3 | Zornitza Stark reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9147 | STEAP3 | Zornitza Stark Phenotypes for gene: STEAP3 were changed from Anemia, hypochromic microcytic, with iron overload 2, MIM# 615234 to Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9146 | STEAP3 | Zornitza Stark Publications for gene: STEAP3 were set to 22031863; 25515317 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9145 | STEAP3 | Zornitza Stark Classified gene: STEAP3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9145 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9144 | STEAP3 |
Zornitza Stark changed review comment from: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence.; to: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence. Conflicting evidence (PMID 26675350): Large Chinese study (of normal and α-thalassemia subjects) investigated the prevalence of STEAP3 mutations in humans and their physiologic consequences. Discovered a relatively high prevalence of potentially harmful recessive alleles. However, whilst the identified STEAP3 mutations exhibited impaired ferrireductase activity in vitro, they had little or no effect on erythrocyte phenotypes |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9144 | STEAP3 | Zornitza Stark edited their review of gene: STEAP3: Changed rating: RED; Changed publications: 22031863, 25515317, 26675350; Changed phenotypes: Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.141 | STEAP3 | Zornitza Stark Marked gene: STEAP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.141 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.141 | STEAP3 | Zornitza Stark Phenotypes for gene: STEAP3 were changed from hypochromic anaemia to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.140 | STEAP3 | Zornitza Stark Publications for gene: STEAP3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.139 | STEAP3 | Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.138 | STEAP3 | Zornitza Stark Classified gene: STEAP3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.138 | STEAP3 | Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.137 | PGK1 | Zornitza Stark Marked gene: PGK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.137 | PGK1 | Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.137 | PGK1 | Zornitza Stark Phenotypes for gene: PGK1 were changed from 300653 Phosphoglycerate kinase 1 deficiency to Phosphoglycerate kinase 1 deficiency MIM# 300653 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.136 | PGK1 | Zornitza Stark Publications for gene: PGK1 were set to 16740138; 6412025 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.135 | PGK1 | Zornitza Stark Classified gene: PGK1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.135 | PGK1 | Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.134 | LARS2 | Zornitza Stark Marked gene: LARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.134 | LARS2 | Zornitza Stark Gene: lars2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.134 | LARS2 | Zornitza Stark Phenotypes for gene: LARS2 were changed from hydrops/sideroblastic anaemia to Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.133 | LARS2 | Zornitza Stark Publications for gene: LARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.132 | LARS2 | Zornitza Stark Mode of inheritance for gene: LARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.131 | SLC4A1 | Zornitza Stark Marked gene: SLC4A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.131 | SLC4A1 | Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.131 | SLC4A1 | Zornitza Stark Phenotypes for gene: SLC4A1 were changed from 166900 Ovalocytosis, SA type, 185020 Cryohydrocytosis; RBC membrane abnormality; 166900 Ovalocytosis, SA type; Haemolytic Anemia; Cryohydrocytosis,185020; 612653 Spherocytosis, type 4; Ovalocytosis, SA type, 166900; Spherocytosis, type 4, 612653 to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.130 | SLC4A1 | Zornitza Stark Publications for gene: SLC4A1 were set to 1722314 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.129 | SLC4A1 | Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.128 | STEAP3 | Danielle Ariti reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.128 | PGK1 | Danielle Ariti reviewed gene: PGK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28580215, 20151463; Phenotypes: Phosphoglycerate kinase 1 deficiency MIM# 300653; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.128 | LARS2 | Danielle Ariti reviewed gene: LARS2: Rating: AMBER; Mode of pathogenicity: None; Publications: 26537577, 32442335; Phenotypes: Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.128 | SLC4A1 | Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 10926824, 7949112, 16392641, 8640229, 16227998, 8640229, 16227998; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.128 | RPL26 | Zornitza Stark Marked gene: RPL26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.128 | RPL26 | Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.128 | RPL26 | Zornitza Stark Phenotypes for gene: RPL26 were changed from Diamond-Blackfan anemia 11, MIM# 614900 to Diamond-Blackfan anaemia 11, MIM# 614900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.127 | RPL26 | Zornitza Stark Phenotypes for gene: RPL26 were changed from ?Diamond-Blackfan anemia 11, 614900; 614900 ?Diamond-Blackfan anemia 11 to Diamond-Blackfan anemia 11, MIM# 614900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.126 | RPL26 | Zornitza Stark Classified gene: RPL26 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.126 | RPL26 | Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.125 | RPL15 | Zornitza Stark Marked gene: RPL15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.125 | RPL15 | Zornitza Stark Gene: rpl15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.125 | RPL15 | Zornitza Stark Phenotypes for gene: RPL15 were changed from Diamond-Blackfan anemia 12, MIM# 615550 to Diamond-Blackfan anaemia 12, MIM# 615550 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.124 | RPL15 | Zornitza Stark Phenotypes for gene: RPL15 were changed from 615550 ?Diamond-Blackfan anaemia 12; ?Diamond-Blackfan anemia 12, 615550; 615550 ?Diamond-Blackfan anemia 1 to Diamond-Blackfan anemia 12, MIM# 615550 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.123 | RPL15 | Zornitza Stark Publications for gene: RPL15 were set to 23812780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.122 | RPL15 | Zornitza Stark Mode of inheritance for gene: RPL15 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.121 | RPL11 | Zornitza Stark Marked gene: RPL11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.121 | RPL11 | Zornitza Stark Gene: rpl11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.121 | RPL11 | Zornitza Stark Phenotypes for gene: RPL11 were changed from Diamond_Blackfan Anemia 7; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 612562 Diamond-Blackfan anemia 7; Diamond-Blackfan Anemia 7; 612562 Diamond_Blackfan Anemia 7; DIAMOND-BLACKFAN ANEMIA 7; Diamond-Blackfan anemia 7, 612562 to Diamond-Blackfan anemia 7, MIM# 612562; MONDO:0012938 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.120 | PKLR | Zornitza Stark Marked gene: PKLR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.120 | PKLR | Zornitza Stark Gene: pklr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.120 | PKLR | Zornitza Stark Phenotypes for gene: PKLR were changed from 266200 PYRUVATE KINASE DEFICIENCY; Enzyme Disorder; PYRUVATE KINASE DEFICIENCY; 266200 Pyruvate kinase deficiency; Pyruvate kinase deficiency, 266200; Pyruvate kinase deficiency to Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900; Pyruvate kinase deficiency, MIM# 266200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.119 | PKLR | Zornitza Stark Mode of inheritance for gene: PKLR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.118 | PKLR | Zornitza Stark reviewed gene: PKLR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900, Pyruvate kinase deficiency, MIM# 266200; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.118 | PIEZO1 | Zornitza Stark Marked gene: PIEZO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.118 | PIEZO1 | Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.118 | PIEZO1 | Zornitza Stark Phenotypes for gene: PIEZO1 were changed from Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema, 194380; 194380 Stomatocytosis; Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Stomatocytosis; Dehydrated hereditary stomatocytosis; 616843 Lymphatic malformation 6; 194380 Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Hereditary xerocytosis to Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.117 | PIEZO1 | Zornitza Stark Publications for gene: PIEZO1 were set to 22529292; 23695678 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.116 | PIEZO1 | Zornitza Stark Mode of inheritance for gene: PIEZO1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.115 | PIEZO1 | Zornitza Stark reviewed gene: PIEZO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21944700, 23695678, 23479567; Phenotypes: Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.115 | PFKM | Zornitza Stark Marked gene: PFKM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.115 | PFKM | Zornitza Stark Gene: pfkm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.115 | PFKM | Zornitza Stark Phenotypes for gene: PFKM were changed from Glycogen storage disease VII, 232800; 232800 Glycogen storage disease VII to Glycogen storage disease VII, MIM# 232800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.114 | PFKM | Zornitza Stark Publications for gene: PFKM were set to 7513946; 2140573 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.113 | PFKM | Zornitza Stark reviewed gene: PFKM: Rating: GREEN; Mode of pathogenicity: None; Publications: 24427140, 27066546, 30792690; Phenotypes: Glycogen storage disease VII, MIM# 232800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9144 | NT5C3A | Zornitza Stark Marked gene: NT5C3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9144 | NT5C3A | Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9144 | NT5C3A | Zornitza Stark Phenotypes for gene: NT5C3A were changed from to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9143 | NT5C3A | Zornitza Stark Publications for gene: NT5C3A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9142 | NT5C3A | Zornitza Stark Mode of inheritance for gene: NT5C3A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9141 | NT5C3A | Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.113 | NT5C3A | Zornitza Stark Marked gene: NT5C3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.113 | NT5C3A | Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.113 | NT5C3A | Zornitza Stark Phenotypes for gene: NT5C3A were changed from Anemia, hemolytic, due to UMPH1 deficiency, 266120; 266120 Anemia, hemolytic, due to UMPH1 deficiency to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.112 | NT5C3A | Zornitza Stark Publications for gene: NT5C3A were set to 11369620; 12714505 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.111 | NT5C3A | Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Oligodontia v0.6 | WNT10B | Zornitza Stark Marked gene: WNT10B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Oligodontia v0.6 | WNT10B | Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Oligodontia v0.6 | WNT10B | Zornitza Stark Classified gene: WNT10B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Oligodontia v0.6 | WNT10B | Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Marked gene: RHOBTB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Classified gene: RHOBTB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Alternating Hemiplegia and Hemiplegic Migraine v0.51 | RHOBTB2 | Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Alternating Hemiplegia and Hemiplegic Migraine v0.50 | RHOBTB2 |
Zornitza Stark gene: RHOBTB2 was added gene: RHOBTB2 was added to Alternating Hemiplegia and Hemiplegic Migraine. Sources: Literature Mode of inheritance for gene: RHOBTB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RHOBTB2 were set to 33504645 Phenotypes for gene: RHOBTB2 were set to Developmental and epileptic encephalopathy 64 618004; Alternating hemiplegia Review for gene: RHOBTB2 was set to GREEN Added comment: Eleven affected patients were identified. All had heterozygous missense variants involving exon 9 of RHOBTB2, confirmed as de novo in 9 cases. All had a complex motor phenotype, including at least 2 different kinds of movement disorder, e.g., ataxia and dystonia. Many patients demonstrated several features fulfilling the criteria for AHC: 10 patients had a movement disorder including paroxysmal elements, and 8 experienced hemiplegic episodes. In contrast to classic AHC, commonly caused by mutations in ATP1A3, these events were reported later only in RHOBTB2 mutation-positive patients from 20 months of age. All had ID, and many had seizures, so this represents an expansion of the phenotype rather than a distinct disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.46 | COPB2 | Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.46 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.45 | COPB2 |
Zornitza Stark edited their review of gene: COPB2: Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported. All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data. Note one of the individuals with heterozygous variant had significant microcephaly in addition to the two sibs with bi-allelic variants.; Changed rating: AMBER; Changed publications: 29036432, 34450031; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Marked gene: COPB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Classified gene: COPB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.65 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.64 | COPB2 |
Zornitza Stark gene: COPB2 was added gene: COPB2 was added to Osteogenesis Imperfecta. Sources: Literature Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COPB2 were set to 34450031 Phenotypes for gene: COPB2 were set to Osteoporosis, recurrent fractures and developmental delay Review for gene: COPB2 was set to GREEN Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported. All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4116 | COPB2 | Zornitza Stark Classified gene: COPB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4116 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4115 | COPB2 | Zornitza Stark reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Oligodontia v0.5 | WNT10B |
Ain Roesley gene: WNT10B was added gene: WNT10B was added to Oligodontia. Sources: Literature Mode of inheritance for gene: WNT10B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: WNT10B were set to 27321946; 29364501; 21554266; 31050392 Phenotypes for gene: WNT10B were set to Tooth agenesis, selective, 8 MIM#617073 Penetrance for gene: WNT10B were set to unknown Review for gene: WNT10B was set to GREEN Added comment: PMID: 27321946; 4 unrelated families (including 1 with 3 affecteds). 3x missense and 1x truncating. Luciferase assays demonstrated LoF compared to WT. PMID: 29364501; 7 unrelated families all missense. Arg159Pro identified in 4 families and family#5 also had variants in WNT10A. Re-evaluation of a previously reported family #8 - 1 heterozygote who only had tooth agenesis while 6 other relatives who were homozygotes also had split hand-foot malformation NOTE: No genotype phenotype correlation between AD tooth agenesis and AR split hand-foot malformation - missense have also been reported in SHFM (PMID: 31050392). While it's noted that most reports of SHFM did not investigate oligodontia in their patients or carrier parents, PMID: 21554266 noted their carrier parents were healthy and clinically distinguishable Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.18 | SLC37A4 | Zornitza Stark Phenotypes for gene: SLC37A4 were changed from Congenital disorder of glycosylation type II to Congenital disorder of glycosylation, type IIw, MIM# 619525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.17 | SLC37A4 | Zornitza Stark edited their review of gene: SLC37A4: Changed phenotypes: Congenital disorder of glycosylation, type IIw 619525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9141 | IMPG1 | Zornitza Stark Phenotypes for gene: IMPG1 were changed from Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200 to Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9140 | IMPG1 | Zornitza Stark reviewed gene: IMPG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 91, MIM# 153870; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.100 | IMPG1 | Zornitza Stark Phenotypes for gene: IMPG1 were changed from Retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.99 | IMPG1 | Zornitza Stark edited their review of gene: IMPG1: Changed phenotypes: Retinitis pigmentosa, MONDO:0019200, Retinitis pigmentosa 91, MIM# 153870 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9140 | ABCC11 | Zornitza Stark Marked gene: ABCC11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9140 | ABCC11 | Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9140 | ABCC11 | Zornitza Stark Phenotypes for gene: ABCC11 were changed from to [Axillary odor, variation in] 117800; [Colostrum secretion, variation in] 117800; [Earwax, wet/dry] 117800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9139 | ABCC11 | Zornitza Stark Classified gene: ABCC11 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9139 | ABCC11 | Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9138 | ABCC11 | Zornitza Stark reviewed gene: ABCC11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: [Axillary odor, variation in] 117800, [Colostrum secretion, variation in] 117800, [Earwax, wet/dry] 117800; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.111 | PUS1 | Zornitza Stark Marked gene: PUS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.111 | PUS1 | Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.111 | PUS1 | Zornitza Stark Phenotypes for gene: PUS1 were changed from 600462 Myopathy, lactic acidosis, and sideroblastic anemia 1; Myopathy, Lactic Acidosis, and Sideroblastic Anemia, 600462; 600462 Myopathy, Lactic Acidosis, and Sideroblastic Anemia to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.110 | PUS1 | Zornitza Stark Publications for gene: PUS1 were set to 15108122; 15772074 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.109 | PUS1 | Zornitza Stark edited their review of gene: PUS1: Changed phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.109 | HSPA9 | Zornitza Stark Marked gene: HSPA9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.109 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.109 | HSPA9 | Zornitza Stark Phenotypes for gene: HSPA9 were changed from sideroblastic anaemia; 182170 Sideroblastic anaemia 4; 182170 sideroblastic anaemia type 4; Sideroblastic anaemia type 4, 182170 to Anaemia, sideroblastic, 4, MIM# 182170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.108 | HSPA9 | Zornitza Stark reviewed gene: HSPA9: Rating: GREEN; Mode of pathogenicity: None; Publications: 26491070; Phenotypes: Anaemia, sideroblastic, 4, MIM# 182170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9138 | KCNN4 | Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26198474; 26178367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9137 | KCNN4 |
Zornitza Stark changed review comment from: At least three families reported. Sources: Expert list; to: Well established gene-disease association, more than 10 families and functional data. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9137 | KCNN4 | Zornitza Stark edited their review of gene: KCNN4: Changed publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Changed phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.108 | KCNN4 | Zornitza Stark Marked gene: KCNN4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.108 | KCNN4 | Zornitza Stark Gene: kcnn4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.108 | KCNN4 | Zornitza Stark Phenotypes for gene: KCNN4 were changed from Hereditary Xerocytosis; 616689 Dehydrated hereditary stomatocytosis 2 to Dehydrated hereditary stomatocytosis 2, MIM# 616689 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.107 | KCNN4 | Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26178367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.106 | KCNN4 | Zornitza Stark Mode of inheritance for gene: KCNN4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.105 | KCNN4 | Zornitza Stark reviewed gene: KCNN4: Rating: GREEN; Mode of pathogenicity: None; Publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.105 | KLF1 | Zornitza Stark Marked gene: KLF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.105 | KLF1 | Zornitza Stark Gene: klf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.105 | KLF1 | Zornitza Stark Phenotypes for gene: KLF1 were changed from 613673 Congenital dyserythropoietic anaemia type 4; Congenital Dyserythropoietic Anemia; 613673 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type IV, 613673; Dyserythropoietic anemia, congenital, type IV to Dyserythropoietic anaemia, congenital, type IV, MIM# 613673; MONDO:0013355 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.104 | KLF1 | Zornitza Stark Publications for gene: KLF1 were set to 21055716; 29200155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.103 | HK1 | Zornitza Stark Marked gene: HK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.103 | HK1 | Zornitza Stark Gene: hk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.103 | HK1 | Zornitza Stark Phenotypes for gene: HK1 were changed from 235700 Enzyme Disorder; Hemolytic anemia due to hexokinase deficiency, 235700; 235700 Hemolytic anemia due to hexokinase deficiency; Hemolytic anemia due to hexokinase deficiency; Enzyme Disorder to Haemolytic anaemia due to hexokinase deficiency, MIM# 235700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.102 | HK1 | Zornitza Stark Publications for gene: HK1 were set to 7655856; 12393545 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.101 | HK1 | Zornitza Stark reviewed gene: HK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7655856, 12393545, 33361148, 31119733, 27282571; Phenotypes: Haemolytic anaemia due to hexokinase deficiency, MIM# 235700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1193 | HCN4 | Zornitza Stark Marked gene: HCN4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1193 | HCN4 | Zornitza Stark Gene: hcn4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1193 | HCN4 |
Zornitza Stark gene: HCN4 was added gene: HCN4 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for gene: HCN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HCN4 were set to 30127718; 29588962 Phenotypes for gene: HCN4 were set to {Epilepsy, idiopathic generalized, susceptibility to, 18}, MIM# 619521 Review for gene: HCN4 was set to RED Added comment: Two families reported. Variant did not segregate with disease in one (PMID 29588962), and was present in two affected sibs from another family reported in PMID 30127718, some functional data to support impact of variant on protein function. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.101 | KIF23 | Zornitza Stark Marked gene: KIF23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.101 | KIF23 | Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.101 | KIF23 | Zornitza Stark Phenotypes for gene: KIF23 were changed from Enzyme Disorder; Anaemia, dyserythropoietic congenital, type III; Congenital dyserythropoietic anemia (CDA); Congenital dyserythropoietic anemia type III; 605064 Congenital dyserythropoietic anaemia type 3; CDA III to Congenital dyserythropoietic anemia type III | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.100 | KIF23 | Zornitza Stark Classified gene: KIF23 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.100 | KIF23 | Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4115 | MTRR | Zornitza Stark Marked gene: MTRR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4115 | MTRR | Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4115 | MTRR | Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4114 | MTRR | Zornitza Stark Publications for gene: MTRR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4113 | MTRR | Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4112 | MTRR | Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9137 | MTRR | Zornitza Stark Marked gene: MTRR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9137 | MTRR | Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9137 | MTRR | Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9136 | MTRR | Zornitza Stark Publications for gene: MTRR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9135 | MTRR | Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9134 | MTRR | Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.99 | MTRR | Zornitza Stark Marked gene: MTRR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.99 | MTRR | Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.99 | MTRR | Zornitza Stark Phenotypes for gene: MTRR were changed from Homocystinuria-megaloblastic anemia, cbl E type, 236270; 236270 Homocystinuria-megaloblastic anemia, cbl E type to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.98 | MTRR | Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4112 | MTR | Zornitza Stark Marked gene: MTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4112 | MTR | Zornitza Stark Gene: mtr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4112 | MTR | Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4111 | MTR | Zornitza Stark Publications for gene: MTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4110 | MTR | Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4109 | MTR | Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9134 | MTR | Zornitza Stark Marked gene: MTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9134 | MTR | Zornitza Stark Gene: mtr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9134 | MTR | Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9133 | MTR | Zornitza Stark Publications for gene: MTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9132 | MTR | Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9131 | MTR | Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.98 | MTR | Zornitza Stark Marked gene: MTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.98 | MTR | Zornitza Stark Gene: mtr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.98 | MTR | Zornitza Stark Phenotypes for gene: MTR were changed from Homocystinuria-megaloblastic anemia, cblG complementation type, 250940; 250940 Homocystinuria-megaloblastic anemia, cblG complementation type to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.97 | MTR | Zornitza Stark Publications for gene: MTR were set to 9683607; 12068375 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.96 | MTR | Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.121 | LPIN2 | Zornitza Stark Marked gene: LPIN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.121 | LPIN2 | Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.121 | LPIN2 | Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.120 | LPIN2 | Zornitza Stark Publications for gene: LPIN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.119 | LPIN2 | Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.118 | LPIN2 | Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9131 | LPIN2 | Zornitza Stark Marked gene: LPIN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9131 | LPIN2 | Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9131 | LPIN2 | Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9130 | LPIN2 | Zornitza Stark Publications for gene: LPIN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9129 | LPIN2 | Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9128 | LPIN2 | Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.96 | LPIN2 | Zornitza Stark Marked gene: LPIN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.96 | LPIN2 | Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.96 | LPIN2 | Zornitza Stark Phenotypes for gene: LPIN2 were changed from Congenital dyserythropoietic anemia; Microcytic anemia; Majeed syndrome, 609628; 609628 Microcytic anemia; CDA; Majeed syndrome; 609628 Majeed syndrome to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.95 | LPIN2 | Zornitza Stark Publications for gene: LPIN2 were set to 17330256; 15994876 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.94 | LPIN2 | Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.206 | KCNQ1 | Zornitza Stark Marked gene: KCNQ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.206 | KCNQ1 | Zornitza Stark Gene: kcnq1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.206 | KCNQ1 |
Zornitza Stark gene: KCNQ1 was added gene: KCNQ1 was added to Hydrops fetalis. Sources: Expert Review Mode of inheritance for gene: KCNQ1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNQ1 were set to 27539165 Phenotypes for gene: KCNQ1 were set to Long QT syndrome 1, 192500 Review for gene: KCNQ1 was set to RED Added comment: Can present antenatally with bradycardia, but no specific mention of hydrops. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.205 | KCNH2 | Zornitza Stark Marked gene: KCNH2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.205 | KCNH2 | Zornitza Stark Gene: kcnh2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.205 | KCNH2 |
Zornitza Stark gene: KCNH2 was added gene: KCNH2 was added to Hydrops fetalis. Sources: Expert Review Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNH2 were set to 27492745 Phenotypes for gene: KCNH2 were set to long QT syndrome Review for gene: KCNH2 was set to RED Added comment: Single case report identified of presentation with hydrops. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Marked gene: SCN5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Classified gene: SCN5A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.204 | SCN5A | Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.203 | SCN5A |
Zornitza Stark gene: SCN5A was added gene: SCN5A was added to Hydrops fetalis. Sources: Expert Review Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SCN5A were set to 22064211; 15184283; 19419784 Phenotypes for gene: SCN5A were set to Long QT syndrome 3 (MIM#603830) Review for gene: SCN5A was set to GREEN Added comment: Three families reported with severe perinatal presentation, including hydrops. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.147 | OPDM1 | Zornitza Stark Tag adult-onset tag was added to STR: OPDM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.147 | NIID | Zornitza Stark Tag adult-onset tag was added to STR: NIID. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.147 | Zornitza Stark Panel types changed to Australian Genomics; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | VACTERLX | Zornitza Stark Tag paediatric-onset tag was added to STR: VACTERLX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | OPML1 | Zornitza Stark Tag adult-onset tag was added to STR: OPML1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Marked STR: NIPA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Tag adult-onset tag was added to STR: NIPA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRAXF | Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXF. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA7A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA7A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11B | Zornitza Stark Marked STR: FRA11B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11B | Zornitza Stark Str: fra11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11B | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11B. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FAME7 | Zornitza Stark Tag adult-onset tag was added to STR: FAME7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FAME6 | Zornitza Stark Tag adult-onset tag was added to STR: FAME6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FAME4 | Zornitza Stark Tag adult-onset tag was added to STR: FAME4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | DMD |
Zornitza Stark Tag adult-onset tag was added to STR: DMD. Tag paediatric-onset tag was added to STR: DMD. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA2A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA2A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA12A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA12A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCD | Zornitza Stark Marked STR: CCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCD | Zornitza Stark Str: ccd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCD | Zornitza Stark Tag paediatric-onset tag was added to STR: CCD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Marked STR: CANVAS_ACAGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Str: canvas_acagg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Tag adult-onset tag was added to STR: CANVAS_ACAGG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | XDP | Zornitza Stark Tag adult-onset tag was added to STR: XDP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | TOF | Zornitza Stark Tag paediatric-onset tag was added to STR: TOF. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SPD1 | Zornitza Stark Tag paediatric-onset tag was added to STR: SPD1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA8 | Zornitza Stark Tag adult-onset tag was added to STR: SCA8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA7 | Zornitza Stark Tag adult-onset tag was added to STR: SCA7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA6 | Zornitza Stark Tag adult-onset tag was added to STR: SCA6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA37 | Zornitza Stark Tag adult-onset tag was added to STR: SCA37. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA36 | Zornitza Stark Tag adult-onset tag was added to STR: SCA36. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA31 | Zornitza Stark Tag adult-onset tag was added to STR: SCA31. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA3 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA3. Tag paediatric-onset tag was added to STR: SCA3. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA2 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA2. Tag paediatric-onset tag was added to STR: SCA2. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA17 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA17. Tag paediatric-onset tag was added to STR: SCA17. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA12 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA12. Tag paediatric-onset tag was added to STR: SCA12. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA10 | Zornitza Stark Tag adult-onset tag was added to STR: SCA10. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9128 | FOXE3 | Zornitza Stark Marked gene: FOXE3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9128 | FOXE3 | Zornitza Stark Gene: foxe3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9128 | FOXE3 | Zornitza Stark Phenotypes for gene: FOXE3 were changed from to Anterior segment dysgenesis 2, multiple subtypes, MIM#610256; Cataract 34, multiple types, MIM#612968; Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9127 | FOXE3 | Zornitza Stark Publications for gene: FOXE3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9126 | FOXE3 | Zornitza Stark Mode of inheritance for gene: FOXE3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9125 | FOXE3 | Eleanor Williams reviewed gene: FOXE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 26854927, 27218149, 16826526, 19708017, 20140963, 20664696, 20361012, 24019743, 27669367, 29878917, 32436650, 34046667, 11159941, 19708017, 20806047, 21150893, 11980846, 34046667; Phenotypes: Anterior segment dysgenesis 2, multiple subtypes, MIM#610256, Cataract 34, multiple types, MIM#612968, Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9125 | SLC26A1 | Zornitza Stark Phenotypes for gene: SLC26A1 were changed from to Nephrolithiasis, calcium oxalate, MIM#167030 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9124 | SLC26A1 | Zornitza Stark Publications for gene: SLC26A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9123 | SLC26A1 | Zornitza Stark Mode of inheritance for gene: SLC26A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9122 | SLC26A1 | Zornitza Stark Classified gene: SLC26A1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9122 | SLC26A1 | Zornitza Stark Gene: slc26a1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9121 | SLC26A1 | Zornitza Stark reviewed gene: SLC26A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27210743, 20160351, 30383413, 27125215; Phenotypes: Nephrolithiasis, calcium oxalate, MIM#167030; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9121 | RHAG | Zornitza Stark Marked gene: RHAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9121 | RHAG | Zornitza Stark Gene: rhag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9121 | RHAG | Zornitza Stark Phenotypes for gene: RHAG were changed from to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9120 | RHAG | Zornitza Stark Publications for gene: RHAG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9119 | RHAG | Zornitza Stark Mode of inheritance for gene: RHAG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9118 | SPTA1 | Zornitza Stark Marked gene: SPTA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9118 | SPTA1 | Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9118 | SPTA1 | Zornitza Stark Phenotypes for gene: SPTA1 were changed from to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9117 | SPTA1 | Zornitza Stark Publications for gene: SPTA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9116 | SPTA1 | Zornitza Stark Mode of inheritance for gene: SPTA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9115 | SPTA1 | Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.94 | RHAG | Zornitza Stark Marked gene: RHAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.94 | RHAG | Zornitza Stark Gene: rhag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.94 | RHAG | Zornitza Stark Phenotypes for gene: RHAG were changed from Stomatocytosis; Anemia, hemolytic, Rh-null, regulator type (BIALLELIC, autosomal or pseudoautosomal), 268150; 185000 Overhydrated hereditary stomatocytosis; Overhydrated hereditary stomatocytosis (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 185000; 268150 Anemia, hemolytic, Rh-null, regulator type to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.93 | RHAG | Zornitza Stark Publications for gene: RHAG were set to 18931342 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.92 | SLC11A2 | Zornitza Stark Marked gene: SLC11A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.92 | SLC11A2 | Zornitza Stark Gene: slc11a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.92 | SLC11A2 | Zornitza Stark Phenotypes for gene: SLC11A2 were changed from 206100 Anemia, hypochromic microcytic, with iron overload 1; Anemia, hypochromic microcytic, with iron overload 1, 206100 to Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.91 | SLC11A2 | Zornitza Stark Publications for gene: SLC11A2 were set to 16160008; 16439678; 15459009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.90 | SLC2A1 | Zornitza Stark Marked gene: SLC2A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.90 | SLC2A1 | Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.90 | SLC2A1 | Zornitza Stark Phenotypes for gene: SLC2A1 were changed from Stomatocytosis; 612126 GLUT1 deficiency without epilepsy and/or hemolytic anemia; 608885 Stomatin-deficient cryohydrocytosis with neurologic defects; Pyridoxine-refractory sideroblastic anemia to Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885; delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia; haemolytic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.89 | SLC2A1 | Zornitza Stark Publications for gene: SLC2A1 were set to 22492876; 21791420 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9115 | SPTB | Zornitza Stark Marked gene: SPTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9115 | SPTB | Zornitza Stark Gene: sptb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.88 | SPTA1 | Zornitza Stark Marked gene: SPTA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.88 | SPTA1 | Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.88 | SPTA1 | Zornitza Stark Phenotypes for gene: SPTA1 were changed from 270970 Spherocytosis, type 3; 266140 Pyropoikilocytosis; RBC membrane abnormality; Pyropoikilocytosis (BIALLELIC, autosomal or pseudoautosomal), 266140; 266140 Pyropoikilocytosis, 270970 Spherocytosis, type 3; Spherocytosis, type 3 (BIALLELIC, autosomal or pseudoautosomal), 270970; 130600 Elliptocytosis-2; Elliptocytosis-2 (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 130600 to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.87 | SPTA1 | Zornitza Stark Publications for gene: SPTA1 were set to 1679439; 3940543; 4077050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9115 | SPTB | Zornitza Stark Phenotypes for gene: SPTB were changed from to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9114 | SPTB | Zornitza Stark Publications for gene: SPTB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9113 | SPTB | Zornitza Stark Mode of inheritance for gene: SPTB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.86 | SPTB | Zornitza Stark Marked gene: SPTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.86 | SPTB | Zornitza Stark Gene: sptb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.86 | SPTB | Zornitza Stark Phenotypes for gene: SPTB were changed from 617948 Elliptocytosis-3; Spherocytosis,616649; Anemia, neonatal hemolytic, fatal and near-fatal; RBC membrane abnormality; 616649 Spherocytosis, type 2; 616649 Anemia, neonatal hemolytic, fatal and near-fatal; Elliptocytosis to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.85 | SPTB | Zornitza Stark Publications for gene: SPTB were set to 8226774; 3276733 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.84 | TCN2 | Zornitza Stark Marked gene: TCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.84 | TCN2 | Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.84 | TCN2 | Zornitza Stark Phenotypes for gene: TCN2 were changed from megaloblastic bone marrow; neutropenia; thrombocytopenia; 275350 Transcobalamin II deficiency; Agammaglobulinemia; pancytopenia; neutropenic colitis; failure to thrive; Transcobalamin II deficiency; can have a presentation similar to severe combined immunodeficiency; hypotonia, myoclonic like movements, pallor, purpura, anaemia, thrombocytopenia, megaloblastosis, aplastic bone marrow to Transcobalamin II deficiency MIM# 275350; Decreased Ig levels; Megaloblastic anaemia; pancytopaenia; Reticulocytopaenia; failure to thrive; diarrhoea; hypogammaglobulinaemia; pallor; hypotonia; respiratory infection; if untreated (B12) for prolonged periods results in intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.83 | TCN2 | Zornitza Stark Publications for gene: TCN2 were set to 10518276; 7849710 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9112 | TF | Zornitza Stark Marked gene: TF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9112 | TF | Zornitza Stark Gene: tf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9112 | TF | Zornitza Stark Phenotypes for gene: TF were changed from to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9111 | TF | Zornitza Stark Publications for gene: TF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9110 | TF | Zornitza Stark Mode of inheritance for gene: TF was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.82 | TF | Zornitza Stark Marked gene: TF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.82 | TF | Zornitza Stark Gene: tf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.82 | TF | Zornitza Stark Phenotypes for gene: TF were changed from Congenital hypotransferrinemia; Atransferrinemia, 209300; 209300 Congenital hypotransferrinemia to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9109 | SLC11A2 | Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.23 | SLC11A2 | Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9109 | RHAG | Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9109 | SPTB | Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9109 | TF | Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.23 | TF | Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.81 | RHAG | Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.81 | SLC11A2 | Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.81 | SLC2A1 | Danielle Ariti reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27353637; Phenotypes: Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885, delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia, haemolytic anaemia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.81 | HBD | Zornitza Stark Marked gene: HBD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.81 | HBD | Zornitza Stark Gene: hbd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.81 | HBD | Zornitza Stark Phenotypes for gene: HBD were changed from Thalassemia due to Hb Lepore; Thalassemia,delta; Thalassemiadue to HbLepore; 141749 Delta-beta thalassaemia, thalassaemia due to Hb Lepore; Thalassemia, delta to Thalassaemia, delta-; Thalassaemia due to Hb Lepore | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.80 | HBD | Zornitza Stark reviewed gene: HBD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassaemia, delta-, Thalassaemia due to Hb Lepore; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.80 | HBB | Zornitza Stark Marked gene: HBB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.80 | HBB | Zornitza Stark Gene: hbb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.80 | HBB | Zornitza Stark Phenotypes for gene: HBB were changed from Sickle cell anemia (BIALLELIC, autosomal or pseudoautosomal),603903; 613985 Thalassemia, beta; Erythremias, beta-; 603902 Thalassemia-beta, dominant inclusion-body; Thalassemias, beta-,(BIALLELIC, autosomal or pseudoautosomal), 613985; Hereditary persistence of fetal hemoglobin,(MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown),141749; 603902 Dominand inclusion body beta thalassaemia; 603903 Sickle cell disease; 141749 Delta-beta thalassaemia; Heinz body anemias, beta- (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 140700; Globin Disorder; Thalassemia-beta, dominant inclusion-body, 603902; Delta-beta thalassemia (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 141749; 613985 Beta thalassaemia; Methemoglobinemias, beta- to Thalassemia, beta, MIM# 613985; Sickle cell anaemia, MIM# 603903; Methaemoglobinaemia, beta type, MIM# 617971; Hereditary persistence of fetal haemoglobin, MIM# 141749; Heinz body anaemia, MIM# 140700; Erythrocytosis 6, MIM# 617980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.79 | HBB | Zornitza Stark reviewed gene: HBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, beta, MIM# 613985, Sickle cell anaemia, MIM# 603903, Methaemoglobinaemia, beta type, MIM# 617971, Hereditary persistence of fetal haemoglobin, MIM# 141749, Heinz body anaemia, MIM# 140700, Erythrocytosis 6, MIM# 617980; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.79 | HBA2 | Zornitza Stark Marked gene: HBA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.79 | HBA2 | Zornitza Stark Gene: hba2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.79 | HBA2 | Zornitza Stark Phenotypes for gene: HBA2 were changed from Hypochromic microcytic anemia; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Erythrocytosis; 60413 Thalassemia, alpha; Heinz body anemia,140700; Thalassemia, alpha-, 604131 to Thalassemia, alpha-, MIM# 604131; Heinz body anaemia, MIM# 140700; Erythrocytosis 7, MIM# 617981 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.78 | HBA2 | Zornitza Stark reviewed gene: HBA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, alpha-, MIM# 604131, Heinz body anaemia, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.78 | HBA1 | Zornitza Stark Marked gene: HBA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.78 | HBA1 | Zornitza Stark Gene: hba1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.78 | HBA1 | Zornitza Stark Phenotypes for gene: HBA1 were changed from Thalassemias, alpha-, 604131; 604131 Thalassemias, alpha; Erythremias, alpha-; Heinz body anemias, alpha-, 140700; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Methemoglobinemias, alpha- to Thalassemias, alpha-, MIM# 604131; Heinz body anemias, alpha-, MIM# 140700; Erythrocytosis 7, MIM# 617981 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.77 | HBA1 | Zornitza Stark reviewed gene: HBA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemias, alpha-, MIM# 604131, Heinz body anemias, alpha-, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.77 | GSS | Zornitza Stark Marked gene: GSS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.77 | GSS | Zornitza Stark Gene: gss has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.77 | GSS | Zornitza Stark Phenotypes for gene: GSS were changed from 231900 Enzyme Disorder; Hemolytic anemia due to glutathione synthetase deficiency, 231900; 266130 Glutathione synthetase deficiency; Enzyme Disorder; Glutathione synthetase deficiency, 266130; Hemolytic anemia due to glutathione synthetase deficiency to Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.76 | GSS | Zornitza Stark Publications for gene: GSS were set to 8896573 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | GSS | Zornitza Stark reviewed gene: GSS: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896573, 31198081, 29395598, 29340523, 28267090; Phenotypes: Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.195 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; deafness; ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; deafness; ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.194 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.92 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.91 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.93 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.92 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9109 | GGPS1 | Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9108 | GGPS1 | Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | SPTA1 | Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | SPTB | Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | TCN2 | Danielle Ariti reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency MIM# 275350, Decreased Ig levels, Megaloblastic anaemia, pancytopaenia, Reticulocytopaenia, failure to thrive, diarrhoea, hypogammaglobulinaemia, pallor, hypotonia, respiratory infection, if untreated (B12) for prolonged periods results in intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | TF | Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA1 | Zornitza Stark Tag adult-onset tag was added to STR: SCA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SBMA | Zornitza Stark Tag adult-onset tag was added to STR: SBMA. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | RCPS | Zornitza Stark Tag paediatric-onset tag was added to STR: RCPS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCHS | Zornitza Stark Marked STR: CCHS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCHS | Zornitza Stark Str: cchs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9108 | GSR | Zornitza Stark Marked gene: GSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9108 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9108 | GSR | Zornitza Stark Phenotypes for gene: GSR were changed from to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9107 | GSR | Zornitza Stark Publications for gene: GSR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9106 | GSR | Zornitza Stark Mode of inheritance for gene: GSR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9105 | GSR | Zornitza Stark Classified gene: GSR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9105 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9104 | GSR | Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | GSR | Zornitza Stark Marked gene: GSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.75 | GSR | Zornitza Stark Phenotypes for gene: GSR were changed from Hemolytic anemia due to glutathione reductase deficiency; Enzyme Disorder; NA Enzyme Disorder to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.74 | GSR | Zornitza Stark Publications for gene: GSR were set to 8533822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.73 | GSR | Zornitza Stark Classified gene: GSR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.73 | GSR | Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.72 | GSR | Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | Bryony Thompson Panel status changed from internal to public | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.294 | MAGEL2 | Zornitza Stark Publications for gene: MAGEL2 were set to 24076603; 27195816; 26365340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.293 | MAGEL2 | Zornitza Stark Mode of inheritance for gene: MAGEL2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9104 | MKRN3 | Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405 33214675 31041429 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Imprinting disorders v0.3 | MKRN3 | Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405, 33214675, 31041429, 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9104 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33820833, 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.292 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26365340, 33820833, 34128869; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | OPMD | Zornitza Stark Tag adult-onset tag was added to STR: OPMD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | OPDM2 | Zornitza Stark Tag adult-onset tag was added to STR: OPDM2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | MEDPSACH | Zornitza Stark Tag paediatric-onset tag was added to STR: MEDPSACH. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | HSAN8 | Zornitza Stark Tag paediatric-onset tag was added to STR: HSAN8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Marked STR: FRA2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Classified STR: FRA2A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.144 | FRA2A |
Bryony Thompson STR: FRA2A was added STR: FRA2A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA2A were set to 24763282 Phenotypes for STR: FRA2A were set to Neurodevelopmental delay Review for STR: FRA2A was set to AMBER Added comment: Three families with a wide spectrum of neurodevelopmental phenotypes with expression of folate-sensitive fragile site FRA2A. The CGG repeat is in an alternative promoter for AFF3, active in the brain. Expansion of >300 repeats causes expression of FRA2A and is associated with hypermethylation and silencing of AFF3 in at least one individual. There were 3-20 repeats in normal controls. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.72 | GPI | Zornitza Stark Marked gene: GPI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.72 | GPI | Zornitza Stark Gene: gpi has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.72 | GPI | Zornitza Stark Phenotypes for gene: GPI were changed from 613470 Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency; Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency, 613470 to Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.71 | GPI | Zornitza Stark Publications for gene: GPI were set to 411100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.70 | GPI | Zornitza Stark reviewed gene: GPI: Rating: GREEN; Mode of pathogenicity: None; Publications: 8499925, 9856489, 32103498; Phenotypes: Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4109 | UMPS | Zornitza Stark Marked gene: UMPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4109 | UMPS | Zornitza Stark Gene: umps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4109 | UMPS | Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria MIM# 258900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4108 | UMPS | Zornitza Stark Publications for gene: UMPS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4107 | UMPS | Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | UMPS | Zornitza Stark reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9104 | UMPS | Zornitza Stark Marked gene: UMPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9104 | UMPS | Zornitza Stark Gene: umps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9104 | UMPS | Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria, MIM# 258900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9103 | UMPS | Zornitza Stark Publications for gene: UMPS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9102 | UMPS | Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9101 | UMPS |
Zornitza Stark edited their review of gene: UMPS: Added comment: 20 unrelated patients have been reported with biallelic missense variants; one mouse model Orotic aciduria is characterised by megaloblastic anaemia and orotic acid crystalluria, frequently associated with a degree of physical and intellectual disability. Other features include, congenital malformations (Atrial/ Ventricular septal defect) and immunodeficiencies (T-cell dysfunction, failure to thrive, recurrent infections). Haematology features - Megaloblastic anaemia - Low to normal reticulocyte count - Anisocytosis - Poikilocytosis - Hypochromia; Changed publications: 9042911, 33489760; Changed phenotypes: Orotic aciduria, MIM# 258900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.70 | UMPS | Zornitza Stark Marked gene: UMPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.70 | UMPS | Zornitza Stark Gene: umps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.70 | UMPS | Zornitza Stark Phenotypes for gene: UMPS were changed from 258900 Orotic aciduria with megaloblastic anaemia to Orotic aciduria MIM# 258900; megaloblastic anaemia; orotic acid crystalluria; ID; immunodeficiencies | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.69 | UMPS | Zornitza Stark Publications for gene: UMPS were set to 9042911 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Imprinting disorders v0.3 | MAGEL2 |
Anna Le Fevre gene: MAGEL2 was added gene: MAGEL2 was added to Imprinting disorders. Sources: Literature Mode of inheritance for gene: MAGEL2 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Publications for gene: MAGEL2 were set to 24076603; 31397880; 29599419; 30302899 Phenotypes for gene: MAGEL2 were set to Schaaf-Yang syndrome; Chitayat-Hall Syndrome Review for gene: MAGEL2 was set to GREEN Added comment: MAGEL2 is a single-exon gene. Frameshift mutations may not cause nonsense-mediated decay, but instead a variety of truncated or elongated protein products. The pathogenicity of haploinsufficiency of the paternal allele is uncertain (ClinGen review 2018). A dominant-negative effect has been suggested. Haploinsufficiency may play a role. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.167 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9101 | TMPRSS6 | Zornitza Stark Marked gene: TMPRSS6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9101 | TMPRSS6 | Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9101 | TMPRSS6 | Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9100 | TMPRSS6 | Zornitza Stark Publications for gene: TMPRSS6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9099 | TMPRSS6 | Zornitza Stark Mode of inheritance for gene: TMPRSS6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.68 | TMPRSS6 | Zornitza Stark Marked gene: TMPRSS6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.68 | TMPRSS6 | Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.68 | TMPRSS6 | Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from Iron refractoryirondeficiencyanemia,206200; Iron-Refractory Iron Deficiency Anemia; 206200 Iron refractoryirondeficiencyanemia to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.67 | TMPRSS6 | Zornitza Stark Publications for gene: TMPRSS6 were set to 18408718 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9098 | TPI1 |
Zornitza Stark changed review comment from: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; to: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital haemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9098 | TPI1 |
Zornitza Stark edited their review of gene: TPI1: Added comment: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; Changed publications: 9338582, 32873690, 8503454; Changed phenotypes: Haemolytic anaemia due to triosephosphate isomerase deficiency, MIM# 615512 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.66 | TPI1 | Zornitza Stark Marked gene: TPI1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.66 | TPI1 | Zornitza Stark Gene: tpi1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.66 | TPI1 | Zornitza Stark Phenotypes for gene: TPI1 were changed from 615512 Hemolytic anemia due to triosephosphate isomerase deficiency; Enzyme Disorder; Hemolytic anemia due to triosephosphate isomerase deficiency,615512 to Haemolytic anaemia due to triosephosphate isomerase deficiency MIM# 615512; chronic haemolytic anaemia; neuromuscular dysfunction; intracellular accumulation of dihydroxyacetone phosphate (DHAP) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.65 | TPI1 | Zornitza Stark Publications for gene: TPI1 were set to 11698297; 9338582 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.648 | YARS2 | Zornitza Stark Marked gene: YARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.648 | YARS2 | Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.648 | YARS2 | Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.647 | YARS2 | Zornitza Stark Publications for gene: YARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.646 | YARS2 | Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.645 | YARS2 | Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9098 | YARS2 | Zornitza Stark Marked gene: YARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9098 | YARS2 | Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: ; Mode of pathogenicity: None; Publications: 24076603, 30302899, 31397880; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9098 | YARS2 | Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9097 | YARS2 | Zornitza Stark Publications for gene: YARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9096 | YARS2 | Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9095 | YARS2 | Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9095 | TMPRSS6 | Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Metal Metabolism Disorders v0.23 | TMPRSS6 | Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.64 | TMPRSS6 | Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.64 | TPI1 | Danielle Ariti reviewed gene: TPI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9338582, 32873690, 8503454; Phenotypes: Hemolytic anemia due to triosephosphate isomerase deficiency MIM# 615512, chronic hemolytic anaemia, neuromuscular dysfunction, intracellular accumulation of dihydroxyacetone phosphate (DHAP); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.64 | GLRX5 | Zornitza Stark Marked gene: GLRX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.64 | GLRX5 | Zornitza Stark Gene: glrx5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.64 | GLRX5 | Zornitza Stark Phenotypes for gene: GLRX5 were changed from 616860 Pyridoxine refractory sideroblastic anaemia 3; Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive, 205950; 205950 Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive to Anaemia, sideroblastic, 3, pyridoxine-refractory, MIM# 616860 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.63 | GLRX5 | Zornitza Stark Publications for gene: GLRX5 were set to 20364084; 25342667; 17485548 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.62 | GLRX5 | Zornitza Stark changed review comment from: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.; to: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anaemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.62 | GIF | Zornitza Stark Marked gene: GIF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.62 | GIF | Zornitza Stark Gene: gif has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.62 | GIF | Zornitza Stark Phenotypes for gene: GIF were changed from 261000 Intrinsic factor deficiency to Intrinsic factor deficiency, MIM# 261000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.61 | GIF | Zornitza Stark Publications for gene: GIF were set to 15738392; 14576042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.60 | GIF | Zornitza Stark reviewed gene: GIF: Rating: GREEN; Mode of pathogenicity: None; Publications: 14695536, 14576042, 15738392; Phenotypes: Intrinsic factor deficiency, MIM# 261000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.371 | GCLC | Zornitza Stark Marked gene: GCLC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.371 | GCLC | Zornitza Stark Gene: gclc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.371 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.370 | GCLC | Zornitza Stark Publications for gene: GCLC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.369 | GCLC | Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.368 | GCLC | Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28571779, 10515893; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9095 | GCLC | Zornitza Stark Marked gene: GCLC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9095 | GCLC | Zornitza Stark Gene: gclc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.60 | UMPS | Danielle Ariti reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900, megaloblastic anaemia, orotic acid crystalluria, ID, immunodeficiencies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9095 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450; Disorders of the gamma-glutamyl cycle | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9094 | GCLC | Zornitza Stark Publications for gene: GCLC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9093 | GCLC | Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9092 | GCLC | Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.60 | GCLC | Zornitza Stark Marked gene: GCLC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.60 | GCLC | Zornitza Stark Gene: gclc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.60 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.59 | GCLC | Zornitza Stark Phenotypes for gene: GCLC were changed from 230450 Glutamate-cysteine ligase deficiency; Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, 230450; Enzyme Disorder; Glutamate-cysteine ligase deficiency; 230450 Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency to Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.58 | GCLC | Zornitza Stark Publications for gene: GCLC were set to 10515893 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.57 | GCLC | Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.143 | FRA7A | Bryony Thompson Marked STR: FRA7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.143 | FRA7A | Bryony Thompson Str: fra7a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.143 | FRA7A |
Bryony Thompson STR: FRA7A was added STR: FRA7A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA7A were set to 25196122 Phenotypes for STR: FRA7A were set to Autism spectrum disorder Review for STR: FRA7A was set to AMBER Added comment: A de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. The expanded allele showed hypermethylation of the adjacent CpG island and reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line. The probands mother had a pre-mutation with 85 repeats. Controls showed a CGG-repeat range of 5 to 22. In a second family a pre-mutation (66-72) was identified in 3 siblings with ASD and an unaffected father. One of the siblings had mitotic instability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Marked gene: MAP1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Gene: map1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Classified gene: MAP1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.91 | MAP1B | Zornitza Stark Gene: map1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9092 | PDGFRL | Zornitza Stark Marked gene: PDGFRL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9092 | PDGFRL | Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9092 | PDGFRL | Zornitza Stark Classified gene: PDGFRL as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9092 | PDGFRL | Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.57 | YARS2 | Zornitza Stark Marked gene: YARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.57 | YARS2 | Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.57 | YARS2 | Zornitza Stark Phenotypes for gene: YARS2 were changed from 613561 Myopathy, lactic acidosis, and sideroblastic anemia 2; Myopathy, lactic acidosis, and sideroblastic anemia 2, 613561 to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.56 | YARS2 | Zornitza Stark Publications for gene: YARS2 were set to 23918765; 22504945; 20598274 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.142 | VACTERLX | Bryony Thompson Marked STR: VACTERLX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.142 | VACTERLX | Bryony Thompson Str: vacterlx has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.142 | VACTERLX |
Bryony Thompson STR: VACTERLX was added STR: VACTERLX was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: VACTERLX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: VACTERLX were set to 20452998; 32639022 Phenotypes for STR: VACTERLX were set to VACTERL association, X-linked MIM#314390 Review for STR: VACTERLX was set to RED Added comment: NM_003413.4(ZIC3):c.163GCC[X] PMID: 20452998 - reports a single case with VACTERL association and an expansion of the poly-Ala tract from 10 to 12 alanines. PMID: 32639022 - a family with Oculo-auriculo-vertebral spectrum (OAVS) segregates the 11 alanine expansion in affected males This polyalanine tract is highly polymorphic in gnomAD v2.1, there are 86 hemizygote 12 alanine expansions present and 65 hemizygotes with the 11 alanine expansion. The 13 polyalanine expansion is also present in 13 hemizygotes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9091 | PDGFRL | Michelle Torres reviewed gene: PDGFRL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Marked STR: FRA12A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Classified STR: FRA12A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.140 | FRA12A |
Bryony Thompson STR: FRA12A was added STR: FRA12A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA12A were set to 17236128 Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630 Review for STR: FRA12A was set to AMBER Added comment: NM_173602.2:c.-137CGG[X] All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp. 70 controls used to determine the "normal" repeat range. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.55 | XK | Danielle Ariti reviewed gene: XK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8004674, 30128557, 30800707; Phenotypes: McLeod syndrome with or without chronic granulomatous disease MIM# 300842, absence of red blood cell Kx antigen, weak expression of Kell red blood cell antigens, neuroacanthocytosis (peripheral and central nervous systems), cardiovascular abnormalities, myopathy; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.139 | FRA11A | Bryony Thompson Marked STR: FRA11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.139 | FRA11A | Bryony Thompson Str: fra11a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.139 | FRA11A |
Bryony Thompson STR: FRA11A was added STR: FRA11A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA11A was set to Unknown Publications for STR: FRA11A were set to 18160775; 453198 Phenotypes for STR: FRA11A were set to Intellectual disability Review for STR: FRA11A was set to RED Added comment: Expansion of a polymorphic CGG-repeat located at the 5' end of the C11orf80 gene causes expression of the folate-sensitive fragile site FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. The expansion was identified in the 15-year-old proband with intellectual disability as well as in phenotypically normal members of the family. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.55 | YARS2 | Danielle Ariti reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Marked STR: TOF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Str: tof has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Classified STR: TOF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Str: tof has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.137 | TOF |
Bryony Thompson STR: TOF was added STR: TOF was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: TOF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: TOF were set to 19948535; 11748311 Phenotypes for STR: TOF were set to Tetralogy of Fallot MIM#187500 Review for STR: TOF was set to GREEN STR: TOF was marked as clinically relevant Added comment: Poly-alanine tract expansion. In vitro functional assays demonstrated the expansion lead to protein aggregation in cells. Two unrelated cases reported with 25 repeats, one case with isolated interrupted aortic arch and one case with scoliosis, facial asymmetry, upslanting palpebral fissures, absent PV, isolated left pulmonary artery (expected de novo - excluded in mother and father not available for testing). Other variant types cause disease in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.90 | MAP1B |
Elena Savva gene: MAP1B was added gene: MAP1B was added to Deafness_IsolatedAndComplex. Sources: Literature Mode of inheritance for gene: MAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAP1B were set to PMID: 33268592 Phenotypes for gene: MAP1B were set to Periventricular nodular heterotopia 9 MIM#618918; sensorineural hearing loss Review for gene: MAP1B was set to GREEN Added comment: PMID: 33268592 - three unrelated patients with heterozygous missense variants and nonsyndromic sensorineural hearing loss. Functional studies on one missense show reduced protein expression and less phosphorylation. Variant correction via CRISPR rescued cell dysfunction, and K/O mice show hearing loss Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.136 | FRAXF | Bryony Thompson Marked STR: FRAXF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.136 | FRAXF | Bryony Thompson Str: fraxf has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.136 | FRAXF |
Bryony Thompson STR: FRAXF was added STR: FRAXF was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRAXF was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: FRAXF were set to 7874164; 10094554; 8651274 Phenotypes for STR: FRAXF were set to Intellectual disability Review for STR: FRAXF was set to RED Added comment: FRAXF is a folate-sensitive fragile site, where expansion was identified in a male with developmental delay. However, further studies found that expression of the fragile site through expansion is not associated with a disease phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Marked gene: UBE2U as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Classified gene: UBE2U as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.287 | UBE2U | Zornitza Stark Marked gene: UBE2U as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.287 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.287 | UBE2U | Zornitza Stark Classified gene: UBE2U as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.287 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9091 | IFIH1 | Zornitza Stark Marked gene: IFIH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9091 | IFIH1 | Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9091 | IFIH1 | Zornitza Stark Phenotypes for gene: IFIH1 were changed from to Aicardi-Goutieres syndrome 7, MIM#615846; Early-onset Inflammatory Bowel Disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9090 | IFIH1 | Zornitza Stark Publications for gene: IFIH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9089 | IFIH1 | Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1192 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1191 | PRICKLE2 |
Zornitza Stark gene: PRICKLE2 was added gene: PRICKLE2 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRICKLE2 were set to 34092786 Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms Review for gene: PRICKLE2 was set to GREEN Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.135 | FRA11B | Bryony Thompson Classified STR: FRA11B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.135 | FRA11B | Bryony Thompson Added comment: Comment on list classification: Low evidence of clinical relevance of expression of the fragile site. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.135 | FRA11B | Bryony Thompson Str: fra11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.134 | FRA11B |
Bryony Thompson STR: FRA11B was added STR: FRA11B was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA11B were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933 Phenotypes for STR: FRA11B were set to Jacobsen syndrome MIM#147791 Review for STR: FRA11B was set to AMBER Added comment: FRA11B is a rare folate sensitive fragile site caused by expansion of (CCG)n in the 5'UTR of CBL, and hypermethylation of adjacent CpG islands. There are commonly 11 repeats. The pre-mutation ranges from 80-100, while >100 leads to expression of the fragile site. Two cases of Jacobsen (llq-) syndrome, which is the clinical presentation of the loss of part of the long arm of chromosome 11, have been associated with the FRA11B repeat expansion (expected breakpoint). The estimated prevalence of the FRA11B expansion is 1 in 5,000, which the estimated prevalence of Jacobsen syndrome is <1 in 100,000. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4105 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | PRICKLE2 |
Hazel Phillimore gene: PRICKLE2 was added gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRICKLE2 were set to PMID: 34092786 Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms Review for gene: PRICKLE2 was set to GREEN Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.59 | IFIH1 |
Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant. Sources: Literature; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified. Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant. Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9088 | IFIH1 |
Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified. Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant. Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9088 | IFIH1 |
Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007). In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9088 | PRICKLE2 |
Hazel Phillimore changed review comment from: Six subjects from four unrelated families with heterozygous variants (two de novo missense (c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg)), one de novo nonsense variant (c.214 C>T; p.(Arg72*) and one frameshift variant (c.1286_1287delGT; p.(Ser429Thrfs*56)) which segregated with the disease in three affected females. Loss-of-function (homozygous) variants cause seizures in flies, and both heterozygous and homozygous mice showed behavioral abnormalities including altered social interaction, learning abnormalities, and behavioural inflexibility. PubMed: 21276947.; to: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PubMed: 21276947). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Marked gene: IFIH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Classified gene: IFIH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.59 | IFIH1 | Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9088 | IFIH1 | Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.58 | IFIH1 |
Sarah Pantaleo gene: IFIH1 was added gene: IFIH1 was added to Inflammatory bowel disease. Sources: Literature Mode of inheritance for gene: IFIH1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: IFIH1 were set to 34185153 Phenotypes for gene: IFIH1 were set to Inflammatory Bowel Disease Penetrance for gene: IFIH1 were set to Incomplete Review for gene: IFIH1 was set to GREEN Added comment: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9088 | FGF8 | Zornitza Stark Marked gene: FGF8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9088 | FGF8 | Zornitza Stark Gene: fgf8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9088 | FGF8 | Zornitza Stark Phenotypes for gene: FGF8 were changed from to Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Femoral hypoplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9087 | FGF8 | Zornitza Stark Publications for gene: FGF8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9086 | FGF8 | Zornitza Stark Mode of inheritance for gene: FGF8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.77 | IFIH1 | Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9085 | FGF8 | Zornitza Stark Tag SV/CNV tag was added to gene: FGF8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9085 | FGF8 | Zornitza Stark reviewed gene: FGF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.286 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Cataract. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9085 | UBE2U | Zornitza Stark Marked gene: UBE2U as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9085 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9085 | PRICKLE2 | Zornitza Stark Marked gene: PRICKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9085 | PRICKLE2 | Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9085 | PRICKLE2 | Zornitza Stark Phenotypes for gene: PRICKLE2 were changed from to Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9084 | PRICKLE2 | Zornitza Stark Publications for gene: PRICKLE2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9083 | PRICKLE2 | Zornitza Stark Mode of inheritance for gene: PRICKLE2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Marked gene: COPB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9082 | PRICKLE2 | Hazel Phillimore reviewed gene: PRICKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34092786; Phenotypes: Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9082 | UBE2U |
Ee Ming Wong changed review comment from: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature; to: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Marked gene: CACNA1I as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Classified gene: CACNA1I as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1190 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Marked gene: CACNA1I as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Classified gene: CACNA1I as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4103 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Marked gene: GRIK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9082 | UBE2U | Zornitza Stark Classified gene: UBE2U as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9082 | UBE2U | Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | COPB2 |
Belinda Chong gene: COPB2 was added gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COPB2 were set to PMID: 34450031 Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay Review for gene: COPB2 was set to AMBER Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis 3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Classified gene: GRIK2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1189 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9081 | FGF8 | Dean Phelan reviewed gene: FGF8: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 34433009; Phenotypes: Femoral hypoplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9081 | LRP1 | Seb Lunke Marked gene: LRP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9081 | LRP1 | Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.4 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.4 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1188 | GRIK2 | Zornitza Stark Classified gene: GRIK2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1188 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9081 | LRP1 | Seb Lunke Classified gene: LRP1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9081 | LRP1 | Seb Lunke Added comment: Comment on list classification: Two papers without related phenotypes and little overall evidence for gene disease association. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9081 | LRP1 | Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.4 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.4 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9080 | COPB2 | Zornitza Stark Phenotypes for gene: COPB2 were changed from Microcephaly 19, primary, autosomal recessive, MIM# 617800 to Microcephaly 19, primary, autosomal recessive, MIM# 617800; Osteoporosis and developmental delay | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9079 | COPB2 | Zornitza Stark Publications for gene: COPB2 were set to 29036432 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9078 | COPB2 | Zornitza Stark Mode of inheritance for gene: COPB2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1187 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9077 | COPB2 | Zornitza Stark Classified gene: COPB2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9077 | COPB2 | Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9076 | CACNA1I | Seb Lunke Marked gene: CACNA1I as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9076 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1187 | GRIK2 |
Danielle Ariti gene: GRIK2 was added gene: GRIK2 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: GRIK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: GRIK2 were set to 34375587; 17847003; 25039795 Phenotypes for gene: GRIK2 were set to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD) Review for gene: GRIK2 was set to GREEN Added comment: Over 10 individuals with variants in GRIK2; Bi-allelic and mono-allelic; loss of function 2 (sibs) with bi-allelic truncating variants and 1 family with bi-allelic deletion (removing exons 7 and 8). 11 individuals with de novo mono-allelic missense variants (5x with the same missense variant c.1969G>A (p.Ala657Thr) all the others were near this location). Associated with nonsyndromic neurodevelopmental disorder (NDD) with intellectual disability and developmental delay as core features with 30-50% individuals experiencing seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9076 | CACNA1I | Seb Lunke Classified gene: CACNA1I as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9076 | CACNA1I | Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | GRIK2 | Zornitza Stark Marked gene: GRIK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | GRIK2 | Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Mendeliome. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4101 | GRIK2 | Zornitza Stark Publications for gene: GRIK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.3 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Growth failure. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to AMBER gene: ZNF668 was marked as current diagnostic Added comment: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | LRP1 | Elena Savva reviewed gene: LRP1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 26142438, 33776059; Phenotypes: ?Keratosis pilaris atrophicans MIM#604093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4100 | GRIK2 | Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | COPB2 | Belinda Chong reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34450031; Phenotypes: Osteoporosis and developmental delay; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4099 | GRIK2 | Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | GRIK2 | Zornitza Stark Marked gene: GRIK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | GRIK2 | Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | CFAP206 | Seb Lunke Marked gene: CFAP206 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | CFAP206 | Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9075 | GRIK2 | Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; Nonsyndromic neurodevelopmental disorder, autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9074 | CFAP206 | Seb Lunke Publications for gene: CFAP206 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9073 | GRIK2 | Zornitza Stark Publications for gene: GRIK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9072 | GRIK2 | Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9071 | CFAP206 | Seb Lunke Classified gene: CFAP206 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9071 | CFAP206 | Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9070 | CFAP206 | Seb Lunke Phenotypes for gene: CFAP206 were changed from Multiple morphological abnormalities of the fagella to Multiple morphological abnormalities of the flagella | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4099 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.45 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.45 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.45 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.45 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9069 | ZNF668 | Zornitza Stark Marked gene: ZNF668 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9069 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9069 | ZNF668 | Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9069 | ZNF668 | Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9068 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9068 | GRIK2 | Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 | Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.44 | ZNF668 | Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.44 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9068 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Marked gene: LAMA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Classified gene: LAMA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Classified gene: LAMA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.14 | LAMA1 | Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9068 | GLIS1 | Seb Lunke Marked gene: GLIS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9068 | GLIS1 | Seb Lunke Gene: glis1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.44 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9068 | GLIS1 | Seb Lunke Phenotypes for gene: GLIS1 were changed from Increased ocular pressure to Increased ocular pressure; Glaucoma | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.13 | LAMA1 |
Zornitza Stark gene: LAMA1 was added gene: LAMA1 was added to Joubert syndrome and other neurological ciliopathies. Sources: Literature Mode of inheritance for gene: LAMA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LAMA1 were set to 34423300 Phenotypes for gene: LAMA1 were set to Poretti-Boltshauser syndrome, MIM# 615960 Review for gene: LAMA1 was set to GREEN Added comment: Four families with Poretti-Bolthauser syndrome identified in a cohort of 'unsolved' Joubert syndrome patients -- included due to phenotypic overlap. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9067 | GLIS1 |
Seb Lunke changed review comment from: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described. Sources: Literature; to: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described. The authors did show dysregulation of GLIS1 in a human cell line study, and performed linkage analysis suggesting an association of the GLIS1 locus with Glaucoma in UK biobank samples. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9067 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9067 | CFAP206 |
Ain Roesley gene: CFAP206 was added gene: CFAP206 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CFAP206 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFAP206 were set to Multiple morphological abnormalities of the fagella Penetrance for gene: CFAP206 were set to unknown Review for gene: CFAP206 was set to AMBER Added comment: 1x hom with a fs variant Sperm from knockout mouse model mainly had a fagellum of normal length but most of them showed abnormal forms including bent and coiled fagella. There was also a significant increase of sperm cells with absent or short fagella compared to the WT mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9067 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Marked gene: SLC32A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1187 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1186 | SLC32A1 |
Zornitza Stark gene: SLC32A1 was added gene: SLC32A1 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC32A1 were set to 34038384 Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus Review for gene: SLC32A1 was set to GREEN Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9067 | SLC32A1 | Zornitza Stark Marked gene: SLC32A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9067 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9067 | GLIS1 |
Seb Lunke gene: GLIS1 was added gene: GLIS1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: GLIS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GLIS1 were set to 34385434 Phenotypes for gene: GLIS1 were set to Increased ocular pressure Review for gene: GLIS1 was set to RED Added comment: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9066 | SLC32A1 | Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9066 | SLC32A1 | Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9065 | SLC32A1 |
Zornitza Stark gene: SLC32A1 was added gene: SLC32A1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC32A1 were set to 34038384 Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus Review for gene: SLC32A1 was set to GREEN Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.55 | GATA1 | Zornitza Stark Marked gene: GATA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.55 | GATA1 | Zornitza Stark Gene: gata1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.55 | GATA1 | Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 to Thrombocytopaenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.54 | GATA1 | Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anemia 300367; 300367 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; Myelodysplastic syndrome (MDS), Paediatric; Diamond-Blackfan anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities 300835; Diamond Blackfan Anaemia; 300835 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; 300367 Diamond Blackfan Anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities; Thrombocytopenia, X-linked, with or without dyserythropoietic anemia, 300367 to Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.53 | GATA1 | Zornitza Stark edited their review of gene: GATA1: Changed publications: 30228860, 24766296, 22706301 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.53 | GATA1 | Zornitza Stark edited their review of gene: GATA1: Changed phenotypes: Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9064 | G6PD | Zornitza Stark Marked gene: G6PD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9064 | G6PD | Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9064 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9063 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from to Haemolytic anemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9062 | G6PD | Zornitza Stark Publications for gene: G6PD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9061 | G6PD | Zornitza Stark Mode of inheritance for gene: G6PD was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9060 | G6PD | Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: 18177777; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.53 | G6PD | Zornitza Stark Marked gene: G6PD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.53 | G6PD | Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.53 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.52 | G6PD | Zornitza Stark Phenotypes for gene: G6PD were changed from 300908 Hemolytic anemia, G6PD deficient (favism); Enzyme Disorder; 300908 Hemolytic anemia due to G6PD deficiency; Hemolytic anemia due to G6PD deficiency, 300908 to Haemolytic anemia, G6PD deficient (favism), MIM# 300908 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.51 | G6PD | Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9060 | EPB42 | Zornitza Stark Marked gene: EPB42 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9060 | EPB42 | Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9060 | EPB42 | Zornitza Stark Phenotypes for gene: EPB42 were changed from to Spherocytosis, type 5, MIM# 612690 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9059 | EPB42 | Zornitza Stark Publications for gene: EPB42 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9058 | EPB42 | Zornitza Stark Mode of inheritance for gene: EPB42 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9057 | EPB42 | Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.51 | EPB42 | Zornitza Stark Marked gene: EPB42 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.51 | EPB42 | Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.51 | EPB42 | Zornitza Stark Phenotypes for gene: EPB42 were changed from Spherocytosis, type 5, 612690; 612690 Hereditary spherocytosis type 5; RBC membrane abnormality; Hereditary spherocytosis type 5; 612690 Spherocytosis, type 5; EPB42-related hereditary spherocytosis; Minkowski-Chauffard disease; Spherocytosis, Recessive; Elliptocytosis to Spherocytosis, type 5, MIM# 612690 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.50 | EPB42 | Zornitza Stark Publications for gene: EPB42 were set to 12176912; 7772513; 1558976 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.49 | EPB42 | Zornitza Stark edited their review of gene: EPB42: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.49 | EPB42 | Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9057 | EPB41 | Zornitza Stark Marked gene: EPB41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9057 | EPB41 | Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9057 | EPB41 | Zornitza Stark Phenotypes for gene: EPB41 were changed from to Elliptocytosis-1, MIM# 611804 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9056 | EPB41 | Zornitza Stark Publications for gene: EPB41 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9055 | EPB41 | Zornitza Stark Mode of inheritance for gene: EPB41 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9054 | EPB41 | Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.49 | EPB41 | Zornitza Stark Marked gene: EPB41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.49 | EPB41 | Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.49 | EPB41 | Zornitza Stark Phenotypes for gene: EPB41 were changed from Elliptocytosis-1,611804; RBC membrane abnormality; 611804 Hereditary elliptocytosis; 611804 Elliptocytosis-1; Elliptocytosis; Hereditary elliptocytosis to Elliptocytosis-1, MIM# 611804 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.48 | EPB41 | Zornitza Stark Publications for gene: EPB41 were set to 8423235; 1430200; 3134067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.47 | EPB41 | Zornitza Stark Mode of inheritance for gene: EPB41 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.46 | EPB41 | Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9054 | DHFR | Zornitza Stark Marked gene: DHFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9054 | DHFR | Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9054 | DHFR | Zornitza Stark Phenotypes for gene: DHFR were changed from to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9053 | DHFR | Zornitza Stark Publications for gene: DHFR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9052 | DHFR | Zornitza Stark Mode of inheritance for gene: DHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9051 | DHFR | Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.46 | DHFR | Zornitza Stark Marked gene: DHFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.46 | DHFR | Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.46 | DHFR | Zornitza Stark Phenotypes for gene: DHFR were changed from Megaloblastic anemia due to dihydrofolate reductase deficiency, 613839; 613839 Megaloblastic anemia due to dihydrofolate reductase deficiency to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.45 | DHFR | Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9051 | CYB5R3 | Zornitza Stark Marked gene: CYB5R3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9051 | CYB5R3 | Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9051 | CYB5R3 | Zornitza Stark Phenotypes for gene: CYB5R3 were changed from to Methaemoglobinaemia, type I and II, MIM# 250800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9050 | CYB5R3 | Zornitza Stark Publications for gene: CYB5R3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9049 | CYB5R3 | Zornitza Stark Mode of inheritance for gene: CYB5R3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9048 | CYB5R3 | Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methaemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.45 | CYB5R3 | Zornitza Stark Marked gene: CYB5R3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.45 | CYB5R3 | Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.45 | CYB5R3 | Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methemoglobinaemia, type I and II, MIM# 250800 to Methaemoglobinaemia, type I and II, MIM# 250800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.44 | CYB5R3 | Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methaemoglobinaemia; 250800 Methemoglobinemia; Methaemoglobinaemia type I and II, 250800; 250800 Methaemoglobinaemia type I and II to Methemoglobinaemia, type I and II, MIM# 250800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.43 | CYB5R3 | Zornitza Stark Publications for gene: CYB5R3 were set to 18318771; 15921385 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.42 | CYB5R3 | Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Classified STR: NIPA1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Added comment: Comment on list classification: This is an association/risk allele rather than high-risk disease-causing expansion, and not useful in the clinical diagnostic setting. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Classified STR: NIPA1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.131 | NIPA1 |
Bryony Thompson STR: NIPA1 was added STR: NIPA1 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: NIPA1 was set to Unknown Publications for STR: NIPA1 were set to 30342764; 22378146 Phenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis Review for STR: NIPA1 was set to GREEN Added comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.42 | CUBN | Zornitza Stark Marked gene: CUBN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.42 | CUBN | Zornitza Stark Gene: cubn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.42 | CUBN | Zornitza Stark Phenotypes for gene: CUBN were changed from Megaloblastic anemia-1, Finnish type, 261100; Megaloblastic Anemia; 261100 Megaloblastic anemia-1, Finnish type to Imerslund-Grasbeck syndrome 1, MIM# 261100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.41 | CUBN | Zornitza Stark Publications for gene: CUBN were set to 17285242; 15024727 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.40 | CUBN | Zornitza Stark reviewed gene: CUBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10080186, 21208123, 17668238]; Phenotypes: Imerslund-Grasbeck syndrome 1, MIM# 261100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.40 | COX4I2 | Zornitza Stark changed review comment from: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs).; to: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs). Note no other variants reported in this gene since original report in 2009. All variants submitted to ClinVar are VOUS/LB/B. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.40 | COX4I2 | Zornitza Stark Marked gene: COX4I2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.40 | COX4I2 | Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.40 | COX4I2 | Zornitza Stark Phenotypes for gene: COX4I2 were changed from Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, 612714; 612714 Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, andCalvarial Hyperostosis; 612714 Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.39 | COX4I2 | Zornitza Stark Publications for gene: COX4I2 were set to 19268275 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.38 | COX4I2 | Zornitza Stark Classified gene: COX4I2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.38 | COX4I2 | Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.37 | COX4I2 | Zornitza Stark reviewed gene: COX4I2: Rating: RED; Mode of pathogenicity: None; Publications: 19268275, 22730437; Phenotypes: Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.37 | CDAN1 | Zornitza Stark Marked gene: CDAN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.37 | CDAN1 | Zornitza Stark Gene: cdan1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.37 | CDAN1 | Zornitza Stark Phenotypes for gene: CDAN1 were changed from 224120 Dyserythropoietic anemia, congenital, type Ia; 224120 Congenital dyserythropoietic anaemia type 1a; Dyserythropoietic anemia, congenital, type Ia, 224120 to Dyserythropoietic anaemia, congenital, type Ia, 224120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.36 | CDAN1 | Zornitza Stark Publications for gene: CDAN1 were set to 16098079; 12434312 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.35 | CDAN1 | Zornitza Stark edited their review of gene: CDAN1: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ia, 224120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.35 | ALDOA | Zornitza Stark Marked gene: ALDOA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.35 | ALDOA | Zornitza Stark Gene: aldoa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.35 | ALDOA | Zornitza Stark Phenotypes for gene: ALDOA were changed from Enzyme Disorder; Glycogen storage disease; Aldolase A deficiency; 611881 Aldolase A deficiency; 611881 Glycogen storage disease XII; Glycogen storage disease XII, 611881; Glycogen storage disease due to aldolase A deficiency to Glycogen storage disease XII , MIM#611881 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.34 | ALDOA | Zornitza Stark Publications for gene: ALDOA were set to 8598869; 7331996 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.33 | ALDOA | Zornitza Stark reviewed gene: ALDOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7331996, 8598869, 25392908; Phenotypes: Glycogen storage disease XII , MIM#611881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9048 | CD59 | Zornitza Stark Marked gene: CD59 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9048 | CD59 | Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9048 | CD59 | Zornitza Stark Phenotypes for gene: CD59 were changed from to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9047 | CD59 | Zornitza Stark Publications for gene: CD59 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9046 | CD59 | Zornitza Stark Mode of inheritance for gene: CD59 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.33 | CD59 |
Zornitza Stark changed review comment from: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.; to: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis. More than 5 unrelated families reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9045 | CD59 | Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.33 | CD59 | Zornitza Stark Marked gene: CD59 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.33 | CD59 | Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.33 | CD59 | Zornitza Stark Phenotypes for gene: CD59 were changed from Dyskeratosis congenita, X-linked, 305000; 305000 Dyskeratosis congenita, X-linked to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.32 | CD59 | Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.32 | C15orf41 | Zornitza Stark Marked gene: C15orf41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.32 | C15orf41 | Zornitza Stark Gene: c15orf41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.32 | C15orf41 | Zornitza Stark Phenotypes for gene: C15orf41 were changed from 615631 Congenital dyserythropoietic anaemia type 1b; Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib; 615631 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib, 615631 to Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.31 | C15orf41 | Zornitza Stark Publications for gene: C15orf41 were set to 29031773; 23716552; 29885034 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.30 | C15orf41 | Zornitza Stark edited their review of gene: C15orf41: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Marked STR: HSAN8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Classified STR: HSAN8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.129 | HSAN8 |
Bryony Thompson STR: HSAN8 was added STR: HSAN8 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: HSAN8 were set to 26005867 Phenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488 Review for STR: HSAN8 was set to GREEN STR: HSAN8 was marked as clinically relevant Added comment: NM_021619.3(PRDM12):c.1041CGC[X] Poly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS |
Bryony Thompson changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Marked STR: RCPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Str: rcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Classified STR: RCPS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Str: rcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.127 | RCPS |
Bryony Thompson STR: RCPS was added STR: RCPS was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: RCPS were set to 24360810; 29112243 Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: RCPS was set to GREEN STR: RCPS was marked as clinically relevant Added comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.30 | SYNCRIP | Zornitza Stark Marked gene: SYNCRIP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.30 | SYNCRIP | Zornitza Stark Gene: syncrip has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.30 | SYNCRIP |
Zornitza Stark gene: SYNCRIP was added gene: SYNCRIP was added to Periventricular Grey Matter Heterotopia. Sources: Literature Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SYNCRIP were set to 34157790 Phenotypes for gene: SYNCRIP were set to SYNCRIP-related neurodevelopmental disorder Review for gene: SYNCRIP was set to RED Added comment: One of 8 individuals reported so far had PVNH. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9045 | NEDD4L | Zornitza Stark Marked gene: NEDD4L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9045 | NEDD4L | Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9045 | NEDD4L | Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9044 | NEDD4L | Zornitza Stark Publications for gene: NEDD4L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9043 | NEDD4L | Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9042 | NEDD4L | Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.29 | NEDD4L | Zornitza Stark Marked gene: NEDD4L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.29 | NEDD4L | Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.29 | NEDD4L | Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.28 | NEDD4L | Zornitza Stark Publications for gene: NEDD4L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.27 | NEDD4L | Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.27 | NEDD4L | Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.26 | NEDD4L | Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Marked STR: MEDPSACH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Str: medpsach has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Classified STR: MEDPSACH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Str: medpsach has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.125 | MEDPSACH |
Bryony Thompson STR: MEDPSACH was added STR: MEDPSACH was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: MEDPSACH were set to 9887340; 17133256; 21922596 Phenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170 Review for STR: MEDPSACH was set to GREEN STR: MEDPSACH was marked as clinically relevant STR: MEDPSACH was marked as current diagnostic Added comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.26 | FLNA | Zornitza Stark Marked gene: FLNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.26 | FLNA | Zornitza Stark Gene: flna has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.26 | FLNA | Zornitza Stark Phenotypes for gene: FLNA were changed from to Heterotopia, periventricular, 1 , MIM#300049 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.25 | FLNA | Zornitza Stark Publications for gene: FLNA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.24 | FLNA | Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.23 | FLNA | Zornitza Stark reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: 9883725, 15668422, 15994863; Phenotypes: Heterotopia, periventricular, 1 , MIM#300049; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Marked gene: ARF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.22 | DCHS1 | Zornitza Stark Marked gene: DCHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.22 | DCHS1 | Zornitza Stark Gene: dchs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.22 | DCHS1 | Zornitza Stark Phenotypes for gene: DCHS1 were changed from to Van Maldergem syndrome 1, MIM# 601390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.21 | DCHS1 | Zornitza Stark Publications for gene: DCHS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.20 | DCHS1 | Zornitza Stark Mode of inheritance for gene: DCHS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.19 | DCHS1 | Zornitza Stark reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Classified gene: ARF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1185 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1184 | ARF1 |
Zornitza Stark gene: ARF1 was added gene: ARF1 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARF1 were set to 28868155; 34353862 Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185 Review for gene: ARF1 was set to GREEN Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Marked gene: ARF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Classified gene: ARF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ARF1 | Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4097 | ARF1 |
Zornitza Stark gene: ARF1 was added gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARF1 were set to 28868155; 34353862 Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185 Review for gene: ARF1 was set to GREEN Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.19 | ARF1 | Zornitza Stark changed review comment from: Additional reported of affected parent and child.; to: Additional report of affected parent and child. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.19 | ARF1 | Zornitza Stark commented on gene: ARF1: Additional reported of affected parent and child. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.19 | ARF1 | Zornitza Stark edited their review of gene: ARF1: Changed publications: 28868155, 34353862; Changed phenotypes: Periventricular nodular heterotopia 8, MIM# 618185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9042 | ARF1 | Zornitza Stark Publications for gene: ARF1 were set to 28868155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v1.25 | GINS2 | Zornitza Stark Marked gene: GINS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v1.25 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v1.25 | GINS2 |
Zornitza Stark gene: GINS2 was added gene: GINS2 was added to Craniosynostosis. Sources: Literature Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GINS2 were set to 34353863 Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis Review for gene: GINS2 was set to RED Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.3 | GINS2 | Zornitza Stark Marked gene: GINS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.3 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.3 | GINS2 |
Zornitza Stark gene: GINS2 was added gene: GINS2 was added to Growth failure. Sources: Literature Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GINS2 were set to 34353863 Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis Review for gene: GINS2 was set to RED Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9041 | GINS2 | Zornitza Stark Marked gene: GINS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9041 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9041 | GINS2 | Zornitza Stark Classified gene: GINS2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9041 | GINS2 | Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.30 | ANK1 | Zornitza Stark Marked gene: ANK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.30 | ANK1 | Zornitza Stark Gene: ank1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.30 | ANK1 | Zornitza Stark Phenotypes for gene: ANK1 were changed from Spherocytosis, type 1; Spherocytosis, type 1,182900; RBC membrane abnormality; 182900 Spherocytosis, type 1; 182900 RBC membrane abnormality to Spherocytosis, type 1, MIM# 182900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.29 | ANK1 | Zornitza Stark Publications for gene: ANK1 were set to 7883994; 9590147; 11167760 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.28 | ANK1 | Zornitza Stark reviewed gene: ANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8640229; Phenotypes: Spherocytosis, type 1, MIM# 182900; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9040 | AMN | Zornitza Stark Marked gene: AMN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9040 | AMN | Zornitza Stark Gene: amn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9040 | AMN | Zornitza Stark Phenotypes for gene: AMN were changed from to Imerslund-Grasbeck syndrome 2, MIM# 618882 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9039 | AMN | Zornitza Stark Publications for gene: AMN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9038 | AMN | Zornitza Stark Mode of inheritance for gene: AMN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9037 | AMN | Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.28 | AMN | Zornitza Stark Marked gene: AMN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.28 | AMN | Zornitza Stark Gene: amn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.28 | AMN | Zornitza Stark Phenotypes for gene: AMN were changed from 261100 Megaloblastic anemia-1, Norwegian type; Megaloblastic anemia-1, Norwegian type, 261100 to Imerslund-Grasbeck syndrome 2, MIM# 618882 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.27 | AMN | Zornitza Stark Publications for gene: AMN were set to 17285242; 12590260 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.26 | AMN | Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.124 | DMD | Bryony Thompson Marked STR: DMD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.124 | DMD | Bryony Thompson Str: dmd has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.124 | DMD |
Bryony Thompson STR: DMD was added STR: DMD was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: DMD was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: DMD were set to 27417533 Phenotypes for STR: DMD were set to Duchenne muscular dystrophy MIM#310200; Becker muscular dystrophy MIM#300376 Review for STR: DMD was set to RED Added comment: Single family reported with GAA repeat expansion in intron 62. Normal repeat range 11-33 in healthy controls. Expanded repeats range from 59-82 in the family, with 2 female carriers manifesting symptoms, a male foetus, 2 asymptomatic female carriers, and 2 male asymptomatic carriers ages 6 and 4 years. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9037 | AK1 | Zornitza Stark Marked gene: AK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9037 | AK1 | Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9037 | AK1 | Zornitza Stark Phenotypes for gene: AK1 were changed from to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9036 | AK1 | Zornitza Stark Publications for gene: AK1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9035 | AK1 | Zornitza Stark Mode of inheritance for gene: AK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9034 | AK1 | Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.26 | AK1 | Zornitza Stark Marked gene: AK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.26 | AK1 | Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.26 | AK1 | Zornitza Stark Phenotypes for gene: AK1 were changed from 612631 Hemolytic anemia due to adenylate kinase deficiency; Hemolytic anemia due to adenylate kinase deficiency, 612631 to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.25 | AK1 | Zornitza Stark Publications for gene: AK1 were set to 28211224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.24 | AK1 | Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9034 | ALAS2 | Zornitza Stark Marked gene: ALAS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9034 | ALAS2 | Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9034 | ALAS2 | Zornitza Stark Phenotypes for gene: ALAS2 were changed from to Anaemia, sideroblastic, 1, MIM# 300751; Protoporphyria, erythropoietic, X-linked, MIM# 300752 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9033 | ALAS2 | Zornitza Stark Publications for gene: ALAS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9032 | ALAS2 | Zornitza Stark Mode of inheritance for gene: ALAS2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9031 | ALAS2 | Zornitza Stark reviewed gene: ALAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10029606, 7949148, 10029606, 25615817; Phenotypes: Anaemia, sideroblastic, 1, MIM# 300751, Protoporphyria, erythropoietic, X-linked, MIM# 300752; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.24 | ALAS2 | Zornitza Stark Marked gene: ALAS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.24 | ALAS2 | Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.24 | ALAS2 | Zornitza Stark Phenotypes for gene: ALAS2 were changed from Anemia, sideroblastic, 1 300751; Anemia, sideroblastic, 1, 300751; 300751 Sideroblastic anaemia 1; 300751 Anemia, sideroblastic, 1 to Anaemia, sideroblastic, 1, MIM# 300751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.23 | ALAS2 | Zornitza Stark Publications for gene: ALAS2 were set to 10029606 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.22 | ALAS2 |
Zornitza Stark edited their review of gene: ALAS2: Added comment: The essential features of X-linked sideroblastic anemia include: (1) a hypochromic microcytic anaemia and 2 discrete populations of red blood cells, one microcytic and the other normocytic; (2) marrow ringed sideroblasts, particularly prominent in the late erythroid precursors; (3) a variable haematologic response to pharmacologic doses of pyridoxine; and (4) systemic iron overload secondary to chronic ineffective erythropoiesis. The age of clinical onset of the disorder can vary from in utero to the ninth decade. Well established gene-disease association.; Changed publications: 10029606, 7949148, 10029606 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.22 | ALAS2 | Zornitza Stark edited their review of gene: ALAS2: Changed phenotypes: Anaemia, sideroblastic, 1, MIM# 300751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.22 | ABCG8 | Zornitza Stark Marked gene: ABCG8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.22 | ABCG8 | Zornitza Stark Gene: abcg8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.22 | ABCG8 | Zornitza Stark Phenotypes for gene: ABCG8 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolemia 1, MIM# 210250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.21 | ABCG8 | Zornitza Stark Publications for gene: ABCG8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.20 | ABCG8 | Zornitza Stark reviewed gene: ABCG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 33807969; Phenotypes: Sitosterolemia 1, MIM# 210250; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.20 | ADA2 | Zornitza Stark Marked gene: ADA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.20 | ADA2 | Zornitza Stark Gene: ada2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.20 | ADA2 | Zornitza Stark Phenotypes for gene: ADA2 were changed from Diamond Blackfan anaemia to Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome, MIM# 615688 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.19 | ADA2 | Zornitza Stark Publications for gene: ADA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.18 | ADA2 |
Zornitza Stark changed review comment from: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency. At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.; to: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency. At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population. Anaemia is a reported feature. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v0.18 | ABCG5 | Zornitza Stark Marked gene: ABCG5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v0.18 | ABCG5 | Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v0.18 | ABCG5 | Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v0.17 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v0.16 | ABCG5 | Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v0.15 | ABCG5 | Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9031 | ABCG5 | Zornitza Stark Marked gene: ABCG5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9031 | ABCG5 | Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9031 | ABCG5 | Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9030 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9029 | ABCG5 | Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9028 | ABCG5 | Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.18 | ABCG5 | Zornitza Stark Marked gene: ABCG5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.18 | ABCG5 | Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.18 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to 32546081; 23556150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.17 | ABCG5 | Zornitza Stark edited their review of gene: ABCG5: Changed publications: 34304999, 33907061, 32546081, 23556150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.17 | ABCG5 | Zornitza Stark Phenotypes for gene: ABCG5 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolaemia 2, MIM# 618666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.16 | ABCG5 | Zornitza Stark Publications for gene: ABCG5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.15 | ABCG5 | Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.2 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.368 | ABCB7 | Zornitza Stark Marked gene: ABCB7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.368 | ABCB7 | Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.368 | ABCB7 | Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.367 | ABCB7 | Zornitza Stark Phenotypes for gene: ABCB7 were changed from to Anaemia, sideroblastic, with ataxia, MIM# 301310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.366 | ABCB7 | Zornitza Stark Publications for gene: ABCB7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.366 | ABCB7 | Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.365 | ABCB7 | Zornitza Stark Classified gene: ABCB7 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.365 | ABCB7 | Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.364 | ABCB7 | Zornitza Stark reviewed gene: ABCB7: Rating: RED; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.14 | ABCB7 | Zornitza Stark Marked gene: ABCB7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.14 | ABCB7 | Zornitza Stark Gene: abcb7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.14 | ABCB7 | Zornitza Stark Phenotypes for gene: ABCB7 were changed from 301310 Sideroblastic anaemia; Anemia, sideroblastic, with ataxia; Anemia, sideroblastic, with ataxia, 301310; 301310 Sideroblastic Anemia and Ataxia; Sideroblastic Anemia and Ataxia to Anaemia, sideroblastic, with ataxia, MIM# 301310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.13 | ABCB7 | Zornitza Stark Publications for gene: ABCB7 were set to 11843825; 4045952; 11050011 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.12 | ABCB7 | Zornitza Stark reviewed gene: ABCB7: Rating: GREEN; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Red cell disorders v0.11 | Zornitza Stark Panel name changed from Rare anaemia_GEL to Red cell disorders | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.320 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1183 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1182 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9028 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9027 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4096 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4095 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4095 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.320 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.319 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1182 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1181 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9027 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9026 | CLCN3 | Zornitza Stark reviewed gene: CLCN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9026 | TOM1 | Zornitza Stark Marked gene: TOM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9026 | TOM1 | Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9026 | TOM1 |
Zornitza Stark gene: TOM1 was added gene: TOM1 was added to Mendeliome. Sources: Expert list Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TOM1 were set to 31263572 Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510 Review for gene: TOM1 was set to RED Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v1.1 | TOM1 | Zornitza Stark Marked gene: TOM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v1.1 | TOM1 | Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v1.1 | TOM1 |
Zornitza Stark gene: TOM1 was added gene: TOM1 was added to Combined Immunodeficiency. Sources: Expert list Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TOM1 were set to 31263572 Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510 Review for gene: TOM1 was set to RED Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9025 | ARF1 | Arina Puzriakova reviewed gene: ARF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28868155, 34353862; Phenotypes: Periventricular nodular heterotopia 8, OMIM:618185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9025 | GINS2 |
Arina Puzriakova gene: GINS2 was added gene: GINS2 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GINS2 were set to 34353863 Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis Review for gene: GINS2 was set to RED Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9025 | DNAH10 | Zornitza Stark Phenotypes for gene: DNAH10 were changed from primary male infertility with asthenoteratozoospermia to Spermatogenic failure 56, MIM# 619515 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9024 | DNAH10 | Zornitza Stark reviewed gene: DNAH10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 56, MIM# 619515; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4095 | GNB2 | Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4094 | GNB2 | Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9024 | GNB2 | Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9023 | GNB2 | Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9023 | KIDINS220 | Zornitza Stark Phenotypes for gene: KIDINS220 were changed from Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; cerebral ventriculomegaly; limb contractures to Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; Ventriculomegaly and arthrogryposis, MIM# 619501 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9022 | KIDINS220 | Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296, Ventriculomegaly and arthrogryposis, MIM# 619501 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.94 | KIDINS220 | Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.93 | KIDINS220 | Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.292 | KIDINS220 | Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.291 | KIDINS220 | Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.1 |
Zornitza Stark Panel name changed from Growth failure in early childhood to Growth failure Panel types changed to Victorian Clinical Genetics Services; Rare Disease |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.404 | ZFP57 | Zornitza Stark edited their review of gene: ZFP57: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.404 | ZFP57 | Zornitza Stark Marked gene: ZFP57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.404 | ZFP57 | Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.404 | ZFP57 | Zornitza Stark Phenotypes for gene: ZFP57 were changed from diabetes mellitus, transient neonatal, 1MONDO:0011073; Diabetes mellitus, transient neonatal 1 OMIM:601410; IUGR; Multi Locus Imprinting Disturbance to Diabetes mellitus, transient neonatal 1, MIM# 601410 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.403 | ZFP57 | Zornitza Stark Classified gene: ZFP57 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.403 | ZFP57 | Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.402 | ZFP57 | Zornitza Stark reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393; Phenotypes: Diabetes mellitus, transient neonatal 1, MIM# 601410; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.92 | GOSR2 | Bryony Thompson Classified gene: GOSR2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.92 | GOSR2 | Bryony Thompson Added comment: Comment on list classification: Additional cases reported with muscular dystrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.92 | GOSR2 | Bryony Thompson Gene: gosr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.91 | GOSR2 | Bryony Thompson reviewed gene: GOSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34167170, 33639315, 33639315, 29855340, DOI:https://doi.org/10.1016/j.nmd.2013.06.404; Phenotypes: Epilepsy, progressive myoclonic 6 MIM#614018, congenital muscluar dystrophy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.402 | PADI6 | Zornitza Stark Marked gene: PADI6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.402 | PADI6 | Zornitza Stark Gene: padi6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.402 | PADI6 | Zornitza Stark Phenotypes for gene: PADI6 were changed from miscarriages in the family; Preimplantation embryonic lethality 2 OMIM:617234; Short stature; preimplantation embryonic lethality 2 MONDO:0014978; Multi Locus Imprinting Disturbance; IUGR; Beckwith-Wiedemann syndrome to IUGR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.401 | PADI6 | Zornitza Stark Mode of inheritance for gene: PADI6 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.400 | PADI6 | Zornitza Stark reviewed gene: PADI6: Rating: AMBER; Mode of pathogenicity: None; Publications: 33221824, 32928291, 29574422; Phenotypes: IUGR; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.400 | NLRP7 | Zornitza Stark Marked gene: NLRP7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.400 | NLRP7 | Zornitza Stark Gene: nlrp7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.400 | NLRP7 | Zornitza Stark Phenotypes for gene: NLRP7 were changed from hydatidiform mole, recurrent, 1 MONDO:0009273; Short stature; fetal wastage; Hydatidiform mole, recurrent, 1 OMIM:231090; IUGR; Multi Locus Imprinting Disturbance to IUGR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.399 | NLRP7 | Zornitza Stark Mode of inheritance for gene: NLRP7 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.398 | NLRP7 | Zornitza Stark reviewed gene: NLRP7: Rating: AMBER; Mode of pathogenicity: None; Publications: 28561018; Phenotypes: IUGR; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Myopathy Superpanel v1.43 | Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Myopathy - adult onset; Muscular dystrophy_Paediatric; Rhabdomyolysis; Limb Girdle Muscular Dystrophy | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9022 | CHRM1 | Bryony Thompson Marked gene: CHRM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9022 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Marked gene: CHRM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4094 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4093 | CHRM1 |
Bryony Thompson gene: CHRM1 was added gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218 Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism Review for gene: CHRM1 was set to AMBER Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways. PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu) PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9022 | CHRM1 | Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9022 | CHRM1 | Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9021 | CHRM1 |
Bryony Thompson gene: CHRM1 was added gene: CHRM1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218 Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism Review for gene: CHRM1 was set to AMBER Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways. PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu) PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9020 | FGF20 | Zornitza Stark Marked gene: FGF20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9020 | FGF20 | Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9020 | FGF20 | Zornitza Stark Classified gene: FGF20 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9020 | FGF20 | Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9019 | FGF20 |
Zornitza Stark gene: FGF20 was added gene: FGF20 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: FGF20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FGF20 were set to 22698282 Phenotypes for gene: FGF20 were set to Renal hypodysplasia/aplasia 2, MIM#615721 Review for gene: FGF20 was set to AMBER Added comment: Multiple affected fetuses in a consanguineous family; functional data. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9018 | ITGA8 | Zornitza Stark Marked gene: ITGA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9018 | ITGA8 | Zornitza Stark Gene: itga8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9018 | ITGA8 | Zornitza Stark Phenotypes for gene: ITGA8 were changed from to Renal hypodysplasia/aplasia 1, MIM# 191830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9017 | ITGA8 | Zornitza Stark Publications for gene: ITGA8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9016 | ITGA8 | Zornitza Stark Mode of inheritance for gene: ITGA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9015 | ITGA8 | Zornitza Stark reviewed gene: ITGA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 24439109; Phenotypes: Renal hypodysplasia/aplasia 1, MIM# 191830; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.398 | NLRP5 | Zornitza Stark Marked gene: NLRP5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.398 | NLRP5 | Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.398 | NLRP5 | Zornitza Stark Phenotypes for gene: NLRP5 were changed from body asymmetry; Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR to Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.397 | NLRP5 | Zornitza Stark Mode of inheritance for gene: NLRP5 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.396 | NLRP5 | Zornitza Stark Classified gene: NLRP5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.396 | NLRP5 | Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.395 | NLRP5 |
Zornitza Stark changed review comment from: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP2 in the MOTHER of the patient. Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother. Current trio filtering protocols may not account for this adequately.; to: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP5 in the MOTHER of the patient. Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother. Current trio filtering protocols may not account for this adequately. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.395 | NLRP5 | Zornitza Stark reviewed gene: NLRP5: Rating: AMBER; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: IUGR; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.395 | STAT3 | Zornitza Stark Marked gene: STAT3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.395 | STAT3 | Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.395 | STAT3 | Zornitza Stark Classified gene: STAT3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.395 | STAT3 | Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.394 | Zornitza Stark removed gene:NPR2 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9015 | NPR2 | Zornitza Stark Marked gene: NPR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9015 | NPR2 | Zornitza Stark Gene: npr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9015 | NPR2 | Zornitza Stark Phenotypes for gene: NPR2 were changed from to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Epiphyseal chondrodysplasia, Miura type, MIM# 615923; Short stature with nonspecific skeletal abnormalities, MIM# 616255 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9014 | NPR2 | Zornitza Stark Publications for gene: NPR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9013 | NPR2 | Zornitza Stark Mode of inheritance for gene: NPR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9012 | NPR2 |
Zornitza Stark changed review comment from: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models. Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.; to: Bi-allelic variants: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models. Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth. Mono-allelic variants have been linked to both tall stature and short stature disorders. Multiple families. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9012 | NPR2 | Zornitza Stark edited their review of gene: NPR2: Changed publications: 31555216, 16384845, 15146390, 22870295, 24057292, 24259409, 16384845, 24471569; Changed phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Epiphyseal chondrodysplasia, Miura type, MIM# 615923, Short stature with nonspecific skeletal abnormalities, MIM# 616255; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9012 | NPR2 | Zornitza Stark reviewed gene: NPR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31555216, 16384845, 15146390; Phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Short stature, disproportionate, Oval vertebral bodies in infancy, Progressive shortening of humerus, radius and ulna in first year, dwarfism, Prominent forehead; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.393 | Zornitza Stark removed gene:RAPSN from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.291 | RAPSN | Zornitza Stark Marked gene: RAPSN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.291 | RAPSN | Zornitza Stark Gene: rapsn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.291 | RAPSN | Zornitza Stark Phenotypes for gene: RAPSN were changed from to Fetal akinesia deformation sequence 2 MIM# 618388; AChR deficiency; fetal akinesia; IUGR; micrognathia; hypokinesia; contractures; muscular hypotonia; feeding difficulties; severe respiratory insufficiency; history of miscarriage | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.290 | RAPSN | Zornitza Stark Publications for gene: RAPSN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.289 | RAPSN | Zornitza Stark Mode of inheritance for gene: RAPSN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.288 | RAPSN | Zornitza Stark reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9012 | RPS6KA3 | Zornitza Stark Marked gene: RPS6KA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9012 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9012 | RPS6KA3 | Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9011 | RPS6KA3 | Zornitza Stark Publications for gene: RPS6KA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9010 | RPS6KA3 | Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9009 | RPS6KA3 | Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.392 | RPS6KA3 | Zornitza Stark Marked gene: RPS6KA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.392 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.392 | RPS6KA3 | Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from Coffin Lowry to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.391 | RPS6KA3 | Zornitza Stark Publications for gene: RPS6KA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.390 | RPS6KA3 | Zornitza Stark Classified gene: RPS6KA3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.390 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atrial Fibrillation v0.7 | SHOX2 | Zornitza Stark Marked gene: SHOX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atrial Fibrillation v0.7 | SHOX2 | Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atrial Fibrillation v0.7 | SHOX2 |
Zornitza Stark gene: SHOX2 was added gene: SHOX2 was added to Atrial Fibrillation. Sources: Expert Review Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SHOX2 were set to 30443179 Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation Review for gene: SHOX2 was set to RED Added comment: Single family reported with LoF in this gene and AF. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9009 | SHOX2 | Zornitza Stark Marked gene: SHOX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9009 | SHOX2 | Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9009 | SHOX2 |
Zornitza Stark gene: SHOX2 was added gene: SHOX2 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SHOX2 were set to 30443179 Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation Review for gene: SHOX2 was set to RED Added comment: Single family reported with LoF in this gene and AF. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.389 | SHOX2 | Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.388 | SHOX2 | Zornitza Stark Marked gene: SHOX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.388 | SHOX2 | Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.388 | SHOX2 | Zornitza Stark Phenotypes for gene: SHOX2 were changed from to Sinus Node Dysfunction; Atrial Fibrillation | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.387 | SHOX2 | Zornitza Stark Publications for gene: SHOX2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.386 | SHOX2 | Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.385 | SMARCAL1 | Zornitza Stark Marked gene: SMARCAL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.385 | SMARCAL1 | Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.385 | SMARCAL1 | Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from to Schimke immune-osseous dysplasia MIM# 242900; T cell deficiency; Short stature; IUGR; spondyloepiphyseal dysplasia; growth retardation; renal dysfunction; lymphocytopaenia; nephropathy; bacterial/viral/fungal infections; may present as SCID; bone marrow failure | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.384 | SMARCAL1 | Zornitza Stark Publications for gene: SMARCAL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.383 | SMARCAL1 | Zornitza Stark Mode of inheritance for gene: SMARCAL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.382 | SMARCAL1 | Zornitza Stark Classified gene: SMARCAL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.382 | SMARCAL1 | Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | NPR2 |
Danielle Ariti gene: NPR2 was added gene: NPR2 was added to Growth failure in early childhood. Sources: Literature Mode of inheritance for gene: NPR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NPR2 were set to 31555216; 16384845; 15146390 Phenotypes for gene: NPR2 were set to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Short stature, disproportionate; Oval vertebral bodies in infancy; Progressive shortening of humerus, radius and ulna in first year; dwarfism; Prominent forehead Review for gene: NPR2 was set to GREEN Added comment: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models. Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Marked gene: EPHB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Classified gene: EPHB4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Vascular Malformations_Somatic v1.6 | EPHB4 | Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Vascular Malformations_Somatic v1.5 | EPHB4 |
Bryony Thompson gene: EPHB4 was added gene: EPHB4 was added to Vascular Malformations_Somatic. Sources: Other Mode of inheritance for gene: EPHB4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHB4 were set to 31300548; 30760892 Phenotypes for gene: EPHB4 were set to Capillary malformation-arteriovenous malformation Review for gene: EPHB4 was set to AMBER Added comment: A single CV-AVM case has been reported with mosaicism of an EPHB4 variant. Mosaicism has also been reported for the other CV-AVM gene, RASA1. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | STAT3 |
Danielle Ariti gene: STAT3 was added gene: STAT3 was added to Growth failure in early childhood. Sources: Literature Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: STAT3 were set to 25349174; 25038750; 25359994 Phenotypes for gene: STAT3 were set to Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Lymphoproliferation; solid organ autoimmunity; growth failure; recurrent infections; short stature; IUGR; eczema; delayed puberty; dental abnormalities; autoimmune interstitial lung disease; juvenile-onset arthritis; primary hypothyroidism Mode of pathogenicity for gene: STAT3 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: STAT3 was set to GREEN Added comment: 18 individuals from 15 unrelated families; monoallelic (missense or in-frame del) variants; gain of function; Multiple mouse models Individuals exhibited various clinical features, with most presenting with early-onset autoimmunity and growth failure (IUGR, lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, recurrent infections, and short stature (<2SDS)). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 | HS2ST1 | Zornitza Stark Marked gene: HS2ST1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 | HS2ST1 | Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 | HS2ST1 | Zornitza Stark Classified gene: HS2ST1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 | HS2ST1 | Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.84 | HS2ST1 |
Zornitza Stark gene: HS2ST1 was added gene: HS2ST1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review Mode of inheritance for gene: HS2ST1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HS2ST1 were set to 33159882 Phenotypes for gene: HS2ST1 were set to Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194 Review for gene: HS2ST1 was set to GREEN Added comment: 4 individuals from 3 unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | PHPX | Zornitza Stark Tag paediatric-onset tag was added to STR: PHPX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | RAPSN | Danielle Ariti reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v1.0 | Bryony Thompson promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.9 | Bryony Thompson Panel status changed from internal to public | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.8 | DNAL4 |
Bryony Thompson gene: DNAL4 was added gene: DNAL4 was added to Mirror movements. Sources: Other Mode of inheritance for gene: DNAL4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAL4 were set to 25098561; 25236653 Phenotypes for gene: DNAL4 were set to Mirror movements 3 MIM#616059 Review for gene: DNAL4 was set to RED Added comment: Only a single large consanguineous Pakastani family with a homozygous variant reported. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.7 | RAD51 | Bryony Thompson Marked gene: RAD51 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.7 | RAD51 | Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.7 | RAD51 | Bryony Thompson Classified gene: RAD51 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.7 | RAD51 | Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.6 | RAD51 |
Bryony Thompson gene: RAD51 was added gene: RAD51 was added to Mirror movements. Sources: Expert list Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAD51 were set to 25763452; 22305526; 27830107; 24808016 Phenotypes for gene: RAD51 were set to Mirror movements 2 MIM#614508 Review for gene: RAD51 was set to GREEN gene: RAD51 was marked as current diagnostic Added comment: >3 families/probands reported with mirror movements Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | RPS6KA3 | Danielle Ariti reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | SHOX2 | Danielle Ariti reviewed gene: SHOX2: Rating: RED; Mode of pathogenicity: None; Publications: 30443179, 16537395, 16537395; Phenotypes: Linked to Sinus Node Dysfunction, Linked to Atrial Fibrillation; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | SMARCAL1 | Danielle Ariti reviewed gene: SMARCAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301550, 17089404, 20036229; Phenotypes: Schimke immune-osseous dysplasia MIM# 242900, T cell deficiency, Short stature, IUGR, spondyloepiphyseal dysplasia, growth retardation, renal dysfunction, lymphocytopaenia, nephropathy, bacterial/viral/fungal infections, may present as SCID, bone marrow failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.5 | NTN1 | Bryony Thompson Marked gene: NTN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.5 | NTN1 | Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.5 | NTN1 | Bryony Thompson Classified gene: NTN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.5 | NTN1 | Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.4 | NTN1 |
Bryony Thompson gene: NTN1 was added gene: NTN1 was added to Mirror movements. Sources: Expert list Mode of inheritance for gene: NTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NTN1 were set to 25763452; 28945198; 33472083 Phenotypes for gene: NTN1 were set to Mirror movements 4 MIM#618264 Review for gene: NTN1 was set to GREEN gene: NTN1 was marked as current diagnostic Added comment: Two unrelated families and an unrelated proband with mirror movements. Also, a mouse model recapitulates the human phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HPE5 | Zornitza Stark Tag paediatric-onset tag was added to STR: HPE5. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HMNMYO | Zornitza Stark Tag paediatric-onset tag was added to STR: HMNMYO. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HFGS_tract3 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HFGS_tract2 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HFGS_tract1 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HDL2 | Zornitza Stark Tag adult-onset tag was added to STR: HDL2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HD | Zornitza Stark Tag adult-onset tag was added to STR: HD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | GDPAG | Zornitza Stark Tag paediatric-onset tag was added to STR: GDPAG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FXTAS | Zornitza Stark Tag adult-onset tag was added to STR: FXTAS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FXS | Zornitza Stark Tag paediatric-onset tag was added to STR: FXS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FXPOI | Zornitza Stark Tag adult-onset tag was added to STR: FXPOI. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.3 | DCC | Bryony Thompson Classified gene: DCC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.3 | DCC | Bryony Thompson Gene: dcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.2 | DCC |
Bryony Thompson gene: DCC was added gene: DCC was added to Mirror movements. Sources: Expert list Mode of inheritance for gene: DCC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DCC were set to 20431009; 25763452; 28250454 Phenotypes for gene: DCC were set to Mirror movements 1 and/or agenesis of the corpus callosum MIM#157600 Review for gene: DCC was set to GREEN gene: DCC was marked as current diagnostic Added comment: Well-established and most common cause of congenital mirror movements. >20 cases reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.1 |
Bryony Thompson Panel name changed from Osteoporosis to Mirror movements Panel status changed from deleted to internal |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FTDALS | Zornitza Stark Tag adult-onset tag was added to STR: FTDALS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FRDA | Zornitza Stark Tag paediatric-onset tag was added to STR: FRDA. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FRAXE | Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXE. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FECD3 | Zornitza Stark Tag adult-onset tag was added to STR: FECD3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FAME3 | Zornitza Stark Tag adult-onset tag was added to STR: FAME3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FAME2 | Zornitza Stark Tag adult-onset tag was added to STR: FAME2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FAME1 | Zornitza Stark Tag adult-onset tag was added to STR: FAME1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | EPM1 | Zornitza Stark Tag paediatric-onset tag was added to STR: EPM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | EIEE1_tract2 | Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | EIEE1_tract1 | Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DRPLA |
Zornitza Stark Tag adult-onset tag was added to STR: DRPLA. Tag paediatric-onset tag was added to STR: DRPLA. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DM2 | Zornitza Stark Tag adult-onset tag was added to STR: DM2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DM1 |
Zornitza Stark Tag adult-onset tag was added to STR: DM1. Tag paediatric-onset tag was added to STR: DM1. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DBQD2 | Zornitza Stark Tag paediatric-onset tag was added to STR: DBQD2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Zornitza Stark Tag adult-onset tag was added to STR: CJD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CCHS | Zornitza Stark Tag paediatric-onset tag was added to STR: CCHS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CANVAS | Zornitza Stark Tag adult-onset tag was added to STR: CANVAS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | BPES | Zornitza Stark Tag paediatric-onset tag was added to STR: BPES. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | MSTO1 | Zornitza Stark Marked gene: MSTO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | MSTO1 | Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | MSTO1 | Zornitza Stark Classified gene: MSTO1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.381 | MSTO1 | Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.380 | MSTO1 | Zornitza Stark reviewed gene: MSTO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28544275, 29339779, 30684668; Phenotypes: Myopathy, mitochondrial, and ataxia, MIM# 617675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9007 | KCTD7 | Zornitza Stark Marked gene: KCTD7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9007 | KCTD7 | Zornitza Stark Gene: kctd7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9007 | KCTD7 | Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9006 | KCTD7 | Zornitza Stark Publications for gene: KCTD7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9005 | KCTD7 | Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9004 | KCTD7 | Kristin Rigbye reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 22693283, 22748208; Phenotypes: Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.139 | ANKRD17 | Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.138 | ANKRD17 | Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4092 | ANKRD17 | Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4091 | ANKRD17 | Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1181 | ANKRD17 | Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1180 | ANKRD17 | Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9004 | ANKRD17 | Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9003 | ANKRD17 | Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.380 | RPL10 | Zornitza Stark Marked gene: RPL10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.380 | RPL10 | Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.380 | RPL10 | Zornitza Stark Phenotypes for gene: RPL10 were changed from Mental retardation, X-linked, syndromic, 35 to Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998; severe growth retardation; intrauterine growth restriction; short stature; dysmorphic facial features (prognathism, dental crowding, thin upper lip); microcephaly; seizures; hypotonia; genitourinary abnormalities; cerebellar hypoplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.379 | RPL10 | Zornitza Stark Publications for gene: RPL10 were set to 25316788 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.378 | RPL10 | Zornitza Stark Classified gene: RPL10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.378 | RPL10 | Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9003 | ROR2 | Zornitza Stark Marked gene: ROR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9003 | ROR2 | Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9003 | ROR2 | Zornitza Stark Phenotypes for gene: ROR2 were changed from to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face; Brachydactyly, type B1 MIM# 113000; hypoplasia/aplasia of distal phalanges and nails (2-5) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9002 | ROR2 | Zornitza Stark Publications for gene: ROR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9001 | ROR2 | Zornitza Stark Mode of inheritance for gene: ROR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9000 | ROR2 | Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.377 | ROR2 | Zornitza Stark Marked gene: ROR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.377 | ROR2 | Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.377 | ROR2 | Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.376 | ROR2 | Zornitza Stark Publications for gene: ROR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.375 | ROR2 | Zornitza Stark Classified gene: ROR2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.375 | ROR2 | Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9000 | PROP1 | Zornitza Stark Marked gene: PROP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9000 | PROP1 | Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.9000 | PROP1 | Zornitza Stark Phenotypes for gene: PROP1 were changed from to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8999 | PROP1 | Zornitza Stark Publications for gene: PROP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8998 | PROP1 | Zornitza Stark Mode of inheritance for gene: PROP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8997 | PROP1 | Zornitza Stark reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.374 | PROP1 | Zornitza Stark Marked gene: PROP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.374 | PROP1 | Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.374 | PROP1 | Zornitza Stark Phenotypes for gene: PROP1 were changed from Pituitary hormone deficiency, combined to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.373 | PROP1 | Zornitza Stark Publications for gene: PROP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.372 | PROP1 | Zornitza Stark Classified gene: PROP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.372 | PROP1 | Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.371 | PROKR2 | Zornitza Stark Marked gene: PROKR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.371 | PROKR2 | Zornitza Stark Gene: prokr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.371 | PROKR2 | Zornitza Stark Phenotypes for gene: PROKR2 were changed from hypopituitarism, Hypoplastic corpus callosum, normal or small anterior pituitary, Club foot, syrinx spinal cord, microcephaly, epilepsy to Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200; Kallmann syndrome (KS); normosmic idiopathic hypogonadotropic hypogonadism (nIHH); Anosmia; GnRH deficiency; cleft lip and palate; renal agenesis; Hypogonadotropic hypogonadism; low testosterone/ estradiol; Absent/ partial Puberty; Hearing loss | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.370 | PROKR2 | Zornitza Stark Publications for gene: PROKR2 were set to 22319038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.369 | PROKR2 | Zornitza Stark Mode of inheritance for gene: PROKR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | RPL10 | Danielle Ariti Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | RPL10 |
Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model. Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model. Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | RPL10 |
Danielle Ariti edited their review of gene: RPL10: Added comment: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model. Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; Changed phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, short stature, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | RPL10 |
Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model. Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model. Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | RPL10 |
Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model. Patients typically present with intellectual disability, psychomotor delay, microcephaly, severe growth restriction (IUGR), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model. Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | RPL10 | Danielle Ariti reviewed gene: RPL10: Rating: GREEN; Mode of pathogenicity: None; Publications: 25316788, 25846674, 26290468; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 | Danielle Ariti Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 |
Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1). Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants. Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features. Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency. Growth failure/ short stature in early childhood is not a prominent feature; Changed rating: RED |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 |
Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants. Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features. Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency. Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1). Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants. Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features. Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency. Growth failure/ short stature is not a prominent feature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | ROR2 | Danielle Ariti reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROP1 | Danielle Ariti reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 |
Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants. Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features. Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency. Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants. Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features. Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency. Growth failure/ short stature is not a prominent feature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 | Danielle Ariti Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 |
Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants. Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features. Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency. Growth failure/ short stature is not a prominent feature; Changed rating: AMBER |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 | Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/ partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 | Danielle Ariti Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 | Danielle Ariti Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 |
Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants. Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features. Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency. Growth failure is not a prominent feature; Changed rating: AMBER |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | PROKR2 | Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), Normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.113 | WRN | Zornitza Stark Marked gene: WRN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.113 | WRN | Zornitza Stark Gene: wrn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.113 | WRN | Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.112 | WRN | Zornitza Stark Publications for gene: WRN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.111 | WRN | Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.110 | WRN | Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8997 | WRN | Zornitza Stark Marked gene: WRN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8997 | WRN | Zornitza Stark Gene: wrn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8997 | WRN | Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8996 | WRN | Zornitza Stark Publications for gene: WRN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8995 | WRN | Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8994 | WRN | Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | WRN | Zornitza Stark Marked gene: WRN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | WRN | Zornitza Stark Gene: wrn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.368 | WRN | Zornitza Stark Phenotypes for gene: WRN were changed from Werner syndrome to Werner syndrome, MIM# 277700; MONDO:0010196 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.367 | WRN | Zornitza Stark Publications for gene: WRN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.366 | WRN | Zornitza Stark Classified gene: WRN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.366 | WRN | Zornitza Stark Gene: wrn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.365 | WRN | Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.17 | POU1F1 | Zornitza Stark Marked gene: POU1F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.17 | POU1F1 | Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.17 | POU1F1 | Zornitza Stark Phenotypes for gene: POU1F1 were changed from Pituitary hormone deficiency, combined, 1 (613038) to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.16 | POU1F1 | Zornitza Stark Publications for gene: POU1F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.15 | POU1F1 | Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Marked STR: CJD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Classified STR: CJD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.147 | CJD |
Bryony Thompson STR: CJD was added STR: CJD was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CJD were set to 2159587; 20301407 Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: CJD was set to GREEN STR: CJD was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8994 | POU1F1 | Zornitza Stark Marked gene: POU1F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8994 | POU1F1 | Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8994 | POU1F1 | Zornitza Stark Phenotypes for gene: POU1F1 were changed from to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8993 | POU1F1 | Zornitza Stark Publications for gene: POU1F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8992 | POU1F1 | Zornitza Stark Mode of inheritance for gene: POU1F1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8991 | POU1F1 | Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.146 | Bryony Thompson removed STR:PRNP from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Marked STR: CJD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Classified STR: CJD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.122 | CJD |
Bryony Thompson STR: CJD was added STR: CJD was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CJD were set to 2159587; 20301407 Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: CJD was set to GREEN STR: CJD was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8991 | OPDM2 | Bryony Thompson Marked STR: OPDM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8991 | OPDM2 | Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.365 | POU1F1 | Zornitza Stark Marked gene: POU1F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.365 | POU1F1 | Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.365 | POU1F1 | Zornitza Stark Phenotypes for gene: POU1F1 were changed from GH, PRL deficiencies; variable degree of TSH deficiency to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.364 | POU1F1 | Zornitza Stark Publications for gene: POU1F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.363 | POU1F1 | Zornitza Stark Classified gene: POU1F1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.363 | POU1F1 | Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8991 | OPDM2 | Bryony Thompson Classified STR: OPDM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8991 | OPDM2 | Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.364 | SCA36 | Bryony Thompson Marked STR: SCA36 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.364 | SCA36 | Bryony Thompson Str: sca36 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.364 | SCA36 | Bryony Thompson Classified STR: SCA36 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.364 | SCA36 | Bryony Thompson Str: sca36 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.363 | SCA36 |
Bryony Thompson STR: SCA36 was added STR: SCA36 was added to Regression. Sources: Expert list Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA36 were set to 21683323 Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153 Review for STR: SCA36 was set to GREEN STR: SCA36 was marked as clinically relevant Added comment: NM_006392.3:c.3+71GGCCTG[X] Toxic RNA effect is suggested mechanism of disease Normal: 3-14 repeats Uncertain significance: 15-650 repeats Pathogenic: ≥650 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.362 | POU1F1 | Danielle Ariti reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.362 | NOP56 | Bryony Thompson Classified gene: NOP56 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.362 | NOP56 | Bryony Thompson Added comment: Comment on list classification: STR expansion is the only reported cause of disease for this gene. An STR has been added to this panel under SCA36 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.362 | NOP56 | Bryony Thompson Gene: nop56 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8990 | OPDM2 |
Bryony Thompson STR: OPDM2 was added STR: OPDM2 was added to Mendeliome. Sources: Literature Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPDM2 were set to 32413282; 33374016 Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940 Review for STR: OPDM2 was set to GREEN STR: OPDM2 was marked as clinically relevant Added comment: NM_005716.4:c.-211GGC[X] >15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Marked STR: OPDM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Classified STR: OPDM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.120 | OPDM2 |
Bryony Thompson STR: OPDM2 was added STR: OPDM2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPDM2 were set to 32413282; 33374016 Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940 Review for STR: OPDM2 was set to GREEN STR: OPDM2 was marked as clinically relevant Added comment: NM_005716.4:c.-211GGC[X] >15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8989 | FAME2 | Bryony Thompson Marked STR: FAME2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8989 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8989 | GIPC1 | Bryony Thompson Classified gene: GIPC1 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8989 | GIPC1 | Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under OPDM2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8989 | GIPC1 | Bryony Thompson Gene: gipc1 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8988 | FAME2 | Bryony Thompson Classified STR: FAME2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8988 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Marked STR: FAME3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Str: fame3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Classified STR: FAME3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Str: fame3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.118 | FAME3 |
Bryony Thompson STR: FAME3 was added STR: FAME3 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME3 were set to 31664039 Phenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608 Review for STR: FAME3 was set to GREEN STR: FAME3 was marked as clinically relevant Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8987 | FAME2 |
Bryony Thompson STR: FAME2 was added STR: FAME2 was added to Mendeliome. Sources: Literature Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME2 were set to 11701600; 24114805; 31664034 Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876 Review for STR: FAME2 was set to GREEN STR: FAME2 was marked as clinically relevant Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X] 158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.85 | BRWD3 | chirag patel Classified gene: BRWD3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.85 | BRWD3 | chirag patel Gene: brwd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.84 | BRWD3 |
chirag patel gene: BRWD3 was added gene: BRWD3 was added to Macrocephaly_Megalencephaly. Sources: Literature Mode of inheritance for gene: BRWD3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: BRWD3 were set to PMID: 30628072, 24462886 Phenotypes for gene: BRWD3 were set to Intellectual developmental disorder, X-linked 93; OMIM # 300659 Review for gene: BRWD3 was set to GREEN Added comment: 10 patients (from 6 unrelated families) with ID, macrocephaly and dysmorphic facial features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8986 | STARD7 | Bryony Thompson Classified gene: STARD7 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8986 | STARD7 | Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8986 | STARD7 | Bryony Thompson Gene: stard7 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Overgrowth v1.4 | BRWD3 | chirag patel Classified gene: BRWD3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Overgrowth v1.4 | BRWD3 | chirag patel Gene: brwd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Overgrowth v1.3 | BRWD3 | chirag patel reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, OMIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1180 | FAME2 | Bryony Thompson Marked STR: FAME2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1180 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1180 | FAME2 | Bryony Thompson Classified STR: FAME2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1180 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1179 | FAME2 |
Bryony Thompson STR: FAME2 was added STR: FAME2 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME2 were set to 11701600; 24114805; 31664034 Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876 Review for STR: FAME2 was set to GREEN STR: FAME2 was marked as clinically relevant Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X] 158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1178 | STARD7 | Bryony Thompson Classified gene: STARD7 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1178 | STARD7 | Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1178 | STARD7 | Bryony Thompson Gene: stard7 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Marked STR: FAME2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Classified STR: FAME2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.116 | FAME2 |
Bryony Thompson STR: FAME2 was added STR: FAME2 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME2 were set to 31664034 Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876 Review for STR: FAME2 was set to GREEN STR: FAME2 was marked as clinically relevant Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X] 158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.83 | PPP2R5D | chirag patel Classified gene: PPP2R5D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.83 | PPP2R5D | chirag patel Gene: ppp2r5d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Overgrowth v1.3 | PPP2R5D | chirag patel Classified gene: PPP2R5D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Overgrowth v1.3 | PPP2R5D | chirag patel Gene: ppp2r5d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.82 | PPP2R5D |
chirag patel gene: PPP2R5D was added gene: PPP2R5D was added to Macrocephaly_Megalencephaly. Sources: Literature Mode of inheritance for gene: PPP2R5D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R5D were set to PMID: 26168268, 25972378, 25533962; 34448180 Phenotypes for gene: PPP2R5D were set to Mental retardation, autosomal dominant 35, MIM# 616355 Review for gene: PPP2R5D was set to GREEN Added comment: Phenotype of macrocephaly is consistent, and multiple patients reported Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Overgrowth v1.2 | PPP2R5D | chirag patel reviewed gene: PPP2R5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.115 | FAME4 | Bryony Thompson Marked STR: FAME4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.115 | FAME4 | Bryony Thompson Str: fame4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.115 | FAME4 |
Bryony Thompson STR: FAME4 was added STR: FAME4 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME4 were set to 31539032 Phenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127 Review for STR: FAME4 was set to RED Added comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.114 | OPML1 | Bryony Thompson Marked STR: OPML1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.114 | OPML1 | Bryony Thompson Str: opml1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.114 | OPML1 |
Bryony Thompson STR: OPML1 was added STR: OPML1 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPML1 were set to 31332380 Phenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637 Review for STR: OPML1 was set to RED Added comment: NR_120611.1:n.192CCG[X] 4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8985 | PNPLA6 | Zornitza Stark Publications for gene: PNPLA6 were set to 25480986; 24355708 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8984 | PNPLA6 |
Zornitza Stark changed review comment from: Ataxia is part of the phenotype. Sources: Expert list; to: Variants in this gene are associated with multiple phenotypes. Oliver-McFarlane syndrome is a rare congenital disorder characterized by trichomegaly, severe chorioretinal atrophy and multiple pituitary hormone deficiencies, including growth hormone. At least 10 families reported. Laurence-Moon syndrome has a clinical presentation similar to that of Oliver-McFarlane syndrome, including chorioretinopathy and pituitary dysfunction, but with childhood onset of ataxia, peripheral neuropathy, and spastic paraplegia and without trichomegaly. Single family reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8984 | PNPLA6 | Zornitza Stark edited their review of gene: PNPLA6: Changed publications: 25480986, 33818269, 32758583, 30097146; Changed phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.362 | PNPLA6 | Zornitza Stark Marked gene: PNPLA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.362 | PNPLA6 | Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.362 | PNPLA6 | Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Oliver-Mcfarlane syndrome, Trichomegaly, GH deficiency, retinal dystrophy, hypogonadotrophic hypogonadism to Oliver-McFarlane syndrome, MIM# 275400; Laurence-Moon syndrome, MIM# 245800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.361 | PNPLA6 | Zornitza Stark Publications for gene: PNPLA6 were set to 25480986 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.360 | PNPLA6 | Zornitza Stark Classified gene: PNPLA6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.360 | PNPLA6 | Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.359 | PNPLA6 | Zornitza Stark reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480986, 33818269, 32758583, 30097146; Phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8984 | PI4KA | Zornitza Stark Phenotypes for gene: PI4KA were changed from Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531 to Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531; Neurodevelopmental syndrome with hypomyelinating leukodystrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8983 | PI4KA | Zornitza Stark Publications for gene: PI4KA were set to 25855803 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8982 | PI4KA | Zornitza Stark Classified gene: PI4KA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8982 | PI4KA | Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8981 | PI4KA | Zornitza Stark changed review comment from: Single family reported, aware of at least one other yet to be published family identified internally.; to: PMG: Single family reported, aware of at least one other yet to be published family identified internally. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8981 | PI4KA | Zornitza Stark edited their review of gene: PI4KA: Added comment: Neurodevelopmental syndrome with hypomyelinating leukodystrophy: 10 unrelated patients harbouring biallelic variants in PI4KA reported with a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.; Changed rating: GREEN; Changed publications: 25855803, 34415322; Changed phenotypes: Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531, Neurodevelopmental syndrome with hypomyelinating leukodystrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.17 | PI4KA | Zornitza Stark Marked gene: PI4KA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.17 | PI4KA | Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4091 | PI4KA | Zornitza Stark Marked gene: PI4KA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4091 | PI4KA | Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.232 | PI4KA | Zornitza Stark Marked gene: PI4KA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.232 | PI4KA | Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.17 | PI4KA | chirag patel Classified gene: PI4KA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.17 | PI4KA | chirag patel Gene: pi4ka has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.16 | PI4KA |
chirag patel gene: PI4KA was added gene: PI4KA was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PI4KA were set to PMID: 34415322 Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy Review for gene: PI4KA was set to GREEN Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4091 | PI4KA | chirag patel Classified gene: PI4KA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4091 | PI4KA | chirag patel Gene: pi4ka has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.232 | PI4KA | chirag patel Classified gene: PI4KA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.232 | PI4KA | chirag patel Gene: pi4ka has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4090 | PI4KA |
chirag patel gene: PI4KA was added gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PI4KA were set to PMID: 34415322 Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy Review for gene: PI4KA was set to GREEN Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.231 | PI4KA |
chirag patel gene: PI4KA was added gene: PI4KA was added to Leukodystrophy - paediatric. Sources: Literature Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PI4KA were set to PMID: 34415322 Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy Review for gene: PI4KA was set to GREEN Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Marked STR: OPDM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Classified STR: OPDM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.112 | OPDM1 |
Bryony Thompson STR: OPDM1 was added STR: OPDM1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: OPDM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPDM1 were set to 31332380; 34047774 Phenotypes for STR: OPDM1 were set to Oculopharyngodistal myopathy 1 MIM#164310 Review for STR: OPDM1 was set to GREEN STR: OPDM1 was marked as clinically relevant Added comment: NM_013437.5:c.-102CGG[X] RNA-mediated toxicity is thought to be the mechanism of disease. Sixty-five Japanese patients with oculopharyngodistal myopathy (OPDM) from 59 families with CGG repeat expansions in LRP12. This represents the most common OPDM subtype among all patients in Japan with genetically diagnosed OPDM. Normal: 13 to 45 repeats. Pathogenic: 85 to 289 repeats. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.145 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.145 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.144 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Early-onset Dementia. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.143 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v0.117 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v0.117 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v0.117 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v0.117 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v0.116 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Hereditary Neuropathy - complex. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v0.115 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.361 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.361 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.361 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.361 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.360 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Regression. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.359 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8981 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8981 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8981 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8981 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8980 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Mendeliome. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8979 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.120 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.120 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.120 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.120 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.119 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.118 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.110 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.109 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.359 | PITX2 | Zornitza Stark Marked gene: PITX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.359 | PITX2 | Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.359 | PITX2 | Zornitza Stark Phenotypes for gene: PITX2 were changed from AXENFELD-RIEGER SYNDROME to Axenfeld-Rieger syndrome, type 1, MIM# 180500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.358 | PITX2 | Zornitza Stark Classified gene: PITX2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.358 | PITX2 | Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.357 | PITX2 | Zornitza Stark reviewed gene: PITX2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Axenfeld-Rieger syndrome, type 1, MIM# 180500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8978 | SUCO | Bryony Thompson Marked gene: SUCO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8978 | SUCO | Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8978 | SUCO | Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8978 | SUCO | Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8977 | SUCO |
Bryony Thompson gene: SUCO was added gene: SUCO was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SUCO were set to 29620724; 20440000 Phenotypes for gene: SUCO were set to Osteogenesis imperfecta Review for gene: SUCO was set to AMBER Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.63 | SUCO | Bryony Thompson Marked gene: SUCO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.63 | SUCO | Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.63 | SUCO | Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.63 | SUCO | Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.62 | SUCO |
Bryony Thompson gene: SUCO was added gene: SUCO was added to Osteogenesis Imperfecta. Sources: Expert list Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SUCO were set to 29620724; 20440000 Phenotypes for gene: SUCO were set to Osteogenesis imperfecta Review for gene: SUCO was set to AMBER Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.61 | ANO5 | Bryony Thompson Classified gene: ANO5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.61 | ANO5 | Bryony Thompson Gene: ano5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.60 | ANO5 |
Bryony Thompson gene: ANO5 was added gene: ANO5 was added to Osteogenesis Imperfecta. Sources: Expert list Mode of inheritance for gene: ANO5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANO5 were set to 30712070; 15124103; 30641283; 29175271 Phenotypes for gene: ANO5 were set to Gnathodiaphyseal dysplasia MIM#166260 Review for gene: ANO5 was set to GREEN gene: ANO5 was marked as current diagnostic Added comment: Bone fragility is a feature of the condition, which is an overlapping feature with OI and could be a differential diagnosis. >3 families/probands and a null mouse model reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.59 | XYLT2 | Bryony Thompson Marked gene: XYLT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.59 | XYLT2 | Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.113 | XYLT2 | Bryony Thompson Marked gene: XYLT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.113 | XYLT2 | Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.59 | XYLT2 | Bryony Thompson Classified gene: XYLT2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.59 | XYLT2 | Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.58 | XYLT2 |
Bryony Thompson gene: XYLT2 was added gene: XYLT2 was added to Osteogenesis Imperfecta. Sources: Expert list Mode of inheritance for gene: XYLT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: XYLT2 were set to 26027496; 26987875 Phenotypes for gene: XYLT2 were set to Spondyloocular syndrome MIM#605822 Review for gene: XYLT2 was set to GREEN gene: XYLT2 was marked as current diagnostic Added comment: Generalised osteoporosis and recurrent fractures are a feature of the condition, which overlaps with the OI phenotype. >3 families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.357 | OTX2 | Zornitza Stark Marked gene: OTX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.357 | OTX2 | Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.357 | OTX2 | Zornitza Stark Phenotypes for gene: OTX2 were changed from Microcephaly, bilateral anopthalmia, developmental delay, cleft palate to Pituitary hormone deficiency, combined, 6, MIM# 613986; Microphthalmia, syndromic 5, MIM# 610125 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.356 | OTX2 | Zornitza Stark Publications for gene: OTX2 were set to 18728160 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.355 | OTX2 | Zornitza Stark Classified gene: OTX2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.355 | OTX2 | Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.354 | OTX2 | Zornitza Stark reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 18728160, 33950863, 15846561; Phenotypes: Pituitary hormone deficiency, combined, 6, MIM# 613986, Microphthalmia, syndromic 5, MIM# 610125; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.354 | MCM5 | Zornitza Stark Marked gene: MCM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.354 | MCM5 | Zornitza Stark Gene: mcm5 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.354 | MCM5 | Zornitza Stark Phenotypes for gene: MCM5 were changed from ?Meier-Gorlin syndrome 8 to Meier-Gorlin syndrome 8 (MIM#617564) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.353 | MCM5 | Zornitza Stark reviewed gene: MCM5: Rating: RED; Mode of pathogenicity: None; Publications: 28198391; Phenotypes: Meier-Gorlin syndrome 8 (MIM#617564); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.353 | LIG1 | Zornitza Stark Marked gene: LIG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.353 | LIG1 | Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.353 | LIG1 | Zornitza Stark Phenotypes for gene: LIG1 were changed from immunodeficiency, sun sensitivity, growth reatrdation to Combined immunodeficiency; Lymphopaenia; Hypogammaglobulinaemia; Recurrent bacterial and viral infections; Growth retardation; Sun sensitivity, radiation sensitivity; Macrocytosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.352 | LIG1 | Zornitza Stark Publications for gene: LIG1 were set to 1581963, 1351188 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.351 | LIG1 | Zornitza Stark Classified gene: LIG1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.351 | LIG1 | Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.350 | LIG1 | Zornitza Stark reviewed gene: LIG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30395541; Phenotypes: Combined immunodeficiency, Lymphopaenia, Hypogammaglobulinaemia, Recurrent bacterial and viral infections, Growth retardation, Sun sensitivity, radiation sensitivity, Macrocytosis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v0.57 | WNT4 |
Bryony Thompson gene: WNT4 was added gene: WNT4 was added to Osteogenesis Imperfecta. Sources: Expert list Mode of inheritance for gene: WNT4 was set to Unknown Publications for gene: WNT4 were set to 25108526; 26733379 Phenotypes for gene: WNT4 were set to Osteoporosis Review for gene: WNT4 was set to RED Added comment: Mouse model where recombinant Wnt4 alleviated bone loss and inflammation by inhibiting NF-κB in vivo in mouse models of bone disease. However, no reported association with Mendelian disease. A common SNP (rs10917157) has been associated with bone mineral density. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.0 | Bryony Thompson Panel deleted | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.350 | LHX4 | Zornitza Stark Marked gene: LHX4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.350 | LHX4 | Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.350 | LHX4 | Zornitza Stark Phenotypes for gene: LHX4 were changed from hypopituitarism to Pituitary hormone deficiency, combined, 4, MIM# 262700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.349 | LHX4 | Zornitza Stark Publications for gene: LHX4 were set to 11567216, 18073311 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.348 | LHX4 | Zornitza Stark Classified gene: LHX4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.348 | LHX4 | Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.347 | LHX4 | Zornitza Stark reviewed gene: LHX4: Rating: GREEN; Mode of pathogenicity: None; Publications: 11567216, 17527005, 18073311; Phenotypes: Pituitary hormone deficiency, combined, 4, MIM# 262700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.347 | LHX3 | Zornitza Stark Marked gene: LHX3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.347 | LHX3 | Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.347 | LHX3 | Zornitza Stark Phenotypes for gene: LHX3 were changed from GH, TSH, LH, FSH, PRL deficiencies to Pituitary hormone deficiency, combined, 3, MIM# 221750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.346 | LHX3 | Zornitza Stark Publications for gene: LHX3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.345 | LHX3 | Zornitza Stark Classified gene: LHX3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.345 | LHX3 | Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.344 | LHX3 | Zornitza Stark reviewed gene: LHX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10835633, 16394081, 17327381, 18407919; Phenotypes: Pituitary hormone deficiency, combined, 3, MIM# 221750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.344 | KHDC3L | Zornitza Stark Marked gene: KHDC3L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.344 | KHDC3L | Zornitza Stark Gene: khdc3l has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.344 | KHDC3L | Zornitza Stark Phenotypes for gene: KHDC3L were changed from pregnancy loss; Hydatidiform mole, recurrent, 2 OMIM:614293; hydatidiform mole, recurrent, 2 MONDO:0013671; Failure to thrive; IUGR to Silver-Russell syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.343 | KHDC3L | Zornitza Stark Mode of inheritance for gene: KHDC3L was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.342 | KHDC3L | Zornitza Stark reviewed gene: KHDC3L: Rating: RED; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: Silver-Russell syndrome; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.342 | Zornitza Stark removed gene:INTS8 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.341 | INSR | Zornitza Stark Marked gene: INSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.341 | INSR | Zornitza Stark Gene: insr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.341 | INSR | Zornitza Stark Phenotypes for gene: INSR were changed from Leprechaunism to Leprechaunism, MIM# 246200; Rabson-Mendenhall syndrome, MIM# 262190 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.340 | INSR | Zornitza Stark Publications for gene: INSR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.339 | INSR | Zornitza Stark Classified gene: INSR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.339 | INSR | Zornitza Stark Gene: insr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.338 | INSR | Zornitza Stark reviewed gene: INSR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8105179, 7815442, 33995269, 33224016, 33048476, 2121734, 9449692; Phenotypes: Leprechaunism, MIM# 246200, Rabson-Mendenhall syndrome, MIM# 262190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.131 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.141 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Early-onset Dementia. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.140 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.107 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.8 | GDPAG | Bryony Thompson Marked STR: GDPAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.8 | GDPAG | Bryony Thompson Str: gdpag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.8 | GDPAG | Bryony Thompson Classified STR: GDPAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.8 | GDPAG | Bryony Thompson Str: gdpag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.7 | GDPAG |
Bryony Thompson STR: GDPAG was added STR: GDPAG was added to Miscellaneous Metabolic Disorders. Sources: Literature Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GDPAG were set to 30970188 Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GDPAG was set to GREEN STR: GDPAG was marked as clinically relevant Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Marked STR: GDPAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Str: gdpag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Classified STR: GDPAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Str: gdpag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.6 | Bryony Thompson removed STR:GLS from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.105 | GDPAG |
Bryony Thompson STR: GDPAG was added STR: GDPAG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GDPAG were set to 30970188 Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GDPAG was set to GREEN STR: GDPAG was marked as clinically relevant Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.104 | FAME1_TTTGA | Bryony Thompson Marked STR: FAME1_TTTGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.104 | FAME1_TTTGA | Bryony Thompson Str: fame1_tttga has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.104 | FAME1_TTTGA |
Bryony Thompson STR: FAME1_TTTGA was added STR: FAME1_TTTGA was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME1_TTTGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME1_TTTGA were set to 31483537 Phenotypes for STR: FAME1_TTTGA were set to familial cortical myoclonic tremor with epilepsy Review for STR: FAME1_TTTGA was set to RED Added comment: A single family with 2 cases and 1 asymptomatic carrier with the repeat allele (TTTTA)114-123 (TTTGA)108-116, instead of the TTTCA FAME1 repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.103 | CANVAS_ACAGG | Bryony Thompson Classified STR: CANVAS_ACAGG as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.103 | CANVAS_ACAGG | Bryony Thompson Added comment: Comment on list classification: Used the pathogenic cut-off of 400 repeats from original CANVAS repeat | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.103 | CANVAS_ACAGG | Bryony Thompson Str: canvas_acagg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.102 | CANVAS_ACAGG |
Bryony Thompson STR: CANVAS_ACAGG was added STR: CANVAS_ACAGG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: CANVAS_ACAGG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CANVAS_ACAGG were set to 33237689; 32694621; 33103729 Phenotypes for STR: CANVAS_ACAGG were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome; fasciculations; elevated serum creatine kinase levels; denervation Review for STR: CANVAS_ACAGG was set to AMBER Added comment: A novel RFC1 repeat expansion motif, (ACAGG)exp, identified in three affected individuals from 2 families in an Asian-Pacific cohort and one Japanese individual for CANVAS. Southern blot was used to identify the repeat was ~1000kb in one of the cases, equivalent to ~1000 repeats. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Marked STR: CANVAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Str: canvas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Classified STR: CANVAS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Str: canvas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.100 | CANVAS |
Bryony Thompson STR: CANVAS was added STR: CANVAS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CANVAS were set to 30926972; 32851396; 33237689; 31230722 Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Review for STR: CANVAS was set to GREEN STR: CANVAS was marked as clinically relevant Added comment: NM_001204747.1:c.132+2923_2927AAAAG[X] Simple tandem repeat (AAAAG)n replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Maori population-specific CANVAS configuration (AAAGG)10-25(AAGGG)exp. (AAAGG)n repeat alone is not pathogenic. Mechanism of disease is unknown. Normal: AAAAG 11 repeats (allele frequency = 0.75); AAAAG 12-200 (allele frequency = 0.13); AAAGG 40-1000 (allele frequency = 0.08) Pathogenic: AAGGG repeat expansion, most frequently ranging from 400 to more than 2000 repeats (allele frequency = 0.01-0.04) Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8976 | IGFALS | Zornitza Stark Marked gene: IGFALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8976 | IGFALS | Zornitza Stark Gene: igfals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8976 | IGFALS | Zornitza Stark Phenotypes for gene: IGFALS were changed from to Acid-labile subunit, deficiency of, MIM# 615961 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8975 | IGFALS | Zornitza Stark Publications for gene: IGFALS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Marked STR: DBQD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Classified STR: DBQD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.98 | DBQD2 |
Bryony Thompson STR: DBQD2 was added STR: DBQD2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: DBQD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: DBQD2 were set to 30554721 Phenotypes for STR: DBQD2 were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: DBQD2 was set to GREEN STR: DBQD2 was marked as clinically relevant Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8974 | IGFALS | Zornitza Stark Mode of inheritance for gene: IGFALS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8973 | IGFALS | Zornitza Stark reviewed gene: IGFALS: Rating: GREEN; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.338 | IGFALS | Zornitza Stark Marked gene: IGFALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.338 | IGFALS | Zornitza Stark Gene: igfals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.338 | IGFALS | Zornitza Stark Phenotypes for gene: IGFALS were changed from very low IGF-I levels; Short stature; delayed puberty to Acid-labile subunit, deficiency of, MIM# 615961 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.337 | IGFALS | Zornitza Stark Publications for gene: IGFALS were set to 14762184 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.336 | IGFALS | Zornitza Stark Classified gene: IGFALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.336 | IGFALS | Zornitza Stark Gene: igfals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | IGFALS | Zornitza Stark edited their review of gene: IGFALS: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | IGFALS | Zornitza Stark reviewed gene: IGFALS: Rating: ; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | IFT172 | Zornitza Stark Marked gene: IFT172 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | IFT172 | Zornitza Stark Gene: ift172 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | IFT172 | Zornitza Stark reviewed gene: IFT172: Rating: RED; Mode of pathogenicity: None; Publications: 25664603; Phenotypes: GH deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | SAMD9 | Zornitza Stark Marked gene: SAMD9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | SAMD9 | Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | SAMD9 | Zornitza Stark Classified gene: SAMD9 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.335 | SAMD9 | Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.334 | SAMD9 | Zornitza Stark reviewed gene: SAMD9: Rating: GREEN; Mode of pathogenicity: None; Publications: 27182967; Phenotypes: MIRAGE syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.97 | FAME7 | Bryony Thompson Marked STR: FAME7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.97 | FAME7 | Bryony Thompson Str: fame7 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.97 | FAME7 |
Bryony Thompson STR: FAME7 was added STR: FAME7 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME7 were set to 29507423 Phenotypes for STR: FAME7 were set to Epilepsy, familial adult myoclonic, 7 MIM#618075 Review for STR: FAME7 was set to RED Added comment: The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.96 | FAME6 | Bryony Thompson Marked STR: FAME6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.96 | FAME6 | Bryony Thompson Str: fame6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.96 | FAME6 |
Bryony Thompson STR: FAME6 was added STR: FAME6 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME6 were set to 29507423 Phenotypes for STR: FAME6 were set to Epilepsy, familial adult myoclonic, 6 MIM#618074 Review for STR: FAME6 was set to RED Added comment: The expanded (TTTTA)22(TTTCA)exp(TTTTA)exp allele was identified 5 affected carriers in a single family. (TTTTA)18 is the reference repeats. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.78 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.78 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.78 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.78 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.77 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Incidentalome. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 25577942; 21944779; 21944778 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.76 | C9orf72 | Bryony Thompson Classified gene: C9orf72 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.76 | C9orf72 | Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FTDALS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.76 | C9orf72 | Bryony Thompson Gene: c9orf72 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8973 | FAME1 | Bryony Thompson Marked STR: FAME1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8973 | FAME1 | Bryony Thompson Str: fame1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8973 | FAME1 | Bryony Thompson Classified STR: FAME1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8973 | FAME1 | Bryony Thompson Str: fame1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8972 | FAME1 |
Bryony Thompson STR: FAME1 was added STR: FAME1 was added to Mendeliome. Sources: Expert list Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for STR: FAME1 were set to 30194086; 29507423 Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068 Review for STR: FAME1 was set to GREEN STR: FAME1 was marked as clinically relevant Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X] A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8971 | SAMD12 | Bryony Thompson Classified gene: SAMD12 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8971 | SAMD12 | Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FAME1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8971 | SAMD12 | Bryony Thompson Gene: samd12 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1171 | SAMD12 | Bryony Thompson Classified gene: SAMD12 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1171 | SAMD12 | Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.1171 | SAMD12 | Bryony Thompson Gene: samd12 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 |
Bryony Thompson changed review comment from: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X] A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease. Sources: Expert list; to: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X] A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Marked STR: FAME1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Str: fame1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Classified STR: FAME1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Str: fame1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.94 | FAME1 |
Bryony Thompson STR: FAME1 was added STR: FAME1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for STR: FAME1 were set to 30194086; 29507423 Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068 Review for STR: FAME1 was set to GREEN STR: FAME1 was marked as clinically relevant Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X] A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.334 | HESX1 | Zornitza Stark Marked gene: HESX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.334 | HESX1 | Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.334 | HESX1 | Zornitza Stark Phenotypes for gene: HESX1 were changed from Septo-optic dysplasia; variable involvement of pituitary hormones to Septooptic dysplasia, MIM# 182230; Growth hormone deficiency with pituitary anomalies, MIM#182230 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.333 | HESX1 | Zornitza Stark Publications for gene: HESX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.332 | HESX1 | Zornitza Stark Classified gene: HESX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.332 | HESX1 | Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.331 | HESX1 | Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14561704, 26781211, 11136712, 16940453; Phenotypes: Septooptic dysplasia, MIM# 182230, Growth hormone deficiency with pituitary anomalies, MIM#182230; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.331 | H19 | Zornitza Stark Marked gene: H19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.331 | H19 | Zornitza Stark Gene: h19 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.331 | H19 | Zornitza Stark Phenotypes for gene: H19 were changed from Russell-Silver syndrome to Silver-Russell syndrome, MIM# 180860 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.330 | H19 | Zornitza Stark Mode of inheritance for gene: H19 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.329 | H19 | Zornitza Stark reviewed gene: H19: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Silver-Russell syndrome, MIM# 180860; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.329 | GPR161 | Zornitza Stark Marked gene: GPR161 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.329 | GPR161 | Zornitza Stark Gene: gpr161 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.329 | GPR161 | Zornitza Stark Phenotypes for gene: GPR161 were changed from Short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk to Pituitary stalk interruption syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.328 | GPR161 | Zornitza Stark changed review comment from: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk.; to: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyly. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.328 | GPR161 | Zornitza Stark reviewed gene: GPR161: Rating: RED; Mode of pathogenicity: None; Publications: 25322266; Phenotypes: Pituitary stalk interruption syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.319 | SCA37 | Bryony Thompson Classified STR: SCA37 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.319 | SCA37 | Bryony Thompson Str: sca37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.318 | SCA37 |
Bryony Thompson STR: SCA37 was added STR: SCA37 was added to Callosome. Sources: Expert list Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA37 were set to 28686858; 31145571 Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945 Review for STR: SCA37 was set to GREEN STR: SCA37 was marked as clinically relevant Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90] Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease. Non-pathogenic allele: (ATTTT)7–400 Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90] Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.317 | Bryony Thompson removed STR:DAB1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.316 | SCA10 | Bryony Thompson Marked STR: SCA10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.316 | SCA10 | Bryony Thompson Str: sca10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.316 | SCA10 | Bryony Thompson Classified STR: SCA10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.316 | SCA10 | Bryony Thompson Str: sca10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.315 | SCA10 |
Bryony Thompson STR: SCA10 was added STR: SCA10 was added to Callosome. Sources: Expert list Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA10 were set to 20301354; 11017075 Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516 Review for STR: SCA10 was set to GREEN STR: SCA10 was marked as clinically relevant Added comment: NM_013236.2:c.1430+54822ATTCT[X] Toxic RNA gain-of-function mechanism of disease Normal alleles: 10-32 ATTCT repeats Alleles of questionable significance: 33-280 ATTCT repeats Reduced-penetrance alleles: 33-850 repeats Full-penetrance alleles: 800-4,500 ATTCT repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.314 | ATXN10 | Bryony Thompson Classified gene: ATXN10 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.314 | ATXN10 | Bryony Thompson Added comment: Comment on list classification: STR is the only reported cause of disease. Added as an STR to the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.314 | ATXN10 | Bryony Thompson Gene: atxn10 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Marked STR: SPD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Str: spd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Classified STR: SPD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Str: spd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.92 | SPD1 |
Bryony Thompson STR: SPD1 was added STR: SPD1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SPD1 were set to 8817328; 33811808; 33533119 Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000 Review for STR: SPD1 was set to GREEN STR: SPD1 was marked as clinically relevant Added comment: NM_000523.4(HOXD13):c.212_213GCG[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect Normal repeat number: 15 Pathogenic repeat number: 24 Truncation of repeat also reported Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.91 | Bryony Thompson removed STR:SPD1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.313 | DAB1 | Bryony Thompson Marked STR: DAB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.313 | DAB1 | Bryony Thompson Str: dab1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.313 | DAB1 | Bryony Thompson Classified STR: DAB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.313 | DAB1 | Bryony Thompson Str: dab1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.312 | DAB1 |
Bryony Thompson STR: DAB1 was added STR: DAB1 was added to Callosome. Sources: Expert list Mode of inheritance for STR: DAB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DAB1 were set to 28686858; 31145571 Phenotypes for STR: DAB1 were set to Spinocerebellar ataxia 37 MIM#615945 Review for STR: DAB1 was set to GREEN STR: DAB1 was marked as clinically relevant Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90] Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease. Non-pathogenic allele: (ATTTT)7–400 Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90] Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Marked STR: SCA37 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Str: sca37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Classified STR: SCA37 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Str: sca37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.89 | SCA37 |
Bryony Thompson STR: SCA37 was added STR: SCA37 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA37 were set to 28686858; 31145571 Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945 Review for STR: SCA37 was set to GREEN STR: SCA37 was marked as clinically relevant Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90] Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease. Non-pathogenic allele: (ATTTT)7–400 Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90] Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.311 | DAB1 | Bryony Thompson Classified gene: DAB1 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.311 | DAB1 | Bryony Thompson Added comment: Comment on list classification: STR expansion is the mechanism of disease for this gene. It has been added as an STR to this panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.311 | DAB1 | Bryony Thompson Gene: dab1 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP |
Bryony Thompson changed review comment from: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression. Sources: Expert list; to: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within intron 32. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Marked STR: XDP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Str: xdp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.117 | TAF1 | Bryony Thompson Classified gene: TAF1 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.117 | TAF1 | Bryony Thompson Added comment: Comment on list classification: Added as an STR to the panel | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.117 | TAF1 | Bryony Thompson Gene: taf1 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.116 | XDP | Bryony Thompson Marked STR: XDP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.116 | XDP | Bryony Thompson Str: xdp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.116 | XDP | Bryony Thompson Classified STR: XDP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.116 | XDP | Bryony Thompson Str: xdp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.115 | XDP |
Bryony Thompson STR: XDP was added STR: XDP was added to Early-onset Parkinson disease. Sources: Expert list founder tags were added to STR: XDP. Mode of inheritance for STR: XDP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: XDP were set to 17273961; 29229810 Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250 Review for STR: XDP was set to GREEN STR: XDP was marked as clinically relevant Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.328 | GLI3 | Zornitza Stark Marked gene: GLI3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.328 | GLI3 | Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.328 | GLI3 | Zornitza Stark Phenotypes for gene: GLI3 were changed from Pallister-Hall syndrome to Pallister-Hall syndrome, MIM# 146510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.327 | GLI3 | Zornitza Stark Publications for gene: GLI3 were set to 9054938 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.326 | GLI3 | Zornitza Stark Classified gene: GLI3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.326 | GLI3 | Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.325 | GLI3 | Zornitza Stark reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9054938, 10945658, 11693785; Phenotypes: Pallister-Hall syndrome, MIM# 146510; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.325 | TRIM37 | Zornitza Stark Marked gene: TRIM37 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.325 | TRIM37 | Zornitza Stark Gene: trim37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.325 | TRIM37 | Zornitza Stark Phenotypes for gene: TRIM37 were changed from Mulibrey nanism; Mulibery Nanism, 253250 to Mulibery nanism, MIM#253250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.324 | TRIM37 | Zornitza Stark Publications for gene: TRIM37 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Classified STR: XDP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Str: xdp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.87 | XDP |
Bryony Thompson STR: XDP was added STR: XDP was added to Repeat Disorders. Sources: Expert list founder tags were added to STR: XDP. Mode of inheritance for STR: XDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: XDP were set to 17273961; 29229810 Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250 Review for STR: XDP was set to GREEN STR: XDP was marked as clinically relevant Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.5 | FECD3 | Bryony Thompson Marked STR: FECD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.5 | FECD3 | Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.5 | FECD3 | Bryony Thompson Classified STR: FECD3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.5 | FECD3 | Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.4 | FECD3 |
Bryony Thompson STR: FECD3 was added STR: FECD3 was added to Corneal Dystrophy. Sources: Expert list Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FECD3 were set to 25722209; 24255041 Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267 Review for STR: FECD3 was set to GREEN STR: FECD3 was marked as clinically relevant Added comment: NG_011716.2:g.54765TGC[X] Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance. Normal: 5-31 repeats Pathogenic: >50 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.3 | TCF4 | Bryony Thompson Classified gene: TCF4 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.3 | TCF4 | Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.3 | TCF4 | Bryony Thompson Gene: tcf4 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Marked STR: FECD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Classified STR: FECD3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.85 | FECD3 |
Bryony Thompson STR: FECD3 was added STR: FECD3 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FECD3 were set to 25722209; 24255041 Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267 Review for STR: FECD3 was set to GREEN STR: FECD3 was marked as clinically relevant Added comment: NG_011716.2:g.54765TGC[X] Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance. Normal: 5-31 repeats Pathogenic: >50 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.192 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.192 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.192 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.192 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.191 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Dystonia - complex. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 26166205; 24363131; 26187722; 25577942; 21944779; 21944778 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.190 | Bryony Thompson removed STR:C9orf72 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.114 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.114 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.114 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.114 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.113 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Early-onset Parkinson disease. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 25577942; 21944779; 21944778; 31779815 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.112 | Bryony Thompson removed STR:C9orf72 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.130 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.130 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.130 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.130 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.129 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Motor Neurone Disease. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 25577942; 21944779; 21944778 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.128 | Bryony Thompson removed STR:C9orf72 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.138 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 25577942; 21944779; 21944778 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.137 | Bryony Thompson removed STR:C9orf72 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.83 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 25577942; 21944779; 21944778 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.82 | SCA12 | Bryony Thompson Publications for STR: SCA12 were set to 27864267; 33811808 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.81 | SCA12 | Bryony Thompson edited their review of STR: SCA12: Changed publications: 27864267, 33811808, 10581021 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.81 | SCA8 | Bryony Thompson Publications for STR: SCA8 were set to 20301445 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.80 | SCA8 | Bryony Thompson edited their review of STR: SCA8: Changed publications: 20301445, 10192387 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.80 | FXPOI | Bryony Thompson Publications for STR: FXPOI were set to 20301558 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.79 | FXPOI | Bryony Thompson edited their review of STR: FXPOI: Changed publications: 20301558, 9647544 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.79 | EPM1 | Bryony Thompson Publications for STR: EPM1 were set to 29325606; 20301321 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.78 | EPM1 | Bryony Thompson edited their review of STR: EPM1: Changed publications: 29325606, 20301321, 9126745 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.78 | FRDA | Bryony Thompson Publications for STR: FRDA were set to 20301458 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.77 | FRDA | Bryony Thompson edited their review of STR: FRDA: Changed publications: 20301458, 8596916 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.77 | DM1 | Bryony Thompson Publications for STR: DM1 were set to 20301344; 29325606 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.76 | DM1 | Bryony Thompson edited their review of STR: DM1: Changed publications: 20301344, 29325606, 1546325 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.76 | FXS | Bryony Thompson Publications for STR: FXS were set to 33795824; 25227148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | FXS | Bryony Thompson edited their review of STR: FXS: Changed publications: 33795824, 25227148, 1710175, 2031184 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8970 | SCA36 | Bryony Thompson Publications for STR: SCA36 were set to 25101480 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8969 | SCA36 | Bryony Thompson edited their review of STR: SCA36: Changed publications: 21683323 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Marked STR: SCA36 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Str: sca36 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Classified STR: SCA36 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Str: sca36 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.74 | SCA36 |
Bryony Thompson STR: SCA36 was added STR: SCA36 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA36 were set to 21683323 Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153 Review for STR: SCA36 was set to GREEN STR: SCA36 was marked as clinically relevant Added comment: NM_006392.3:c.3+71GGCCTG[X] Toxic RNA effect is suggested mechanism of disease Normal: 3-14 repeats Uncertain significance: 15-650 repeats Pathogenic: ≥650 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.111 | PSAP | Zornitza Stark Phenotypes for gene: PSAP were changed from Parkinson Disease, AD to Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.110 | PSAP | Zornitza Stark reviewed gene: PSAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mirror movements v0.0 |
Bryony Thompson Added Panel Osteoporosis Set panel types to: Royal Melbourne Hospital; Rare Disease |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8969 | MYO1H | Zornitza Stark Marked gene: MYO1H as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8969 | MYO1H | Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8969 | MYO1H |
Zornitza Stark gene: MYO1H was added gene: MYO1H was added to Mendeliome. Sources: Literature Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MYO1H were set to 28779001 Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482 Review for gene: MYO1H was set to RED Added comment: Single family reported with three affected children, homozygous LoF variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Central Hypoventilation v1.1 | MYO1H | Zornitza Stark Marked gene: MYO1H as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Central Hypoventilation v1.1 | MYO1H | Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Central Hypoventilation v1.1 | MYO1H |
Zornitza Stark gene: MYO1H was added gene: MYO1H was added to Central Hypoventilation. Sources: Literature Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MYO1H were set to 28779001 Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482 Review for gene: MYO1H was set to RED Added comment: Single family reported with three affected children, homozygous LoF variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Marked STR: SCA31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Str: sca31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Classified STR: SCA31 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Str: sca31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.72 | SCA31 |
Bryony Thompson STR: SCA31 was added STR: SCA31 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA31 were set to 19878914; 31755042 Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210 Review for STR: SCA31 was set to GREEN STR: SCA31 was marked as clinically relevant Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested. 2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042) Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Marked STR: FXTAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Str: fxtas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Classified STR: FXTAS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Str: fxtas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.70 | FXTAS |
Bryony Thompson STR: FXTAS was added STR: FXTAS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FXTAS were set to 23765048; 25227148; 11445641 Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623 Review for STR: FXTAS was set to GREEN STR: FXTAS was marked as clinically relevant Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Marked STR: DM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Str: dm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Classified STR: DM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Str: dm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.68 | DM2 |
Bryony Thompson STR: DM2 was added STR: DM2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: DM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DM2 were set to 20301639; 11486088 Phenotypes for STR: DM2 were set to Myotonic dystrophy 2 MIM#602668 Review for STR: DM2 was set to GREEN STR: DM2 was marked as clinically relevant Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X] Toxic gain of function RNA expected mechanism of disease Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions Unknown significance (normal vs. mutable): 27-29 CCTG repeats Mutable normal (premutation) alleles. ~30-~54 CCTG repeats Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats Pathogenic: ~75-11,000 CCTG repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Marked STR: SCA10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Str: sca10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Classified STR: SCA10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Str: sca10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.66 | SCA10 |
Bryony Thompson STR: SCA10 was added STR: SCA10 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA10 were set to 20301354; 11017075 Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516 Review for STR: SCA10 was set to GREEN STR: SCA10 was marked as clinically relevant Added comment: NM_013236.2:c.1430+54822ATTCT[X] Toxic RNA gain-of-function mechanism of disease Normal alleles: 10-32 ATTCT repeats Alleles of questionable significance: 33-280 ATTCT repeats Reduced-penetrance alleles: 33-850 repeats Full-penetrance alleles: 800-4,500 ATTCT repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.110 | FBXW7 | Zornitza Stark Marked gene: FBXW7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.110 | FBXW7 | Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.110 | FBXW7 | Zornitza Stark Phenotypes for gene: FBXW7 were changed from to Predisposition to cancer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.109 | FBXW7 | Zornitza Stark Classified gene: FBXW7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.109 | FBXW7 | Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.108 | BLM | Zornitza Stark Marked gene: BLM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.108 | BLM | Zornitza Stark Gene: blm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.108 | BLM | Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.107 | BLM | Zornitza Stark Publications for gene: BLM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.106 | BLM | Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.105 | BLM | Zornitza Stark reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8968 | BLM | Zornitza Stark Marked gene: BLM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8968 | BLM | Zornitza Stark Gene: blm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8968 | BLM | Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8967 | BLM | Zornitza Stark Publications for gene: BLM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8966 | BLM | Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8965 | PRKDC | Zornitza Stark Marked gene: PRKDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8965 | PRKDC | Zornitza Stark Gene: prkdc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8965 | PRKDC | Zornitza Stark Phenotypes for gene: PRKDC were changed from to Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966; Absent T and B cells; normal NK cells; SCID; recurrent respiratory infections; microcephaly; seizures; developmental delay | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8964 | PRKDC | Zornitza Stark Publications for gene: PRKDC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8963 | PRKDC | Zornitza Stark Mode of inheritance for gene: PRKDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8962 | PRKDC | Zornitza Stark reviewed gene: PRKDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 19075392, 23722905; Phenotypes: Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966, Absent T and B cells, normal NK cells, SCID, recurrent respiratory infections, microcephaly, seizures, developmental delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.394 | WAS | Zornitza Stark Marked gene: WAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.394 | WAS | Zornitza Stark Gene: was has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.394 | WAS | Zornitza Stark Phenotypes for gene: WAS were changed from to Neutropaenia, severe congenital, X-linked MIM# 300299; Wiskott-Aldrich syndrome MIM# 301000; Thrombocytopaenia, X-linked MIM# 313900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.393 | WAS | Zornitza Stark Publications for gene: WAS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.392 | WAS | Zornitza Stark Mode of pathogenicity for gene: WAS was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.391 | WAS | Zornitza Stark Mode of inheritance for gene: WAS was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8962 | TBX1 | Zornitza Stark Marked gene: TBX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8962 | TBX1 | Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8962 | TBX1 | Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8961 | TBX1 | Zornitza Stark Publications for gene: TBX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8960 | TBX1 | Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8959 | TBX1 | Zornitza Stark Tag SV/CNV tag was added to gene: TBX1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8959 | TBX1 | Zornitza Stark reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.390 | TBX1 | Zornitza Stark Tag SV/CNV tag was added to gene: TBX1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.390 | TBX1 | Zornitza Stark Marked gene: TBX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.390 | TBX1 | Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.390 | TBX1 | Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.389 | TBX1 | Zornitza Stark Publications for gene: TBX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.388 | TBX1 | Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8959 | RTEL1 | Zornitza Stark Marked gene: RTEL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8959 | RTEL1 | Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8959 | RTEL1 | Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8958 | RTEL1 | Zornitza Stark Publications for gene: RTEL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8957 | RTEL1 | Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8956 | RTEL1 | Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.387 | RTEL1 | Zornitza Stark Marked gene: RTEL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.387 | RTEL1 | Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.387 | RTEL1 | Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.386 | RTEL1 | Zornitza Stark Publications for gene: RTEL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.385 | RTEL1 | Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8956 | RMRP |
Zornitza Stark changed review comment from: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function. *Founder variant g.70A>G (Amish and Finnish populations) CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency.; to: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function. *Founder variant g.70A>G (Amish and Finnish populations) CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency. Anauxetic dysplasia 1, MIM# 607095 is a more severe phenotype, whereas Metaphyseal dysplasia without hypotrichosis, MIM# 250460 is milder. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8956 | RMRP | Zornitza Stark edited their review of gene: RMRP: Changed publications: 16244706, 21396580, 22420014, 11940090, 16252239 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8956 | RMRP | Zornitza Stark edited their review of gene: RMRP: Changed phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, Anauxetic dysplasia 1, MIM# 607095, Metaphyseal dysplasia without hypotrichosis, MIM# 250460 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8956 | RMRP | Zornitza Stark Marked gene: RMRP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8956 | RMRP | Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8956 | RMRP | Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage-hair hypoplasia MIM#250250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8955 | RMRP | Zornitza Stark Publications for gene: RMRP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8954 | RMRP | Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8953 | RMRP | Zornitza Stark reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.384 | RMRP | Zornitza Stark Marked gene: RMRP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.384 | RMRP | Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.384 | RMRP | Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage hair hypoplasia (CHH) MIM#250250; shortened limbs; short stature; metaphysical dysplasia; fine, sparse and/or light-coloured hair; hematologic abnormalities; CID; impaired lymphocyte proliferation; low Ig levels; antibodies variably decreased; bone marrow failure; autoimmunity; susceptibility to lymphoma and other cancers; impaired spermatogenesis; neuronal dysplasia of the intestine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.383 | RMRP | Zornitza Stark Publications for gene: RMRP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.382 | RMRP | Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8953 | BLM | Danielle Ariti reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Severe Combined Immunodeficiency v0.28 | IL7R | Danielle Ariti reviewed gene: IL7R: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843216, 19890784, 26123418, 11023514, 7964471; Phenotypes: Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type MIM# 608971, low T-cell numbers, normal-high B and NK-cell numbers, fever, rash, failure to thrive, recurrent respiratory and gastric infections, Hepatomegaly, Splenomegaly, diarrhoea, lymphadenopathy, pneumonitis, Pancytopaenia, decreased immunoglobulins; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | LIG4 | Danielle Ariti edited their review of gene: LIG4: Changed phenotypes: LIG4 syndrome MIM# 606593, T-/B- lymphocytopaenia, Normal NK, radiation sensitivity, Microcephaly, low/ absent B and T cells, low Ig, raised IgM, failure to thrive, bacterial/viral/fungal infections, hypogammaglobulinaemia, neurodevelopmental delay, microcephaly, pancytopaenia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | IKBKG | Danielle Ariti reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 11242109, 11047757, 29855039, 15833888, 28993958, 15577852; Phenotypes: Ectodermal dysplasia and immunodeficiency 1 MIM# 300291, Immunodeficiency 33 MIM# 300636; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | IKBKG | Danielle Ariti Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | IKBKG |
Danielle Ariti edited their review of gene: IKBKG: Added comment: Ectodermal dysplasia with immunodeficiency Over 12 families have been identified with IKBKG variants Individuals typically present within the first year of life with recurrent infections (pneumonia, bacterial infections of the bone and soft tissue), elevated IgM and ectodermal dysplasia features (sparse scalp and body hair, reduced ability to sweat, and conical teeth) ------ Immunodeficiency-33 and no ectodermal dysplasia 10 unrelated individuals been reported with IKBKG variants Characterised by early-onset severe infections, hypogammaglobulinaemia, decreased IgG and impaired antibody response to multiple vaccinations. ------- Multiple null IKBKG mouse models demonstrating both disease phenotypes AND Hemizygous (insertion, slice site, deletion and missense) variants have been reported in association with both diseases, causing premature stop codons; most common variants are splice-site; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | CD40LG |
Danielle Ariti changed review comment from: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome. Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119) Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF. Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections.; to: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome. Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119) Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF. Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | WAS | Danielle Ariti reviewed gene: WAS: Rating: GREEN; Mode of pathogenicity: Other; Publications: 11242115, 19006568, 16804117, 8069912, 10575547, 7579329, 7795648, 23807894; Phenotypes: Neutropenia, severe congenital, X-linked MIM# 300299, Wiskott-Aldrich syndrome MIM# 301000, Thrombocytopenia, X-linked MIM# 313900; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8953 | RFX5 | Zornitza Stark Marked gene: RFX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8953 | RFX5 | Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8953 | RFX5 | Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8952 | RFX5 | Zornitza Stark Publications for gene: RFX5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8951 | RFX5 | Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8950 | RFX5 | Zornitza Stark reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | RFX5 | Zornitza Stark Marked gene: RFX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | RFX5 | Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.381 | RFX5 | Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.380 | RFX5 | Zornitza Stark Publications for gene: RFX5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.379 | RFX5 | Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | TBX1 |
Danielle Ariti changed review comment from: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc). Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients.; to: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc). Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | TBX1 | Danielle Ariti reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | RTEL1 | Danielle Ariti reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | RMRP | Danielle Ariti reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | RFX5 | Danielle Ariti reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.90 | ELMOD3 | Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.89 | ELMOD3 | Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8950 | ELMOD3 | Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8949 | ELMOD3 | Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.80 | TYK2 | Zornitza Stark Marked gene: TYK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.80 | TYK2 | Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.80 | TYK2 | Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.79 | TYK2 | Zornitza Stark Publications for gene: TYK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.78 | TYK2 | Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.77 | TYK2 | Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8949 | TYK2 | Zornitza Stark Marked gene: TYK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8949 | TYK2 | Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8949 | TYK2 | Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8948 | TYK2 | Zornitza Stark Publications for gene: TYK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8947 | TYK2 | Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8946 | TYK2 | Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8946 | RAG1 | Zornitza Stark Marked gene: RAG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8946 | RAG1 | Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8946 | RAG1 | Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8945 | RAG1 | Zornitza Stark Publications for gene: RAG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8944 | RAG1 | Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8943 | RAG2 | Zornitza Stark Marked gene: RAG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8943 | RAG2 | Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8943 | RAG2 | Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8942 | RAG2 | Zornitza Stark Publications for gene: RAG2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8941 | RAG2 | Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4089 | EDEM3 | Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4088 | EDEM3 | Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8940 | EDEM3 | Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8939 | EDEM3 | Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.17 | EDEM3 | Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.16 | EDEM3 | Zornitza Stark edited their review of gene: EDEM3: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.16 | EDEM3 | Zornitza Stark reviewed gene: EDEM3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8939 | RAG2 | Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8939 | RAC2 | Zornitza Stark Marked gene: RAC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8939 | RAC2 | Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8939 | RAC2 | Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8938 | RAC2 | Zornitza Stark Publications for gene: RAC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8937 | RAG1 | Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8937 | RAC2 | Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8936 | RAC2 | Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | RAG2 | Zornitza Stark Marked gene: RAG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | RAG2 | Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.378 | RAG2 | Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.377 | RAG2 | Zornitza Stark Publications for gene: RAG2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.376 | RAG2 | Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.375 | RAG1 | Zornitza Stark Marked gene: RAG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.375 | RAG1 | Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.375 | RAG1 | Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.374 | RAG1 | Zornitza Stark Publications for gene: RAG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.373 | RAG1 | Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8935 | RAC2 | Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.372 | RAC2 | Zornitza Stark Marked gene: RAC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.372 | RAC2 | Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.372 | RAC2 | Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.372 | RAC2 | Zornitza Stark Publications for gene: RAC2 were set to 21167572; 10758162; 10072071; 25512081; 32542921; 31919089 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.371 | RAC2 | Zornitza Stark Publications for gene: RAC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.370 | RAC2 | Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.369 | RAC2 | Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.368 | MTHFD1 | Zornitza Stark Marked gene: MTHFD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.368 | MTHFD1 | Zornitza Stark Gene: mthfd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.368 | MTHFD1 | Zornitza Stark Phenotypes for gene: MTHFD1 were changed from to Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780; Decreased Ig levels; poor antibody responses to conjugated polysaccharide antigens; low B/T/NK cells; Recurrent bacterial infection; megaloblastic anaemia; failure to thrive; neutropenia; seizures; intellectual disability; folate-responsive; Lymphopaenia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8935 | MTHFD1 | Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Phenotypes: 32414565, 19033438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.367 | MTHFD1 | Zornitza Stark Publications for gene: MTHFD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.366 | MTHFD1 | Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.366 | MTHFD1 | Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8935 | GLI2 | Zornitza Stark Marked gene: GLI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8935 | GLI2 | Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8935 | GLI2 | Zornitza Stark Phenotypes for gene: GLI2 were changed from to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8934 | GLI2 | Zornitza Stark Publications for gene: GLI2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8933 | GLI2 | Zornitza Stark Mode of inheritance for gene: GLI2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8932 | GLI2 |
Zornitza Stark changed review comment from: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported, short stature is a feature as a result of GH deficiency. Variants in GLI2 are also associated with HPE, at least 5 families reported. Short stature is observed more rarely, as a result of midline defect.; to: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported. Variants in GLI2 are also associated with HPE, at least 5 families reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8932 | GLI2 | Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.323 | GLI2 | Zornitza Stark Marked gene: GLI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.323 | GLI2 | Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.323 | GLI2 | Zornitza Stark Phenotypes for gene: GLI2 were changed from Holoprosencephaly, hypopituitarism to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.322 | GLI2 | Zornitza Stark Publications for gene: GLI2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.321 | GLI2 | Zornitza Stark Classified gene: GLI2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.321 | GLI2 | Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.320 | GLI2 | Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.15 | GHSR | Zornitza Stark Marked gene: GHSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.15 | GHSR | Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.15 | GHSR | Zornitza Stark Publications for gene: GHSR were set to 19789204; 25557026 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.14 | GHSR | Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.14 | GHSR | Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pituitary hormone deficiency v0.13 | GHSR | Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8932 | GHSR | Zornitza Stark Marked gene: GHSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8932 | GHSR | Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8932 | GHSR | Zornitza Stark Phenotypes for gene: GHSR were changed from to Growth hormone deficiency, isolated partial, MIM# 615925 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8931 | GHSR | Zornitza Stark Publications for gene: GHSR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8930 | GHSR | Zornitza Stark Mode of inheritance for gene: GHSR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8929 | GHSR | Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8929 | GHSR | Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8928 | GHSR | Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.320 | GHSR | Zornitza Stark edited their review of gene: GHSR: Changed publications: 25557026, 19789204, 16511605 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.320 | GHSR | Zornitza Stark Marked gene: GHSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.320 | GHSR | Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.320 | GHSR | Zornitza Stark Phenotypes for gene: GHSR were changed from Idiopathic short stature, GH deficiency to Growth hormone deficiency, isolated partial, MIM# 615925 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.319 | GHSR | Zornitza Stark Publications for gene: GHSR were set to 16511605 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.318 | GHSR | Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.318 | GHSR | Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.317 | GHSR | Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.365 | RAG2 | Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.365 | RAC2 |
Danielle Ariti changed review comment from: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis 2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function. Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia. -------- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model. They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function. Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism. Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID. --------- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia 13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R) These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia. ----- Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (loss of function) Amber- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (loss of function) Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (gain of function); to: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis 2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function. Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia. -------- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model. They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function. Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism. Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID. --------- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia 13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R) These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia. ----- Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (Mono-allelic; loss of function) Red- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (Bi-allelic; loss of function) Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (Mono-allelic; gain of function) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4088 | PDE6D | Zornitza Stark Classified gene: PDE6D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4088 | PDE6D | Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4087 | PDE6D | Zornitza Stark changed review comment from: Two families and functional data.; to: Two families and good functional data. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4087 | PDE6D | Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.236 | PDE6D | Zornitza Stark changed review comment from: Comment on publications: Second family identified; to: Comment on publications: Second family identified. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.236 | PDE6D | Zornitza Stark edited their review of gene: PDE6D: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.236 | PDE6D | Zornitza Stark Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8928 | PDE6D | Zornitza Stark edited their review of gene: PDE6D: Changed publications: 30423442, 24166846 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8928 | PDE6D | Zornitza Stark Classified gene: PDE6D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8928 | PDE6D | Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8927 | PDE6D | Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified in the literature.; to: Comment when marking as ready: Second family identified in the literature. Good functional data. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8927 | PDE6D | Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.11 | PDE6D | Zornitza Stark Classified gene: PDE6D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.11 | PDE6D | Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.10 | PDE6D | Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified PMID 30423442; to: Comment when marking as ready: Second family identified PMID 30423442. Good functional data. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.10 | PDE6D | Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8927 | GHRHR | Zornitza Stark Marked gene: GHRHR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8927 | GHRHR | Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8927 | GHRHR | Zornitza Stark Phenotypes for gene: GHRHR were changed from to Growth hormone deficiency, isolated, type IV, MIM# 618157 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8926 | GHRHR | Zornitza Stark Publications for gene: GHRHR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8925 | GHRHR | Zornitza Stark Mode of inheritance for gene: GHRHR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8924 | GHRHR | Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.317 | GHRHR | Zornitza Stark Marked gene: GHRHR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.317 | GHRHR | Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.317 | GHRHR | Zornitza Stark Phenotypes for gene: GHRHR were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IV, MIM# 618157 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.316 | GHRHR | Zornitza Stark Publications for gene: GHRHR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.315 | GHRHR | Zornitza Stark Classified gene: GHRHR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.315 | GHRHR | Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.314 | GHRHR | Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8924 | GHR | Zornitza Stark Marked gene: GHR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8924 | GHR | Zornitza Stark Gene: ghr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8924 | GHR | Zornitza Stark Phenotypes for gene: GHR were changed from to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8923 | GHR | Zornitza Stark Publications for gene: GHR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8922 | GHR | Zornitza Stark Mode of inheritance for gene: GHR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8921 | GHR | Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.314 | GHR | Zornitza Stark Marked gene: GHR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.314 | GHR | Zornitza Stark Gene: ghr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.314 | GHR | Zornitza Stark Phenotypes for gene: GHR were changed from Laron syndrome to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.313 | GHR | Zornitza Stark Publications for gene: GHR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.312 | GHR | Zornitza Stark Mode of inheritance for gene: GHR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.311 | GHR | Zornitza Stark Classified gene: GHR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.311 | GHR | Zornitza Stark Gene: ghr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.310 | GHR | Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.365 | RAG1 | Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.365 | RAC2 | Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.365 | MTHFD1 | Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32414565, 19033438; Phenotypes: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.12 | PDE6D | chirag patel Classified gene: PDE6D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.12 | PDE6D | chirag patel Gene: pde6d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Joubert syndrome and other neurological ciliopathies v1.11 | PDE6D | chirag patel reviewed gene: PDE6D: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24166846; Phenotypes: Joubert syndrome 22, OMIM #615665; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8921 | SCA12 | Bryony Thompson Marked STR: SCA12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8921 | SCA12 | Bryony Thompson Str: sca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8921 | SCA12 | Bryony Thompson Classified STR: SCA12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8921 | SCA12 | Bryony Thompson Str: sca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8920 | SCA12 |
Bryony Thompson STR: SCA12 was added STR: SCA12 was added to Mendeliome. Sources: Expert list Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA12 were set to 27864267; 33811808 Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: SCA12 was set to GREEN STR: SCA12 was marked as clinically relevant Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12 Established pathogenic (used as diagnostic cut-off): ≥51 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.15 | RNU7-1 | Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.14 | RNU7-1 | Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.189 | RNU7-1 | Zornitza Stark Marked gene: RNU7-1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.189 | RNU7-1 | Zornitza Stark Gene: rnu7-1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.189 | RNU7-1 | Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.188 | RNU7-1 | Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4087 | RNU7-1 | Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4086 | RNU7-1 | Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.358 | RNU7-1 | Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.357 | RNU7-1 | Zornitza Stark edited their review of gene: RNU7-1: Changed phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8919 | RNU7-1 | Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8918 | RNU7-1 | Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v1.12 | RNU7-1 | Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v1.11 | RNU7-1 | Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4086 | LSM11 | Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4085 | LSM11 | Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.357 | LSM11 | Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.356 | LSM11 | Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8918 | LSM11 | Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8917 | LSM11 | Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v1.11 | LSM11 | Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v1.10 | LSM11 | Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.44 | WDR11 | Zornitza Stark Marked gene: WDR11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.44 | WDR11 | Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.44 | WDR11 | Zornitza Stark Classified gene: WDR11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.44 | WDR11 | Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.43 | WDR11 |
Zornitza Stark gene: WDR11 was added gene: WDR11 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: WDR11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR11 were set to 34413497 Phenotypes for gene: WDR11 were set to Intellectual disability; Microcephaly; Short stature Review for gene: WDR11 was set to GREEN Added comment: Haag et al (2021 - PMID: 34413497) report on 6 individuals from 3 unrelated families, harboring biallelic LoF WDR11 variants. Common features included microcephaly (6/6 - range: -2.43 SD to -4.93SD) and intellectual disability (6/6, in 5 cases mild, in 1 severe) with some individuals presenting also with mild short stature. Homozygosity or compound heterozygosity for LoF variants in affected individuals was identified following exome sequencing (fam1: NM_018117.12:c.1255C>T/p.Q419* hmz, fam2:c.3033_3036del/D1011Efs*21 in trans with c.1439del/p.N480Tfs*32, fam3:c.2931+1G>A hmz). Segregation studies supported carrier state of parents and unaffected sibs (or homozygosity for wt allele in the latter). Variable previous investigations incl. standard karyotype and CMA were normal in several subjects (notably index cases from each family). ----- As the authors comment WDR11 encodes for the WD repeat domain 11 protein and has broad expression in the developing mouse CNS. Mutations in other genes encoding for WD repeat proteins have been associated with neurological, endocrine or other disorders incl. ciliopathies. Heterozygous missense WDR11 variants are associated with hypogonadotropic hypogonadism (HH) 14 with or without anosmia (MIM #614858). [Gene2Phenotype : monoallelic, all missense/in-frame]. The authors performed extensive hormonal studies and argue that the phenotype associated with biallelic variants differs significantly from the dominantly inherited variants (HH) suggesting that biallelic variants result in a clinically distinct entity. In addition, carrier parents of the individuals reported by Haag et al had no obvious signs of congenital HH. However, there was no endocrinological examination performed. ----- Variant effect: Immunofluorescence studies demonstrated strong juxtanuclear WDR11 staining in control fibroblasts , but only cell-ubiquitous background labeling in patient fibroblasts (for Q419*). There was also evidence for colocalization of wt WDR11 to the trans-Golgi network (TGN) with loss of this pattern in patient fibroblasts (Q419*). Western blot in whole cell lysates of cultured patient fibroblasts (same variant) proved loss of WDR11 irrespectively of the antibody used (against N- or C-terminal epitopes of WDR11). There was no indication of a truncated protein. ----- Animal models: The authors discuss previous evidence from mice/zebrafish models suggesting abnormal Hedgehog signaling in the primary cilium and impaired ciliogenesis due to loss of WDR11. Wdr11-null mice display features of holoprosencephaly incl. microcephaly, hypotelorism, micro/anophthalmia, abnormal pituitary gland, growth retardation, heart defects, hypoplasia of reproductive organs and infertility. There was evidence of reduced length of the ciliary axoneme and reduced frequency of ciliated cells. Knockdown of wdr11 in zebrafish led to microcephaly, aberrant head cartilage formation, microphthalmia, curved body axis, motility defects. Overall the authors consider that the phenotype of microcephaly, variable growth delay and/or some visual/skeletal anomalies are recapitulated to some degree in animal models, although a more severe phenotype is observed in mice. In the cohort presented by Haag et al there was no evidence of congenital heart defects, brain malformations, abnormal sexual hormone profiles or pituitary (MRI) abnormalities based on the investigations performed. ----- The authors discuss briefly on the previously proposed role for WDR11 in endosome to trans Golgi network vesicular trafficking which might also be supported by their colocalization experiments in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8917 | WDR11 | Zornitza Stark Marked gene: WDR11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8917 | WDR11 | Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8917 | WDR11 | Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8916 | WDR11 | Zornitza Stark Publications for gene: WDR11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8915 | WDR11 | Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8914 | WDR11 | Zornitza Stark reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4085 | WDR11 | Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Microcephaly; Short stature | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4084 | WDR11 | Zornitza Stark Publications for gene: WDR11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4083 | WDR11 | Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4082 | WDR11 | Zornitza Stark Classified gene: WDR11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4082 | WDR11 | Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8914 | Bryony Thompson removed STR:SCA12 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Marked STR: SCA12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Str: sca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Classified STR: SCA12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Str: sca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.64 | SCA12 |
Bryony Thompson STR: SCA12 was added STR: SCA12 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA12 were set to 27864267; 33811808 Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: SCA12 was set to GREEN STR: SCA12 was marked as clinically relevant Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12 Established pathogenic (used as diagnostic cut-off): ≥51 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4081 | WDR11 | Konstantinos Varvagiannis reviewed gene: WDR11: Rating: AMBER; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Microcephaly, Short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8913 | GH1 | Zornitza Stark Marked gene: GH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8913 | GH1 | Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8913 | GH1 | Zornitza Stark Phenotypes for gene: GH1 were changed from to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8912 | GH1 | Zornitza Stark Publications for gene: GH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8911 | GH1 | Zornitza Stark Mode of inheritance for gene: GH1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8910 | GH1 | Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.310 | GH1 | Zornitza Stark Marked gene: GH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.310 | GH1 | Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.310 | GH1 | Zornitza Stark Phenotypes for gene: GH1 were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.309 | GH1 | Zornitza Stark Publications for gene: GH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.308 | GH1 | Zornitza Stark Classified gene: GH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.308 | GH1 | Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.307 | GH1 | Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.307 | Zornitza Stark removed gene:FGFR1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.306 | Zornitza Stark removed gene:FGF8 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.23 | EPHX1 | Zornitza Stark Marked gene: EPHX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.23 | EPHX1 | Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.23 | EPHX1 | Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.23 | EPHX1 | Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.22 | EPHX1 |
Zornitza Stark gene: EPHX1 was added gene: EPHX1 was added to Monogenic Diabetes. Sources: Literature Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHX1 were set to 34342583 Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes Review for gene: EPHX1 was set to AMBER Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lipodystrophy_Lipoatrophy v1.3 | EPHX1 | Zornitza Stark Marked gene: EPHX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lipodystrophy_Lipoatrophy v1.3 | EPHX1 | Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lipodystrophy_Lipoatrophy v1.3 | EPHX1 | Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lipodystrophy_Lipoatrophy v1.3 | EPHX1 | Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.305 | Zornitza Stark removed gene:EPHX1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8910 | EPHX1 | Zornitza Stark Marked gene: EPHX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8910 | EPHX1 | Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lipodystrophy_Lipoatrophy v1.2 | EPHX1 |
Zornitza Stark gene: EPHX1 was added gene: EPHX1 was added to Lipodystrophy_Lipoatrophy. Sources: Literature Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHX1 were set to 34342583 Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes Review for gene: EPHX1 was set to AMBER Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8910 | EPHX1 | Zornitza Stark Phenotypes for gene: EPHX1 were changed from to Lipoatrophic diabetes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8909 | EPHX1 | Zornitza Stark Publications for gene: EPHX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8908 | EPHX1 | Zornitza Stark Mode of inheritance for gene: EPHX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8907 | EPHX1 | Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8907 | EPHX1 | Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8906 | EPHX1 | Zornitza Stark reviewed gene: EPHX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 34342583; Phenotypes: Lipoatrophic diabetes; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.304 | EP300 | Zornitza Stark Marked gene: EP300 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.304 | EP300 | Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.304 | EP300 | Zornitza Stark Phenotypes for gene: EP300 were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 2, MIM# 613684; Menke-Hennekam syndrome , MIM#2 618333 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.303 | EP300 | Zornitza Stark Publications for gene: EP300 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.302 | EP300 | Zornitza Stark Classified gene: EP300 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.302 | EP300 | Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.301 | EP300 | Zornitza Stark reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: 29506490, 29460469; Phenotypes: Rubinstein-Taybi syndrome 2, MIM# 613684, Menke-Hennekam syndrome , MIM#2 618333; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.301 | Zornitza Stark removed gene:COL1A1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.300 | Zornitza Stark removed gene:DOK7 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.299 | DHCR7 | Zornitza Stark Marked gene: DHCR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.299 | DHCR7 | Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.299 | DHCR7 | Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith Lemli Opitz to Smith-Lemli-Opitz syndrome, MIM#270400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.298 | DHCR7 | Zornitza Stark Classified gene: DHCR7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.298 | DHCR7 | Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.297 | DHCR7 | Zornitza Stark reviewed gene: DHCR7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Smith-Lemli-Opitz syndrome, MIM#270400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.297 | CREBBP | Zornitza Stark Marked gene: CREBBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.297 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.297 | CREBBP | Zornitza Stark Phenotypes for gene: CREBBP were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.296 | CREBBP | Zornitza Stark Publications for gene: CREBBP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.295 | CREBBP | Zornitza Stark Classified gene: CREBBP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.295 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.294 | CREBBP | Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8906 | CREBBP | Zornitza Stark Marked gene: CREBBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8906 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8906 | CREBBP | Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.294 | ATRX | Zornitza Stark Marked gene: ATRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.294 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.294 | ATRX | Zornitza Stark Phenotypes for gene: ATRX were changed from SGA, which is sometimes called intrauterine growth restriction (IUGR), to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.293 | ATRX | Zornitza Stark Publications for gene: ATRX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.292 | ATRX | Zornitza Stark Mode of inheritance for gene: ATRX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.291 | ATRX | Zornitza Stark Classified gene: ATRX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.291 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.290 | ATRX | Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301622; Phenotypes: Alpha-thalassemia/mental retardation syndrome, MIM# 301040, Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.290 | ZBTB24 | Zornitza Stark Marked gene: ZBTB24 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.290 | ZBTB24 | Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.290 | ZBTB24 | Zornitza Stark Classified gene: ZBTB24 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.290 | ZBTB24 | Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.289 | ZBTB24 |
Zornitza Stark gene: ZBTB24 was added gene: ZBTB24 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: ZBTB24 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZBTB24 were set to 21596365; 21906047; 23486536 Phenotypes for gene: ZBTB24 were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 2, MIM# 614069; MONDO:0013553 Review for gene: ZBTB24 was set to GREEN Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is characterized by facial dysmorphism, immunoglobulin deficiency resulting in recurrent infections, and intellectual disability. Laboratory studies of patient cells show hypomethylation of satellite regions of chromosomes 1, 9, and 16, as well as pericentromeric chromosomal instability in response to phytohaemagglutinin stimulation. 20 unrelated families reported. Short stature is a feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.288 | SPRTN | Zornitza Stark Marked gene: SPRTN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.288 | SPRTN | Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.288 | SPRTN | Zornitza Stark Classified gene: SPRTN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.288 | SPRTN | Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.287 | SPRTN |
Zornitza Stark gene: SPRTN was added gene: SPRTN was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: SPRTN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPRTN were set to 25261934 Phenotypes for gene: SPRTN were set to Ruijs-Aalfs syndrome, MIM# 616200; MONDO:0014527 Review for gene: SPRTN was set to GREEN Added comment: Two families with functional evidence for a DNA repair disorder; progeroid features and hepatocellular carcinoma reported as key features, as is short stature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.286 | RNF168 | Zornitza Stark Marked gene: RNF168 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.286 | RNF168 | Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.286 | RNF168 | Zornitza Stark Classified gene: RNF168 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.286 | RNF168 | Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.285 | RNF168 |
Zornitza Stark gene: RNF168 was added gene: RNF168 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: RNF168 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNF168 were set to 19203578; 21394101; 29255463; 21552324 Phenotypes for gene: RNF168 were set to RIDDLE syndrome MIM# 611943; Radiosensitivity; Immune Deficiency; Dysmorphic Features; Learning difficulties; Low IgG or IgA; Short stature; mild defect of motor control to ataxia; normal intelligence to learning difficulties; mild facial dysmorphism to microcephaly Review for gene: RNF168 was set to GREEN Added comment: 4 individuals from 3 unrelated families have been reported with RNF168 variants and display RIDDLE syndrome phenotype. One mouse model; demonstrated RNF168 deficient mice are immunodeficient and exhibit increased radiosensitivity. Homozygous and Compound heterozygous (duplications, deletions and nonsense) variants identified resulting in frameshift, aberrant protein and alteration of binding motifs. Typically presents with increased radiosensitivity, immunodeficiency (decrease IgA), mild motor control and learning difficulties, facial dysmorphism, and short stature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.284 | RECQL4 | Zornitza Stark Marked gene: RECQL4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.284 | RECQL4 | Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.284 | RECQL4 | Zornitza Stark Classified gene: RECQL4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.284 | RECQL4 | Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.283 | RECQL4 |
Zornitza Stark gene: RECQL4 was added gene: RECQL4 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RECQL4 were set to 10319867; 12952869; 15964893 Phenotypes for gene: RECQL4 were set to Rothmund-Thomson syndrome, type 2, MIM# 268400; RAPADILINO syndrome, MIM# 266280; Baller-Gerold syndrome, MIM# 218600 Review for gene: RECQL4 was set to GREEN Added comment: Gene encodes DNA helicase involved in DNA repair. Bi-allelic variants associated with a range of phenotypes. Short stature is a feature of these disorders. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.282 | RAD51C | Zornitza Stark Marked gene: RAD51C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.282 | RAD51C | Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.282 | RAD51C | Zornitza Stark Classified gene: RAD51C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.282 | RAD51C | Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.281 | RAD51C |
Zornitza Stark gene: RAD51C was added gene: RAD51C was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: RAD51C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RAD51C were set to 20400963; 29278735 Phenotypes for gene: RAD51C were set to Fanconi anaemia, complementation group O, MIM# 613390 Review for gene: RAD51C was set to GREEN Added comment: Two unrelated families reported, excellent biological candidate for FA. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.280 | RAD51 | Zornitza Stark Marked gene: RAD51 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.280 | RAD51 | Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.280 | RAD51 | Zornitza Stark Classified gene: RAD51 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.280 | RAD51 | Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.279 | RAD51 |
Zornitza Stark gene: RAD51 was added gene: RAD51 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAD51 were set to 26253028; 26681308; 30907510 Phenotypes for gene: RAD51 were set to Fanconi anaemia, complementation group R, MIM# 617244 Review for gene: RAD51 was set to GREEN Added comment: Three unrelated individuals reported with de novo missense variants in this gene. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.278 | RAD50 | Zornitza Stark Marked gene: RAD50 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.278 | RAD50 | Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.278 | RAD50 | Zornitza Stark Classified gene: RAD50 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.278 | RAD50 | Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.277 | RAD50 |
Zornitza Stark gene: RAD50 was added gene: RAD50 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: RAD50 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RAD50 were set to 19409520; 32212377; 33378670 Phenotypes for gene: RAD50 were set to Nijmegen breakage syndrome-like disorder, MIM# 613078; MONDO:0013118 Review for gene: RAD50 was set to GREEN Added comment: Three unrelated families reported, short stature is a key feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.276 | NHEJ1 | Zornitza Stark Marked gene: NHEJ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.276 | NHEJ1 | Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.276 | NHEJ1 | Zornitza Stark Classified gene: NHEJ1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.276 | NHEJ1 | Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.275 | NHEJ1 |
Zornitza Stark gene: NHEJ1 was added gene: NHEJ1 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: NHEJ1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NHEJ1 were set to 16439204; 16439205 Phenotypes for gene: NHEJ1 were set to Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation, MIM# 611291; MONDO:0012650 Review for gene: NHEJ1 was set to GREEN Added comment: More than 5 unrelated families reported, poor growth is a key feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.274 | MPLKIP | Zornitza Stark Marked gene: MPLKIP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.274 | MPLKIP | Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.274 | MPLKIP | Zornitza Stark Classified gene: MPLKIP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.274 | MPLKIP | Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.273 | MPLKIP |
Zornitza Stark gene: MPLKIP was added gene: MPLKIP was added to Growth failure in early childhood. Sources: Expert list Mode of inheritance for gene: MPLKIP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MPLKIP were set to 15645389; 16977596 Phenotypes for gene: MPLKIP were set to Trichothiodystrophy 4, nonphotosensitive, MIM# 234050; MONDO:0021013 Review for gene: MPLKIP was set to GREEN Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections. Gene previously known as c7orf11. More than 5 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.272 | GTF2H5 | Zornitza Stark Marked gene: GTF2H5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.272 | GTF2H5 | Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.272 | GTF2H5 | Zornitza Stark Classified gene: GTF2H5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.272 | GTF2H5 | Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.271 | GTF2H5 |
Zornitza Stark gene: GTF2H5 was added gene: GTF2H5 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: GTF2H5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTF2H5 were set to 15220921; 30359777; 24986372 Phenotypes for gene: GTF2H5 were set to Trichothiodystrophy 3, photosensitive, MIM# 616395; MONDO:0014619 Review for gene: GTF2H5 was set to GREEN Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections. Established gene-disease association, at least 5 families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.270 | ERCC5 | Zornitza Stark Marked gene: ERCC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.270 | ERCC5 | Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.270 | ERCC5 | Zornitza Stark Classified gene: ERCC5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.270 | ERCC5 | Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.269 | ERCC5 |
Zornitza Stark gene: ERCC5 was added gene: ERCC5 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERCC5 were set to 7951246; 9096355; 9096355; 24700531; 33766032; 33219753 Phenotypes for gene: ERCC5 were set to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216 Review for gene: ERCC5 was set to GREEN Added comment: Well established gene-disease association, spectrum of severity. Poor growth is a feature of COFS but is also present in some individuals with xeroderma pigmentosa. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.268 | ERCC3 | Zornitza Stark Marked gene: ERCC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.268 | ERCC3 | Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.268 | ERCC3 | Zornitza Stark Classified gene: ERCC3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.268 | ERCC3 | Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.267 | ERCC3 |
Zornitza Stark gene: ERCC3 was added gene: ERCC3 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: ERCC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERCC3 were set to 2167179; 10447254; 16947863; 9012405; 32557569; 27004399 Phenotypes for gene: ERCC3 were set to Trichothiodystrophy 2, photosensitive, MIM# 616390; Xeroderma pigmentosum, group B 61, MIM#0651 Review for gene: ERCC3 was set to GREEN Added comment: Nucleotide excision repair disorder, variable severity, short stature associated with both disorders. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.266 | ERCC2 | Zornitza Stark Marked gene: ERCC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.266 | ERCC2 | Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.266 | ERCC2 | Zornitza Stark Classified gene: ERCC2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.266 | ERCC2 | Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.265 | ERCC2 |
Zornitza Stark gene: ERCC2 was added gene: ERCC2 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: ERCC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERCC2 were set to 7849702; 9758621; 11443545; 33733458 Phenotypes for gene: ERCC2 were set to Cerebrooculofacioskeletal syndrome 2, MIM# 610756; Trichothiodystrophy 1, photosensitive, MIM# 601675 Review for gene: ERCC2 was set to GREEN Added comment: Bi-allelic inactivation of XPD protein, a nucleotide excision repair (NER) signaling pathway component encoded by ERCC2 gene, has been associated with several defective DNA repair phenotypes, of which photosensitive trichothiodystrophy and cerebro-oculo-facio-skeletal syndrome have short stature as a feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.264 | DNMT3B | Zornitza Stark Marked gene: DNMT3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.264 | DNMT3B | Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.264 | DNMT3B | Zornitza Stark Classified gene: DNMT3B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.264 | DNMT3B | Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.263 | DNMT3B |
Zornitza Stark gene: DNMT3B was added gene: DNMT3B was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNMT3B were set to 10647011; 23486536 Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1, MIM# 242860 Review for gene: DNMT3B was set to GREEN Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency, and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. More than 20 unrelated families reported. Short stature is a feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.262 | DDX11 | Zornitza Stark Marked gene: DDX11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.262 | DDX11 | Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.262 | DDX11 | Zornitza Stark Classified gene: DDX11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.262 | DDX11 | Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.261 | DDX11 |
Zornitza Stark gene: DDX11 was added gene: DDX11 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: DDX11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDX11 were set to 20137776; 23033317; 30216658 Phenotypes for gene: DDX11 were set to Warsaw breakage syndrome, MIM# 613398; MONDO:0013252 Review for gene: DDX11 was set to GREEN Added comment: PMID 30216658 reviews 12 individuals reported to date: severe microcephaly with prenatal onset was identified in all patients, and severe pre- and postnatal growth restriction was observed in 11 of 11 patients. All 12 patients had sensorineural hearing loss, with 10 of 10 having cochlear hypoplasia or functional abnormalities; 1 patient had a posterior labyrinthine anomaly. In all 4 patients who had brain imaging, abnormalities were identified. Some patients had other structural anomalies, including cardiac defects (5/12), recurrent infections (4/9), and skin pigmentation changes (6/12). Craniofacial features included a depressed nasal bridge with a broad nasal tip and overhanging columella. Elevated induced chromosome breakage was observed in 6 of 8 reported patients. Cohesin defects (premature chromatid separation and premature centromere division) were consistent in most metaphases among the patients examined. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.260 | BRCA1 | Zornitza Stark Marked gene: BRCA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.260 | BRCA1 | Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.260 | BRCA1 | Zornitza Stark Classified gene: BRCA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.260 | BRCA1 | Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.259 | BRCA1 |
Zornitza Stark gene: BRCA1 was added gene: BRCA1 was added to Growth failure in early childhood. Sources: Expert list Mode of inheritance for gene: BRCA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRCA1 were set to 23269703; 29133208; 25472942; 29712865 Phenotypes for gene: BRCA1 were set to Fanconi anaemia, complementation group S, MIM# 617883 Review for gene: BRCA1 was set to GREEN Added comment: At least 5 unrelated families with bi-allelic variants reported and FA phenotype. Short stature is a feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8905 | ATM | Zornitza Stark Phenotypes for gene: ATM were changed from to Ataxia-telangiectasia, MIM# 208900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8904 | ATM | Zornitza Stark Publications for gene: ATM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8903 | ATM | Zornitza Stark reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: 30137827; Phenotypes: Ataxia-telangiectasia, MIM# 208900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.258 | ATM | Zornitza Stark Marked gene: ATM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.258 | ATM | Zornitza Stark Gene: atm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.258 | ATM | Zornitza Stark Classified gene: ATM as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.258 | ATM | Zornitza Stark Gene: atm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.257 | ATM |
Zornitza Stark gene: ATM was added gene: ATM was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: ATM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATM were set to 30137827 Phenotypes for gene: ATM were set to Ataxia-telangiectasia, MIM# 208900 Review for gene: ATM was set to GREEN Added comment: Well established gene-disease association. Ataxia-telangiectasia (AT) is a chromosome breakage disorder characterized by cerebellar ataxia, telangiectases, immune defects, and a predisposition to malignancy. Short stature is a feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.256 | TRAIP | Zornitza Stark Marked gene: TRAIP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.256 | TRAIP | Zornitza Stark Gene: traip has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.256 | TRAIP | Zornitza Stark Classified gene: TRAIP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.256 | TRAIP | Zornitza Stark Gene: traip has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.255 | TRAIP |
Zornitza Stark gene: TRAIP was added gene: TRAIP was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: TRAIP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAIP were set to 26595769 Phenotypes for gene: TRAIP were set to Seckel syndrome 9, MIM# 616777 Review for gene: TRAIP was set to GREEN Added comment: Three families reported, though two distantly related (founder); functional data. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.254 | RNU4ATAC | Zornitza Stark Marked gene: RNU4ATAC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.254 | RNU4ATAC | Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.254 | RNU4ATAC | Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from MOPD I to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.253 | RNU4ATAC | Zornitza Stark Publications for gene: RNU4ATAC were set to 21474760 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.252 | RNU4ATAC | Zornitza Stark Classified gene: RNU4ATAC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.252 | RNU4ATAC | Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.251 | RNU4ATAC | Zornitza Stark reviewed gene: RNU4ATAC: Rating: GREEN; Mode of pathogenicity: None; Publications: 23794361, 26522830, 30455926, 29265708, 12605445; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710), Roifman syndrome (MIM# 616651), Lowry-Wood syndrome, MIM# 226960; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8903 | RNU4ATAC | Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960 to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8902 | RNU4ATAC | Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651) to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8901 | RNU4ATAC | Zornitza Stark Publications for gene: RNU4ATAC were set to 23794361; 26522830; 30455926 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8900 | RNU4ATAC |
Zornitza Stark edited their review of gene: RNU4ATAC: Added comment: Lowry-Wood syndrome (LWS) is characterized by multiple epiphyseal dysplasia and microcephaly. Patients exhibit intrauterine growth retardation and short stature, as well as developmental delay and intellectual disability. Retinal degeneration has been reported in some patients. Four unrelated families reported. Note features between the three RNU4ATAC-related conditions overlap and they may not represent distinct disorders.; Changed rating: GREEN; Changed publications: 29265708, 12605445; Changed phenotypes: Lowry-Wood syndrome, MIM# 226960; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.251 | RBBP8 | Zornitza Stark Marked gene: RBBP8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.251 | RBBP8 | Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.251 | RBBP8 | Zornitza Stark Phenotypes for gene: RBBP8 were changed from seckel syndrome but with proportionate head/height impairment, cafe au lair macules to Seckel syndrome 2, MIM# 606744 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.250 | RBBP8 | Zornitza Stark Publications for gene: RBBP8 were set to 24389050, 21998596 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.249 | RBBP8 | Zornitza Stark Classified gene: RBBP8 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.249 | RBBP8 | Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.248 | RBBP8 | Zornitza Stark reviewed gene: RBBP8: Rating: AMBER; Mode of pathogenicity: None; Publications: 21998596, 24389050; Phenotypes: Seckel syndrome 2, MIM# 606744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.248 | POLE | Zornitza Stark Marked gene: POLE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.248 | POLE | Zornitza Stark Gene: pole has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.248 | POLE | Zornitza Stark Classified gene: POLE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.248 | POLE | Zornitza Stark Gene: pole has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.247 | POLE | Zornitza Stark Tag deep intronic tag was added to gene: POLE. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.247 | POLE |
Zornitza Stark gene: POLE was added gene: POLE was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: POLE was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLE were set to 30503519; 23230001; 25948378 Phenotypes for gene: POLE were set to FILS syndrome, MIM# 615139; IMAGE-I syndrome, MIM# 618336 Review for gene: POLE was set to GREEN Added comment: Both the FILS and IMAGE-I phenotypes have short stature as a feature, although it is more severe in IMAGE-I. Note recurrent intronic variant, c.1686+32C-G (intron 15) in IMAGE-I, found in combination with multiple other variants. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.246 | PCNT | Zornitza Stark Marked gene: PCNT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.246 | PCNT | Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.246 | PCNT | Zornitza Stark Phenotypes for gene: PCNT were changed from Seckel syndrome, MOPD type II - growth restrction, microcephaly, prominent nose, micrognathia, squeaky voice, insulin resistance, 210720; MOPDII to Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720; MONDO:0008872 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.245 | PCNT | Zornitza Stark Publications for gene: PCNT were set to 18157127; 18174396 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.244 | PCNT | Zornitza Stark Classified gene: PCNT as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.244 | PCNT | Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.243 | PCNT | Zornitza Stark reviewed gene: PCNT: Rating: GREEN; Mode of pathogenicity: None; Publications: 18174396, 12210304, 30922925, 33460028, 32557621, 32267100; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720, MONDO:0008872; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.243 | LARP7 | Zornitza Stark Marked gene: LARP7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.243 | LARP7 | Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.243 | LARP7 | Zornitza Stark Classified gene: LARP7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.243 | LARP7 | Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.242 | LARP7 |
Zornitza Stark gene: LARP7 was added gene: LARP7 was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: LARP7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LARP7 were set to 22865833; 21937992; 30006060; 33569879 Phenotypes for gene: LARP7 were set to Alazami syndrome, MIM# 615071; Microcephalic primordial dwarfism, Alazami type MONDO:0014031 Review for gene: LARP7 was set to GREEN Added comment: Alazami syndrome is an autosomal recessive disorder characterized by severe growth restriction present at birth, severely impaired intellectual development, and distinctive facial features. Five unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.241 | FAM111A | Zornitza Stark Marked gene: FAM111A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.241 | FAM111A | Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.241 | FAM111A | Zornitza Stark Classified gene: FAM111A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.241 | FAM111A | Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.240 | FAM111A |
Zornitza Stark gene: FAM111A was added gene: FAM111A was added to Growth failure in early childhood. Sources: Expert Review Mode of inheritance for gene: FAM111A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FAM111A were set to 32996714; 23684011 Phenotypes for gene: FAM111A were set to Kenny-Caffey syndrome, type 2, MIM@ 127000 Review for gene: FAM111A was set to GREEN Added comment: Kenny-Caffey syndrome is characterized by severe proportionate short stature, cortical thickening and medullary stenosis of the tubular bones, delayed closure of the anterior fontanel, eye abnormalities including microphthalmia/nanophthalmos, and transient hypocalcemia. Note monoallelic variants in this gene are also associated with gracile bone dysplasia, but this is generally perinatal lethal. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.239 | DNA2 | Zornitza Stark Marked gene: DNA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.239 | DNA2 | Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.239 | DNA2 | Zornitza Stark Phenotypes for gene: DNA2 were changed from Seckel syndrome 8, OMIM:615807 to Seckel syndrome 8, MIM:615807 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.238 | DNA2 | Zornitza Stark Classified gene: DNA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.238 | DNA2 | Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.237 | DNA2 | Zornitza Stark reviewed gene: DNA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24389050, 31045292; Phenotypes: Seckel syndrome 8, MIM#615807; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8900 | TRPS1 | Zornitza Stark Marked gene: TRPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8900 | TRPS1 | Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8900 | TRPS1 | Zornitza Stark Phenotypes for gene: TRPS1 were changed from to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8899 | TRPS1 | Zornitza Stark Publications for gene: TRPS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8898 | TRPS1 | Zornitza Stark Mode of inheritance for gene: TRPS1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8897 | TRPS1 | Zornitza Stark reviewed gene: TRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11112658, 10615131; Phenotypes: Trichorhinophalangeal syndrome, type I, OMIM # 190350, Trichorhinophalangeal syndrome, type III, OMIM # 190351; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.237 | TRPS1 | Zornitza Stark Marked gene: TRPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.237 | TRPS1 | Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.237 | TRPS1 | Zornitza Stark Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.236 | PUF60 | Zornitza Stark Marked gene: PUF60 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.236 | PUF60 | Zornitza Stark Gene: puf60 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.236 | PUF60 | Zornitza Stark Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4081 | FGD1 | Zornitza Stark Marked gene: FGD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4081 | FGD1 | Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4081 | FGD1 | Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4080 | FGD1 | Zornitza Stark Publications for gene: FGD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4079 | FGD1 | Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4078 | FGD1 | Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8897 | FGD1 | Zornitza Stark Marked gene: FGD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8897 | FGD1 | Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8897 | FGD1 | Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8896 | FGD1 | Zornitza Stark Publications for gene: FGD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8895 | FGD1 | Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8894 | FGD1 | Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.235 | FGD1 | Zornitza Stark Marked gene: FGD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.235 | FGD1 | Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.235 | FGD1 | Zornitza Stark Phenotypes for gene: FGD1 were changed from Aarskog to Aarskog-Scott syndrome, MIM # 305400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.234 | FGD1 | Zornitza Stark Publications for gene: FGD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4078 | RAD21 | Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia de Lange syndrome 4, MIM # 614701 to Cornelia de Lange syndrome 4, MIM # 614701 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4078 | RAD21 | Zornitza Stark Marked gene: RAD21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4078 | RAD21 | Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4078 | RAD21 | Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4077 | RAD21 | Zornitza Stark Publications for gene: RAD21 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4076 | RAD21 | Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4075 | RAD21 | Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.33 | RAD21 | Zornitza Stark Marked gene: RAD21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.33 | RAD21 | Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.33 | RAD21 | Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.32 | RAD21 | Zornitza Stark Publications for gene: RAD21 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.31 | RAD21 | Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.30 | RAD21 |
Zornitza Stark commented on gene: RAD21: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in RAD21 gene. Deardorff et al. (2012) reported 6 patients with CdLS phenotype with heterozygous variants (4 microdeletions incl RAD21, and 2 missense variants), showing functional evidence for the missense variants. Krab et al. (2020) reported the clinical and molecular data in 29 patients from 22 families with CDLS4 and RAD21 variants Many other case reports. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.30 | RAD21 | Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.233 | RAD21 | Zornitza Stark Marked gene: RAD21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.233 | RAD21 | Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.233 | RAD21 | Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia De Lange to Cornelia de Lange syndrome 4, MIM # 614701 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.232 | RAD21 | Zornitza Stark Publications for gene: RAD21 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4075 | BRD4 | Zornitza Stark Marked gene: BRD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4075 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4075 | BRD4 | Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4074 | BRD4 | Zornitza Stark Publications for gene: BRD4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4073 | BRD4 | Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4072 | BRD4 | Zornitza Stark Classified gene: BRD4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4072 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4071 | BRD4 | Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.42 | BRD4 | Zornitza Stark Publications for gene: BRD4 were set to 29379197; 30302754 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.41 | BRD4 | Zornitza Stark Classified gene: BRD4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.41 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.40 | BRD4 | Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8894 | BRD4 | Zornitza Stark Marked gene: BRD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8894 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8894 | BRD4 | Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8893 | BRD4 | Zornitza Stark Publications for gene: BRD4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8892 | BRD4 | Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.8891 | BRD4 | Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.30 | BRD4 | Zornitza Stark Marked gene: BRD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.30 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.30 | BRD4 | Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.29 | BRD4 | Zornitza Stark Publications for gene: BRD4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.28 | BRD4 | Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.27 | BRD4 | Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.231 | BRD4 | Zornitza Stark Marked gene: BRD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.231 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.231 | BRD4 | Zornitza Stark Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.230 | TRPS1 | chirag patel Classified gene: TRPS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.230 | TRPS1 | chirag patel Gene: trps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.229 | TRPS1 |
chirag patel gene: TRPS1 was added gene: TRPS1 was added to Growth failure in early childhood. Sources: Literature Mode of inheritance for gene: TRPS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131 Phenotypes for gene: TRPS1 were set to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351 Review for gene: TRPS1 was set to GREEN Added comment: Trichorhinophalangeal syndrome (TRPS) is characterised by sparse, slowly growing scalp hair, laterally sparse eyebrows, bulbous tip of the nose, protruding ears, long flat philtrum, thin upper vermillion border, cone-shaped epiphyses (middle phalanges), and hip malformations (coxa plana, coxa magna, or coxa vara, degenerative arthrosis). TRPS3 differs from TRPS1 by the presence of severe brachydactyly, due to short metacarpals, and severe short stature. Momeni et al. (2000) identified 6 different nonsense mutations in the TRPS1 gene in 10 unrelated patients. Ludecke et al. (2001) found 35 different mutations in TRPS1 in 44 unrelated patients with TRPS I or TRPS III. The detection rate (86%) indicated that TRPS1 is the major locus for both type I and type III TRPS. They found no mutation in the parents of sporadic patients or in apparently healthy relatives of familial patients, indicating complete penetrance of TRPS1 mutations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.228 | PUF60 | chirag patel Classified gene: PUF60 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.228 | PUF60 | chirag patel Gene: puf60 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.227 | PUF60 |
chirag patel gene: PUF60 was added gene: PUF60 was added to Growth failure in early childhood. Sources: Literature Mode of inheritance for gene: PUF60 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958 Phenotypes for gene: PUF60 were set to Verheij syndrome, OMIM # 615583 Review for gene: PUF60 was set to GREEN Added comment: Verheij syndrome is characterised by growth retardation, delayed psychomotor development, dysmorphic facial features, skeletal/vertebral abnormalities, coloboma, renal defects, and cardiac defects. Over 25 patients reported in literature with deletions and SNVs involving PUF60. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.226 | FGD1 | chirag patel Classified gene: FGD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.226 | FGD1 | chirag patel Gene: fgd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.225 | FGD1 | chirag patel reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, OMIM # 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.225 | RAD21 | chirag patel Classified gene: RAD21 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.225 | RAD21 | chirag patel Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.224 | RAD21 | chirag patel reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, OMIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.224 | BRD4 | chirag patel Classified gene: BRD4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.224 | BRD4 | chirag patel Gene: brd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v0.223 | BRD4 |
chirag patel gene: BRD4 was added gene: BRD4 was added to Growth failure in early childhood. Sources: Literature Mode of inheritance for gene: BRD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299 Phenotypes for gene: BRD4 were set to Cornelia de Lange syndrome (no OMIM# yet) Review for gene: BRD4 was set to GREEN Added comment: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in the BRD4 gene. Olley et al. (2018) report 4 patients with CdLS phenotype with 4 different variants (1 deletion incl BRD4, 1 missense, and 2 frameshift). Alesi et al. (2019) reported a patient with 19p13.12p13.11 deletion including BRD4 with CdLS phenotype. Olley et al (2021) provided further functional evidence for the previous missense variant, showing it reduces BRD4-occupancy at enhancers it does not affect transcription of the pluripotency network in mouse embryonic stem cells. Rather, it delays the cell cycle, increases DNA damage signalling, and perturbs regulation of DNA repair in mutant cells. Houzelstein et al. (2002) showed that mice with heterozygous LOF mutations in Brd4 have marked early postnatal mortality, severe prenatal onset growth failure, abnormalities of the craniofacial skeleton and reduced body fat19; all features common in CdLS. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.106 | JPH2 | Zornitza Stark Phenotypes for gene: JPH2 were changed from Cardiomyopathy, hypertrophic, MIM#613873 to Cardiomyopathy, hypertrophic, MIM#613873; Cardiomyopathy, dilated, 2E, MIM# 619492 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||