PanelApp

Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Mendeliome v0.4151 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Mendeliome v0.4151 PLK4 Zornitza Stark Phenotypes for gene: PLK4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171
Mendeliome v0.4150 PLK4 Zornitza Stark Publications for gene: PLK4 were set to
Mendeliome v0.4149 PLK4 Zornitza Stark Mode of inheritance for gene: PLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4148 PLK4 Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.383 PLK4 Zornitza Stark Marked gene: PLK4 as ready
Microcephaly v0.383 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Microcephaly v0.383 PLK4 Zornitza Stark Classified gene: PLK4 as Green List (high evidence)
Microcephaly v0.383 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Microcephaly v0.382 PLK4 Zornitza Stark gene: PLK4 was added
gene: PLK4 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: PLK4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLK4 were set to 25344692; 25320347; 27650967
Phenotypes for gene: PLK4 were set to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171
Review for gene: PLK4 was set to GREEN
Added comment: At least 3 unrelated families reported with autosomal recessive developmental disorder characterised by delayed psychomotor development, visual impairment, and microcephaly.
Sources: Expert list
Mendeliome v0.4148 PIGH Zornitza Stark Marked gene: PIGH as ready
Mendeliome v0.4148 PIGH Zornitza Stark Gene: pigh has been classified as Green List (High Evidence).
Mendeliome v0.4148 PIGH Zornitza Stark Phenotypes for gene: PIGH were changed from to Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010
Mendeliome v0.4147 PIGH Zornitza Stark Publications for gene: PIGH were set to
Mendeliome v0.4146 PIGH Zornitza Stark Mode of inheritance for gene: PIGH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4145 PIGH Zornitza Stark reviewed gene: PIGH: Rating: GREEN; Mode of pathogenicity: None; Publications: 29573052, 29603516; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.381 PIGH Zornitza Stark Marked gene: PIGH as ready
Microcephaly v0.381 PIGH Zornitza Stark Gene: pigh has been classified as Amber List (Moderate Evidence).
Microcephaly v0.381 PIGH Zornitza Stark Phenotypes for gene: PIGH were changed from to Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010
Microcephaly v0.380 PIGH Zornitza Stark Publications for gene: PIGH were set to
Microcephaly v0.379 PIGH Zornitza Stark Mode of inheritance for gene: PIGH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.378 PIGH Zornitza Stark Classified gene: PIGH as Amber List (moderate evidence)
Microcephaly v0.378 PIGH Zornitza Stark Gene: pigh has been classified as Amber List (Moderate Evidence).
Microcephaly v0.377 PIGH Zornitza Stark reviewed gene: PIGH: Rating: AMBER; Mode of pathogenicity: None; Publications: 29573052; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.377 PDHA1 Zornitza Stark Marked gene: PDHA1 as ready
Microcephaly v0.377 PDHA1 Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence).
Microcephaly v0.377 PDHA1 Zornitza Stark Classified gene: PDHA1 as Green List (high evidence)
Microcephaly v0.377 PDHA1 Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence).
Microcephaly v0.376 PDHA1 Zornitza Stark gene: PDHA1 was added
gene: PDHA1 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: PDHA1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: PDHA1 were set to 8032855
Phenotypes for gene: PDHA1 were set to Pyruvate dehydrogenase E1-alpha deficiency, MIM# 312170
Review for gene: PDHA1 was set to GREEN
Added comment: Well established gene-disease association. Variable phenotype, but microcephaly is a feature.
Sources: Expert list
Cerebral Palsy v0.27 PCYT2 Zornitza Stark Marked gene: PCYT2 as ready
Cerebral Palsy v0.27 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.27 PCYT2 Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770
Cerebral Palsy v0.26 PCYT2 Zornitza Stark Publications for gene: PCYT2 were set to
Cerebral Palsy v0.25 PCYT2 Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.24 PCYT2 Zornitza Stark reviewed gene: PCYT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4145 PCYT2 Zornitza Stark Marked gene: PCYT2 as ready
Mendeliome v0.4145 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Green List (High Evidence).
Mendeliome v0.4145 PCYT2 Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770; global developmental delay; regression; spastic parapesis or tetraparesis; epilepsy; progressive cerebral and cerebellar atrophy
Mendeliome v0.4144 PCYT2 Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4143 PCYT2 Zornitza Stark reviewed gene: PCYT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.375 PCYT2 Zornitza Stark Marked gene: PCYT2 as ready
Microcephaly v0.375 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Red List (Low Evidence).
Microcephaly v0.375 PCYT2 Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770
Microcephaly v0.374 PCYT2 Zornitza Stark Publications for gene: PCYT2 were set to
Microcephaly v0.373 PCYT2 Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.372 PCYT2 Zornitza Stark Classified gene: PCYT2 as Red List (low evidence)
Microcephaly v0.372 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Red List (Low Evidence).
Microcephaly v0.371 PCYT2 Zornitza Stark reviewed gene: PCYT2: Rating: RED; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark Tag founder tag was added to gene: TRAPPC2L.
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Tag founder tag was added to gene: TRAPPC2L.
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Classified gene: TRAPPC2L as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2939 TRAPPC2L Zornitza Stark Tag founder tag was added to gene: TRAPPC2L.
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Red List (Low Evidence).
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark gene: TRAPPC2L was added
gene: TRAPPC2L was added to Rhabdomyolysis RMH. Sources: Literature
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to RED
Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Red on this panel as rhabdomyolysis not reported in all families. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2939 TRAPPC2L Zornitza Stark gene: TRAPPC2L was added
gene: TRAPPC2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to AMBER
Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark changed review comment from: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature; to: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Red on this panel as seizures not reported in all families. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark edited their review of gene: TRAPPC2L: Changed rating: RED
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark gene: TRAPPC2L was added
gene: TRAPPC2L was added to Genetic Epilepsy. Sources: Literature
founder tags were added to gene: TRAPPC2L.
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to AMBER
Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Classified gene: TRAPPC2L as Amber List (moderate evidence)
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Dystonia and Chorea v0.75 TIMM8A Zornitza Stark Marked gene: TIMM8A as ready
Dystonia and Chorea v0.75 TIMM8A Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence).
Dystonia and Chorea v0.75 TIMM8A Zornitza Stark Phenotypes for gene: TIMM8A were changed from Deafness-Dystonia-Optic Neuronopathy Syndrome to Deafness-Dystonia-Optic Neuronopathy Syndrome; Mohr-Tranebjaerg syndrome, MIM# 304700
Dystonia and Chorea v0.74 TIMM8A Zornitza Stark Publications for gene: TIMM8A were set to
Dystonia and Chorea v0.73 TIMM8A Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Dystonia and Chorea v0.72 TIMM8A Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816, 32820032; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4142 TIMM8A Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Deafness_IsolatedAndComplex v0.386 TIMM8A Zornitza Stark Marked gene: TIMM8A as ready
Deafness_IsolatedAndComplex v0.386 TIMM8A Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v0.386 TIMM8A Zornitza Stark Phenotypes for gene: TIMM8A were changed from to Mohr-Tranebjaerg syndrome, MIM# 304700
Deafness_IsolatedAndComplex v0.385 TIMM8A Zornitza Stark Publications for gene: TIMM8A were set to
Deafness_IsolatedAndComplex v0.384 TIMM8A Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Deafness_IsolatedAndComplex v0.383 TIMM8A Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816, 32820032; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4141 TIMM8A Zornitza Stark Marked gene: TIMM8A as ready
Mendeliome v0.4141 TIMM8A Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence).
Mendeliome v0.4141 TIMM8A Zornitza Stark Phenotypes for gene: TIMM8A were changed from to Mohr-Tranebjaerg syndrome, MIM# 304700
Mendeliome v0.4140 TIMM8A Zornitza Stark Publications for gene: TIMM8A were set to
Mendeliome v0.4139 TIMM8A Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Hydrocephalus_Ventriculomegaly v0.56 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Hydrocephalus_Ventriculomegaly v0.56 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Hydrocephalus_Ventriculomegaly v0.56 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Hydrocephalus_Ventriculomegaly. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Ciliopathies v0.206 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Ciliopathies v0.206 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Ciliopathies v0.206 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Ciliopathies. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Anophthalmia_Microphthalmia_Coloboma v0.66 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Anophthalmia_Microphthalmia_Coloboma v0.66 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Microcephaly v0.371 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Microcephaly v0.371 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Anophthalmia_Microphthalmia_Coloboma v0.66 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Anophthalmia_Microphthalmia_Coloboma. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Microcephaly v0.371 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Classified gene: TOGARAM1 as Red List (low evidence)
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2938 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Intellectual disability syndromic and non-syndromic v0.2938 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2938 DPP6 Zornitza Stark Phenotypes for gene: DPP6 were changed from to Mental retardation, autosomal dominant 33 (MIM#616311)
Intellectual disability syndromic and non-syndromic v0.2937 DPP6 Zornitza Stark Publications for gene: DPP6 were set to
Intellectual disability syndromic and non-syndromic v0.2936 DPP6 Zornitza Stark Mode of inheritance for gene: DPP6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2935 DPP6 Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2935 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2934 DPP6 Zornitza Stark reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4138 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Mendeliome v0.4138 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4138 DPP6 Zornitza Stark Phenotypes for gene: DPP6 were changed from to Mental retardation, autosomal dominant 33 (MIM#616311)
Mendeliome v0.4137 DPP6 Zornitza Stark Publications for gene: DPP6 were set to
Mendeliome v0.4136 DPP6 Zornitza Stark Mode of inheritance for gene: DPP6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4135 DPP6 Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence)
Mendeliome v0.4135 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4134 DPP6 Zornitza Stark Tag SV/CNV tag was added to gene: DPP6.
Mendeliome v0.4134 DPP6 Zornitza Stark reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.370 DPP6 Zornitza Stark changed review comment from: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013.; to: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013. Association studies with dementia, and suggested role in tardive dyskinesia.
Microcephaly v0.370 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Microcephaly v0.370 DPP6 Zornitza Stark Added comment: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013.
Microcephaly v0.370 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.370 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Microcephaly v0.370 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.370 DPP6 Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence)
Microcephaly v0.370 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.369 DPP6 Zornitza Stark Tag SV/CNV tag was added to gene: DPP6.
Mendeliome v0.4134 TRAPPC2L Arina Puzriakova changed review comment from: Gene is associated with Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis in OMIM, but not in G2P.

PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect.

The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11.


PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family.

Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature; to: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship.

PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect.

The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11.


PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family.

Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.

Sources: Literature
Mendeliome v0.4134 TRAPPC2L Arina Puzriakova gene: TRAPPC2L was added
gene: TRAPPC2L was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to AMBER
Added comment: Gene is associated with Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis in OMIM, but not in G2P.

PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect.

The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11.


PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family.

Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Mendeliome v0.4134 TIMM8A Arina Puzriakova reviewed gene: TIMM8A: Rating: ; Mode of pathogenicity: None; Publications: 32820032; Phenotypes: ; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4134 TOGARAM1 Arina Puzriakova gene: TOGARAM1 was added
gene: TOGARAM1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene.

Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2934 DPP6 Ain Roesley edited their review of gene: DPP6: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4134 DPP6 Ain Roesley reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.2934 DPP6 Ain Roesley reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: None
Microcephaly v0.369 DPP6 Ain Roesley gene: DPP6 was added
gene: DPP6 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: DPP6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DPP6 were set to 23832105
Phenotypes for gene: DPP6 were set to Mental retardation, autosomal dominant 33 (MIM#616311)
Penetrance for gene: DPP6 were set to unknown
Review for gene: DPP6 was set to AMBER
Added comment: PMID: 23832105
- 1x proband (OFC < -3 SD) with a missense which segregated in 3 other family members
- 2x probands with 336kb deletion. Both OFCs < -3 SD
- mouse KO model with significantly smaller brain weight

*unable to find new reports since
Sources: Literature
Microcephaly v0.369 CTU2 Zornitza Stark Marked gene: CTU2 as ready
Microcephaly v0.369 CTU2 Zornitza Stark Gene: ctu2 has been classified as Green List (High Evidence).
Microcephaly v0.369 CTU2 Zornitza Stark Phenotypes for gene: CTU2 were changed from to Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome (MIM#618142)
Microcephaly v0.368 CTU2 Zornitza Stark Publications for gene: CTU2 were set to
Microcephaly v0.367 CTU2 Zornitza Stark Mode of inheritance for gene: CTU2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2934 PCGF2 Zornitza Stark Marked gene: PCGF2 as ready
Intellectual disability syndromic and non-syndromic v0.2934 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2934 PCGF2 Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371
Intellectual disability syndromic and non-syndromic v0.2933 PCGF2 Zornitza Stark Publications for gene: PCGF2 were set to
Microcephaly v0.366 CTU2 Ain Roesley reviewed gene: CTU2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26633546; Phenotypes: Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome (MIM#618142); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2932 PCGF2 Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2931 PCGF2 Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4134 PCGF2 Zornitza Stark Marked gene: PCGF2 as ready
Mendeliome v0.4134 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Green List (High Evidence).
Mendeliome v0.4134 PCGF2 Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371
Mendeliome v0.4133 PCGF2 Zornitza Stark Publications for gene: PCGF2 were set to
Mendeliome v0.4132 PCGF2 Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4131 PCGF2 Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.366 PCGF2 Zornitza Stark Marked gene: PCGF2 as ready
Microcephaly v0.366 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.366 PCGF2 Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371
Microcephaly v0.365 PCGF2 Zornitza Stark Publications for gene: PCGF2 were set to
Microcephaly v0.364 PCGF2 Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.363 PCGF2 Zornitza Stark Classified gene: PCGF2 as Amber List (moderate evidence)
Microcephaly v0.363 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.362 PCGF2 Zornitza Stark changed review comment from: developmental delay, impaired intellectual development, impaired growth, and recognizable facial features that include frontal bossing, sparse hair, malar hypoplasia, small palpebral fissures and oral stoma, and dysplastic 'satyr' ears. Other common findings include feeding problems, constipation, and a range of brain, cardiac, vascular, and skeletal malformations. Head size is variable, with some patients showing relative macrocephaly and others showing microcephaly. Over 10 affected individuals reported to date, all variants affect residue p.Pro65; to: Key features include developmental delay, impaired intellectual development, impaired growth, and recognizable facial features (frontal bossing, sparse hair, malar hypoplasia, small palpebral fissures and oral stoma, and dysplastic 'satyr' ears). Other common findings include feeding problems, constipation, and a range of brain, cardiac, vascular, and skeletal malformations. Head size is variable, with some patients showing relative macrocephaly and others showing microcephaly. Over 10 affected individuals reported to date, all variants affect residue p.Pro65
Microcephaly v0.362 PCGF2 Zornitza Stark edited their review of gene: PCGF2: Changed rating: AMBER
Microcephaly v0.362 PCGF2 Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.362 CTNNB1 Zornitza Stark Marked gene: CTNNB1 as ready
Microcephaly v0.362 CTNNB1 Zornitza Stark Gene: ctnnb1 has been classified as Green List (High Evidence).
Microcephaly v0.362 CTNNB1 Zornitza Stark Classified gene: CTNNB1 as Green List (high evidence)
Microcephaly v0.362 CTNNB1 Zornitza Stark Gene: ctnnb1 has been classified as Green List (High Evidence).
Microcephaly v0.361 CTNNB1 Ain Roesley gene: CTNNB1 was added
gene: CTNNB1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CTNNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CTNNB1 were set to 25326669; 32039639
Phenotypes for gene: CTNNB1 were set to Neurodevelopmental disorder with spastic diplegia and visual defects (MIM#615075); Exudative vitreoretinopathy 7 (MIM#617572)
Penetrance for gene: CTNNB1 were set to unknown
Review for gene: CTNNB1 was set to GREEN
Added comment: PMID: 32039639;
-1x proband with familial exudative vitreoretinopathy (FEVR) and microcephaly. Head circumference <1st centile

PMID: 25326669
- 15 families with 16 affecteds. de novo PTVs
- included 5 patients from published literature
- 10 out of 20 presented with microcephaly, head circumference < -3 SD
Sources: Literature
Microcephaly v0.361 PCDH12 Zornitza Stark Phenotypes for gene: PCDH12 were changed from DIENCEPHALIC-MESENCEPHALIC JUNCTION DYSPLASIA SYNDROME 1 to Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280
Microcephaly v0.360 PCDH12 Zornitza Stark Publications for gene: PCDH12 were set to 27164683; 22822038
Microcephaly v0.359 PCDH12 Zornitza Stark reviewed gene: PCDH12: Rating: GREEN; Mode of pathogenicity: None; Publications: 27164683, 30178464; Phenotypes: Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2931 TRIT1 Zornitza Stark Marked gene: TRIT1 as ready
Intellectual disability syndromic and non-syndromic v0.2931 TRIT1 Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2931 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873
Intellectual disability syndromic and non-syndromic v0.2930 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Intellectual disability syndromic and non-syndromic v0.2929 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2928 TRIT1 Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.478 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873
Mitochondrial disease v0.477 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Mitochondrial disease v0.476 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.475 TRIT1 Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4131 TRIT1 Zornitza Stark Marked gene: TRIT1 as ready
Mendeliome v0.4131 TRIT1 Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence).
Mendeliome v0.4131 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873
Mendeliome v0.4130 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Mendeliome v0.4129 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4128 TRIT1 Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.359 TRIT1 Zornitza Stark Marked gene: TRIT1 as ready
Microcephaly v0.359 TRIT1 Zornitza Stark Gene: trit1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.359 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35 MIM#617873
Microcephaly v0.358 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Microcephaly v0.357 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.356 TRIT1 Zornitza Stark Classified gene: TRIT1 as Amber List (moderate evidence)
Microcephaly v0.356 TRIT1 Zornitza Stark Gene: trit1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.355 TRIT1 Paul De Fazio reviewed gene: TRIT1: Rating: AMBER; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35 MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.355 CTCF Zornitza Stark Marked gene: CTCF as ready
Microcephaly v0.355 CTCF Zornitza Stark Gene: ctcf has been classified as Green List (High Evidence).
Microcephaly v0.355 CTCF Zornitza Stark Phenotypes for gene: CTCF were changed from to Mental retardation, autosomal dominant 21 (MIM#615502)
Microcephaly v0.354 CTCF Zornitza Stark Publications for gene: CTCF were set to
Microcephaly v0.353 CTCF Zornitza Stark Mode of inheritance for gene: CTCF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Arthrogryposis v0.207 TBCD Zornitza Stark Tag umccr was removed from gene: TBCD.
Microcephaly v0.352 TBCD Zornitza Stark Marked gene: TBCD as ready
Microcephaly v0.352 TBCD Zornitza Stark Gene: tbcd has been classified as Green List (High Evidence).
Microcephaly v0.352 TBCD Zornitza Stark Phenotypes for gene: TBCD were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193
Microcephaly v0.351 TBCD Zornitza Stark Publications for gene: TBCD were set to
Microcephaly v0.350 TBCD Zornitza Stark Mode of inheritance for gene: TBCD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.349 TBCD Zornitza Stark changed review comment from: 15 children from 9 unrelated families with bi-allelic variants in this gene and a progressive neurodegenerative encephalopathy.
Sources: Expert Review; to: 15 children from 9 unrelated families with bi-allelic variants in this gene and a progressive neurodegenerative encephalopathy including progressive microcephaly.
Sources: Expert Review
Microcephaly v0.349 TSEN15 Zornitza Stark Marked gene: TSEN15 as ready
Microcephaly v0.349 TSEN15 Zornitza Stark Gene: tsen15 has been classified as Green List (High Evidence).
Microcephaly v0.349 TSEN15 Zornitza Stark Classified gene: TSEN15 as Green List (high evidence)
Microcephaly v0.349 TSEN15 Zornitza Stark Gene: tsen15 has been classified as Green List (High Evidence).
Microcephaly v0.348 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Microcephaly v0.347 TSEN2 Zornitza Stark Marked gene: TSEN2 as ready
Microcephaly v0.347 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.347 TSEN2 Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B (MIM#612389)
Microcephaly v0.346 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to
Microcephaly v0.345 TSEN2 Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.344 TSEN15 Paul De Fazio gene: TSEN15 was added
gene: TSEN15 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TSEN15 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TSEN15 were set to 27392077
Phenotypes for gene: TSEN15 were set to Pontocerebellar hypoplasia, type 2F MIM#617026
Review for gene: TSEN15 was set to GREEN
gene: TSEN15 was marked as current diagnostic
Added comment: PMID 27392077 Reports four individuals from three families with PCH type 2 and different homozygous missense variants, all had progressive microcephaly (between -3SD and -9.7SD). Functional studies indicated that all variants resulted in almost complete lack of in vitro tRNA cleavage activity.
Sources: Literature
Microcephaly v0.344 TSEN2 Zornitza Stark Classified gene: TSEN2 as Amber List (moderate evidence)
Microcephaly v0.344 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.343 TSEN54 Zornitza Stark Marked gene: TSEN54 as ready
Microcephaly v0.343 TSEN54 Zornitza Stark Gene: tsen54 has been classified as Green List (High Evidence).
Microcephaly v0.343 TSEN54 Zornitza Stark Phenotypes for gene: TSEN54 were changed from to Pontocerebellar hypoplasia type 2A (MIM#277470) and type 4 (MIM#225753)
Microcephaly v0.342 TSEN54 Zornitza Stark Publications for gene: TSEN54 were set to
Microcephaly v0.341 TSEN54 Zornitza Stark Mode of inheritance for gene: TSEN54 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.340 TUBB2B Zornitza Stark Marked gene: TUBB2B as ready
Microcephaly v0.340 TUBB2B Zornitza Stark Gene: tubb2b has been classified as Green List (High Evidence).
Microcephaly v0.340 TUBB2B Zornitza Stark Phenotypes for gene: TUBB2B were changed from to Cortical dysplasia, complex, with other brain malformations 7 MIM#610031
Microcephaly v0.339 TUBB2B Zornitza Stark Publications for gene: TUBB2B were set to
Microcephaly v0.338 TUBB2B Zornitza Stark Mode of inheritance for gene: TUBB2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.337 COASY Zornitza Stark Marked gene: COASY as ready
Microcephaly v0.337 COASY Zornitza Stark Gene: coasy has been classified as Green List (High Evidence).
Microcephaly v0.337 COASY Zornitza Stark Classified gene: COASY as Green List (high evidence)
Microcephaly v0.337 COASY Zornitza Stark Gene: coasy has been classified as Green List (High Evidence).
Microcephaly v0.336 VPS51 Zornitza Stark Marked gene: VPS51 as ready
Microcephaly v0.336 VPS51 Zornitza Stark Gene: vps51 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.336 VPS51 Zornitza Stark Classified gene: VPS51 as Amber List (moderate evidence)
Microcephaly v0.336 VPS51 Zornitza Stark Gene: vps51 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.335 TSEN2 Paul De Fazio reviewed gene: TSEN2: Rating: AMBER; Mode of pathogenicity: None; Publications: 23562994, 20952379, 27392077; Phenotypes: Pontocerebellar hypoplasia type 2B (MIM#612389); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v0.4128 CRIPT Zornitza Stark Marked gene: CRIPT as ready
Mendeliome v0.4128 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4128 CRIPT Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence)
Mendeliome v0.4128 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Microcephaly v0.335 CRIPT Zornitza Stark Marked gene: CRIPT as ready
Microcephaly v0.335 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Microcephaly v0.335 CRIPT Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence)
Microcephaly v0.335 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2928 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Intellectual disability syndromic and non-syndromic v0.2928 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2928 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Intellectual disability syndromic and non-syndromic v0.2927 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Intellectual disability syndromic and non-syndromic v0.2926 CREBBP Zornitza Stark Mode of inheritance for gene: CREBBP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2925 CREBBP Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4127 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Mendeliome v0.4126 CREBBP Zornitza Stark Mode of inheritance for gene: CREBBP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4125 CREBBP Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.334 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Microcephaly v0.334 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Microcephaly v0.334 CREBBP Zornitza Stark Classified gene: CREBBP as Green List (high evidence)
Microcephaly v0.334 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Microcephaly v0.333 ERCC5 Zornitza Stark Publications for gene: ERCC5 were set to 32052936
Microcephaly v0.332 ERCC5 Zornitza Stark Publications for gene: ERCC5 were set to 32052936; 32052936
Microcephaly v0.331 ERCC5 Zornitza Stark Marked gene: ERCC5 as ready
Microcephaly v0.331 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.331 ERCC5 Zornitza Stark Classified gene: ERCC5 as Amber List (moderate evidence)
Microcephaly v0.331 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.330 TTC5 Zornitza Stark Marked gene: TTC5 as ready
Microcephaly v0.330 TTC5 Zornitza Stark Gene: ttc5 has been classified as Green List (High Evidence).
Microcephaly v0.330 TTC5 Zornitza Stark Classified gene: TTC5 as Green List (high evidence)
Microcephaly v0.330 TTC5 Zornitza Stark Gene: ttc5 has been classified as Green List (High Evidence).
Microcephaly v0.329 CKAP2L Zornitza Stark Marked gene: CKAP2L as ready
Microcephaly v0.329 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Microcephaly v0.329 CKAP2L Zornitza Stark Classified gene: CKAP2L as Green List (high evidence)
Microcephaly v0.329 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Microcephaly v0.328 TSEN54 Paul De Fazio reviewed gene: TSEN54: Rating: GREEN; Mode of pathogenicity: None; Publications: 20952379, 20301773; Phenotypes: Pontocerebellar hypoplasia type 2A (MIM#277470) and type 4 (MIM#225753); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.328 TTC5 Paul De Fazio gene: TTC5 was added
gene: TTC5 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TTC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC5 were set to 29302074; 32439809
Phenotypes for gene: TTC5 were set to Intellectual disability; microcephaly
Review for gene: TTC5 was set to GREEN
gene: TTC5 was marked as current diagnostic
Added comment: PMID 29302074: 3 affected individuals from 2 consaguinous families described. All had head circumference < -3SD

PMID 32439809: Report another 8 affected individuals from 5 families but only 3 individuals from 2 families were microcephalic (OFCs 31cm (unsure age), 32cm (12yo), 31cm (5yo)).
Sources: Literature
Microcephaly v0.328 CTCF Ain Roesley reviewed gene: CTCF: Rating: GREEN; Mode of pathogenicity: None; Publications: 23746550, 30893510, 28619046; Phenotypes: Mental retardation, autosomal dominant 21 (MIM#615502); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4125 CRIPT Ain Roesley gene: CRIPT was added
gene: CRIPT was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRIPT were set to 24389050; 27250922
Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789)
Penetrance for gene: CRIPT were set to unknown
Review for gene: CRIPT was set to AMBER
Added comment: PMID: 24389050
- 2 unrelated probands homozygous for PTVs. However 1 was deceased and DNA was unavailable therefore parents were sequenced

PMID: 27250922
- 1x proband
- het for a missense which was maternally inherited. Because the father was negative for SNVs, they did CMA and found a small heterozygous deletion 1.6kb in size encompassing exon 1 of CRIPT. This deletion was paternally inherited

*did not find new reports since
Sources: Literature
Microcephaly v0.328 CRIPT Ain Roesley gene: CRIPT was added
gene: CRIPT was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRIPT were set to 24389050; 27250922
Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789)
Penetrance for gene: CRIPT were set to unknown
Review for gene: CRIPT was set to AMBER
Added comment: PMID: 24389050
- 2 unrelated probands homozygous for PTVs. However 1 was deceased and DNA was unavailable therefore parents were sequenced
- OFCs -2.5 and -2.7SD

PMID: 27250922
- 1x proband with a head circumference of Z= -2.7.
- het for a missense which was maternally inherited. Because the father was negative for SNVs, they did CMA and found a small heterozygous deletion 1.6kb in size encompassing exon 1 of CRIPT. This deletion was paternally inherited

*did not find new reports since
Sources: Literature
Microcephaly v0.328 CREBBP Ain Roesley gene: CREBBP was added
gene: CREBBP was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CREBBP were set to 27311832; 29460469; 24989455
Phenotypes for gene: CREBBP were set to Menke-Hennekam syndrome 1(MIM#618332); Rubinstein-Taybi syndrome 1(MIM#180849)
Penetrance for gene: CREBBP were set to unknown
Review for gene: CREBBP was set to GREEN
Added comment: Microcephaly is a feature of both syndromes (OMIM, GeneReviews)

Variants causing Menke-Hennekam syndrome occur in 3' end of exon 30 and 5' end of exon 31 and are de novo missense versus Rubinstein-Taybi which are LoF variants.


PMID: 27311832
7 out of 11 Menke-Hennekam probands with microcephaly (<3rd centile)

PMID: 29460469
13 new Menke-Hennekam probands with 3 having OFCs of <-3 SD

PMID: 24989455 provides growth charts of 92 molecularly diagnosed Rubinstein-Taybi patients. Mean of -1.89 SD for males and -2.71 SD for females
Sources: Literature
Microcephaly v0.328 COASY Seb Lunke gene: COASY was added
gene: COASY was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: COASY was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COASY were set to 30089828; 28489334
Phenotypes for gene: COASY were set to Pontocerebellar hypoplasia, type 12, MIM#618266
Review for gene: COASY was set to GREEN
Added comment: 6 patients from 3 families published with microcephaly. One paper (2018, 30089828) describes two families, one consanguineous with hom splice region variant c.1486-3 C>G, the other family with a compound heterozygous c.[1549_1550delAG]; [1486-3 C>G] genotype. An earlier paper (2017, 28489334) describes an additional family with two affected siblings compound het c.1495C > T; p.(R499C) and c.C641T; p(A214V) variants.
Sources: Literature
Microcephaly v0.327 CLTC Ain Roesley reviewed gene: CLTC: Rating: AMBER; Mode of pathogenicity: None; Publications: 31776469; Phenotypes: Mental retardation, autosomal dominant 56 (MIM#617854); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.327 ERCC5 Paul De Fazio gene: ERCC5 was added
gene: ERCC5 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC5 were set to 32052936; 32052936
Phenotypes for gene: ERCC5 were set to Cerebrooculofacioskeletal syndrome 3 MIM#616570
Review for gene: ERCC5 was set to AMBER
gene: ERCC5 was marked as current diagnostic
Added comment: PMID 9096355 identified a homozygous LoF variant in a boy with microcephaly but this publication was later retracted over data in Figure 6.

PMID 24700531 describes 4 fetuses from a large consanguineous Pakistani kindred with a homozygous LoF variant. All were said to be microcephalic with no measurements given.

PMID 32052936 describes another 3 microcephalic fetuses from 2 families with homozygous LoF variants, again no measurements given.

3 families described in total but head circumference measurements of affected fetuses not provided so rated Amber.
Sources: Literature
Deafness_IsolatedAndComplex v0.383 DIAPH1 Dean Phelan reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 24781755, 27707755, 27808407, 28003573, 28815995; Phenotypes: Deafness, autosomal dominant 1, with or without thrombocytopenia 124900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.327 ERCC8 Seb Lunke Marked gene: ERCC8 as ready
Microcephaly v0.327 ERCC8 Seb Lunke Gene: ercc8 has been classified as Green List (High Evidence).
Microcephaly v0.327 ERCC8 Seb Lunke Classified gene: ERCC8 as Green List (high evidence)
Microcephaly v0.327 ERCC8 Seb Lunke Gene: ercc8 has been classified as Green List (High Evidence).
Microcephaly v0.326 DIAPH1 Seb Lunke Marked gene: DIAPH1 as ready
Microcephaly v0.326 DIAPH1 Seb Lunke Gene: diaph1 has been classified as Green List (High Evidence).
Microcephaly v0.326 DIAPH1 Seb Lunke Classified gene: DIAPH1 as Green List (high evidence)
Microcephaly v0.326 DIAPH1 Seb Lunke Gene: diaph1 has been classified as Green List (High Evidence).
Microcephaly v0.325 ERCC8 Belinda Chong gene: ERCC8 was added
gene: ERCC8 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC8 were set to 14661080; 21108394
Phenotypes for gene: ERCC8 were set to Cockayne syndrome, type A, MIM# 216400
Review for gene: ERCC8 was set to GREEN
gene: ERCC8 was marked as current diagnostic
Added comment: Well established gene-disease association, with microcephaly a reported feature.
(https://www.ncbi.nlm.nih.gov/books/NBK1342/)
Sources: Literature
Microcephaly v0.325 DIAPH1 Dean Phelan gene: DIAPH1 was added
gene: DIAPH1 was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: DIAPH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DIAPH1 were set to PMID: 24781755; 26463574
Phenotypes for gene: DIAPH1 were set to Seizures, cortical blindness, microcephaly syndrome 616632
Review for gene: DIAPH1 was set to GREEN
Added comment: PMID: 24781755 (2015) - five individuals from a consanguineous family with severe microcephaly >2SD below the mean for age with homozygous nonsense variant in DIAPH1

PMID: 26463574 (2016) - two different homozygous LOF variants identified in two unrelated consanguineous families. The affected individuals were diagnosed with postnatal microcephaly (>2SD), early-onset epilepsy, severe vision impairment, and pulmonary symptoms including bronchiectasis and recurrent respiratory infections.
Sources: Expert Review
Microcephaly v0.325 ERCC6 Seb Lunke Marked gene: ERCC6 as ready
Microcephaly v0.325 ERCC6 Seb Lunke Gene: ercc6 has been classified as Green List (High Evidence).
Microcephaly v0.325 ERCC6 Seb Lunke Classified gene: ERCC6 as Green List (high evidence)
Microcephaly v0.325 ERCC6 Seb Lunke Gene: ercc6 has been classified as Green List (High Evidence).
Microcephaly v0.324 ERCC4 Seb Lunke Marked gene: ERCC4 as ready
Microcephaly v0.324 ERCC4 Seb Lunke Gene: ercc4 has been classified as Green List (High Evidence).
Microcephaly v0.324 ERCC6 Naomi Baker gene: ERCC6 was added
gene: ERCC6 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC6 were set to PMID: 20301516
Phenotypes for gene: ERCC6 were set to Cockayne syndrome, type B, MIM#133540; Cerebrooculofacioskeletal syndrome 1, MIM#214150; De Sanctis-Cacchione syndrome, MIM#278800
Penetrance for gene: ERCC6 were set to Complete
Review for gene: ERCC6 was set to GREEN
Added comment: Well established gene-disease association, with microcephaly a reported feature.
Sources: Literature
Microcephaly v0.324 CKAP2L Zornitza Stark Classified gene: CKAP2L as Green List (high evidence)
Microcephaly v0.324 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Microcephaly v0.324 FANCF Zornitza Stark Marked gene: FANCF as ready
Microcephaly v0.324 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Microcephaly v0.324 ERCC4 Seb Lunke Classified gene: ERCC4 as Green List (high evidence)
Microcephaly v0.324 ERCC4 Seb Lunke Gene: ercc4 has been classified as Green List (High Evidence).
Microcephaly v0.323 BRIP1 Zornitza Stark Marked gene: BRIP1 as ready
Microcephaly v0.323 BRIP1 Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence).
Microcephaly v0.323 FANCD2 Seb Lunke Marked gene: FANCD2 as ready
Microcephaly v0.323 FANCD2 Seb Lunke Gene: fancd2 has been classified as Green List (High Evidence).
Microcephaly v0.323 FANCD2 Seb Lunke Classified gene: FANCD2 as Green List (high evidence)
Microcephaly v0.323 FANCD2 Seb Lunke Gene: fancd2 has been classified as Green List (High Evidence).
Microcephaly v0.323 BRIP1 Zornitza Stark Publications for gene: BRIP1 were set to
Microcephaly v0.322 BRIP1 Zornitza Stark Classified gene: BRIP1 as Green List (high evidence)
Microcephaly v0.322 BRIP1 Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence).
Microcephaly v0.321 FANCD2 Dean Phelan gene: FANCD2 was added
gene: FANCD2 was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: FANCD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCD2 were set to PMID:20301575
Phenotypes for gene: FANCD2 were set to Fanconi anemia 227646
Review for gene: FANCD2 was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert Review
Microcephaly v0.321 FANCG Seb Lunke Marked gene: FANCG as ready
Microcephaly v0.321 FANCG Seb Lunke Gene: fancg has been classified as Green List (High Evidence).
Microcephaly v0.321 FANCG Seb Lunke Classified gene: FANCG as Green List (high evidence)
Microcephaly v0.321 FANCG Seb Lunke Gene: fancg has been classified as Green List (High Evidence).
Microcephaly v0.320 FANCF Zornitza Stark Classified gene: FANCF as Green List (high evidence)
Microcephaly v0.320 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Microcephaly v0.319 ERCC4 Ain Roesley gene: ERCC4 was added
gene: ERCC4 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC4 were set to Fanconi anemia, complementation group Q (MIM#615272); Cockayne syndrome (MIM#278760)
Penetrance for gene: ERCC4 were set to unknown
Review for gene: ERCC4 was set to GREEN
Added comment: Microcephaly is a well established feature in Cockayne syndrome
Sources: Literature
Microcephaly v0.319 FANCE Seb Lunke Marked gene: FANCE as ready
Microcephaly v0.319 FANCE Seb Lunke Gene: fance has been classified as Green List (High Evidence).
Microcephaly v0.319 FANCE Seb Lunke Classified gene: FANCE as Green List (high evidence)
Microcephaly v0.319 FANCE Seb Lunke Gene: fance has been classified as Green List (High Evidence).
Microcephaly v0.318 FANCI Zornitza Stark Marked gene: FANCI as ready
Microcephaly v0.318 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Microcephaly v0.318 FANCI Zornitza Stark Classified gene: FANCI as Green List (high evidence)
Microcephaly v0.318 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Microcephaly v0.317 FANCF Belinda Chong gene: FANCF was added
gene: FANCF was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCF were set to 20301575
Phenotypes for gene: FANCF were set to Fanconi anemia, complementation group F, MIM# 603467
Review for gene: FANCF was set to GREEN
Added comment: Well established gene disease association
Sources: https://www.ncbi.nlm.nih.gov/books/NBK1401/
Sources: Literature
Microcephaly v0.317 FANCG Paul De Fazio gene: FANCG was added
gene: FANCG was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCG were set to 20301575
Phenotypes for gene: FANCG were set to Fanconi anemia, complementation group G MIM#614082
Review for gene: FANCG was set to GREEN
gene: FANCG was marked as current diagnostic
Added comment: Well-established gene-disease association, microcephaly is a feature.
Sources: Literature
Microcephaly v0.317 FANCL Zornitza Stark Marked gene: FANCL as ready
Microcephaly v0.317 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Microcephaly v0.317 FANCL Zornitza Stark Classified gene: FANCL as Green List (high evidence)
Microcephaly v0.317 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Microcephaly v0.316 FANCL Zornitza Stark gene: FANCL was added
gene: FANCL was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCL were set to 20301575
Phenotypes for gene: FANCL were set to Fanconi anemia, complementation group L, MIM# 614083
Review for gene: FANCL was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert list
Microcephaly v0.316 FANCC Seb Lunke Marked gene: FANCC as ready
Microcephaly v0.316 FANCC Seb Lunke Gene: fancc has been classified as Green List (High Evidence).
Microcephaly v0.316 FANCC Seb Lunke Classified gene: FANCC as Green List (high evidence)
Microcephaly v0.316 FANCC Seb Lunke Gene: fancc has been classified as Green List (High Evidence).
Microcephaly v0.315 FANCI Ain Roesley gene: FANCI was added
gene: FANCI was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCI was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCI were set to 20301575
Phenotypes for gene: FANCI were set to Fanconi anemia, complementation group I (MIM#609053)
Penetrance for gene: FANCI were set to unknown
Review for gene: FANCI was set to GREEN
Added comment: 75% of Fanconi Anemia (FA) patients have microcephaly and approx 1% cases is caused by FANCI
Sources: Literature
Microcephaly v0.315 FANCA Seb Lunke Marked gene: FANCA as ready
Microcephaly v0.315 FANCA Seb Lunke Gene: fanca has been classified as Green List (High Evidence).
Mendeliome v0.4125 FANCD2 Dean Phelan reviewed gene: FANCD2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:20301575; Phenotypes: Fanconi anemia 227646; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.315 FANCA Seb Lunke Classified gene: FANCA as Green List (high evidence)
Microcephaly v0.315 FANCA Seb Lunke Gene: fanca has been classified as Green List (High Evidence).
Microcephaly v0.314 FANCE Naomi Baker gene: FANCE was added
gene: FANCE was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCE were set to PMID: 20301575
Phenotypes for gene: FANCE were set to Fanconi anemia, complementation group E, MIM#600901
Penetrance for gene: FANCE were set to Complete
Review for gene: FANCE was set to GREEN
Added comment: Well established gene-disease association, with microcephaly a reported feature.
Sources: Literature
Microcephaly v0.314 FANCA Seb Lunke gene: FANCA was added
gene: FANCA was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: FANCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCA were set to 20301575
Phenotypes for gene: FANCA were set to Fanconi anemia, complementation group A (MIM#227650)
Review for gene: FANCA was set to GREEN
gene: FANCA was marked as current diagnostic
Added comment: Well established gene disease association
Sources: Expert Review
Microcephaly v0.314 FANCB Zornitza Stark Marked gene: FANCB as ready
Microcephaly v0.314 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Microcephaly v0.314 FANCB Zornitza Stark Classified gene: FANCB as Green List (high evidence)
Microcephaly v0.314 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Microcephaly v0.313 FANCB Zornitza Stark gene: FANCB was added
gene: FANCB was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: FANCB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: FANCB were set to 20301575
Phenotypes for gene: FANCB were set to Fanconi anemia, complementation group B, MIM# 300514
Review for gene: FANCB was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert list
Microcephaly v0.312 FANCC Ain Roesley gene: FANCC was added
gene: FANCC was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCC were set to 20301575
Phenotypes for gene: FANCC were set to Fanconi anemia, complementation group C (MIM#227645)
Penetrance for gene: FANCC were set to unknown
Review for gene: FANCC was set to GREEN
Added comment: 75% of Fanconi Anemia (FA) patients have microcephaly and approx 14% cases is caused by FANCC
Sources: Literature
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Marked gene: CHD4 as ready
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Gene: chd4 has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Classified gene: CHD4 as Green List (high evidence)
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Gene: chd4 has been classified as Green List (High Evidence).
Mendeliome v0.4125 DIAPH1 Zornitza Stark Marked gene: DIAPH1 as ready
Mendeliome v0.4125 DIAPH1 Zornitza Stark Gene: diaph1 has been classified as Green List (High Evidence).
Mendeliome v0.4125 DIAPH1 Zornitza Stark Phenotypes for gene: DIAPH1 were changed from to Deafness; thrombocytopenia 124900; Seizures; cortical blindness; microcephaly 616632
Macrocephaly_Megalencephaly v0.45 CHD4 Ain Roesley gene: CHD4 was added
gene: CHD4 was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: CHD4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CHD4 were set to 31388190; 27616479
Phenotypes for gene: CHD4 were set to Sifrim-Hitz-Weiss syndrome (MIM#617159)
Penetrance for gene: CHD4 were set to unknown
Review for gene: CHD4 was set to GREEN
Added comment: PMID: 31388190
Out of 32 probands, 5 had OFC of > 3 SD

PMID: 27616479
Out of 5 patients, 3 had OFC of >98th percentiles and 1x 90th

* all de novo variants
Sources: Literature
Mendeliome v0.4124 DIAPH1 Zornitza Stark Publications for gene: DIAPH1 were set to
Mendeliome v0.4123 UFC1 Seb Lunke Marked gene: UFC1 as ready
Mendeliome v0.4123 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Mendeliome v0.4123 DIAPH1 Zornitza Stark Mode of inheritance for gene: DIAPH1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4122 UFC1 Seb Lunke Classified gene: UFC1 as Green List (high evidence)
Mendeliome v0.4122 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Microcephaly v0.312 UFC1 Seb Lunke Marked gene: UFC1 as ready
Microcephaly v0.312 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Microcephaly v0.312 UFC1 Seb Lunke Publications for gene: UFC1 were set to 29868776
Mendeliome v0.4121 UFC1 Paul De Fazio gene: UFC1 was added
gene: UFC1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: UFC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFC1 were set to 29868776; 30552426
Phenotypes for gene: UFC1 were set to Neurodevelopmental disorder with spasticity and poor growth (MIM#618076)
Review for gene: UFC1 was set to GREEN
gene: UFC1 was marked as current diagnostic
Added comment: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.

In vitro functional expression studies showed that both mutations caused impaired thioester binding with UFM1. Patient cells also showed decreased UFC1 intermediate formation with UFM1. The decrease in function was consistent with a hypomorphic allele, and the authors suggested that complete loss of function would be embryonic lethal.

PMID 30552426: 1 more individual with epileptic encephalopathy reported with a different homozygous missense variant in UFC1. The patient had microcephaly <3rd percentile.
Sources: Literature
Microcephaly v0.311 UFC1 Seb Lunke Classified gene: UFC1 as Green List (high evidence)
Microcephaly v0.311 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Microcephaly v0.310 CHD4 Seb Lunke Marked gene: CHD4 as ready
Microcephaly v0.310 CHD4 Seb Lunke Gene: chd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.310 CHD4 Seb Lunke Phenotypes for gene: CHD4 were changed from to Sifrim-Hitz-Weiss syndrome (MIM#617159)
Microcephaly v0.309 UFC1 Paul De Fazio edited their review of gene: UFC1: Changed rating: GREEN
Microcephaly v0.309 TUBGCP4 Zornitza Stark Marked gene: TUBGCP4 as ready
Microcephaly v0.309 TUBGCP4 Zornitza Stark Gene: tubgcp4 has been classified as Green List (High Evidence).
Microcephaly v0.309 UFC1 Paul De Fazio changed review comment from: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.
Sources: Literature; to: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.

In vitro functional expression studies showed that both mutations caused impaired thioester binding with UFM1. Patient cells also showed decreased UFC1 intermediate formation with UFM1. The decrease in function was consistent with a hypomorphic allele, and the authors suggested that complete loss of function would be embryonic lethal.

PMID 30552426: 1 more individual with epileptic encephalopathy reported with a different homozygous missense variant in UFC1. The patient had microcephaly <3rd percentile.

Sources: Literature
Microcephaly v0.309 TUBGCP4 Zornitza Stark Classified gene: TUBGCP4 as Green List (high evidence)
Microcephaly v0.309 TUBGCP4 Zornitza Stark Gene: tubgcp4 has been classified as Green List (High Evidence).
Microcephaly v0.309 CHD4 Seb Lunke Publications for gene: CHD4 were set to
Microcephaly v0.308 CHD4 Seb Lunke Mode of inheritance for gene: CHD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.308 UBA5 Zornitza Stark Marked gene: UBA5 as ready
Microcephaly v0.308 UBA5 Zornitza Stark Gene: uba5 has been classified as Green List (High Evidence).
Microcephaly v0.308 UBA5 Zornitza Stark Classified gene: UBA5 as Green List (high evidence)
Microcephaly v0.308 UBA5 Zornitza Stark Gene: uba5 has been classified as Green List (High Evidence).
Microcephaly v0.307 CHD4 Seb Lunke Classified gene: CHD4 as Amber List (moderate evidence)
Microcephaly v0.307 CHD4 Seb Lunke Added comment: Comment on list classification: Unclear what would differentiate Macro- from micro-cephaly in this gene, or if micro-cephaly is actually a feature of the condition
Microcephaly v0.307 CHD4 Seb Lunke Gene: chd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.306 DNM1L Zornitza Stark Marked gene: DNM1L as ready
Microcephaly v0.306 DNM1L Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green, but overall a small proportion of individuals have microcephaly.
Microcephaly v0.306 DNM1L Zornitza Stark Gene: dnm1l has been classified as Amber List (Moderate Evidence).
Microcephaly v0.306 DNM1L Zornitza Stark Phenotypes for gene: DNM1L were changed from to Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388
Microcephaly v0.305 UFC1 Paul De Fazio edited their review of gene: UFC1: Changed publications: 29868776, 30552426
Microcephaly v0.305 DNM1L Zornitza Stark Classified gene: DNM1L as Amber List (moderate evidence)
Microcephaly v0.305 DNM1L Zornitza Stark Gene: dnm1l has been classified as Amber List (Moderate Evidence).
Microcephaly v0.305 DNM1L Zornitza Stark Publications for gene: DNM1L were set to
Microcephaly v0.304 DNM1L Zornitza Stark Mode of inheritance for gene: DNM1L was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.303 CENPF Zornitza Stark Marked gene: CENPF as ready
Microcephaly v0.303 CENPF Zornitza Stark Gene: cenpf has been classified as Green List (High Evidence).
Microcephaly v0.303 CIT Zornitza Stark Marked gene: CIT as ready
Microcephaly v0.303 CIT Zornitza Stark Gene: cit has been classified as Green List (High Evidence).
Microcephaly v0.303 CIT Zornitza Stark Classified gene: CIT as Green List (high evidence)
Microcephaly v0.303 CIT Zornitza Stark Gene: cit has been classified as Green List (High Evidence).
Microcephaly v0.302 UBE3A Zornitza Stark Marked gene: UBE3A as ready
Microcephaly v0.302 UBE3A Zornitza Stark Gene: ube3a has been classified as Green List (High Evidence).
Microcephaly v0.302 UBE3A Zornitza Stark Phenotypes for gene: UBE3A were changed from to Angelman syndrome MIM#105830
Microcephaly v0.301 UBE3A Zornitza Stark Mode of inheritance for gene: UBE3A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.300 CHAMP1 Zornitza Stark Marked gene: CHAMP1 as ready
Microcephaly v0.300 CHAMP1 Zornitza Stark Gene: champ1 has been classified as Green List (High Evidence).
Microcephaly v0.300 CHAMP1 Zornitza Stark Publications for gene: CHAMP1 were set to
Microcephaly v0.299 CHAMP1 Zornitza Stark Mode of inheritance for gene: CHAMP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.298 CHAMP1 Zornitza Stark Phenotypes for gene: CHAMP1 were changed from to Mental retardation, autosomal dominant 40 (MIM#616579)
Microcephaly v0.297 CDKL5 Zornitza Stark Marked gene: CDKL5 as ready
Microcephaly v0.297 CDKL5 Zornitza Stark Gene: cdkl5 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.297 CENPF Zornitza Stark Classified gene: CENPF as Green List (high evidence)
Microcephaly v0.297 CENPF Zornitza Stark Gene: cenpf has been classified as Green List (High Evidence).
Mendeliome v0.4121 CENPE Seb Lunke Marked gene: CENPE as ready
Mendeliome v0.4121 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Mendeliome v0.4121 CENPE Seb Lunke Phenotypes for gene: CENPE were changed from to Microcephaly 13, primary, autosomal recessive (MIM#616051)
Microcephaly v0.296 CDKL5 Zornitza Stark Phenotypes for gene: CDKL5 were changed from to Epileptic encephalopathy, early infantile, 2 (MIM#300672)
Mendeliome v0.4120 CENPE Seb Lunke Publications for gene: CENPE were set to
Microcephaly v0.295 UFM1 Zornitza Stark Tag founder tag was added to gene: UFM1.
Microcephaly v0.295 UFM1 Zornitza Stark Marked gene: UFM1 as ready
Microcephaly v0.295 UFM1 Zornitza Stark Added comment: Comment when marking as ready: Green rating in view of the marked microcephaly, and large number of individuals reported with the founder variant. Rating is borderline but consistent across panels.
Microcephaly v0.295 UFM1 Zornitza Stark Gene: ufm1 has been classified as Green List (High Evidence).
Mendeliome v0.4119 CENPE Seb Lunke Mode of inheritance for gene: CENPE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.295 CENPE Seb Lunke Marked gene: CENPE as ready
Microcephaly v0.295 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Mendeliome v0.4118 CENPE Seb Lunke Classified gene: CENPE as Red List (low evidence)
Mendeliome v0.4118 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Microcephaly v0.295 UFM1 Zornitza Stark Classified gene: UFM1 as Green List (high evidence)
Microcephaly v0.295 UFM1 Zornitza Stark Gene: ufm1 has been classified as Green List (High Evidence).
Microcephaly v0.295 CENPE Seb Lunke Phenotypes for gene: CENPE were changed from to Microcephaly 13, primary, autosomal recessive (MIM#616051)
Mendeliome v0.4117 CENPE Ain Roesley reviewed gene: CENPE: Rating: RED; Mode of pathogenicity: None; Publications: 24748105, 30086807; Phenotypes: Microcephaly 13, primary, autosomal recessive (MIM#616051); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.294 CENPE Seb Lunke Publications for gene: CENPE were set to
Microcephaly v0.293 CENPE Seb Lunke Mode of inheritance for gene: CENPE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.292 CENPE Seb Lunke Classified gene: CENPE as Red List (low evidence)
Microcephaly v0.292 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Mendeliome v0.4117 CDC6 Seb Lunke Marked gene: CDC6 as ready
Mendeliome v0.4117 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.291 CKAP2L Ain Roesley gene: CKAP2L was added
gene: CKAP2L was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CKAP2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CKAP2L were set to 29473684; 25439729
Phenotypes for gene: CKAP2L were set to Filippi syndrome (MIM#272440)
Penetrance for gene: CKAP2L were set to unknown
Review for gene: CKAP2L was set to GREEN
Added comment: PMID: 29473684
- 1x proband with head circumference -3SD

PMID: 25439729
- 11 patients, 7 have OFCs <= -3SD
Sources: Literature
Microcephaly v0.291 TUBB2B Paul De Fazio reviewed gene: TUBB2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 19465910, 22333901; Phenotypes: Cortical dysplasia, complex, with other brain malformations 7 MIM#610031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Mendeliome v0.4117 CDC6 Seb Lunke Phenotypes for gene: CDC6 were changed from to Meier-Gorlin syndrome 5 (MIM#613805)
Microcephaly v0.291 CDKL5 Zornitza Stark Publications for gene: CDKL5 were set to
Intellectual disability syndromic and non-syndromic v0.2925 CDC6 Seb Lunke Marked gene: CDC6 as ready
Intellectual disability syndromic and non-syndromic v0.2925 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2925 CDC6 Seb Lunke Phenotypes for gene: CDC6 were changed from to Meier-Gorlin syndrome 5 (MIM#613805)
Microcephaly v0.290 CDKL5 Zornitza Stark Mode of inheritance for gene: CDKL5 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.4116 CDC6 Seb Lunke Publications for gene: CDC6 were set to
Microcephaly v0.289 CDKL5 Zornitza Stark Classified gene: CDKL5 as Amber List (moderate evidence)
Microcephaly v0.289 CDKL5 Zornitza Stark Gene: cdkl5 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4115 CDC6 Seb Lunke Mode of inheritance for gene: CDC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2924 CDC6 Seb Lunke Publications for gene: CDC6 were set to
Mendeliome v0.4114 DIAPH1 Dean Phelan reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24781755, 26463574, 24781755, 27808407, 28003573, 28815995; Phenotypes: Deafness, thrombocytopenia, Seizures, cortical blindness, microcephaly; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4114 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Mendeliome v0.4114 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2923 CDC6 Seb Lunke Mode of inheritance for gene: CDC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2922 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.2922 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.288 CDK13 Seb Lunke Marked gene: CDK13 as ready
Microcephaly v0.288 CDK13 Seb Lunke Gene: cdk13 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.288 CDK13 Seb Lunke Phenotypes for gene: CDK13 were changed from to Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder (MIM#617360)
Microcephaly v0.287 UNC80 Zornitza Stark Marked gene: UNC80 as ready
Microcephaly v0.287 UNC80 Zornitza Stark Gene: unc80 has been classified as Green List (High Evidence).
Microcephaly v0.287 CDK13 Seb Lunke Publications for gene: CDK13 were set to
Microcephaly v0.287 UNC80 Zornitza Stark Phenotypes for gene: UNC80 were changed from to Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 MIM#616801
Microcephaly v0.286 CDK13 Seb Lunke Mode of inheritance for gene: CDK13 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.286 UNC80 Zornitza Stark Publications for gene: UNC80 were set to
Microcephaly v0.285 UNC80 Zornitza Stark Mode of inheritance for gene: UNC80 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4113 CDC6 Ain Roesley reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.284 CDK13 Seb Lunke Classified gene: CDK13 as Amber List (moderate evidence)
Microcephaly v0.284 CDK13 Seb Lunke Gene: cdk13 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2921 CDC6 Ain Roesley reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.283 DDX11 Zornitza Stark Marked gene: DDX11 as ready
Microcephaly v0.283 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Microcephaly v0.283 DDX11 Zornitza Stark Classified gene: DDX11 as Green List (high evidence)
Microcephaly v0.283 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Microcephaly v0.282 TUBGCP4 Paul De Fazio gene: TUBGCP4 was added
gene: TUBGCP4 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TUBGCP4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TUBGCP4 were set to 25817018
Phenotypes for gene: TUBGCP4 were set to Microcephaly and chorioretinopathy, autosomal recessive, MIM#616335
Review for gene: TUBGCP4 was set to GREEN
gene: TUBGCP4 was marked as current diagnostic
Added comment: 4 patients from 3 families with biallelic variants reported, all with microcephaly < -3SD. All had a synonymous splice variant on one allele.
Sources: Literature
Microcephaly v0.282 USP18 Zornitza Stark Marked gene: USP18 as ready
Microcephaly v0.282 USP18 Zornitza Stark Gene: usp18 has been classified as Red List (Low Evidence).
Microcephaly v0.282 USP18 Zornitza Stark Phenotypes for gene: USP18 were changed from to Pseudo-TORCH syndrome 2 MIM#617397
Microcephaly v0.281 USP18 Zornitza Stark Publications for gene: USP18 were set to
Microcephaly v0.280 CDC6 Seb Lunke Marked gene: CDC6 as ready
Microcephaly v0.280 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.280 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Microcephaly v0.280 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.280 USP18 Zornitza Stark Mode of inheritance for gene: USP18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.279 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Microcephaly v0.279 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.279 USP18 Zornitza Stark Classified gene: USP18 as Red List (low evidence)
Microcephaly v0.279 USP18 Zornitza Stark Gene: usp18 has been classified as Red List (Low Evidence).
Microcephaly v0.278 CCDC88A Zornitza Stark Classified gene: CCDC88A as Green List (high evidence)
Microcephaly v0.278 CCDC88A Zornitza Stark Gene: ccdc88a has been classified as Green List (High Evidence).
Microcephaly v0.277 CCDC88A Ain Roesley edited their review of gene: CCDC88A: Changed rating: GREEN; Changed phenotypes: PEHO syndrome-like (MIM#617507)
Microcephaly v0.277 BUB1B Seb Lunke Marked gene: BUB1B as ready
Microcephaly v0.277 BUB1B Seb Lunke Gene: bub1b has been classified as Green List (High Evidence).
Microcephaly v0.277 BUB1B Seb Lunke Phenotypes for gene: BUB1B were changed from to Mosaic variegated aneuploidy syndrome 1 (MIM#257300)
Microcephaly v0.276 CCDC88A Zornitza Stark Marked gene: CCDC88A as ready
Microcephaly v0.276 CCDC88A Zornitza Stark Gene: ccdc88a has been classified as Amber List (Moderate Evidence).
Microcephaly v0.276 BUB1B Seb Lunke Publications for gene: BUB1B were set to
Microcephaly v0.276 CCDC88A Zornitza Stark Classified gene: CCDC88A as Amber List (moderate evidence)
Microcephaly v0.276 CCDC88A Zornitza Stark Gene: ccdc88a has been classified as Amber List (Moderate Evidence).
Microcephaly v0.275 BUB1B Seb Lunke Mode of inheritance for gene: BUB1B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.274 DHCR7 Zornitza Stark Marked gene: DHCR7 as ready
Microcephaly v0.274 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Microcephaly v0.274 DHCR7 Zornitza Stark Classified gene: DHCR7 as Green List (high evidence)
Microcephaly v0.274 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Microcephaly v0.273 UBA5 Paul De Fazio gene: UBA5 was added
gene: UBA5 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UBA5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBA5 were set to 27545674; 27545681
Phenotypes for gene: UBA5 were set to Epileptic encephalopathy, early infantile, 44 (MIM#617132)
Review for gene: UBA5 was set to GREEN
gene: UBA5 was marked as current diagnostic
Added comment: PMID 27545674: 8 patients from 5 unrelated families with biallelic variants reported. All had the same missense variant on one allele (517hets in gnomAD), which they referred to as a hypomorphic allele. 7 of the 8 were microcephalic (they used < -3SD as diagnostic criteria).

PMID 27545681: 5 patients from 4 families with biallelic variants reported. Head circumferences were cited as: -3.5SD, -2SD, 4th centile, -2.5SD, -2.4SD.
Sources: Literature
Microcephaly v0.273 DHCR7 Belinda Chong changed review comment from: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/)

More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7)
Sources: Literature; to: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/, ClinVar)

More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7)
Sources: Literature
Microcephaly v0.273 DNM1L Naomi Baker changed review comment from: Most individuals reported with variants in DNM1L do not have microcephaly listed as a phenotype.

PMID: 17460227 - Reports a newborn girl with microcephaly (head circumference below the 0.4 percentile), abnormal brain development, optic atrophy and hypoplasia, persistent lactic acidemia, and a mildly elevated plasma concentration of very-long-chain fatty acids. She died suddenly at the age of 37 days. A monoallelic missense variant was identified.

PMID: 26992161 - A monoallelic missense variant reported in a 2 year old boy with a chronic neurological disorder, characterized by postnatal microcephaly (OFC 45.5 cm (<3rd centile)), developmental delay, and pain insensitivity.

PMID: 30801875 - Five patients presenting with severe epileptic encephalopathy; microcephaly (<3rd percentile) reported in one patient. Five de novo dominant DNM1L variants were identified.
Loss-of-function and dominant negative; to: Most individuals reported with variants in DNM1L do not have microcephaly listed as a phenotype.

PMID: 17460227 - Reports a newborn girl with microcephaly (head circumference below the 0.4 percentile), abnormal brain development, optic atrophy and hypoplasia, persistent lactic acidemia, and a mildly elevated plasma concentration of very-long-chain fatty acids. She died suddenly at the age of 37 days. A monoallelic missense variant was identified.

PMID: 26992161 - A monoallelic missense variant reported in a 2 year old boy with a chronic neurological disorder, characterized by postnatal microcephaly (OFC 45.5 cm (<3rd centile)), developmental delay, and pain insensitivity.

PMID: 30801875 - Five patients presenting with severe epileptic encephalopathy; microcephaly (<3rd percentile) reported in one patient. Five de novo dominant DNM1L variants were identified.

Both loss-of-function (variants within the GTPase domain) and dominant negative (variants within the middle domain) mechanisms have been reported.
Microcephaly v0.273 DNM1L Naomi Baker reviewed gene: DNM1L: Rating: AMBER; Mode of pathogenicity: Other; Publications: PMID: 17460227, 26992161, 30801875; Phenotypes: Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.273 CIT Ain Roesley gene: CIT was added
gene: CIT was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CIT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CIT were set to 27453578; 27503289; 27453579
Phenotypes for gene: CIT were set to Microcephaly 17, primary, autosomal recessive (MIM#617090)
Penetrance for gene: CIT were set to unknown
Review for gene: CIT was set to GREEN
Added comment: PMID: 27453578
- 3 consanguineous families with 7 affecteds and head circumferences ranging from -5.6 SD to -8.4 SD

PMID: 27503289
- 2 consanguineous families with 2 affecteds and OFCs of -9 and -10 SDs

PMID: 27453579
- 3 families (2 consanguineous) with 6 affecteds
- only 3 had OFCs records:: birth and last examined ranged from -3.5 to -12 SDs

*mix of missense and PTVs
Sources: Literature
Microcephaly v0.273 CHD4 Ain Roesley reviewed gene: CHD4: Rating: AMBER; Mode of pathogenicity: None; Publications: 31388190; Phenotypes: Sifrim-Hitz-Weiss syndrome (MIM#617159); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.273 UBE3A Paul De Fazio reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Angelman syndrome MIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed); Current diagnostic: yes
Microcephaly v0.273 CHAMP1 Ain Roesley reviewed gene: CHAMP1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27148580, 26340335; Phenotypes: Mental retardation, autosomal dominant 40 (MIM#616579); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.273 UFC1 Paul De Fazio gene: UFC1 was added
gene: UFC1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UFC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFC1 were set to 29868776
Phenotypes for gene: UFC1 were set to Neurodevelopmental disorder with spasticity and poor growth (MIM#618076)
Review for gene: UFC1 was set to AMBER
gene: UFC1 was marked as current diagnostic
Added comment: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.
Sources: Literature
Microcephaly v0.273 CENPF Ain Roesley gene: CENPF was added
gene: CENPF was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CENPF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CENPF were set to 25564561; 28407396; 27300082; 31953238
Phenotypes for gene: CENPF were set to Stromme syndrome (MIM#243605)
Penetrance for gene: CENPF were set to unknown
Review for gene: CENPF was set to GREEN
Added comment: *Several Stromme syndrome patients reported with microcephaly however only the following were genetically confirmed.

PMID: 31953238
- 2 siblings from a consanguineous Saudi family
- Patient 1: head circumference -3.33 SD (44cm) at 3 years and -4.4 SD (45.5cm) at 6 years
- Patient 2: +5.07 SD (39.5cm) at birth and +8.99 SD (49cm) at 2 months
- homozygous splice variant

PMID: 28407396
- 1x proband with head circumference -6.29 SD (at birth) and -7.57 SD at 18 months
- homozygous fs variant

PMID: 25564561;
- 1x proband with OFC <0.4 centile (29.5cm) at birth and adult OFC of <0.4 centile (45.5cm)
- cHet for 2x nonsense variants

PMID: 27300082 ;
- 1x proband with OFC <3rd centile
- chet for PTVs
Sources: Literature
Microcephaly v0.273 UFM1 Paul De Fazio gene: UFM1 was added
gene: UFM1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UFM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFM1 were set to 28931644; 29868776; 31914610
Phenotypes for gene: UFM1 were set to Leukodystrophy, hypomyelinating, 14 MIM#617899
Review for gene: UFM1 was set to AMBER
gene: UFM1 was marked as current diagnostic
Added comment: Summary: Only 2 variants reported in this gene, one a founder promoter variant and one a missense variant found in 2 Sudanese families (3 hets in gnomAD). All affected individuals were reported with microcephaly but measurements only provided for two. A Drosophila model supports an association of this gene with microcephaly, but it's Drosophila.

PMID 28931644: Found a 3bp deletion in the promoter region of UFM1 in 16 Roma individuals with hypomyelination with atrophy of the basal ganglia and cerebellum who were negative for TUBB4A mutations. Functional studies showed an effect on gene expressin in neuronal cell lines but not other cell lines. All affected individuals had microcephaly but no measurements were provided.

PMID 29868776: 4 affected individuals from 2 Sudanese families reported with the same missense variant. All four were said to have microcephaly but measurments only provided for two: Proband from family 1 had a head circumference of 40cm at 2yo; proband from family 2 had head circumference of < -4SD at 13mo.

PMID 31914610: Used Drosophila embryos to show that UFM1 knockdown was associated with developmental processes that lead to microcephaly.
Sources: Literature
Microcephaly v0.273 CENPE Ain Roesley reviewed gene: CENPE: Rating: RED; Mode of pathogenicity: None; Publications: 24748105, 30086807; Phenotypes: Microcephaly 13, primary, autosomal recessive (MIM#616051); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.273 CDKL5 Ain Roesley reviewed gene: CDKL5: Rating: AMBER; Mode of pathogenicity: None; Publications: 15689447, 19396824, 22678952, 31122804, 30928302; Phenotypes: Epileptic encephalopathy, early infantile, 2 (MIM#300672); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Microcephaly v0.273 UNC80 Paul De Fazio reviewed gene: UNC80: Rating: GREEN; Mode of pathogenicity: None; Publications: 26708751, 26708753, 26545877, 29572195; Phenotypes: Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 MIM#616801; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.273 DDX11 Naomi Baker gene: DDX11 was added
gene: DDX11 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: DDX11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX11 were set to PMID: 31824187; 20137776; 23033317.
Phenotypes for gene: DDX11 were set to Warsaw breakage syndrome, MIM#613398
Penetrance for gene: DDX11 were set to Complete
Review for gene: DDX11 was set to GREEN
Added comment: The cardinal clinical features observed in Warsaw breakage syndrome (WABS) patients include severe pre- and post-natal growth retardation, microcephaly, sensorineural hearing loss, cochlear anomalies, facial dysmorphia and sister chromatid cohesion defects (PMID: 31824187).

A male patient with biallelic DDX11 variants (splice site and in-frame deletion) presented with several congenital abnormalities, including microcephaly, facial dysmorphy, high arched palate, coloboma of the right optic disc, deafness, small ventricular septal defect, bilateral clinodactyly of the fifth fingers, syndactyly of the second and third toes, cutis marmorata, and one hypo- and three hyperpigmented patches on the skin. Authors proposed to name the syndrome associated with defective DDX11 “Warsaw breakage syndrome” (WABS) (PMID: 20137776).

Three siblings carrying a biallelic DDX11 missense variant with clinical presentation of WABS: ID, growth retardation, and severe congenital abnormalities including microcephaly, facial dysmorphism, deafness due to cochlear abnormalities (in two of the sibs), and cardiac malformations (in one of the sibs) (PMID: 23033317).
Sources: Literature
Microcephaly v0.273 CDK13 Ain Roesley changed review comment from: Mild microcephaly in some patients (OMIM)

PMID: 29021403;
- 15 patients, all de novo missense
- OFC ranges from 50th to <0.4th centile. Only 4 patients have <0.4 centiles
(includes patients reported in PMID: 27479907)

PMID: 31238879;
- 7 patients with likely path variants in CDK13 (ACMG was used in classifications)
- 2 with microcephaly but measurements not provided; to: Mild microcephaly in some patients (OMIM)

PMID: 29021403;
- 15 patients, all de novo missense
- OFC ranges from 50th to <0.4th centile. Only 4 patients have <0.4 centiles and 2 with 1st centile
(includes patients reported in PMID: 27479907)

PMID: 31238879;
- 7 patients with likely path variants in CDK13 (ACMG was used in classifications)
- 2 with microcephaly but measurements not provided
Microcephaly v0.273 CDK13 Ain Roesley reviewed gene: CDK13: Rating: AMBER; Mode of pathogenicity: None; Publications: 27479907, 29021403, 31238879; Phenotypes: Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder (MIM#617360); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.273 USP18 Paul De Fazio reviewed gene: USP18: Rating: RED; Mode of pathogenicity: None; Publications: 27325888, 31940699; Phenotypes: Pseudo-TORCH syndrome 2 MIM#617397; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.273 CDC6 Ain Roesley gene: CDC6 was added
gene: CDC6 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CDC6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDC6 were set to 21358632
Phenotypes for gene: CDC6 were set to Meier-Gorlin syndrome 5 (MIM#613805)
Penetrance for gene: CDC6 were set to unknown
Review for gene: CDC6 was set to RED
Added comment: PMID: 21358632;
- 1x proband with OFC -3.3SD
- homozygous for a missense

*no new reports since
Sources: Literature
Microcephaly v0.273 CCDC88A Ain Roesley gene: CCDC88A was added
gene: CCDC88A was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CCDC88A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC88A were set to 30392057; 26917597
Phenotypes for gene: CCDC88A were set to PEHO syndrome-like (MIM#617507)
Penetrance for gene: CCDC88A were set to unknown
Review for gene: CCDC88A was set to AMBER
Added comment: PMID: 30392057
- consanguineous Saudi family with 2 affecteds. Homozygous for a nonsense variant
- microcephaly, dev delay, ID, epilepsy, dysmorphism and brain atropy
- no measurements provided

PMID: 26917597
- consanguineous family with 3 affecteds. Homozygous fs variant
- infantile hypotonia, dev delay, optic and brain atrophy, seizures and microcephaly (measurements not provided)
- functional studies on KO mice
Sources: Literature
Mendeliome v0.4113 GMNN Zornitza Stark changed review comment from: Three unrelated individuals reported.; to: Three unrelated individuals reported, all variants in exon 2 (first coding exon).
Microcephaly v0.273 GMNN Zornitza Stark Marked gene: GMNN as ready
Microcephaly v0.273 GMNN Zornitza Stark Gene: gmnn has been classified as Green List (High Evidence).
Microcephaly v0.273 GMNN Zornitza Stark Mode of inheritance for gene: GMNN was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.272 GMNN Zornitza Stark Classified gene: GMNN as Green List (high evidence)
Microcephaly v0.272 GMNN Zornitza Stark Gene: gmnn has been classified as Green List (High Evidence).
Microcephaly v0.271 GMNN Zornitza Stark edited their review of gene: GMNN: Changed phenotypes: Meier-Gorlin syndrome 6, MIM# 616835; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.271 GMNN Zornitza Stark gene: GMNN was added
gene: GMNN was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: GMNN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GMNN were set to 26637980
Phenotypes for gene: GMNN were set to Meier-Gorlin syndrome 6, MIM# 616835
Review for gene: GMNN was set to GREEN
Added comment: Three unrelated individuals reported with variants in exon 2 (first coding exon) and primordial dwarfism (including microcephaly), microtia, and absent patellae.
Sources: Expert list
Microcephaly v0.270 BUB1B Ain Roesley reviewed gene: BUB1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 18548531; Phenotypes: Mosaic variegated aneuploidy syndrome 1 (MIM#257300); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.270 KIF21B Zornitza Stark Marked gene: KIF21B as ready
Microcephaly v0.270 KIF21B Zornitza Stark Gene: kif21b has been classified as Green List (High Evidence).
Microcephaly v0.270 KIF21B Zornitza Stark Classified gene: KIF21B as Green List (high evidence)
Microcephaly v0.270 KIF21B Zornitza Stark Gene: kif21b has been classified as Green List (High Evidence).
Microcephaly v0.269 KIF21B Zornitza Stark gene: KIF21B was added
gene: KIF21B was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: KIF21B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF21B were set to 32415109
Phenotypes for gene: KIF21B were set to Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly
Mode of pathogenicity for gene: KIF21B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: KIF21B was set to GREEN
Added comment: Asselin et al (2020 - PMID: 32415109) report on 4 individuals with KIF21B pathogenic variants. DD/ID (borderline intellectual functioning to severe ID) was a feature in all. Variable other findings included brain malformations (CCA) and microcephaly. 3 missense variants and a 4-bp insertion were identified, in 3 cases as de novo events while in a single subject the variant was inherited from the father who was also affected. The authors provide evidence for a role of KIF21B in the regulation of processes involved in cortical development and deleterious effect of the missense variants impeding neuronal migration and kinesin autoinhibition. Phenotypes specific to variants (e.g. CCA or microcephaly) were recapitulated in animal models. Missense variants are thought to exert a gain-of-function effect. As commented on, the 4-bp duplication (/frameshift) variant might not be pathogenic. In blood sample from the respective individual, RT-qPCR analysis suggested that haploinsufficiency (NMD) applies. Although Kif21b haploinsufficiency in mice was shown to lead to impaired neuronal positioning, the gene might partially tolerate LoF variants as also suggested by 28 such variants in gnomAD. Homozygous Kif21b ko mice display severe morphological abnormalities, partial loss of commissural fibers, cognitive deficits and altered synaptic transmission (several refs to previous studies provided by the authors).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Marked gene: CTNND1 as ready
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Gene: ctnnd1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Classified gene: CTNND1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Gene: ctnnd1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2920 CTNND1 Zornitza Stark gene: CTNND1 was added
gene: CTNND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CTNND1 were set to 28301459; 32196547
Phenotypes for gene: CTNND1 were set to Blepharocheilodontic syndrome 2, MIM# 617681
Review for gene: CTNND1 was set to AMBER
Added comment: 4 individuals from 3 unrelated families with blepharocheilodontic syndrome and mutations in the CTNND1 gene reported originally in PMID 28301459. All had eyelid anomalies, including ectropion of the lower lids, euryblepharon, lagophthalmia, and distichiasis. In addition, all 4 showed typical facial dysmorphism with hypertelorism, flat face, and high forehead, and all had conical teeth and tooth agenesis. Three had cleft lip and palate, 3 had hair anomalies, and 1 had hypothyroidism due to hypoplasia or aplasia of the thyroid gland. None of the patients exhibited anal atresia or neural tube defects.

PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).

This more recent publication suggests a broader phenotype associated with CTNND1 variants including dev delay, ADHD/ASD, behavioural issues. Unclear from description whether significant ID present.
Sources: Literature
Mendeliome v0.4113 CTNND1 Zornitza Stark Marked gene: CTNND1 as ready
Mendeliome v0.4113 CTNND1 Zornitza Stark Gene: ctnnd1 has been classified as Green List (High Evidence).
Mendeliome v0.4113 CTNND1 Zornitza Stark Publications for gene: CTNND1 were set to
Mendeliome v0.4112 CTNND1 Zornitza Stark reviewed gene: CTNND1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28301459; Phenotypes: Blepharocheilodontic syndrome 2, MIM# 617681; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.268 DHCR7 Belinda Chong edited their review of gene: DHCR7: Changed rating: GREEN; Changed phenotypes: Smith-Lemli-Opitz syndrome 270400
Microcephaly v0.268 DHCR7 Belinda Chong gene: DHCR7 was added
gene: DHCR7 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DHCR7 were set to 9634533; 12949967; 15670717; 14981719
Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome 270400
Added comment: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/)

More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7)
Sources: Literature
Mendeliome v0.4112 CTNND1 Zornitza Stark Phenotypes for gene: CTNND1 were changed from to Blepharocheilodontic syndrome 2, MIM# 617681
Mendeliome v0.4111 CTNND1 Zornitza Stark Mode of inheritance for gene: CTNND1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Deafness_IsolatedAndComplex v0.383 DNMT1 Zornitza Stark Marked gene: DNMT1 as ready
Deafness_IsolatedAndComplex v0.383 DNMT1 Zornitza Stark Gene: dnmt1 has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v0.383 DNMT1 Zornitza Stark Phenotypes for gene: DNMT1 were changed from to Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant, 604121; Neuropathy, hereditary sensory, type IE, 614116
Deafness_IsolatedAndComplex v0.382 DNMT1 Zornitza Stark Publications for gene: DNMT1 were set to
Deafness_IsolatedAndComplex v0.381 DNMT1 Zornitza Stark Mode of inheritance for gene: DNMT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Deafness_IsolatedAndComplex v0.380 DNMT1 Zornitza Stark reviewed gene: DNMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22328086, 21532572, 31984424; Phenotypes: Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant, 604121, Neuropathy, hereditary sensory, type IE, 614116; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4110 DNMT1 Zornitza Stark Publications for gene: DNMT1 were set to 22328086; 21532572
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Marked gene: RIPOR2 as ready
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Added comment: Comment when marking as ready: Insufficient evidence for Green rating for either MOI.
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Gene: ripor2 has been classified as Amber List (Moderate Evidence).
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Mode of inheritance for gene: RIPOR2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Deafness_IsolatedAndComplex v0.379 RIPOR2 Zornitza Stark Phenotypes for gene: RIPOR2 were changed from Deafness, autosomal recessive 104, MIM# 616515 to Deafness, autosomal recessive 104, MIM# 616515; Deafness, autosomal dominant
Mendeliome v0.4109 RIPOR2 Zornitza Stark Phenotypes for gene: RIPOR2 were changed from Deafness, autosomal recessive 104, MIM# 616515 to Deafness, autosomal recessive 104, MIM# 616515; Deafness, autosomal dominant
Deafness_IsolatedAndComplex v0.378 RIPOR2 Zornitza Stark Publications for gene: RIPOR2 were set to 24958875
Deafness_IsolatedAndComplex v0.377 RIPOR2 Zornitza Stark Tag founder tag was added to gene: RIPOR2.
Deafness_IsolatedAndComplex v0.377 RIPOR2 Zornitza Stark changed review comment from: Single family and animal model data.
Sources: Expert list; to: Single family with bi-allelic variants and animal model data.
Sources: Expert list
Deafness_IsolatedAndComplex v0.377 RIPOR2 Zornitza Stark edited their review of gene: RIPOR2: Added comment: PMID: 32631815 (2020) - A heterozygous 12 nucleotide in-frame deletion (c.1696_1707del, p.Gln566_Lys569del) in RIPOR2 was detected in 12 families of Dutch origin with non-syndromic hearing loss.

In total, the variant was detected in 59/63 affected participants, but also in five unaffected subjects from three family. Age of onset was highly variable, from congenital to 70 years (mean age: 30.6 years) - unaffected family members who harboured the variant were aged 23, 40, 49, 50, and 51 years, respectively. The authors speculate that the four affected subjects without the variant represent phenocopies. The presence of an identical variant in 12 families of common origin, as well as haplotype analysis, indicates a founder effect.

Functional analysis of the variant showed aberrant localisation of mutant-RIPOR2 in early postnatal mouse hair cells, ex vivo; and failure to rescue the stereocilia defects of Ripor2 knockout mice, in contrast to the rescue effect observed in cells expressing wild-type RIPOR2.; Changed publications: 24958875, 32631815; Changed phenotypes: Deafness, autosomal recessive 104, MIM# 616515, Deafness, autosomal dominant
Mendeliome v0.4108 RIPOR2 Zornitza Stark changed review comment from: Single family and animal model data.
Sources: Expert list; to: Single family with bi-allelic variants and animal model data.
Sources: Expert list
Mendeliome v0.4108 RIPOR2 Zornitza Stark Marked gene: RIPOR2 as ready
Mendeliome v0.4108 RIPOR2 Zornitza Stark Added comment: Comment when marking as ready: Insufficient evidence for Green rating for either MOI.
Mendeliome v0.4108 RIPOR2 Zornitza Stark Gene: ripor2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4108 RIPOR2 Zornitza Stark Publications for gene: RIPOR2 were set to 24958875
Mendeliome v0.4107 RIPOR2 Zornitza Stark Mode of inheritance for gene: RIPOR2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4106 RIPOR2 Zornitza Stark Tag founder tag was added to gene: RIPOR2.
Mendeliome v0.4106 NOTCH3 Zornitza Stark Classified gene: NOTCH3 as No list
Mendeliome v0.4106 NOTCH3 Zornitza Stark Gene: notch3 has been removed from the panel.
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Marked gene: NOTCH3 as ready
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence).
Microcephaly v0.268 BRIP1 Ain Roesley gene: BRIP1 was added
gene: BRIP1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: BRIP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BRIP1 were set to Fanconi anemia, complementation group J (MIM#609054)
Penetrance for gene: BRIP1 were set to unknown
Review for gene: BRIP1 was set to GREEN
Added comment: 75% of Fanconi anemia (FA) patients present with microcephaly and BRIP1 contributes to approx 2% of FA diagnosis (gene reviews)
Sources: Literature
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Phenotypes for gene: NOTCH3 were changed from to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310
Early-onset Dementia v0.75 NOTCH3 Zornitza Stark Publications for gene: NOTCH3 were set to
Early-onset Dementia v0.74 NOTCH3 Zornitza Stark Mode of inheritance for gene: NOTCH3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.73 NOTCH3 Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Stroke v0.55 NOTCH3 Zornitza Stark Marked gene: NOTCH3 as ready
Stroke v0.55 NOTCH3 Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence).
Stroke v0.55 NOTCH3 Zornitza Stark Publications for gene: NOTCH3 were set to
Stroke v0.54 NOTCH3 Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4105 TET2 Zornitza Stark Phenotypes for gene: TET2 were changed from to Dementia; Lymphoma/myeloid malignancy
Mendeliome v0.4104 TET2 Zornitza Stark Mode of inheritance for gene: TET2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4103 TET2 Zornitza Stark Publications for gene: TET2 were set to
Early-onset Dementia v0.73 TET2 Zornitza Stark Marked gene: TET2 as ready
Early-onset Dementia v0.73 TET2 Zornitza Stark Gene: tet2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.73 TET2 Zornitza Stark gene: TET2 was added
gene: TET2 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: TET2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TET2 were set to 32330418; 31943063
Phenotypes for gene: TET2 were set to Dementia
Review for gene: TET2 was set to RED
Added comment: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution. PMID: 31943063 - Li et al 2020 - functional studies in mice show that Tet2 depletion in the hippocampus exacerbates Alzheimer disease pathology and cognitive dysfunction at early disease stages.
Sources: Literature
Mendeliome v0.4102 TET2 Zornitza Stark edited their review of gene: TET2: Changed phenotypes: Dementia, Lymphoma/myeloid malignancy; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cholestasis v0.179 ZFYVE19 Zornitza Stark Marked gene: ZFYVE19 as ready
Cholestasis v0.179 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Cholestasis v0.179 ZFYVE19 Zornitza Stark Classified gene: ZFYVE19 as Green List (high evidence)
Cholestasis v0.179 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Cholestasis v0.178 ZFYVE19 Zornitza Stark gene: ZFYVE19 was added
gene: ZFYVE19 was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: ZFYVE19 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZFYVE19 were set to 32737136
Phenotypes for gene: ZFYVE19 were set to Cholestasis
Review for gene: ZFYVE19 was set to GREEN
Added comment: PMID: 32737136 (2020) - Nine Han Chinese children from seven families with biallelic, predicted complete LoF variants in ZFYVE19. All patients had high-GGT intrahepatic cholestasis, portal hypertension, and histopathological features of the ductal plate malformation/congenital hepatic fibrosis. ZFYVE19 depletion in cultured cells from one patient yielded centriolar and axonemal abnormalities, and immunostaining for two ciliary proteins DCDC2 and ACALT showed abnormal localisation in patient cholangiocytes, indicating this as a novel ciliopathy disorder.
Sources: Literature
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Marked gene: ZFYVE19 as ready
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Classified gene: ZFYVE19 as Green List (high evidence)
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Mendeliome v0.4101 TRPM7 Zornitza Stark Phenotypes for gene: TRPM7 were changed from {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500 to {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500; Cardiac arrhythmia, stillbirth
Mendeliome v0.4100 TRPM7 Zornitza Stark Publications for gene: TRPM7 were set to
Mendeliome v0.4099 TRPM7 Zornitza Stark Mode of inheritance for gene: TRPM7 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4098 TRPM7 Zornitza Stark Classified gene: TRPM7 as Amber List (moderate evidence)
Mendeliome v0.4098 TRPM7 Zornitza Stark Gene: trpm7 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4097 TRPM7 Zornitza Stark edited their review of gene: TRPM7: Added comment: Ion channel expressed in the nervous and cardiac systems. The variant associated with ALS/dementia in the Guam population, p.Thr1482Ile is present in >23,000 hets in gnomad, which is out of keeping for a rare Mendelian disorder. Note recent publication associating missense variants with cardiac arrhythmia and stillbirth, with some functional data provided to substantiate effect of variant on protein function but not necessarily establish gene-disease association.; Changed rating: AMBER; Changed publications: 32503408, 31423533; Changed phenotypes: {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500, Cardiac arrhythmia, stillbirth; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mitochondrial disease v0.475 CHCHD10 Zornitza Stark Marked gene: CHCHD10 as ready
Mitochondrial disease v0.475 CHCHD10 Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence).
Mitochondrial disease v0.475 CHCHD10 Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911; Spinal muscular atrophy, Jokela type 615048; Myopathy, isolated mitochondrial, autosomal dominant 616209
Mitochondrial disease v0.474 CHCHD10 Zornitza Stark Publications for gene: CHCHD10 were set to
Mitochondrial disease v0.473 CHCHD10 Zornitza Stark Mode of pathogenicity for gene: CHCHD10 was changed from to Other
Mitochondrial disease v0.472 CHCHD10 Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mitochondrial disease v0.471 CHCHD10 Zornitza Stark Tag founder tag was added to gene: CHCHD10.
Mitochondrial disease v0.471 CHCHD10 Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: Other; Publications: 24934289, 25428574, 25193783, 32042922, 31690696, 30877432, 30874923, 31261376; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911, Spinal muscular atrophy, Jokela type 615048, Myopathy, isolated mitochondrial, autosomal dominant 616209; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4097 CHCHD10 Zornitza Stark Marked gene: CHCHD10 as ready
Mendeliome v0.4097 CHCHD10 Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence).
Mendeliome v0.4097 CHCHD10 Zornitza Stark Tag founder tag was added to gene: CHCHD10.
Mendeliome v0.4097 CHCHD10 Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911; Spinal muscular atrophy, Jokela type 615048; Myopathy, isolated mitochondrial, autosomal dominant 616209
Mendeliome v0.4096 CHCHD10 Zornitza Stark Publications for gene: CHCHD10 were set to
Mendeliome v0.4095 CHCHD10 Zornitza Stark Mode of pathogenicity for gene: CHCHD10 was changed from to Other
Mendeliome v0.4094 CHCHD10 Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4093 CHCHD10 Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: Other; Publications: 24934289, 25428574, 25193783, 32042922, 31690696, 30877432, 30874923; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911, Spinal muscular atrophy, Jokela type 615048, Myopathy, isolated mitochondrial, autosomal dominant 616209; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2919 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Intellectual disability syndromic and non-syndromic v0.2918 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Genetic Epilepsy v0.830 ADARB1 Zornitza Stark Marked gene: ADARB1 as ready
Genetic Epilepsy v0.830 ADARB1 Zornitza Stark Gene: adarb1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.830 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Genetic Epilepsy v0.829 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Mendeliome v0.4093 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Mendeliome v0.4092 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Microcephaly v0.268 ADARB1 Zornitza Stark Marked gene: ADARB1 as ready
Microcephaly v0.268 ADARB1 Zornitza Stark Gene: adarb1 has been classified as Green List (High Evidence).
Microcephaly v0.268 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Microcephaly v0.267 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Mendeliome v0.4091 CTNND1 Eleanor Williams changed review comment from: PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).; to: PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).
Mendeliome v0.4091 CTNND1 Eleanor Williams reviewed gene: CTNND1: Rating: ; Mode of pathogenicity: None; Publications: 32196547; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.4091 DNMT1 Eleanor Williams reviewed gene: DNMT1: Rating: ; Mode of pathogenicity: None; Publications: 31984424; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.4091 RIPOR2 Arina Puzriakova reviewed gene: RIPOR2: Rating: AMBER; Mode of pathogenicity: None; Publications: 32631815; Phenotypes: Sensorineural hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Mendeliome v0.4091 NOTCH3 Eleanor Williams gene: NOTCH3 was added
gene: NOTCH3 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: NOTCH3 were set to 31960911
Phenotypes for gene: NOTCH3 were set to CADASIL
Review for gene: NOTCH3 was set to AMBER
Added comment: PMID: 31960911 - Gravesteijn et al 2020 - describe a family with a unique cysteine-altering NOTCH3 variant in exon 9 in 5 individuals, which is predicted to cause natural exon 9 skipping. This mimics the therapeutic NOTCH3 cysteine correction approach and allows the effect of cysteine corrective exon skipping on NOTCH3 protein aggregation and disease severity in humans to be studied. In this family the CADASIL phenotype was mild.

Note this gene is rated green on the Neurodegenerative disorders - adult onset panel in the Genomics England instance of PanelApp https://panelapp.genomicsengland.co.uk/panels/474/gene/NOTCH3/
Sources: Literature
Mendeliome v0.4091 TET2 Eleanor Williams commented on gene: TET2
Mendeliome v0.4091 TRPM7 Eleanor Williams commented on gene: TRPM7: PMID: 31423533 - Cartwright et al 2020 - functional studies on four heterozygous nonsynonymous variants that were observed in TRPM7 in four individual cases of unexplained still birth which were screened for variants in 35 candidate genes in PMID: 29874177 (Munroe et al 2018). TRPM7 is a ubiquitously expressed ion channel known to regulate cardiac development and repolarization in mice. They found two variants in TRPM7, p.G179V and p.T860M, reduce ion channel current expression, which in the case of p.T860M is likely due to rapid degradation mediated by the proteasome. In addition, the p.R494Q TRPM7 variant significantly increases TRPM7 ion channel current, in a cell-type specific manner. They believe that TRPM7 may play a key role in ensuring correct cardiac development of the fetus.
Mendeliome v0.4091 ZFYVE19 Arina Puzriakova gene: ZFYVE19 was added
gene: ZFYVE19 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ZFYVE19 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZFYVE19 were set to 32737136
Phenotypes for gene: ZFYVE19 were set to Cholestasis
Review for gene: ZFYVE19 was set to GREEN
Added comment: PMID: 32737136 (2020) - Nine Han Chinese children from seven families with biallelic, predicted complete LoF variants in ZFYVE19. All patients had high-GGT intrahepatic cholestasis, portal hypertension, and histopathological features of the ductal plate malformation/congenital hepatic fibrosis.

ZFYVE19 depletion in cultured cells from one patient yielded centriolar and axonemal abnormalities, and immunostaining for two ciliary proteins DCDC2 and ACALT showed abnormal localisation in patient cholangiocytes, indicating this as a novel ciliopathy disorder.
Sources: Literature
Mendeliome v0.4091 TRPM7 Eleanor Williams reviewed gene: TRPM7: Rating: AMBER; Mode of pathogenicity: None; Publications: 31423533, 29874177; Phenotypes: still birth, cardiac development; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4091 CHCHD10 Eleanor Williams reviewed gene: CHCHD10: Rating: ; Mode of pathogenicity: None; Publications: 31261376; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.4091 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2917 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.828 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.266 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.266 HDAC8 Zornitza Stark Marked gene: HDAC8 as ready
Microcephaly v0.266 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Microcephaly v0.266 HDAC8 Zornitza Stark Classified gene: HDAC8 as Green List (high evidence)
Microcephaly v0.266 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Microcephaly v0.265 HDAC8 Zornitza Stark gene: HDAC8 was added
gene: HDAC8 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: HDAC8 were set to 24403048
Phenotypes for gene: HDAC8 were set to Cornelia de Lange syndrome 5, MIM# 300882
Review for gene: HDAC8 was set to GREEN
Added comment: Over 35 individuals reported, ~30% had microcephaly.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2917 IARS Zornitza Stark Tag new gene name tag was added to gene: IARS.
Mendeliome v0.4091 IARS Zornitza Stark Tag new gene name tag was added to gene: IARS.
Microcephaly v0.264 IARS Zornitza Stark Marked gene: IARS as ready
Microcephaly v0.264 IARS Zornitza Stark Gene: iars has been classified as Green List (High Evidence).
Microcephaly v0.264 IARS Zornitza Stark Tag new gene name tag was added to gene: IARS.
Microcephaly v0.264 IARS Zornitza Stark Classified gene: IARS as Green List (high evidence)
Microcephaly v0.264 IARS Zornitza Stark Gene: iars has been classified as Green List (High Evidence).
Microcephaly v0.263 IARS Zornitza Stark gene: IARS was added
gene: IARS was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: IARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IARS were set to 27426735; 27891590
Phenotypes for gene: IARS were set to Growth retardation, impaired intellectual development, hypotonia, and hepatopathy, MIM# 617093
Review for gene: IARS was set to GREEN
Added comment: Microcephaly -3 to -5SD is part of the phenotype of this autosomal recessive multisystem disorder characterised by poor overall growth, impaired intellectual development, hypotonia, and variable liver dysfunction. Additional features, such as seizures and hearing loss, may also be present. At least 4 families reported. Note HGNC approved name is IARS1.
Sources: Expert list
Microcephaly v0.262 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Microcephaly v0.262 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Microcephaly v0.262 IGF1 Zornitza Stark Classified gene: IGF1 as Green List (high evidence)
Microcephaly v0.262 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Microcephaly v0.261 IGF1 Zornitza Stark gene: IGF1 was added
gene: IGF1 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: IGF1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IGF1 were set to 15769976; 14684690; 8857020
Phenotypes for gene: IGF1 were set to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM# 608747
Review for gene: IGF1 was set to GREEN
Added comment: Severe growth retardation including significant microcephaly.
Sources: Expert list
Microcephaly v0.260 IGF1R Zornitza Stark Marked gene: IGF1R as ready
Microcephaly v0.260 IGF1R Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence).
Microcephaly v0.260 IGF1R Zornitza Stark Classified gene: IGF1R as Green List (high evidence)
Microcephaly v0.260 IGF1R Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence).
Microcephaly v0.259 IGF1R Zornitza Stark gene: IGF1R was added
gene: IGF1R was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: IGF1R was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: IGF1R were set to 14657428; 25040157; 23045302; 26252249; 15928254
Phenotypes for gene: IGF1R were set to Insulin-like growth factor I, resistance to, MIM# 270450
Review for gene: IGF1R was set to GREEN
Added comment: Severe IUGR including significant microcephaly, both mono-allelic and bi-allelic variants reported.
Sources: Expert list
Mendeliome v0.4091 SRD5A3 Zornitza Stark Marked gene: SRD5A3 as ready
Mendeliome v0.4091 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence).
Mendeliome v0.4091 SRD5A3 Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM#612379; Kahrizi syndrome, MIM# 612713
Mendeliome v0.4090 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Mendeliome v0.4089 SRD5A3 Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4088 SRD5A3 Zornitza Stark Deleted their comment
Mendeliome v0.4088 SRD5A3 Zornitza Stark edited their review of gene: SRD5A3: Added comment: Over 25 families reported, well established gene-disease association for CDG. Allelic disorder Kahrizi syndrome has overlapping features, may not be distinct entity.; Changed publications: 32424323; Changed phenotypes: Congenital disorder of glycosylation, type Iq, MIM#612379, Kahrizi syndrome, MIM# 612713
Congenital Disorders of Glycosylation v0.163 SRD5A3 Zornitza Stark Marked gene: SRD5A3 as ready
Congenital Disorders of Glycosylation v0.163 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v0.163 SRD5A3 Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM# 612379; Kahrizi syndrome, MIM# 612713
Congenital Disorders of Glycosylation v0.162 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Congenital Disorders of Glycosylation v0.161 SRD5A3 Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Congenital Disorders of Glycosylation v0.160 SRD5A3 Zornitza Stark reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323; Phenotypes: Congenital disorder of glycosylation, type Iq, MIM# 612379, Kahrizi syndrome, MIM# 612713; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2917 KIF14 Zornitza Stark Marked gene: KIF14 as ready
Intellectual disability syndromic and non-syndromic v0.2917 KIF14 Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2917 KIF14 Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914; Meckel syndrome 12, MIM# 616258
Intellectual disability syndromic and non-syndromic v0.2916 KIF14 Zornitza Stark Publications for gene: KIF14 were set to
Intellectual disability syndromic and non-syndromic v0.2915 KIF14 Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2914 KIF14 Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914, Meckel syndrome 12, MIM# 616258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4088 KIF14 Zornitza Stark Marked gene: KIF14 as ready
Mendeliome v0.4088 KIF14 Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence).
Mendeliome v0.4088 KIF14 Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914; Meckel syndrome 12, MIM# 616258
Mendeliome v0.4087 KIF14 Zornitza Stark Publications for gene: KIF14 were set to
Mendeliome v0.4086 KIF14 Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4085 KIF14 Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805, 24128419; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914, Meckel syndrome 12, MIM# 616258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.258 KIF14 Zornitza Stark Marked gene: KIF14 as ready
Microcephaly v0.258 KIF14 Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence).
Microcephaly v0.258 KIF14 Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914
Microcephaly v0.257 KIF14 Zornitza Stark Publications for gene: KIF14 were set to
Microcephaly v0.256 KIF14 Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.255 KIF14 Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4085 KIF1BP Zornitza Stark Marked gene: KIF1BP as ready
Mendeliome v0.4085 KIF1BP Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence).
Mendeliome v0.4085 KIF1BP Zornitza Stark Phenotypes for gene: KIF1BP were changed from to Goldberg-Shprintzen megacolon syndrome, MIM# 609460
Mendeliome v0.4084 KIF1BP Zornitza Stark Publications for gene: KIF1BP were set to
Mendeliome v0.4083 KIF1BP Zornitza Stark Mode of inheritance for gene: KIF1BP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4082 KIF1BP Zornitza Stark Tag new gene name tag was added to gene: KIF1BP.
Mendeliome v0.4082 KIF1BP Zornitza Stark reviewed gene: KIF1BP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23427148; Phenotypes: Goldberg-Shprintzen megacolon syndrome, MIM# 609460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.255 KIF1BP Zornitza Stark Marked gene: KIF1BP as ready
Microcephaly v0.255 KIF1BP Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence).
Microcephaly v0.255 KIF1BP Zornitza Stark Classified gene: KIF1BP as Green List (high evidence)
Microcephaly v0.255 KIF1BP Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence).
Microcephaly v0.254 KIF1BP Zornitza Stark Tag new gene name tag was added to gene: KIF1BP.
Microcephaly v0.254 KIF1BP Zornitza Stark gene: KIF1BP was added
gene: KIF1BP was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF1BP were set to 23427148
Phenotypes for gene: KIF1BP were set to Goldberg-Shprintzen megacolon syndrome, MIM# 609460
Review for gene: KIF1BP was set to GREEN
Added comment: Autosomal recessive multiple congenital anomaly syndrome characterised by intellectual disability, microcephaly, and dysmorphic facial features. Most individuals also have Hirschsprung disease and/or gyral abnormalities of the brain, consistent with defects in migration of neural crest cells and neurons. Other features, such as megalocornea or urogenital anomalies, may also be present. Well established gene-disease association, multiple families reported. Note HGNC approved name is KIAA1279.
Sources: Expert list
Microcephaly v0.253 KLHL7 Zornitza Stark Marked gene: KLHL7 as ready
Microcephaly v0.253 KLHL7 Zornitza Stark Gene: klhl7 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.253 KLHL7 Zornitza Stark Phenotypes for gene: KLHL7 were changed from to PERCHING syndrome, MIM# 617055
Microcephaly v0.252 KLHL7 Zornitza Stark Publications for gene: KLHL7 were set to
Microcephaly v0.251 KLHL7 Zornitza Stark Mode of inheritance for gene: KLHL7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.250 KLHL7 Zornitza Stark Classified gene: KLHL7 as Amber List (moderate evidence)
Microcephaly v0.250 KLHL7 Zornitza Stark Gene: klhl7 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.249 KLHL7 Zornitza Stark reviewed gene: KLHL7: Rating: AMBER; Mode of pathogenicity: None; Publications: 27392078, 29074562; Phenotypes: PERCHING syndrome, MIM# 617055; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Skeletal Dysplasia_Fetal v0.31 TRIP11 Zornitza Stark Marked gene: TRIP11 as ready
Skeletal Dysplasia_Fetal v0.31 TRIP11 Zornitza Stark Gene: trip11 has been classified as Green List (High Evidence).
Skeletal Dysplasia_Fetal v0.31 TRIP11 Zornitza Stark Phenotypes for gene: TRIP11 were changed from to Achondrogenesis, type IA, MIM# 200600
Skeletal Dysplasia_Fetal v0.30 TRIP11 Zornitza Stark Publications for gene: TRIP11 were set to
Skeletal Dysplasia_Fetal v0.29 TRIP11 Zornitza Stark Mode of inheritance for gene: TRIP11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Skeletal Dysplasia_Fetal v0.28 TRIP11 Zornitza Stark reviewed gene: TRIP11: Rating: GREEN; Mode of pathogenicity: None; Publications: 20089971; Phenotypes: Achondrogenesis, type IA, MIM# 200600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4082 TRIP11 Zornitza Stark Marked gene: TRIP11 as ready
Mendeliome v0.4082 TRIP11 Zornitza Stark Gene: trip11 has been classified as Green List (High Evidence).
Mendeliome v0.4082 TRIP11 Zornitza Stark Phenotypes for gene: TRIP11 were changed from to Osteochondrodysplasia, 184260; Achondrogenesis, type IA, 200600
Mendeliome v0.4081 TRIP11 Zornitza Stark Publications for gene: TRIP11 were set to
Mendeliome v0.4080 TRIP11 Zornitza Stark Mode of inheritance for gene: TRIP11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4079 PRF1 Zornitza Stark Marked gene: PRF1 as ready
Mendeliome v0.4079 PRF1 Zornitza Stark Added comment: Comment when marking as ready: Principal association is between bi-allelic variants and HLH.
Mendeliome v0.4079 PRF1 Zornitza Stark Gene: prf1 has been classified as Green List (High Evidence).
Mendeliome v0.4079 PRF1 Zornitza Stark Phenotypes for gene: PRF1 were changed from to Aplastic anemia 609135; Hemophagocytic lymphohistiocytosis, familial, 2 603553; Lymphoma, non-Hodgkin 605027
Mendeliome v0.4078 PRF1 Zornitza Stark Publications for gene: PRF1 were set to
Mendeliome v0.4077 PRF1 Zornitza Stark Mode of inheritance for gene: PRF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4076 HLCS Zornitza Stark Marked gene: HLCS as ready
Mendeliome v0.4076 HLCS Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence).
Mendeliome v0.4076 HLCS Zornitza Stark Phenotypes for gene: HLCS were changed from to Holocarboxylase synthetase deficiency, MIM# 253270
Mendeliome v0.4075 HLCS Zornitza Stark Publications for gene: HLCS were set to
Mendeliome v0.4074 HLCS Zornitza Stark Mode of inheritance for gene: HLCS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4073 HLCS Zornitza Stark reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holocarboxylase synthetase deficiency, MIM# 253270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4073 CA5A Zornitza Stark reviewed gene: CA5A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperammonemia due to carbonic anhydrase VA deficiency, 615751; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.471 CA5A Zornitza Stark Tag SV/CNV tag was added to gene: CA5A.
Mendeliome v0.4073 CA5A Zornitza Stark Marked gene: CA5A as ready
Mendeliome v0.4073 CA5A Zornitza Stark Gene: ca5a has been classified as Green List (High Evidence).
Mendeliome v0.4073 CA5A Zornitza Stark Phenotypes for gene: CA5A were changed from to Hyperammonemia due to carbonic anhydrase VA deficiency, 615751
Mendeliome v0.4072 CA5A Zornitza Stark Publications for gene: CA5A were set to
Mendeliome v0.4071 CA5A Zornitza Stark Mode of inheritance for gene: CA5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4070 CA5A Zornitza Stark Tag SV/CNV tag was added to gene: CA5A.
Intellectual disability syndromic and non-syndromic v0.2914 MOCS1 Zornitza Stark Marked gene: MOCS1 as ready
Intellectual disability syndromic and non-syndromic v0.2914 MOCS1 Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2914 MOCS1 Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150
Intellectual disability syndromic and non-syndromic v0.2913 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Intellectual disability syndromic and non-syndromic v0.2912 MOCS1 Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2911 MOCS1 Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701, 21031595; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.828 MOCS1 Zornitza Stark Marked gene: MOCS1 as ready
Genetic Epilepsy v0.828 MOCS1 Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.828 MOCS1 Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150
Genetic Epilepsy v0.827 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Genetic Epilepsy v0.826 MOCS1 Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.825 MOCS1 Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701, 21031595; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4070 MOCS1 Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150
Mendeliome v0.4069 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Mendeliome v0.4068 MOCS1 Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4068 MOCS1 Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4067 OSR1 Zornitza Stark Marked gene: OSR1 as ready
Mendeliome v0.4067 OSR1 Zornitza Stark Gene: osr1 has been classified as Red List (Low Evidence).
Mendeliome v0.4067 OSR1 Zornitza Stark Classified gene: OSR1 as Red List (low evidence)
Mendeliome v0.4067 OSR1 Zornitza Stark Gene: osr1 has been classified as Red List (Low Evidence).
Mendeliome v0.4066 OSR1 Zornitza Stark reviewed gene: OSR1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.2911 KDM1A Zornitza Stark Marked gene: KDM1A as ready
Intellectual disability syndromic and non-syndromic v0.2911 KDM1A Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2911 KDM1A Zornitza Stark Phenotypes for gene: KDM1A were changed from to Cleft palate, psychomotor retardation, and distinctive facial features 616728
Intellectual disability syndromic and non-syndromic v0.2910 KDM1A Zornitza Stark Publications for gene: KDM1A were set to
Intellectual disability syndromic and non-syndromic v0.2909 KDM1A Zornitza Stark Mode of inheritance for gene: KDM1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2908 KDM1A Zornitza Stark reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4066 KDM1A Zornitza Stark reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4066 KDM1A Zornitza Stark Marked gene: KDM1A as ready
Mendeliome v0.4066 KDM1A Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence).
Mendeliome v0.4066 KDM1A Zornitza Stark Phenotypes for gene: KDM1A were changed from to Cleft palate, psychomotor retardation, and distinctive facial features 616728; Multiple myeloma
Mendeliome v0.4065 KDM1A Zornitza Stark Mode of inheritance for gene: KDM1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4064 KDM1A Zornitza Stark Publications for gene: KDM1A were set to
Mendeliome v0.4063 TRIP11 Elena Savva reviewed gene: TRIP11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31903676, 30728324; Phenotypes: Osteochondrodysplasia, 184260, Achondrogenesis, type IA, 200600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4063 COL11A1 Zornitza Stark Marked gene: COL11A1 as ready
Mendeliome v0.4063 COL11A1 Zornitza Stark Gene: col11a1 has been classified as Green List (High Evidence).
Mendeliome v0.4063 COL11A1 Zornitza Stark Phenotypes for gene: COL11A1 were changed from to Fibrochondrogenesis 1 (MIM#228520); Marshall syndrome (MIM#154780); Stickler syndrome, type II (MIM#604841)
Mendeliome v0.4062 COL11A1 Zornitza Stark Publications for gene: COL11A1 were set to
Mendeliome v0.4061 PRF1 Elena Savva reviewed gene: PRF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19487666; Phenotypes: Aplastic anemia 609135, Hemophagocytic lymphohistiocytosis, familial, 2 603553, Lymphoma, non-Hodgkin 605027; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4061 COL11A1 Zornitza Stark Mode of pathogenicity for gene: COL11A1 was changed from to Other
Mendeliome v0.4060 COL11A1 Zornitza Stark Mode of inheritance for gene: COL11A1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.4059 HLCS Elena Savva reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10190325; Phenotypes: Holocarboxylase synthetase deficiency, 253270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4059 CA5A Elena Savva reviewed gene: CA5A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26913920, 32381389; Phenotypes: Hyperammonemia due to carbonic anhydrase VA deficiency, 615751; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4059 MOCS1 Elena Savva reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21031595; Phenotypes: Molybdenum cofactor deficiency A 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4059 KDM1A Elena Savva reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29559475, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728, Multiple myeloma; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4059 COL11A1 Elena Savva reviewed gene: COL11A1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID 25073711, 30245514, 32427345, 27081569, 21035103; Phenotypes: Fibrochondrogenesis 1 (MIM#228520), Marshall syndrome (MIM#154780), Stickler syndrome, type II (MIM#604841), {Lumbar disc herniation, susceptibility to}, (MIM#603932), ?Deafness, autosomal dominant 37, (MIM#618533); Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Ciliary Dyskinesia v0.123 GAS2L2 Zornitza Stark Classified gene: GAS2L2 as Amber List (moderate evidence)
Ciliary Dyskinesia v0.123 GAS2L2 Zornitza Stark Gene: gas2l2 has been classified as Amber List (Moderate Evidence).
Proteinuria v0.130 GON7 Zornitza Stark Tag founder tag was added to gene: GON7.
Microcephaly v0.249 GON7 Zornitza Stark Tag founder tag was added to gene: GON7.
Mendeliome v0.4059 GON7 Zornitza Stark Tag founder tag was added to gene: GON7.
Microcephaly v0.249 YRDC Zornitza Stark Marked gene: YRDC as ready
Microcephaly v0.249 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Microcephaly v0.249 YRDC Zornitza Stark Classified gene: YRDC as Green List (high evidence)
Microcephaly v0.249 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Proteinuria v0.130 YRDC Zornitza Stark Marked gene: YRDC as ready
Proteinuria v0.130 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Proteinuria v0.130 YRDC Zornitza Stark Classified gene: YRDC as Green List (high evidence)
Proteinuria v0.130 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Mendeliome v0.4059 YRDC Zornitza Stark Marked gene: YRDC as ready
Mendeliome v0.4059 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Microcephaly v0.248 YRDC Zornitza Stark gene: YRDC was added
gene: YRDC was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YRDC were set to 31481669
Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome
Review for gene: YRDC was set to GREEN
Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data.
Sources: Literature
Mendeliome v0.4059 YRDC Zornitza Stark Classified gene: YRDC as Green List (high evidence)
Mendeliome v0.4059 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Proteinuria v0.129 YRDC Zornitza Stark gene: YRDC was added
gene: YRDC was added to Proteinuria. Sources: Literature
Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YRDC were set to 31481669
Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome
Review for gene: YRDC was set to GREEN
Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data.
Sources: Literature
Mendeliome v0.4058 YRDC Zornitza Stark gene: YRDC was added
gene: YRDC was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YRDC were set to 31481669
Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome
Review for gene: YRDC was set to GREEN
Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data.
Sources: Literature
Mendeliome v0.4057 GON7 Zornitza Stark Marked gene: GON7 as ready
Mendeliome v0.4057 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Mendeliome v0.4057 GON7 Zornitza Stark Classified gene: GON7 as Green List (high evidence)
Mendeliome v0.4057 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Mendeliome v0.4056 GON7 Zornitza Stark gene: GON7 was added
gene: GON7 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON7 were set to 31481669
Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome
Review for gene: GON7 was set to GREEN
Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data.
Sources: Literature
Microcephaly v0.247 GON7 Zornitza Stark Marked gene: GON7 as ready
Microcephaly v0.247 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Microcephaly v0.247 GON7 Zornitza Stark Classified gene: GON7 as Green List (high evidence)
Microcephaly v0.247 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Microcephaly v0.246 GON7 Zornitza Stark gene: GON7 was added
gene: GON7 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON7 were set to 31481669
Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome
Review for gene: GON7 was set to GREEN
Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data.
Sources: Literature
Proteinuria v0.128 GON7 Zornitza Stark Marked gene: GON7 as ready
Proteinuria v0.128 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Proteinuria v0.128 GON7 Zornitza Stark Classified gene: GON7 as Green List (high evidence)
Proteinuria v0.128 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Proteinuria v0.127 GON7 Zornitza Stark gene: GON7 was added
gene: GON7 was added to Proteinuria. Sources: Literature
Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON7 were set to 31481669
Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome
Review for gene: GON7 was set to GREEN
Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data.
Sources: Literature
Proteinuria v0.126 LAGE3 Zornitza Stark Marked gene: LAGE3 as ready
Proteinuria v0.126 LAGE3 Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence).
Proteinuria v0.126 LAGE3 Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Proteinuria v0.125 LAGE3 Zornitza Stark Publications for gene: LAGE3 were set to
Proteinuria v0.124 LAGE3 Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Proteinuria v0.123 LAGE3 Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4055 LAGE3 Zornitza Stark Marked gene: LAGE3 as ready
Mendeliome v0.4055 LAGE3 Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence).
Mendeliome v0.4055 LAGE3 Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Mendeliome v0.4054 LAGE3 Zornitza Stark Publications for gene: LAGE3 were set to
Mendeliome v0.4053 LAGE3 Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4052 LAGE3 Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.245 LAGE3 Zornitza Stark Marked gene: LAGE3 as ready
Microcephaly v0.245 LAGE3 Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence).
Microcephaly v0.245 LAGE3 Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Microcephaly v0.244 LAGE3 Zornitza Stark Publications for gene: LAGE3 were set to
Microcephaly v0.243 LAGE3 Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.242 LAGE3 Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4052 LINGO1 Zornitza Stark Marked gene: LINGO1 as ready
Mendeliome v0.4052 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4052 LINGO1 Zornitza Stark Phenotypes for gene: LINGO1 were changed from to Mental retardation, autosomal recessive 64, MIM# 618103
Mendeliome v0.4051 LINGO1 Zornitza Stark Publications for gene: LINGO1 were set to
Mendeliome v0.4050 LINGO1 Zornitza Stark Mode of inheritance for gene: LINGO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4049 LINGO1 Zornitza Stark Classified gene: LINGO1 as Amber List (moderate evidence)
Mendeliome v0.4049 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4048 LINGO1 Zornitza Stark reviewed gene: LINGO1: Rating: AMBER; Mode of pathogenicity: None; Publications: 31668702; Phenotypes: Mental retardation, autosomal recessive 64, MIM# 618103; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.242 LINGO1 Zornitza Stark Marked gene: LINGO1 as ready
Microcephaly v0.242 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.242 LINGO1 Zornitza Stark Phenotypes for gene: LINGO1 were changed from to Mental retardation, autosomal recessive 64, MIM# 618103
Microcephaly v0.241 LINGO1 Zornitza Stark Publications for gene: LINGO1 were set to
Microcephaly v0.240 LINGO1 Zornitza Stark Mode of inheritance for gene: LINGO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.239 LINGO1 Zornitza Stark Classified gene: LINGO1 as Amber List (moderate evidence)
Microcephaly v0.239 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.238 LINGO1 Zornitza Stark edited their review of gene: LINGO1: Changed rating: AMBER
Microcephaly v0.238 LINGO1 Zornitza Stark reviewed gene: LINGO1: Rating: ; Mode of pathogenicity: None; Publications: 31668702; Phenotypes: Mental retardation, autosomal recessive 64, MIM# 618103; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.123 TRIM8 Tiong Tan Marked gene: TRIM8 as ready
Proteinuria v0.123 TRIM8 Tiong Tan Gene: trim8 has been classified as Green List (High Evidence).
Proteinuria v0.123 TRIM8 Tiong Tan Classified gene: TRIM8 as Green List (high evidence)
Proteinuria v0.123 TRIM8 Tiong Tan Gene: trim8 has been classified as Green List (High Evidence).
Proteinuria v0.122 TRIM8 Tiong Tan gene: TRIM8 was added
gene: TRIM8 was added to Proteinuria. Sources: Literature
Mode of inheritance for gene: TRIM8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRIM8 were set to 30244534; 32193649
Phenotypes for gene: TRIM8 were set to intellectual disability; epileptic encephalopathy; nephrotic syndrome; proteinuria
Penetrance for gene: TRIM8 were set to Complete
Review for gene: TRIM8 was set to GREEN
Added comment: ~50% affected individuals have proteinuria, one confirmed with FSGS
Sources: Literature
Proteinuria v0.121 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Proteinuria v0.121 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Proteinuria v0.121 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729
Proteinuria v0.120 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Proteinuria v0.119 OSGEP Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.118 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.238 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Microcephaly v0.238 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Mendeliome v0.4048 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Mendeliome v0.4048 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Mendeliome v0.4048 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729
Mendeliome v0.4047 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Mendeliome v0.4046 OSGEP Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4045 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.238 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729
Microcephaly v0.237 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Microcephaly v0.236 OSGEP Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.235 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4045 NUP107 Zornitza Stark Tag founder tag was added to gene: NUP107.
Proteinuria v0.118 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Proteinuria v0.118 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Proteinuria v0.118 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348
Proteinuria v0.117 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Proteinuria v0.116 NUP107 Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.115 NUP107 Zornitza Stark Tag founder tag was added to gene: NUP107.
Proteinuria v0.115 NUP107 Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4045 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Mendeliome v0.4045 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Mendeliome v0.4045 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348
Mendeliome v0.4044 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Mendeliome v0.4043 NUP107 Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4042 NUP107 Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.235 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Microcephaly v0.235 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Microcephaly v0.235 NUP107 Zornitza Stark Tag founder tag was added to gene: NUP107.
Microcephaly v0.235 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348
Microcephaly v0.234 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Microcephaly v0.233 NUP107 Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.232 NUP107 Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.232 VRK1 Zornitza Stark Marked gene: VRK1 as ready
Microcephaly v0.232 VRK1 Zornitza Stark Gene: vrk1 has been classified as Green List (High Evidence).
Microcephaly v0.232 VRK1 Zornitza Stark Phenotypes for gene: VRK1 were changed from to Pontocerebellar hypoplasia type 1A MIM#607596
Microcephaly v0.231 VRK1 Zornitza Stark Publications for gene: VRK1 were set to
Microcephaly v0.230 VRK1 Zornitza Stark Mode of inheritance for gene: VRK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.229 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Microcephaly v0.229 BRD4 Zornitza Stark Gene: brd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.229 BRD4 Zornitza Stark Tag SV/CNV tag was added to gene: BRD4.
Microcephaly v0.229 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange-like syndrome
Microcephaly v0.228 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Microcephaly v0.227 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.226 BRD4 Zornitza Stark Classified gene: BRD4 as Amber List (moderate evidence)
Microcephaly v0.226 BRD4 Zornitza Stark Gene: brd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.225 WDR4 Zornitza Stark Marked gene: WDR4 as ready
Microcephaly v0.225 WDR4 Zornitza Stark Gene: wdr4 has been classified as Green List (High Evidence).
Microcephaly v0.225 WDR4 Zornitza Stark Phenotypes for gene: WDR4 were changed from to Galloway-Mowat syndrome 6 MIM#618347
Microcephaly v0.224 WDR4 Zornitza Stark Publications for gene: WDR4 were set to
Microcephaly v0.223 WDR4 Zornitza Stark Mode of inheritance for gene: WDR4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2908 NSD2 Zornitza Stark Marked gene: NSD2 as ready
Intellectual disability syndromic and non-syndromic v0.2908 NSD2 Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2908 NSD2 Zornitza Stark Publications for gene: NSD2 were set to
Intellectual disability syndromic and non-syndromic v0.2907 NSD2 Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability
Microcephaly v0.222 NSD2 Zornitza Stark Marked gene: NSD2 as ready
Microcephaly v0.222 NSD2 Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2906 NSD2 Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2905 NSD2 Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4042 NSD2 Zornitza Stark Marked gene: NSD2 as ready
Mendeliome v0.4042 NSD2 Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence).
Mendeliome v0.4042 NSD2 Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability
Mendeliome v0.4041 NSD2 Zornitza Stark Publications for gene: NSD2 were set to
Mendeliome v0.4040 NSD2 Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4039 NSD2 Zornitza Stark changed review comment from: Microcephaly reported in 6 of 7 individuals with LOF variants in this gene.; to: 7 individuals with LOF variants in this gene, gene thought to be responsible for key features of Wolf-Hirschorn syndrome.
Mendeliome v0.4039 NSD2 Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.222 NSD2 Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability
Microcephaly v0.221 NSD2 Zornitza Stark Publications for gene: NSD2 were set to
Microcephaly v0.220 NSD2 Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.219 NSD2 Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.219 NIPBL Zornitza Stark Marked gene: NIPBL as ready
Microcephaly v0.219 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Microcephaly v0.219 NIPBL Zornitza Stark Classified gene: NIPBL as Green List (high evidence)
Microcephaly v0.219 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Microcephaly v0.218 VRK1 Paul De Fazio reviewed gene: VRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19646678, 24126608, 27281532, 31560180; Phenotypes: Pontocerebellar hypoplasia type 1A MIM#607596; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.218 NIPBL Zornitza Stark gene: NIPBL was added
gene: NIPBL was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome 1, MIM# 122470
Review for gene: NIPBL was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a prominent feature of the phenotype.
Sources: Expert list
Mendeliome v0.4039 NCAPH Zornitza Stark Marked gene: NCAPH as ready
Mendeliome v0.4039 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Mendeliome v0.4039 NCAPH Zornitza Stark Phenotypes for gene: NCAPH were changed from to Microcephaly 23, primary, autosomal recessive 617985
Mendeliome v0.4038 NCAPH Zornitza Stark Publications for gene: NCAPH were set to
Mendeliome v0.4037 NCAPH Zornitza Stark Mode of inheritance for gene: NCAPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4036 NCAPH Zornitza Stark Classified gene: NCAPH as Red List (low evidence)
Mendeliome v0.4036 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Mendeliome v0.4035 NCAPH Zornitza Stark reviewed gene: NCAPH: Rating: RED; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 23, primary, autosomal recessive 617985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.217 NCAPH Zornitza Stark Marked gene: NCAPH as ready
Microcephaly v0.217 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Microcephaly v0.217 NCAPH Zornitza Stark Phenotypes for gene: NCAPH were changed from to Microcephaly 23, primary, autosomal recessive 617985
Microcephaly v0.216 NCAPH Zornitza Stark Publications for gene: NCAPH were set to
Microcephaly v0.215 NCAPH Zornitza Stark Mode of inheritance for gene: NCAPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.214 NCAPH Zornitza Stark Classified gene: NCAPH as Red List (low evidence)
Microcephaly v0.214 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Microcephaly v0.213 NCAPH Zornitza Stark reviewed gene: NCAPH: Rating: RED; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 23, primary, autosomal recessive 617985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.213 BRD4 Ain Roesley reviewed gene: BRD4: Rating: AMBER; Mode of pathogenicity: None; Publications: 29379197, 30302754; Phenotypes: Cornelia de Lange-like syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.213 WDR4 Paul De Fazio reviewed gene: WDR4: Rating: GREEN; Mode of pathogenicity: None; Publications: 26416026, 28617965, 30079490, 29597095; Phenotypes: Galloway-Mowat syndrome 6 MIM#618347; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.213 NCAPD3 Zornitza Stark Marked gene: NCAPD3 as ready
Microcephaly v0.213 NCAPD3 Zornitza Stark Gene: ncapd3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.213 NCAPD3 Zornitza Stark Phenotypes for gene: NCAPD3 were changed from to Microcephaly 22, primary, autosomal recessive, MIM# 617984
Microcephaly v0.212 NCAPD3 Zornitza Stark Publications for gene: NCAPD3 were set to 27737959
Microcephaly v0.211 BRCA2 Zornitza Stark Marked gene: BRCA2 as ready
Microcephaly v0.211 BRCA2 Zornitza Stark Gene: brca2 has been classified as Green List (High Evidence).
Microcephaly v0.211 BRCA2 Zornitza Stark Classified gene: BRCA2 as Green List (high evidence)
Microcephaly v0.211 BRCA2 Zornitza Stark Gene: brca2 has been classified as Green List (High Evidence).
Microcephaly v0.210 BRCA2 Ain Roesley gene: BRCA2 was added
gene: BRCA2 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: BRCA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BRCA2 were set to Fanconi anemia, complementation group D1 (MIM#605724)
Penetrance for gene: BRCA2 were set to unknown
Review for gene: BRCA2 was set to GREEN
Added comment: Approx 75% of FA patients present with microcephaly and approx 3% of FA patients have variants in BRCA2 (GeneReviews)
Sources: Literature
Mendeliome v0.4035 ATRIP Zornitza Stark Marked gene: ATRIP as ready
Mendeliome v0.4035 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Mendeliome v0.4035 ATRIP Zornitza Stark Classified gene: ATRIP as Red List (low evidence)
Mendeliome v0.4035 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Microcephaly v0.210 WDR73 Zornitza Stark Marked gene: WDR73 as ready
Microcephaly v0.210 WDR73 Zornitza Stark Gene: wdr73 has been classified as Green List (High Evidence).
Microcephaly v0.210 WDR73 Zornitza Stark Classified gene: WDR73 as Green List (high evidence)
Microcephaly v0.210 WDR73 Zornitza Stark Gene: wdr73 has been classified as Green List (High Evidence).
Microcephaly v0.209 BLM Zornitza Stark Marked gene: BLM as ready
Microcephaly v0.209 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Microcephaly v0.209 BLM Zornitza Stark Publications for gene: BLM were set to 30214071
Microcephaly v0.208 BLM Zornitza Stark Classified gene: BLM as Green List (high evidence)
Microcephaly v0.208 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Microcephaly v0.207 WDR37 Zornitza Stark Marked gene: WDR37 as ready
Microcephaly v0.207 WDR37 Zornitza Stark Gene: wdr37 has been classified as Green List (High Evidence).
Microcephaly v0.207 WDR37 Zornitza Stark Phenotypes for gene: WDR37 were changed from to Neurooculocardiogenitourinary syndrome MIM#618652
Microcephaly v0.206 WDR37 Zornitza Stark Publications for gene: WDR37 were set to
Microcephaly v0.205 WDR37 Zornitza Stark Mode of inheritance for gene: WDR37 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.204 ZNF335 Zornitza Stark Marked gene: ZNF335 as ready
Microcephaly v0.204 ZNF335 Zornitza Stark Gene: znf335 has been classified as Green List (High Evidence).
Microcephaly v0.204 ZNF335 Zornitza Stark Phenotypes for gene: ZNF335 were changed from to Microcephaly 10, primary, autosomal recessive (MIM#615095)
Microcephaly v0.204 WDR37 Paul De Fazio reviewed gene: WDR37: Rating: GREEN; Mode of pathogenicity: None; Publications: 31327508, 31327510; Phenotypes: Neurooculocardiogenitourinary syndrome MIM#618652; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Microcephaly v0.204 ZNF335 Zornitza Stark Publications for gene: ZNF335 were set to 23178126; 27540107; 29652087
Microcephaly v0.203 BLM Ain Roesley edited their review of gene: BLM: Added comment: Microcephaly is a feature of Bloom Syndrome

PMID: 30214071;
- in a cohort of microcephalic patients (<=-2SD), 1 family with 2 affecteds are homozygous for a nonsense variant

PMID: 29056561
- 1x proband. At 36 yrs of age her head circumference was 47.8cm (-6.2SD)

PMID: 23928670;
- 1x patient of a consanguineous Dutch family. At 4 years of age: head circumference 45.9 cm (3.2 SDS). Homozygous nonsense
- 1x patient of a consanguineous Turkish family. At 5 years of age: head circumference 46.3 cm (2.7 SDS). Homozygous nonsense

PMID: 25129257;
- 1 family with 3 affecteds. 1 had a head circumference of -4SD. Homozygous fs; Changed rating: GREEN; Changed publications: 30214071, 29056561, 23928670; Changed phenotypes: Bloom syndrome (MIM#210900)
Microcephaly v0.203 ZNF335 Zornitza Stark Publications for gene: ZNF335 were set to
Microcephaly v0.203 NCAPD3 Zornitza Stark Publications for gene: NCAPD3 were set to
Microcephaly v0.202 ZNF335 Zornitza Stark Mode of inheritance for gene: ZNF335 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.201 NCAPD3 Zornitza Stark Mode of inheritance for gene: NCAPD3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.200 NCAPD3 Zornitza Stark Classified gene: NCAPD3 as Amber List (moderate evidence)
Microcephaly v0.200 NCAPD3 Zornitza Stark Gene: ncapd3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.199 NCAPD3 Zornitza Stark reviewed gene: NCAPD3: Rating: AMBER; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 22, primary, autosomal recessive, MIM# 617984; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.199 NACC1 Zornitza Stark Marked gene: NACC1 as ready
Microcephaly v0.199 NACC1 Zornitza Stark Gene: nacc1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.199 NACC1 Zornitza Stark Phenotypes for gene: NACC1 were changed from to Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination , MIM#617393
Microcephaly v0.198 NACC1 Zornitza Stark Publications for gene: NACC1 were set to
Microcephaly v0.197 NACC1 Zornitza Stark Mode of inheritance for gene: NACC1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.196 NACC1 Zornitza Stark Classified gene: NACC1 as Amber List (moderate evidence)
Microcephaly v0.196 NACC1 Zornitza Stark Gene: nacc1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.195 NACC1 Zornitza Stark reviewed gene: NACC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 28132692; Phenotypes: Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination , MIM#617393; Mode of inheritance: None
Microcephaly v0.195 MYCN Zornitza Stark edited their review of gene: MYCN: Changed rating: GREEN; Changed phenotypes: Feingold syndrome 1, MIM# 164280
Microcephaly v0.195 MYCN Zornitza Stark Marked gene: MYCN as ready
Microcephaly v0.195 MYCN Zornitza Stark Gene: mycn has been classified as Green List (High Evidence).
Microcephaly v0.195 MYCN Zornitza Stark Classified gene: MYCN as Green List (high evidence)
Microcephaly v0.195 MYCN Zornitza Stark Gene: mycn has been classified as Green List (High Evidence).
Microcephaly v0.194 MYCN Zornitza Stark gene: MYCN was added
gene: MYCN was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYCN were set to 18470948
Phenotypes for gene: MYCN were set to Feingold syndrome 1, MIM# 164280
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert list
Microcephaly v0.193 MRE11 Zornitza Stark Marked gene: MRE11 as ready
Microcephaly v0.193 MRE11 Zornitza Stark Gene: mre11 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.193 MRE11 Zornitza Stark Phenotypes for gene: MRE11 were changed from to Nijmegen breakage syndrome-like severe microcephaly
Microcephaly v0.192 MRE11 Zornitza Stark Publications for gene: MRE11 were set to
Microcephaly v0.191 ZNF335 Paul De Fazio reviewed gene: ZNF335: Rating: GREEN; Mode of pathogenicity: None; Publications: 23178126, 27540107, 29652087; Phenotypes: Microcephaly 10, primary, autosomal recessive (MIM#615095); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.191 MRE11 Zornitza Stark Mode of inheritance for gene: MRE11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.190 MRE11 Zornitza Stark Classified gene: MRE11 as Amber List (moderate evidence)
Microcephaly v0.190 MRE11 Zornitza Stark Gene: mre11 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.189 MRE11 Zornitza Stark reviewed gene: MRE11: Rating: AMBER; Mode of pathogenicity: None; Publications: 21227757; Phenotypes: Nijmegen breakage syndrome-like severe microcephaly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.189 BLM Ain Roesley Deleted their comment
Microcephaly v0.189 MED17 Zornitza Stark Marked gene: MED17 as ready
Microcephaly v0.189 MED17 Zornitza Stark Gene: med17 has been classified as Green List (High Evidence).
Microcephaly v0.189 MED17 Zornitza Stark Phenotypes for gene: MED17 were changed from to Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM# 613668
Microcephaly v0.188 WDR73 Paul De Fazio gene: WDR73 was added
gene: WDR73 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: WDR73 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR73 were set to 25466283; 26123727; 25873735; 26070982; 30315938
Phenotypes for gene: WDR73 were set to Galloway-Mowat syndrome 1 MIM#251300
Review for gene: WDR73 was set to GREEN
gene: WDR73 was marked as current diagnostic
Added comment: Summary: many individuals with progressive microcephaly reported, though only a few (4
families) with head circumference -3SD.

PMID 25466283: Three affected children from two families with LoF variants. All had progressive microcephaly among other phenotypes (e.g. facial dysmorphisms, brain MRI anomalies). Head circumferences were -3SD at 5yo, -2.5SD at 2yo, -3SD at 10yo.

PMID 26123727: 9 individuals from 4 families with "Microcephaly (< 3rd centile)" and biallelic variants, ranging in age from 2.5yo to 31yo.

PMID 26070982: describes 30 Amish individuals with the same homozygous LoF variant, 80% of whom (24 individuals) had head circumference <-2SD.

PMID 25873735: 2 sibs with biallelic LoF variants and head circumference -1.8SD at 12yo and −1.15SD at 5yo respectively.

PMID 30315938: 2 families with homozygous missense variants. All had postnatal microcephaly: -2.5SD, -4,5SD, -3,8SD from 1 family and -3 SD from the other.
Sources: Literature
Microcephaly v0.188 MED17 Zornitza Stark Publications for gene: MED17 were set to
Microcephaly v0.187 MED17 Zornitza Stark Mode of inheritance for gene: MED17 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.186 MED17 Zornitza Stark reviewed gene: MED17: Rating: GREEN; Mode of pathogenicity: None; Publications: 20950787, 30345598, 26004231; Phenotypes: Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM# 613668; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.186 MECP2 Zornitza Stark Marked gene: MECP2 as ready
Microcephaly v0.186 MECP2 Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence).
Microcephaly v0.186 MECP2 Zornitza Stark Phenotypes for gene: MECP2 were changed from to Rett syndrome, MIM# 312750; Encephalopathy, neonatal severe 300673
Microcephaly v0.185 MECP2 Zornitza Stark Mode of inheritance for gene: MECP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Microcephaly v0.184 MECP2 Zornitza Stark reviewed gene: MECP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rett syndrome, MIM# 312750, Encephalopathy, neonatal severe 300673; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.4034 ATRIP Ain Roesley gene: ATRIP was added
gene: ATRIP was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ATRIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATRIP were set to 23144622
Phenotypes for gene: ATRIP were set to Seckel Syndrome
Penetrance for gene: ATRIP were set to unknown
Review for gene: ATRIP was set to RED
Added comment: PMID: 23144622;
- 1x proband from a consanguineous family
- progressive severe microcephaly (-9 to -10SD)
- cHet for a nonsense and a splice
Sources: Literature
Microcephaly v0.184 ATRIP Zornitza Stark Marked gene: ATRIP as ready
Microcephaly v0.184 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Microcephaly v0.184 ATRIP Zornitza Stark Classified gene: ATRIP as Red List (low evidence)
Microcephaly v0.184 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Microcephaly v0.183 ATP1A2 Zornitza Stark Marked gene: ATP1A2 as ready
Microcephaly v0.183 ATP1A2 Zornitza Stark Gene: atp1a2 has been classified as Green List (High Evidence).
Microcephaly v0.183 ATP1A2 Zornitza Stark Phenotypes for gene: ATP1A2 were changed from to hydrops fetalis, microcephaly, arthrogryposis and extensive cortical malformations
Microcephaly v0.182 ATP1A2 Zornitza Stark Publications for gene: ATP1A2 were set to
Microcephaly v0.181 ATP1A2 Zornitza Stark Mode of inheritance for gene: ATP1A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.180 ARCN1 Zornitza Stark Marked gene: ARCN1 as ready
Microcephaly v0.180 ARCN1 Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green. Microcephaly is a key part of the phenotype but few measurements actually reported.
Microcephaly v0.180 ARCN1 Zornitza Stark Gene: arcn1 has been classified as Green List (High Evidence).
Microcephaly v0.180 ARCN1 Zornitza Stark Phenotypes for gene: ARCN1 were changed from to Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164)
Microcephaly v0.179 ARCN1 Zornitza Stark Publications for gene: ARCN1 were set to
Microcephaly v0.178 ARCN1 Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.177 AP4S1 Zornitza Stark Marked gene: AP4S1 as ready
Microcephaly v0.177 AP4S1 Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green as only one affected individual <-3SD; however, part of same gene family as other spastic paraplegias with microcephaly.
Microcephaly v0.177 AP4S1 Zornitza Stark Gene: ap4s1 has been classified as Green List (High Evidence).
Microcephaly v0.177 AP4S1 Zornitza Stark Phenotypes for gene: AP4S1 were changed from to Spastic paraplegia 52, autosomal recessive (MIM#614067)
Microcephaly v0.176 AP4S1 Zornitza Stark Publications for gene: AP4S1 were set to
Microcephaly v0.175 AP4S1 Zornitza Stark Mode of inheritance for gene: AP4S1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.174 AP4M1 Zornitza Stark Marked gene: AP4M1 as ready
Microcephaly v0.174 AP4M1 Zornitza Stark Gene: ap4m1 has been classified as Green List (High Evidence).
Microcephaly v0.174 AP4M1 Zornitza Stark Phenotypes for gene: AP4M1 were changed from to Spastic paraplegia 50, autosomal recessive (MIM#612936)
Microcephaly v0.173 AP4M1 Zornitza Stark Publications for gene: AP4M1 were set to
Microcephaly v0.172 AP4M1 Zornitza Stark Mode of inheritance for gene: AP4M1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 BLM Ain Roesley gene: BLM was added
gene: BLM was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: BLM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BLM were set to 30214071
Phenotypes for gene: BLM were set to Bloom syndrome (MIM#210900)
Penetrance for gene: BLM were set to unknown
Review for gene: BLM was set to RED
Added comment: Microcephaly is a feature of Bloom Syndrome, however there is limited evidence for the association of microcephaly with BLM gene specifically.

PMID: 30214071;
in a cohort of microcephalic patients (<=-2SD), 1 family with 2 affecteds are homozygous for a nonsense variant
Sources: Literature
Microcephaly v0.171 ATRIP Ain Roesley gene: ATRIP was added
gene: ATRIP was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ATRIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATRIP were set to 23144622
Phenotypes for gene: ATRIP were set to Seckel Syndrome
Penetrance for gene: ATRIP were set to unknown
Review for gene: ATRIP was set to RED
Added comment: PMID: 23144622;
- 1x proband from a consanguineous family
- progressive severe microcephaly (-9 to -10SD)
- cHet for a nonsense and a splice
Sources: Literature
Microcephaly v0.171 ATP1A2 Ain Roesley reviewed gene: ATP1A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30690204, 31608932; Phenotypes: hydrops fetalis, microcephaly, arthrogryposis and extensive cortical malformations; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 ARCN1 Ain Roesley reviewed gene: ARCN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27476655; Phenotypes: Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.171 AP4S1 Ain Roesley reviewed gene: AP4S1: Rating: AMBER; Mode of pathogenicity: None; Publications: 21620353, 25552650, 27444738; Phenotypes: Spastic paraplegia 52, autosomal recessive (MIM#614067); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 AP4M1 Ain Roesley edited their review of gene: AP4M1: Changed publications: 28464862, 24700674
Microcephaly v0.171 AP4M1 Ain Roesley changed review comment from: PMID: 28464862;
- 1x with severe progressive microcephaly (< - 4 SD)
- homozygous nonsense

PMID: 24700674;
- 2x unrelated patients (1 and 3) < -3 SD head circumference
- 2x homozygous nonsense

PMID: 21620353 ;
- 3 families with 4 affecteds ( < -3 SD)
- all PTVs; to: PMID: 28464862;
- 1x with severe progressive microcephaly (< - 4 SD)
- homozygous nonsense

PMID: 24700674;
- 2x unrelated patients (1 and 3) < -3 SD head circumference
- 2x homozygous nonsense
Microcephaly v0.171 AP4M1 Ain Roesley reviewed gene: AP4M1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28464862, 24700674, 21620353; Phenotypes: Spastic paraplegia 50, autosomal recessive (MIM#612936); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 AKT3 Zornitza Stark changed review comment from: Activating variants in AKT2 and micro duplications are associated with macrocephaly/megalencephaly. Note that deletions involving AKT3 have consistently been associated with microcephaly. However, most involve at least one other gene apart from AKT3. One family reported with only AKT3 deleted: deletion was inherited from a phenotypically normal parent, suggesting either additional effects in bigger deletions or incomplete penetrance.; to: Activating variants in AKT3 and micro duplications are associated with macrocephaly/megalencephaly. Note that deletions involving AKT3 have consistently been associated with microcephaly. However, most involve at least one other gene apart from AKT3. One family reported with only AKT3 deleted: deletion was inherited from a phenotypically normal parent, suggesting either additional effects in bigger deletions or incomplete penetrance.
Microcephaly v0.171 AKT3 Zornitza Stark Marked gene: AKT3 as ready
Microcephaly v0.171 AKT3 Zornitza Stark Gene: akt3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.171 AKT3 Zornitza Stark Phenotypes for gene: AKT3 were changed from to Microcephaly
Microcephaly v0.170 AKT3 Zornitza Stark Publications for gene: AKT3 were set to
Microcephaly v0.169 AKT3 Zornitza Stark Mode of inheritance for gene: AKT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.168 AKT3 Zornitza Stark Classified gene: AKT3 as Amber List (moderate evidence)
Microcephaly v0.168 AKT3 Zornitza Stark Gene: akt3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.167 AKT3 Zornitza Stark Tag SV/CNV tag was added to gene: AKT3.
Microcephaly v0.167 AKT3 Zornitza Stark reviewed gene: AKT3: Rating: AMBER; Mode of pathogenicity: None; Publications: 32827175, 31929334, 30853971, 30053339, 25424989; Phenotypes: Microcephaly; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2905 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Intellectual disability syndromic and non-syndromic v0.2905 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2905 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Intellectual disability syndromic and non-syndromic v0.2904 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Intellectual disability syndromic and non-syndromic v0.2903 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2902 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.24 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Cerebral Palsy v0.24 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.24 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Cerebral Palsy v0.23 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Cerebral Palsy v0.22 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.21 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4034 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Mendeliome v0.4034 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Mendeliome v0.4034 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Mendeliome v0.4033 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Mendeliome v0.4032 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4031 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.167 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Microcephaly v0.167 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Microcephaly v0.167 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Microcephaly v0.166 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Microcephaly v0.165 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.164 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.21 AP4B1 Zornitza Stark Marked gene: AP4B1 as ready
Cerebral Palsy v0.21 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.21 AP4B1 Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066
Cerebral Palsy v0.20 AP4B1 Zornitza Stark Publications for gene: AP4B1 were set to
Cerebral Palsy v0.19 AP4B1 Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.18 AP4B1 Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4031 AP4B1 Zornitza Stark Marked gene: AP4B1 as ready
Mendeliome v0.4031 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Mendeliome v0.4031 AP4B1 Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066
Mendeliome v0.4030 AP4B1 Zornitza Stark Publications for gene: AP4B1 were set to
Mendeliome v0.4029 AP4B1 Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 AP4B1 Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.164 AP4B1 Zornitza Stark Marked gene: AP4B1 as ready
Microcephaly v0.164 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Microcephaly v0.164 AP4B1 Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066
Microcephaly v0.163 AP4B1 Zornitza Stark Publications for gene: AP4B1 were set to
Microcephaly v0.162 AP4B1 Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.161 AP4B1 Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 ANKLE2 Zornitza Stark reviewed gene: ANKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25259927, 30214071, 31735666; Phenotypes: Microcephaly 16, primary, autosomal recessive, MIM# 616681; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.161 ANKLE2 Zornitza Stark Marked gene: ANKLE2 as ready
Microcephaly v0.161 ANKLE2 Zornitza Stark Gene: ankle2 has been classified as Green List (High Evidence).
Microcephaly v0.161 ANKLE2 Zornitza Stark Phenotypes for gene: ANKLE2 were changed from to Microcephaly 16, primary, autosomal recessive, MIM# 616681
Microcephaly v0.160 ANKLE2 Zornitza Stark Publications for gene: ANKLE2 were set to
Microcephaly v0.159 ANKLE2 Zornitza Stark Mode of inheritance for gene: ANKLE2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.158 ANKLE2 Zornitza Stark reviewed gene: ANKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25259927, 30214071, 31735666; Phenotypes: Microcephaly 16, primary, autosomal recessive, MIM# 616681; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 TSEN2 Zornitza Stark Marked gene: TSEN2 as ready
Mendeliome v0.4028 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Green List (High Evidence).
Cerebellar and Pontocerebellar Hypoplasia v0.148 TSEN2 Zornitza Stark Marked gene: TSEN2 as ready
Cerebellar and Pontocerebellar Hypoplasia v0.148 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Green List (High Evidence).
Cerebellar and Pontocerebellar Hypoplasia v0.148 TSEN2 Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B, MIM# 612389
Cerebellar and Pontocerebellar Hypoplasia v0.147 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to
Cerebellar and Pontocerebellar Hypoplasia v0.146 TSEN2 Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebellar and Pontocerebellar Hypoplasia v0.145 TSEN2 Zornitza Stark reviewed gene: TSEN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23562994, 20952379; Phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 TSEN2 Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B, MIM# 612389
Mendeliome v0.4027 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to
Mendeliome v0.4026 TSEN2 Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4025 TSEN2 Zornitza Stark edited their review of gene: TSEN2: Added comment: At least 3 unrelated families reported.; Changed rating: GREEN; Changed publications: 23562994, 20952379; Changed phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389
Mendeliome v0.4025 TSEN2 Zornitza Stark Deleted their comment
Frontonasal dysplasia v0.4 ZSWIM6 Zornitza Stark Marked gene: ZSWIM6 as ready
Frontonasal dysplasia v0.4 ZSWIM6 Zornitza Stark Gene: zswim6 has been classified as Green List (High Evidence).
Frontonasal dysplasia v0.4 ZSWIM6 Zornitza Stark Phenotypes for gene: ZSWIM6 were changed from to Acromelic frontonasal dysostosis, MIM# 603671
Frontonasal dysplasia v0.3 ZSWIM6 Zornitza Stark Publications for gene: ZSWIM6 were set to
Frontonasal dysplasia v0.2 ZSWIM6 Zornitza Stark Mode of inheritance for gene: ZSWIM6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Frontonasal dysplasia v0.1 ZSWIM6 Zornitza Stark reviewed gene: ZSWIM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25105228, 26706854; Phenotypes: Acromelic frontonasal dysostosis, MIM# 603671; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4025 ZSWIM6 Zornitza Stark Marked gene: ZSWIM6 as ready
Mendeliome v0.4025 ZSWIM6 Zornitza Stark Gene: zswim6 has been classified as Green List (High Evidence).
Mendeliome v0.4025 ZSWIM6 Zornitza Stark Phenotypes for gene: ZSWIM6 were changed from to Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM# 617865; Acromelic frontonasal dysostosis, MIM# 603671
Mendeliome v0.4024 ZSWIM6 Zornitza Stark Publications for gene: ZSWIM6 were set to
Mendeliome v0.4023 ZSWIM6 Zornitza Stark Mode of inheritance for gene: ZSWIM6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4022 ZSWIM6 Zornitza Stark reviewed gene: ZSWIM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 29198722, 25105228, 26706854; Phenotypes: Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM# 617865, Acromelic frontonasal dysostosis, MIM# 603671; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cholestasis v0.177 ABCB11 Zornitza Stark Publications for gene: ABCB11 were set to 23141890
Cholestasis v0.176 ABCB11 Zornitza Stark reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4022 ABCB11 Zornitza Stark Marked gene: ABCB11 as ready
Mendeliome v0.4022 ABCB11 Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence).
Mendeliome v0.4022 ABCB11 Zornitza Stark Phenotypes for gene: ABCB11 were changed from to Cholestasis, progressive familial intrahepatic 2, MIM# 601847; Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479
Mendeliome v0.4021 ABCB11 Zornitza Stark Publications for gene: ABCB11 were set to
Mendeliome v0.4020 ABCB11 Zornitza Stark Mode of inheritance for gene: ABCB11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4019 ABCB11 Zornitza Stark reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4019 ABCB1 Zornitza Stark Marked gene: ABCB1 as ready
Mendeliome v0.4019 ABCB1 Zornitza Stark Gene: abcb1 has been classified as Red List (Low Evidence).
Mendeliome v0.4019 ABCB1 Zornitza Stark Phenotypes for gene: ABCB1 were changed from to {Inflammatory bowel disease 13} 612244
Mendeliome v0.4018 ABCB1 Zornitza Stark Publications for gene: ABCB1 were set to
Mendeliome v0.4017 ABCB1 Zornitza Stark Mode of inheritance for gene: ABCB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4016 ABCB1 Zornitza Stark Classified gene: ABCB1 as Red List (low evidence)
Mendeliome v0.4016 ABCB1 Zornitza Stark Gene: abcb1 has been classified as Red List (Low Evidence).
Mendeliome v0.4015 ABCB1 Zornitza Stark reviewed gene: ABCB1: Rating: RED; Mode of pathogenicity: None; Publications: 14610718; Phenotypes: {Inflammatory bowel disease 13} 612244; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4015 AASS Zornitza Stark Tag disputed tag was added to gene: AASS.
Intellectual disability syndromic and non-syndromic v0.2902 AASS Zornitza Stark Tag disputed tag was added to gene: AASS.
Intellectual disability syndromic and non-syndromic v0.2902 AASS Zornitza Stark Mode of inheritance for gene: AASS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Pulmonary Fibrosis_Interstitial Lung Disease v0.9 ABCA3 Zornitza Stark Marked gene: ABCA3 as ready
Pulmonary Fibrosis_Interstitial Lung Disease v0.9 ABCA3 Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2901 AASS Zornitza Stark Mode of inheritance for gene: AASS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Pulmonary Fibrosis_Interstitial Lung Disease v0.9 ABCA3 Zornitza Stark Phenotypes for gene: ABCA3 were changed from to Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921
Mendeliome v0.4015 ABCA3 Zornitza Stark Marked gene: ABCA3 as ready
Mendeliome v0.4015 ABCA3 Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.8 ABCA3 Zornitza Stark Publications for gene: ABCA3 were set to
Mendeliome v0.4015 ABCA3 Zornitza Stark Phenotypes for gene: ABCA3 were changed from to Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921
Mendeliome v0.4014 ABCA3 Zornitza Stark Publications for gene: ABCA3 were set to
Pulmonary Fibrosis_Interstitial Lung Disease v0.7 ABCA3 Zornitza Stark Mode of inheritance for gene: ABCA3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Pulmonary Fibrosis_Interstitial Lung Disease v0.6 ABCA3 Zornitza Stark reviewed gene: ABCA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 15044640; Phenotypes: Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4013 ABCA3 Zornitza Stark Mode of inheritance for gene: ABCA3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4012 ABCA3 Zornitza Stark reviewed gene: ABCA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 15044640; Phenotypes: Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ichthyosis and Porokeratosis v0.97 ABCA12 Zornitza Stark reviewed gene: ABCA12: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, congenital, autosomal recessive 4A (MIM#601277), Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4012 ABCA12 Zornitza Stark Marked gene: ABCA12 as ready
Mendeliome v0.4012 ABCA12 Zornitza Stark Gene: abca12 has been classified as Green List (High Evidence).
Mendeliome v0.4012 ABCA12 Zornitza Stark Phenotypes for gene: ABCA12 were changed from to Ichthyosis, congenital, autosomal recessive 4A (MIM#601277); Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500)
Mendeliome v0.4011 ABCA12 Zornitza Stark Publications for gene: ABCA12 were set to
Mendeliome v0.4010 ABCA12 Zornitza Stark Mode of inheritance for gene: ABCA12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4009 ABCA12 Zornitza Stark reviewed gene: ABCA12: Rating: GREEN; Mode of pathogenicity: None; Publications: 31168818, 19664001, 31489029; Phenotypes: Ichthyosis, congenital, autosomal recessive 4A (MIM#601277), Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Dyslipidaemia v0.3 ABCA1 Zornitza Stark Marked gene: ABCA1 as ready
Dyslipidaemia v0.3 ABCA1 Zornitza Stark Gene: abca1 has been classified as Green List (High Evidence).
Dyslipidaemia v0.3 ABCA1 Zornitza Stark Phenotypes for gene: ABCA1 were changed from Tangier disease, ABCA1 deficiency, HDL deficiency, Familial hypoalphalipoproteinemia to Tangier disease, MIM# 205400; HDL deficiency, familial, 1, MIM# 604091
Dyslipidaemia v0.2 ABCA1 Zornitza Stark Publications for gene: ABCA1 were set to
Dyslipidaemia v0.1 ABCA1 Zornitza Stark reviewed gene: ABCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10431237, 10431236; Phenotypes: Tangier disease, MIM# 205400, HDL deficiency, familial, 1, MIM# 604091; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4009 ABCA1 Zornitza Stark Phenotypes for gene: ABCA1 were changed from to Tangier disease, MIM# 205400; HDL deficiency, familial, 1, MIM# 604091
Mendeliome v0.4008 ABCA1 Zornitza Stark Publications for gene: ABCA1 were set to
Mendeliome v0.4007 ABCA1 Zornitza Stark Mode of inheritance for gene: ABCA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4006 ABCA1 Zornitza Stark reviewed gene: ABCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10431237, 10431236; Phenotypes: Tangier disease, MIM# 205400, HDL deficiency, familial, 1, MIM# 604091; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2900 AASS Zornitza Stark Phenotypes for gene: AASS were changed from to Hyperlysinemia, MIM# 238700
Mendeliome v0.4006 AASS Zornitza Stark Marked gene: AASS as ready
Mendeliome v0.4006 AASS Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2899 AASS Zornitza Stark Publications for gene: AASS were set to
Intellectual disability syndromic and non-syndromic v0.2898 AASS Zornitza Stark Classified gene: AASS as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2898 AASS Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4006 AASS Zornitza Stark Phenotypes for gene: AASS were changed from to Hyperlysinemia, MIM# 238700
Intellectual disability syndromic and non-syndromic v0.2897 AASS Zornitza Stark reviewed gene: AASS: Rating: AMBER; Mode of pathogenicity: None; Publications: 23570448; Phenotypes: Hyperlysinemia, MIM# 238700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4005 AASS Zornitza Stark Publications for gene: AASS were set to
Mendeliome v0.4004 AASS Zornitza Stark Mode of inheritance for gene: AASS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4003 AASS Zornitza Stark Classified gene: AASS as Amber List (moderate evidence)
Mendeliome v0.4003 AASS Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4002 AASS Zornitza Stark changed review comment from: Hyperlysinemia type I is an autosomal recessive metabolic condition with variable clinical features. Some patients who present in infancy with nonspecific seizures, hypotonia, or mildly delayed psychomotor development have been found to have increased serum lysine and pipecolic acid on laboratory analysis. However, about 50% of probands are reported to be asymptomatic. Given the broad range of clinical features and the presence of consanguinity in several families, there was not strong evidence for causality of symptoms. Hyperlysinemia is generally considered to be a benign metabolic variant rather than a disease entity.; to: Hyperlysinemia type I is an autosomal recessive metabolic condition with variable clinical features. Some patients who present in infancy with nonspecific seizures, hypotonia, or mildly delayed psychomotor development have been found to have increased serum lysine and pipecolic acid on laboratory analysis. However, about 50% of probands are reported to be asymptomatic. Given the broad range of clinical features and the presence of consanguinity in several families, there was not strong evidence for causality of symptoms. It has been suggested that hyperlysinemia is a benign metabolic variant rather than a disease entity.
Mendeliome v0.4002 AASS Zornitza Stark edited their review of gene: AASS: Changed rating: AMBER
Mendeliome v0.4002 AASS Zornitza Stark reviewed gene: AASS: Rating: RED; Mode of pathogenicity: None; Publications: 23570448; Phenotypes: Hyperlysinemia, MIM# 238700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.208 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Callosome v0.208 AARS2 Zornitza Stark Gene: aars2 has been classified as Red List (Low Evidence).
Callosome v0.208 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570
Callosome v0.207 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Callosome v0.206 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Callosome v0.205 AARS2 Zornitza Stark Classified gene: AARS2 as Red List (low evidence)
Callosome v0.205 AARS2 Zornitza Stark Gene: aars2 has been classified as Red List (Low Evidence).
Callosome v0.204 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: RED; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Regression v0.139 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Regression v0.139 AARS2 Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence).
Regression v0.139 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Leukoencephalopathy, progressive, with ovarian failure MIM#615889
Regression v0.138 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Regression v0.137 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.136 AARS2 Zornitza Stark edited their review of gene: AARS2: Changed phenotypes: Leukoencephalopathy, progressive, with ovarian failure MIM#615889
Regression v0.136 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.471 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570
Mitochondrial disease v0.470 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Mitochondrial disease v0.469 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.468 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4002 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Mendeliome v0.4002 AARS2 Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence).
Mendeliome v0.4002 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570
Mendeliome v0.4001 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Mendeliome v0.4000 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3999 AARS2 Zornitza Stark edited their review of gene: AARS2: Changed phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570
Mendeliome v0.3999 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3999 AARS Zornitza Stark Marked gene: AARS as ready
Mendeliome v0.3999 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Mendeliome v0.3999 AARS Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339; Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287
Mendeliome v0.3998 AARS Zornitza Stark Publications for gene: AARS were set to
Mendeliome v0.3997 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3996 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015, 20045102, 22009580, 22206013, 30373780, 26032230; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339, Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.158 AARS Zornitza Stark Marked gene: AARS as ready
Microcephaly v0.158 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Microcephaly v0.158 AARS Zornitza Stark Classified gene: AARS as Green List (high evidence)
Microcephaly v0.158 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Microcephaly v0.157 AARS Zornitza Stark gene: AARS was added
gene: AARS was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: AARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AARS were set to 28493438; 25817015
Phenotypes for gene: AARS were set to Epileptic encephalopathy, early infantile, 29, MIM# 616339
Review for gene: AARS was set to GREEN
Added comment: Bi-allelic variants associated with a severe phenotype comprising leukodystrophy, epilepsy, microcephaly and neurodevelopmental delay reported in three families.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2897 AARS Zornitza Stark Marked gene: AARS as ready
Intellectual disability syndromic and non-syndromic v0.2897 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2897 AARS Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339
Intellectual disability syndromic and non-syndromic v0.2896 AARS Zornitza Stark Publications for gene: AARS were set to
Intellectual disability syndromic and non-syndromic v0.2896 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2895 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2894 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy v0.171 AARS Zornitza Stark Marked gene: AARS as ready
Leukodystrophy v0.171 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Leukodystrophy v0.171 AARS Zornitza Stark Publications for gene: AARS were set to
Leukodystrophy v0.170 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.825 AARS Zornitza Stark Marked gene: AARS as ready
Genetic Epilepsy v0.825 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Genetic Epilepsy v0.825 AARS Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339
Genetic Epilepsy v0.824 AARS Zornitza Stark Publications for gene: AARS were set to
Genetic Epilepsy v0.823 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.823 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.822 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3996 AAGAB Zornitza Stark Marked gene: AAGAB as ready
Mendeliome v0.3996 AAGAB Zornitza Stark Gene: aagab has been classified as Green List (High Evidence).
Mendeliome v0.3996 AAGAB Zornitza Stark Phenotypes for gene: AAGAB were changed from to Keratoderma, palmoplantar, punctate type IA (MIM#148600)
Mendeliome v0.3995 AAGAB Zornitza Stark Publications for gene: AAGAB were set to
Mendeliome v0.3994 AAGAB Zornitza Stark Mode of inheritance for gene: AAGAB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3993 AAGAB Zornitza Stark reviewed gene: AAGAB: Rating: GREEN; Mode of pathogenicity: None; Publications: 30451279, 26608363; Phenotypes: Keratoderma, palmoplantar, punctate type IA (MIM#148600); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3993 A4GALT Zornitza Stark Marked gene: A4GALT as ready
Mendeliome v0.3993 A4GALT Zornitza Stark Gene: a4galt has been classified as Red List (Low Evidence).
Mendeliome v0.3993 A4GALT Zornitza Stark Phenotypes for gene: A4GALT were changed from to [Blood group, P1Pk system, p phenotype], MIM# 111400
Mendeliome v0.3992 A4GALT Zornitza Stark Classified gene: A4GALT as Red List (low evidence)
Mendeliome v0.3992 A4GALT Zornitza Stark Gene: a4galt has been classified as Red List (Low Evidence).
Mendeliome v0.3991 A4GALT Zornitza Stark reviewed gene: A4GALT: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: [Blood group, P1Pk system, p phenotype], MIM# 111400; Mode of inheritance: None
Genetic Epilepsy v0.822 RELN Zornitza Stark Marked gene: RELN as ready
Genetic Epilepsy v0.822 RELN Zornitza Stark Gene: reln has been classified as Green List (High Evidence).
Genetic Epilepsy v0.822 RELN Zornitza Stark Phenotypes for gene: RELN were changed from to {Epilepsy, familial temporal lobe, 7}, MIM# 616436; MONDO:0014639
Genetic Epilepsy v0.821 RELN Zornitza Stark Publications for gene: RELN were set to
Genetic Epilepsy v0.820 RELN Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.819 RELN Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28142128; Phenotypes: {Epilepsy, familial temporal lobe, 7}, MIM# 616436, MONDO:0014639; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.107 RELN Zornitza Stark Marked gene: RELN as ready
Lissencephaly and Band Heterotopia v0.107 RELN Zornitza Stark Gene: reln has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.107 RELN Zornitza Stark Phenotypes for gene: RELN were changed from to Lissencephaly 2 (Norman-Roberts type), MIM# 257320
Lissencephaly and Band Heterotopia v0.106 RELN Zornitza Stark Publications for gene: RELN were set to
Lissencephaly and Band Heterotopia v0.105 RELN Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.104 RELN Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10973257, 29671837, 31805691; Phenotypes: Lissencephaly 2 (Norman-Roberts type), MIM# 257320; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.104 LAMB1 Zornitza Stark Marked gene: LAMB1 as ready
Lissencephaly and Band Heterotopia v0.104 LAMB1 Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence).
Callosome v0.204 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Callosome v0.204 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Callosome v0.204 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Callosome v0.204 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Callosome v0.203 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Callosome v0.202 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.201 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.156 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Microcephaly v0.156 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Microcephaly v0.156 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Microcephaly v0.155 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Microcephaly v0.154 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.153 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Microcephaly v0.153 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2894 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Intellectual disability syndromic and non-syndromic v0.2894 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2894 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Intellectual disability syndromic and non-syndromic v0.2893 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Intellectual disability syndromic and non-syndromic v0.2892 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2891 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Intellectual disability syndromic and non-syndromic v0.2891 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Genetic Epilepsy v0.818 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Genetic Epilepsy v0.817 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.816 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Mendeliome v0.3990 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Mendeliome v0.3989 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3988 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark changed review comment from: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia.; to: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia. Note deletions are common.
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Lissencephaly and Band Heterotopia v0.103 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Lissencephaly and Band Heterotopia v0.102 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.101 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Marked gene: LARGE1 as ready
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Gene: large1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840
Lissencephaly and Band Heterotopia v0.100 LARGE1 Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.99 LARGE1 Zornitza Stark reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3988 LAMB1 Zornitza Stark Marked gene: LAMB1 as ready
Mendeliome v0.3988 LAMB1 Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence).
Mendeliome v0.3988 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191; Cystic leukoencephalopathy
Mendeliome v0.3987 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Mendeliome v0.3986 LAMB1 Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3985 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467, 25925986, 32548278; Phenotypes: Lissencephaly 5, MIM# 615191, Cystic leukoencephalopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.99 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191
Lissencephaly and Band Heterotopia v0.98 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Lissencephaly and Band Heterotopia v0.97 LAMB1 Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.96 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467; Phenotypes: Lissencephaly 5, MIM# 615191; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Muscular dystrophy and myopathy_Paediatric v0.72 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Muscular dystrophy and myopathy_Paediatric v0.71 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.70 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3985 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Mendeliome v0.3985 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Mendeliome v0.3985 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Mendeliome v0.3984 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Mendeliome v0.3983 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3982 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Cobblestone Malformations v0.11 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Cobblestone Malformations v0.10 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cobblestone Malformations v0.9 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Lissencephaly and Band Heterotopia v0.95 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Lissencephaly and Band Heterotopia v0.94 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.93 TMEM5 Zornitza Stark edited their review of gene: TMEM5: Changed publications: 23217329, 23519211
Lissencephaly and Band Heterotopia v0.93 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.201 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Callosome v0.201 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Callosome v0.201 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Callosome v0.200 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Callosome v0.199 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.198 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Intellectual disability syndromic and non-syndromic v0.2890 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2889 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Intellectual disability syndromic and non-syndromic v0.2888 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.815 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Genetic Epilepsy v0.814 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3982 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Mendeliome v0.3982 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Genetic Epilepsy v0.813 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3982 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Mendeliome v0.3981 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Mendeliome v0.3980 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Mendeliome v0.3979 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.141 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Polymicrogyria and Schizencephaly v0.140 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.139 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Lissencephaly and Band Heterotopia v0.92 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Lissencephaly and Band Heterotopia v0.91 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.198 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Callosome v0.198 KIF2A Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence).
Callosome v0.198 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Callosome v0.197 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Callosome v0.196 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.195 KIF2A Zornitza Stark Classified gene: KIF2A as Red List (low evidence)
Callosome v0.195 KIF2A Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence).
Callosome v0.194 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: RED; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.153 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Microcephaly v0.153 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Microcephaly v0.153 KIF2A Zornitza Stark Classified gene: KIF2A as Green List (high evidence)
Microcephaly v0.153 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Microcephaly v0.152 KIF2A Zornitza Stark gene: KIF2A was added
gene: KIF2A was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: KIF2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF2A were set to 23603762; 27896282; 27747449; 29077851; 31919497
Phenotypes for gene: KIF2A were set to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Review for gene: KIF2A was set to GREEN
Added comment: At least five unrelated families reported, with various malformations of cortical development including lissencephaly, agyria, posterior or frontal pachygyria, subcortical band heterotopia, and thin corpus callosum; microcephaly, intellectual disability and seizures. Microcephaly is in the range of -2SD -4.5SD, described as progressive in at least one individual. Some normocephalic but lower end of normal range. Some recurrent missense at p.Ser317 and p.His321. Functional data supports gene-disease association.
Sources: Expert Review
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Genetic Epilepsy v0.812 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Genetic Epilepsy v0.811 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.810 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Mendeliome v0.3979 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Mendeliome v0.3979 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Mendeliome v0.3979 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Mendeliome v0.3978 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Mendeliome v0.3977 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3976 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Lissencephaly and Band Heterotopia v0.89 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Lissencephaly and Band Heterotopia v0.88 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.87 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.87 DCX Zornitza Stark Marked gene: DCX as ready
Lissencephaly and Band Heterotopia v0.87 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Marked gene: ISPD as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Publications for gene: ISPD were set to
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.52 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Marked gene: ISPD as ready
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Hydrocephalus_Ventriculomegaly v0.55 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643
Hydrocephalus_Ventriculomegaly v0.54 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Mendeliome v0.3976 ISPD Zornitza Stark Marked gene: ISPD as ready
Mendeliome v0.3976 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Mendeliome v0.3976 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Mendeliome v0.3975 ISPD Zornitza Stark Publications for gene: ISPD were set to
Mendeliome v0.3974 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.69 ISPD Zornitza Stark Publications for gene: ISPD were set to
Muscular dystrophy and myopathy_Paediatric v0.68 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.67 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.67 Zornitza Stark Panel name changed from Muscular dystrophy to Muscular dystrophy_Paediatric
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Marked gene: ISPD as ready
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Mendeliome v0.3973 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.87 ISPD Zornitza Stark edited their review of gene: ISPD: Changed publications: 22522421, 23217329
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Publications for gene: ISPD were set to
Hydrocephalus_Ventriculomegaly v0.52 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Hydrocephalus_Ventriculomegaly v0.51 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.87 ISPD Zornitza Stark Publications for gene: ISPD were set to 22522421
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Marked gene: ISPD as ready
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643
Lissencephaly and Band Heterotopia v0.85 ISPD Zornitza Stark Publications for gene: ISPD were set to
Lissencephaly and Band Heterotopia v0.84 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.83 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Marked gene: DYNC1H1 as ready
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Gene: dync1h1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to Mental retardation, autosomal dominant 13, MIM# 614563
Lissencephaly and Band Heterotopia v0.82 DYNC1H1 Zornitza Stark Publications for gene: DYNC1H1 were set to
Lissencephaly and Band Heterotopia v0.81 DYNC1H1 Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark changed review comment from: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, nodular heterotopias, and PMG.; to: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, lissencephaly, nodular heterotopias, and PMG.
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762, 29671837, 32570172, 27331017
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 13, MIM# 614563; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3973 DCX Zornitza Stark Marked gene: DCX as ready
Mendeliome v0.3973 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Mendeliome v0.3973 DCX Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067
Mendeliome v0.3972 DCX Zornitza Stark Publications for gene: DCX were set to
Mendeliome v0.3971 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.80 DCX Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067
Mendeliome v0.3970 DCX Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.79 DCX Zornitza Stark Publications for gene: DCX were set to
Lissencephaly and Band Heterotopia v0.78 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.77 DCX Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Marked gene: B3GALNT2 as ready
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Gene: b3galnt2 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Phenotypes for gene: B3GALNT2 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181
Lissencephaly and Band Heterotopia v0.76 B3GALNT2 Zornitza Stark Publications for gene: B3GALNT2 were set to
Lissencephaly and Band Heterotopia v0.75 B3GALNT2 Zornitza Stark Mode of inheritance for gene: B3GALNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.74 B3GALNT2 Zornitza Stark reviewed gene: B3GALNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23453667; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Marked gene: ARX as ready
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Phenotypes for gene: ARX were changed from to Lissencephaly, X-linked 2, MIM# 300215
Lissencephaly and Band Heterotopia v0.73 ARX Zornitza Stark Publications for gene: ARX were set to
Lissencephaly and Band Heterotopia v0.72 ARX Zornitza Stark Mode of inheritance for gene: ARX was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Lissencephaly and Band Heterotopia v0.71 ARX Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: 14722918; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.2888 DPM3 Zornitza Stark edited their review of gene: DPM3: Changed phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 612937, Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Marked gene: TLR7 as ready
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence).
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Classified gene: TLR7 as Green List (high evidence)
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence).
Susceptibility to Viral Infections v0.64 TLR7 Zornitza Stark gene: TLR7 was added
gene: TLR7 was added to Susceptibility to Viral Infections. Sources: Expert list
Mode of inheritance for gene: TLR7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TLR7 were set to 32706371
Phenotypes for gene: TLR7 were set to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051
Review for gene: TLR7 was set to GREEN
Added comment: Four affected individuals from two unrelated families and some functional data.
Sources: Expert list
Mendeliome v0.3970 TLR7 Zornitza Stark reviewed gene: TLR7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32706371; Phenotypes: Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Palmoplantar Keratoderma and Erythrokeratoderma v0.94 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Palmoplantar Keratoderma and Erythrokeratoderma v0.93 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3970 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Mendeliome v0.3969 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ichthyosis and Porokeratosis v0.97 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Ichthyosis and Porokeratosis v0.96 ASPRV1 Zornitza Stark edited their review of gene: ASPRV1: Changed rating: GREEN; Changed phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ichthyosis and Porokeratosis v0.96 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, M 146750; Mode of inheritance: None
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395
Cardiomyopathy_Paediatric v0.6 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from ?Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis)
Cardiomyopathy_Paediatric v0.5 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Cardiomyopathy_Paediatric v0.4 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3969 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Mendeliome v0.3969 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Mendeliome v0.3969 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395
Mendeliome v0.3968 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Mendeliome v0.3967 MRPL44 Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3966 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395
Mitochondrial disease v0.467 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Mitochondrial disease v0.466 MRPL44 Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.465 MRPL44 Zornitza Stark edited their review of gene: MRPL44: Changed rating: GREEN
Mitochondrial disease v0.465 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: ; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson Marked gene: FANCL as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson Gene: fancl has been classified as Red List (Low Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson gene: FANCL was added
gene: FANCL was added to Amenorrhoea. Sources: Literature
Mode of inheritance for gene: FANCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FANCL were set to 32048394; 32851770; 11823446
Phenotypes for gene: FANCL were set to Primary ovarian insufficiency
Review for gene: FANCL was set to AMBER
Added comment: 2 independent cases reported with heterozygous loss of function variants and primary ovarian insufficiency. However, there is no reported evidence of POI in female carriers of FANCL pathogenic variants for fanconi anemia. Null mouse model is less fertile and has defective proliferation of germ cells.
Sources: Literature
Early-onset Dementia v0.72 PRNP Bryony Thompson Classified STR: PRNP as Green List (high evidence)
Early-onset Dementia v0.72 PRNP Bryony Thompson Str: prnp has been classified as Green List (High Evidence).
Early-onset Dementia v0.71 PRNP Bryony Thompson STR: PRNP was added
STR: PRNP was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: PRNP.
Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP were set to 20301407
Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP was set to GREEN
STR: PRNP was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.3966 KBTBD13 Zornitza Stark Marked gene: KBTBD13 as ready
Mendeliome v0.3966 KBTBD13 Zornitza Stark Gene: kbtbd13 has been classified as Green List (High Evidence).
Mendeliome v0.3966 KBTBD13 Zornitza Stark Phenotypes for gene: KBTBD13 were changed from to Nemaline myopathy 6, autosomal dominant, MIM# 609273; Hereditary motor neuropathy; late-onset limb girdle muscular dystrophy
Mendeliome v0.3965 KBTBD13 Zornitza Stark Publications for gene: KBTBD13 were set to
Mendeliome v0.3964 KBTBD13 Zornitza Stark Mode of inheritance for gene: KBTBD13 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3963 KBTBD13 Zornitza Stark edited their review of gene: KBTBD13: Changed rating: GREEN
Mendeliome v0.3963 KBTBD13 Zornitza Stark reviewed gene: KBTBD13: Rating: ; Mode of pathogenicity: None; Publications: 11731279, 21104864; Phenotypes: Nemaline myopathy 6, autosomal dominant, MIM# 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: None
Mitochondrial disease v0.465 NDUFA13 Zornitza Stark Publications for gene: NDUFA13 were set to 25901006
Mendeliome v0.3963 NDUFA13 Zornitza Stark Publications for gene: NDUFA13 were set to 25901006
Mendeliome v0.3962 NDUFA13 Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence)
Mendeliome v0.3962 NDUFA13 Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.3961 NDUFA13 Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639
Mitochondrial disease v0.464 NDUFA13 Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence)
Mitochondrial disease v0.464 NDUFA13 Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence).
Mitochondrial disease v0.463 NDUFA13 Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639
Mendeliome v0.3961 KBTBD13 Elena Savva reviewed gene: KBTBD13: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 28403181, 31167812, 31671076, 30208948; Phenotypes: Nemaline myopathy 6, autosomal dominant, 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Classified STR: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.69 C9orf72 Bryony Thompson STR: C9orf72 was added
STR: C9orf72 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: C9orf72.
Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: C9orf72 were set to 25577942
Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: C9orf72 was set to GREEN
STR: C9orf72 was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Arthrogryposis v0.207 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Arthrogryposis v0.207 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Arthrogryposis v0.207 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Arthrogryposis v0.206 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Arthrogryposis v0.205 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Arthrogryposis v0.204 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Muscular dystrophy and myopathy_Paediatric v0.65 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Muscular dystrophy and myopathy_Paediatric v0.64 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.63 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3961 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Mendeliome v0.3961 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Mendeliome v0.3961 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Mendeliome v0.3960 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Mendeliome v0.3959 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3958 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.71 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from LAMA2-related muscular dystrophy to LAMA2-related muscular dystrophy; Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855
Lissencephaly and Band Heterotopia v0.70 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Autism v0.107 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Autism v0.107 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Autism v0.107 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Autism v0.106 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Autism v0.105 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Autism v0.104 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Genetic Epilepsy v0.809 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Genetic Epilepsy v0.808 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.807 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3958 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Mendeliome v0.3958 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Mendeliome v0.3958 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Mendeliome v0.3957 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Mendeliome v0.3956 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3955 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Intellectual disability syndromic and non-syndromic v0.2887 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Intellectual disability syndromic and non-syndromic v0.2886 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2885 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.139 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from GRIN2B-related neurodevelopmental disorder to GRIN2B-related neurodevelopmental disorder; Mental retardation, autosomal dominant 6, MIM# 613970
Polymicrogyria and Schizencephaly v0.138 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Classified gene: GRIN1 as Green List (high evidence)
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.71 GRIN1 Zornitza Stark gene: GRIN1 was added
gene: GRIN1 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: GRIN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: GRIN1 were set to 29365063; 27164704; 27164704; 28051072
Phenotypes for gene: GRIN1 were set to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Review for gene: GRIN1 was set to GREEN
Added comment: Over 20 individuals reported with de novo missense variants in GRIN1 and severe neurodevelopmental phenotype, comprising ID, seizures, and a movement disorder, in particular dystonia. Two families reported with bi-allelic variants: different mechanism postulated (LOF vs affecting channel functioning or hypomorphic alleles), parents were carriers and unaffected. Movement disorder, in particular dystonia also reported in bi-allelic cases.
Sources: Expert list
Mendeliome v0.3955 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Mendeliome v0.3955 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Mendeliome v0.3955 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Mendeliome v0.3954 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Mendeliome v0.3953 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3952 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254
Genetic Epilepsy v0.806 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Genetic Epilepsy v0.805 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.804 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Intellectual disability syndromic and non-syndromic v0.2884 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Intellectual disability syndromic and non-syndromic v0.2883 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2882 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Added comment: Comment when marking as ready: All variants occurred between residues 559 and 828, and there may be an association between variant location and PMG.
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from GRIN1-related neurodevelopmental disorder to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254
Intellectual disability syndromic and non-syndromic v0.2882 HARS Zornitza Stark Publications for gene: HARS were set to 32296180
Intellectual disability syndromic and non-syndromic v0.2881 HARS Zornitza Stark commented on gene: HARS: Please note this is the correct PMID for this disease association
Intellectual disability syndromic and non-syndromic v0.2881 HARS Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome, mild-severe intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ataxia v0.222 HARS Zornitza Stark Publications for gene: HARS were set to 32296180
Ataxia v0.221 HARS Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Additional findings_Paediatric v0.2 ZNF674 Zornitza Stark gene: ZNF674 was added
gene: ZNF674 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZNF674 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ZNF674 were set to Mental retardation
Additional findings_Paediatric v0.2 ZNF252P Zornitza Stark gene: ZNF252P was added
gene: ZNF252P was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZNF252P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZNF252P were set to Hypothyroidism
Additional findings_Paediatric v0.2 ZFPM2 Zornitza Stark gene: ZFPM2 was added
gene: ZFPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZFPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZFPM2 were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 YARS2 Zornitza Stark gene: YARS2 was added
gene: YARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: YARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: YARS2 were set to Myopathy, lactic acidosis, and sideroblastic anemia
Additional findings_Paediatric v0.2 WRAP53 Zornitza Stark gene: WRAP53 was added
gene: WRAP53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WRAP53 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WRAP53 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 WNT7A Zornitza Stark gene: WNT7A was added
gene: WNT7A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT7A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT7A were set to Ulna and fibula absence of with severe limb deficiency
Additional findings_Paediatric v0.2 WNT5A Zornitza Stark gene: WNT5A was added
gene: WNT5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WNT5A were set to Robinow syndrome
Additional findings_Paediatric v0.2 WNT3 Zornitza Stark gene: WNT3 was added
gene: WNT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT3 were set to Tetra-amelia, autosomal recessive
Additional findings_Paediatric v0.2 WNK1 Zornitza Stark gene: WNK1 was added
gene: WNK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNK1 were set to Neuropathy, hereditary sensory and autonomic, type I
Additional findings_Paediatric v0.2 WDR36 Zornitza Stark gene: WDR36 was added
gene: WDR36 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WDR36 were set to Glaucoma
Additional findings_Paediatric v0.2 WDR35 Zornitza Stark gene: WDR35 was added
gene: WDR35 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR35 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR35 were set to Cranioectodermal dysplasia
Additional findings_Paediatric v0.2 WDR19 Zornitza Stark gene: WDR19 was added
gene: WDR19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR19 were set to Nephronophthisis
Additional findings_Paediatric v0.2 VSX1 Zornitza Stark gene: VSX1 was added
gene: VSX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VSX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VSX1 were set to Keratoconus
Additional findings_Paediatric v0.2 VPS53 Zornitza Stark gene: VPS53 was added
gene: VPS53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VPS53 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS53 were set to Progressive cerebello-cerebral atrophy
Additional findings_Paediatric v0.2 VAMP1 Zornitza Stark gene: VAMP1 was added
gene: VAMP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VAMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VAMP1 were set to Spastic ataxia
Additional findings_Paediatric v0.2 UQCRQ Zornitza Stark gene: UQCRQ was added
gene: UQCRQ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UQCRQ was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UQCRQ were set to Mitochondrial complex III deficiency
Additional findings_Paediatric v0.2 UQCRB Zornitza Stark gene: UQCRB was added
gene: UQCRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UQCRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UQCRB were set to Mitochondrial complex III deficiency
Additional findings_Paediatric v0.2 UGT1A5 Zornitza Stark gene: UGT1A5 was added
gene: UGT1A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UGT1A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A5 were set to UDP glucuronosyltransferase deficiency
Additional findings_Paediatric v0.2 UGT1A4 Zornitza Stark gene: UGT1A4 was added
gene: UGT1A4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UGT1A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A4 were set to Crigler-Najjar syndrome
Additional findings_Paediatric v0.2 UCP2 Zornitza Stark gene: UCP2 was added
gene: UCP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UCP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: UCP2 were set to Hyperinsulinism
Additional findings_Paediatric v0.2 UBA1 Zornitza Stark gene: UBA1 was added
gene: UBA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UBA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: UBA1 were set to Spinal muscular atrophy, X-linked infantile
Additional findings_Paediatric v0.2 TUBA8 Zornitza Stark gene: TUBA8 was added
gene: TUBA8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TUBA8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TUBA8 were set to Polymicrogyria with optic nerve hypoplasia
Additional findings_Paediatric v0.2 TTC21B Zornitza Stark gene: TTC21B was added
gene: TTC21B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TTC21B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC21B were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.2 TSPYL1 Zornitza Stark gene: TSPYL1 was added
gene: TSPYL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSPYL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSPYL1 were set to Sudden infant death with dysgenesis of the testes syndrome
Additional findings_Paediatric v0.2 TSPEAR Zornitza Stark gene: TSPEAR was added
gene: TSPEAR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSPEAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSPEAR were set to Sensorineural deafness
Additional findings_Paediatric v0.2 TSFM Zornitza Stark gene: TSFM was added
gene: TSFM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSFM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSFM were set to Combined oxidative phosphorylation deficiency
Additional findings_Paediatric v0.2 TRPM2 Zornitza Stark gene: TRPM2 was added
gene: TRPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TRPM2 were set to ALS and Parkinson's disease
Additional findings_Paediatric v0.2 TRIP11 Zornitza Stark gene: TRIP11 was added
gene: TRIP11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRIP11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIP11 were set to Achondrogenesis type 1A
Additional findings_Paediatric v0.2 TRHR Zornitza Stark gene: TRHR was added
gene: TRHR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRHR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRHR were set to Thyrotropin-releasing hormone resistance, generalized
Additional findings_Paediatric v0.2 TRH Zornitza Stark gene: TRH was added
gene: TRH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRH were set to Thyrotropin-releasing hormone deficiency
Additional findings_Paediatric v0.2 TRDN Zornitza Stark gene: TRDN was added
gene: TRDN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRDN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRDN were set to Catecholaminergic polymorphic ventricular tachycardia
Additional findings_Paediatric v0.2 TPRN Zornitza Stark gene: TPRN was added
gene: TPRN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TPRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TPRN were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TNXB Zornitza Stark gene: TNXB was added
gene: TNXB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TNXB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNXB were set to Ehlers-Danlos syndrome due to tenascin X deficiency
Additional findings_Paediatric v0.2 TMPO Zornitza Stark gene: TMPO was added
gene: TMPO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TMPO were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TMEM237 Zornitza Stark gene: TMEM237 was added
gene: TMEM237 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMEM237 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM237 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMEM216 Zornitza Stark Added phenotypes Meckel syndrome for gene: TMEM216
Additional findings_Paediatric v0.2 TMEM216 Zornitza Stark gene: TMEM216 was added
gene: TMEM216 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMEM216 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM216 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMC8 Zornitza Stark gene: TMC8 was added
gene: TMC8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMC8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMC8 were set to Epidermodysplasia verruciformi
Additional findings_Paediatric v0.2 TJP2 Zornitza Stark gene: TJP2 was added
gene: TJP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TJP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TJP2 were set to Hypercholanemia, familial
Additional findings_Paediatric v0.2 THBS1 Zornitza Stark gene: THBS1 was added
gene: THBS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: THBS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THBS1 were set to Pulmonary hypertension
Additional findings_Paediatric v0.2 THBD Zornitza Stark gene: THBD was added
gene: THBD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: THBD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THBD were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 TGIF1 Zornitza Stark gene: TGIF1 was added
gene: TGIF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGIF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGIF1 were set to Holoprosencephaly-4
Additional findings_Paediatric v0.2 TGFBR3 Zornitza Stark gene: TGFBR3 was added
gene: TGFBR3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFBR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFBR3 were set to Premature ovarian failure
Additional findings_Paediatric v0.2 TGFB3 Zornitza Stark gene: TGFB3 was added
gene: TGFB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFB3 were set to Arrhythmogenic right ventricular dysplasia
Additional findings_Paediatric v0.2 TGFB1 Zornitza Stark gene: TGFB1 was added
gene: TGFB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFB1 were set to Camurati-Engelmann disease
Additional findings_Paediatric v0.2 TFR2 Zornitza Stark gene: TFR2 was added
gene: TFR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TFR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TFR2 were set to Hemochromatosis type 3
Additional findings_Paediatric v0.2 TCTN3 Zornitza Stark gene: TCTN3 was added
gene: TCTN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TCTN3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCTN3 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TCTN1 Zornitza Stark gene: TCTN1 was added
gene: TCTN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TCTN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCTN1 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TCAP Zornitza Stark Source BabySeq Category C gene was added to TCAP.
Source Expert Review Red was added to TCAP.
Added phenotypes Cardiomyopathy, dilated for gene: TCAP
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 TBX20 Zornitza Stark gene: TBX20 was added
gene: TBX20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TBX20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TBX20 were set to Congenital heart disease
Additional findings_Paediatric v0.2 TBCE Zornitza Stark gene: TBCE was added
gene: TBCE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TBCE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TBCE were set to Hypoparathyroidism retardation dysmorphism syndrome
Additional findings_Paediatric v0.2 TARDBP Zornitza Stark gene: TARDBP was added
gene: TARDBP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TARDBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TARDBP were set to Amyotrophic lateral sclerosis type 10
Additional findings_Paediatric v0.2 TAB2 Zornitza Stark gene: TAB2 was added
gene: TAB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TAB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TAB2 were set to Congenital heart disease, nonsyndromic
Additional findings_Paediatric v0.2 SYT14 Zornitza Stark gene: SYT14 was added
gene: SYT14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SYT14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SYT14 were set to Spinocerebellar ataxia, autosomal recessive 11
Additional findings_Paediatric v0.2 SYNE4 Zornitza Stark gene: SYNE4 was added
gene: SYNE4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SYNE4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SYNE4 were set to Hearing loss
Additional findings_Paediatric v0.2 STAC3 Zornitza Stark gene: STAC3 was added
gene: STAC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: STAC3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STAC3 were set to Myopathy, Native American
Additional findings_Paediatric v0.2 ST3GAL5 Zornitza Stark gene: ST3GAL5 was added
gene: ST3GAL5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ST3GAL5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ST3GAL5 were set to Amish infantile epilepsy syndrome
Additional findings_Paediatric v0.2 ST14 Zornitza Stark gene: ST14 was added
gene: ST14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ST14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ST14 were set to Ichthyosis hypotrichosis syndrome
Additional findings_Paediatric v0.2 SPTLC2 Zornitza Stark gene: SPTLC2 was added
gene: SPTLC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SPTLC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTLC2 were set to Neuropathy, hereditary sensory and autonomic, type IC
Additional findings_Paediatric v0.2 SPEG Zornitza Stark gene: SPEG was added
gene: SPEG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SPEG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SPEG were set to Centronuclear myopathy with dilated cardiomyopathy
Additional findings_Paediatric v0.2 SP7 Zornitza Stark gene: SP7 was added
gene: SP7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SP7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SP7 were set to Osteogenesis imperfecta, type XII
Additional findings_Paediatric v0.2 SOX18 Zornitza Stark gene: SOX18 was added
gene: SOX18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SOX18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOX18 were set to Hypotrichosis-lymphedema-telangiectasia syndrome
Additional findings_Paediatric v0.2 SOD1 Zornitza Stark gene: SOD1 was added
gene: SOD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SOD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOD1 were set to Amyotrophic lateral sclerosis
Additional findings_Paediatric v0.2 SNAP29 Zornitza Stark gene: SNAP29 was added
gene: SNAP29 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SNAP29 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SNAP29 were set to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome
Additional findings_Paediatric v0.2 SMO Zornitza Stark gene: SMO was added
gene: SMO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMO were set to Medulloblastoma
Additional findings_Paediatric v0.2 SMAD9 Zornitza Stark gene: SMAD9 was added
gene: SMAD9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMAD9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD9 were set to Pulmonary arterial hypertension
Additional findings_Paediatric v0.2 SMAD6 Zornitza Stark gene: SMAD6 was added
gene: SMAD6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD6 were set to Cardiovascular malformation, congenital
Additional findings_Paediatric v0.2 SMAD1 Zornitza Stark gene: SMAD1 was added
gene: SMAD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMAD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD1 were set to Pulmonary arterial hypertension
Additional findings_Paediatric v0.2 SLCO1B3 Zornitza Stark gene: SLCO1B3 was added
gene: SLCO1B3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLCO1B3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLCO1B3 were set to Hyperbilirubinemia, Rotor type, digenic
Additional findings_Paediatric v0.2 SLCO1B1 Zornitza Stark gene: SLCO1B1 was added
gene: SLCO1B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLCO1B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLCO1B1 were set to Hyperbilirubinemia, Rotor type, digenic
Additional findings_Paediatric v0.2 SLC9A3R1 Zornitza Stark gene: SLC9A3R1 was added
gene: SLC9A3R1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC9A3R1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC9A3R1 were set to Nephrolithiasis/osteoporosis, hypophosphatemic, 2
Additional findings_Paediatric v0.2 SLC6A2 Zornitza Stark gene: SLC6A2 was added
gene: SLC6A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC6A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC6A2 were set to Orthostatic intolerance
Additional findings_Paediatric v0.2 SLC6A19 Zornitza Stark gene: SLC6A19 was added
gene: SLC6A19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC6A19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC6A19 were set to Hartnup disorder
Additional findings_Paediatric v0.2 SLC4A4 Zornitza Stark gene: SLC4A4 was added
gene: SLC4A4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC4A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC4A4 were set to Renal tubular acidosis, proximal, with ocular abnormalities
Additional findings_Paediatric v0.2 SLC4A10 Zornitza Stark gene: SLC4A10 was added
gene: SLC4A10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC4A10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC4A10 were set to Epilepsy & mental retardation
Additional findings_Paediatric v0.2 SLC41A1 Zornitza Stark gene: SLC41A1 was added
gene: SLC41A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC41A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC41A1 were set to Parkinson disease, idiopathic
Additional findings_Paediatric v0.2 SLC35C1 Zornitza Stark gene: SLC35C1 was added
gene: SLC35C1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC35C1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC35C1 were set to Congenital disorder of glycosylation 2c
Additional findings_Paediatric v0.2 SLC35A2 Zornitza Stark gene: SLC35A2 was added
gene: SLC35A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC35A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC35A2 were set to Early-onset epileptic encephalopathy
Additional findings_Paediatric v0.2 SLC35A1 Zornitza Stark gene: SLC35A1 was added
gene: SLC35A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC35A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC35A1 were set to CDG syndrome type IIf
Additional findings_Paediatric v0.2 SLC33A1 Zornitza Stark Mode of inheritance for gene SLC33A1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Spastic paraplegia, autosomal dominant for gene: SLC33A1
Additional findings_Paediatric v0.2 SLC33A1 Zornitza Stark gene: SLC33A1 was added
gene: SLC33A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC33A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC33A1 were set to Congenital cataracts, hearing loss and low serum copper and ceruloplasmin
Additional findings_Paediatric v0.2 SLC27A5 Zornitza Stark gene: SLC27A5 was added
gene: SLC27A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC27A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC27A5 were set to Bile acid amidation defect
Additional findings_Paediatric v0.2 SLC25A22 Zornitza Stark gene: SLC25A22 was added
gene: SLC25A22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC25A22 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A22 were set to Early myoclonic encephalopathy
Additional findings_Paediatric v0.2 SLC25A12 Zornitza Stark gene: SLC25A12 was added
gene: SLC25A12 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC25A12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A12 were set to Hypomyelination, global cerebral
Additional findings_Paediatric v0.2 SLC16A12 Zornitza Stark gene: SLC16A12 was added
gene: SLC16A12 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC16A12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC16A12 were set to Cataract, juvenile with microcornea and renal glucosuria
Additional findings_Paediatric v0.2 SLC16A1 Zornitza Stark gene: SLC16A1 was added
gene: SLC16A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC16A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC16A1 were set to Monocarboxylate transporter 1 deficiency
Additional findings_Paediatric v0.2 SLC12A5 Zornitza Stark gene: SLC12A5 was added
gene: SLC12A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC12A5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC12A5 were set to Febrile seizures
Additional findings_Paediatric v0.2 SLC11A2 Zornitza Stark gene: SLC11A2 was added
gene: SLC11A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC11A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC11A2 were set to Anemia, hypochromic microcytic
Additional findings_Paediatric v0.2 SIX5 Zornitza Stark gene: SIX5 was added
gene: SIX5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SIX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX5 were set to Branchiootorenal syndrome
Additional findings_Paediatric v0.2 SIX2 Zornitza Stark gene: SIX2 was added
gene: SIX2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SIX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX2 were set to Renal hypodysplasia
Additional findings_Paediatric v0.2 SHOC2 Zornitza Stark gene: SHOC2 was added
gene: SHOC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SHOC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SHOC2 were set to Noonan-like syndrome with loose anagen hair
Additional findings_Paediatric v0.2 SH3BP2 Zornitza Stark gene: SH3BP2 was added
gene: SH3BP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SH3BP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SH3BP2 were set to Cherubism
Additional findings_Paediatric v0.2 SGCD Zornitza Stark Source BabySeq Category C gene was added to SGCD.
Source Expert Review Red was added to SGCD.
Added phenotypes Cardiomyopathy, dilated for gene: SGCD
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 SFTPC Zornitza Stark gene: SFTPC was added
gene: SFTPC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SFTPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SFTPC were set to Interstitial lung disease
Additional findings_Paediatric v0.2 SFTPA2 Zornitza Stark gene: SFTPA2 was added
gene: SFTPA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SFTPA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SFTPA2 were set to Pulmonary fibrosis, idiopathic
Additional findings_Paediatric v0.2 SERPIND1 Zornitza Stark gene: SERPIND1 was added
gene: SERPIND1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPIND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SERPIND1 were set to Heparin cofactor 2 deficiency
Additional findings_Paediatric v0.2 SERPINC1 Zornitza Stark gene: SERPINC1 was added
gene: SERPINC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPINC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SERPINC1 were set to Thrombophilia due to antithrombin III deficiency
Additional findings_Paediatric v0.2 SERPINB6 Zornitza Stark gene: SERPINB6 was added
gene: SERPINB6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPINB6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SERPINB6 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 SERPINA1 Zornitza Stark gene: SERPINA1 was added
gene: SERPINA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPINA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SERPINA1 were set to Antitrypsin alpha 1 deficiency
Additional findings_Paediatric v0.2 SEMA3A Zornitza Stark gene: SEMA3A was added
gene: SEMA3A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SEMA3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SEMA3A were set to Kallmann syndrome 1
Additional findings_Paediatric v0.2 SEC63 Zornitza Stark gene: SEC63 was added
gene: SEC63 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SEC63 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SEC63 were set to Polycystic liver disease
Additional findings_Paediatric v0.2 SCP2 Zornitza Stark gene: SCP2 was added
gene: SCP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCP2 were set to Leukoencephalopathy - dystonia - motor neuropathy
Additional findings_Paediatric v0.2 SCO1 Zornitza Stark gene: SCO1 was added
gene: SCO1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCO1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCO1 were set to Hepatic failure, early onset, and neurologic disorder
Additional findings_Paediatric v0.2 SCNN1G Zornitza Stark gene: SCNN1G was added
gene: SCNN1G was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCNN1G was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCNN1G were set to Pseudohypoaldosteronism
Additional findings_Paediatric v0.2 SCNN1B Zornitza Stark Source BabySeq Category C gene was added to SCNN1B.
Source Expert Review Red was added to SCNN1B.
Mode of inheritance for gene SCNN1B was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Liddle syndrome for gene: SCNN1B
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 SCN4B Zornitza Stark gene: SCN4B was added
gene: SCN4B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN4B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN4B were set to Long QT syndrome
Additional findings_Paediatric v0.2 SCN4A Zornitza Stark Source BabySeq Category C gene was added to SCN4A.
Source Expert Review Red was added to SCN4A.
Added phenotypes Hypokalemic periodic paralysis, type 2 for gene: SCN4A
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 SCN3B Zornitza Stark gene: SCN3B was added
gene: SCN3B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN3B were set to Brugada syndrome
Additional findings_Paediatric v0.2 SCN2B Zornitza Stark gene: SCN2B was added
gene: SCN2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN2B were set to Atrial fibrillation
Additional findings_Paediatric v0.2 SCN1B Zornitza Stark gene: SCN1B was added
gene: SCN1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN1B were set to Brugada syndrome
Additional findings_Paediatric v0.2 SC5D Zornitza Stark gene: SC5D was added
gene: SC5D was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SC5D was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SC5D were set to Lathosterolosis
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Source BabySeq Category C gene was added to RYR1.
Source Expert Review Red was added to RYR1.
Mode of inheritance for gene RYR1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Congenital fiber type disproportion for gene: RYR1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 RPS7 Zornitza Stark gene: RPS7 was added
gene: RPS7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RPS7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS7 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS10 Zornitza Stark gene: RPS10 was added
gene: RPS10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RPS10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS10 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPL35A Zornitza Stark gene: RPL35A was added
gene: RPL35A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RPL35A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPL35A were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RHAG Zornitza Stark gene: RHAG was added
gene: RHAG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RHAG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RHAG were set to Rh-deficiency syndrome
Additional findings_Paediatric v0.2 RFX6 Zornitza Stark gene: RFX6 was added
gene: RFX6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RFX6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RFX6 were set to Diabetes, neonatal, with intestinal atresia
Additional findings_Paediatric v0.2 RELN Zornitza Stark gene: RELN was added
gene: RELN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RELN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RELN were set to Lissencephaly syndrome
Additional findings_Paediatric v0.2 RDX Zornitza Stark gene: RDX was added
gene: RDX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RDX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RDX were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 RANGRF Zornitza Stark gene: RANGRF was added
gene: RANGRF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RANGRF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RANGRF were set to Brugada syndrome
Additional findings_Paediatric v0.2 RAD51B Zornitza Stark gene: RAD51B was added
gene: RAD51B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RAD51B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAD51B were set to Breast and/or ovarian cancer
Additional findings_Paediatric v0.2 RAB3GAP2 Zornitza Stark gene: RAB3GAP2 was added
gene: RAB3GAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RAB3GAP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB3GAP2 were set to Warburg micro syndrome
Additional findings_Paediatric v0.2 RAB10 Zornitza Stark gene: RAB10 was added
gene: RAB10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RAB10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAB10 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NECTIN1 Zornitza Stark gene: NECTIN1 was added
gene: NECTIN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NECTIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NECTIN1 were set to Cleft lip / palate
Additional findings_Paediatric v0.2 PSEN2 Zornitza Stark gene: PSEN2 was added
gene: PSEN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PSEN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PSEN2 were set to Alzheimer disease, type 4
Additional findings_Paediatric v0.2 PSEN1 Zornitza Stark gene: PSEN1 was added
gene: PSEN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PSEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PSEN1 were set to Alzheimer disease, type 3
Additional findings_Paediatric v0.2 PSAT1 Zornitza Stark gene: PSAT1 was added
gene: PSAT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PSAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PSAT1 were set to Phosphoserine aminotransferase deficiency
Additional findings_Paediatric v0.2 PRRX1 Zornitza Stark gene: PRRX1 was added
gene: PRRX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRRX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRRX1 were set to Agnathia-otocephaly complex
Additional findings_Paediatric v0.2 PRPS1 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: PRPS1
Additional findings_Paediatric v0.2 PRPS1 Zornitza Stark gene: PRPS1 was added
gene: PRPS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRPS1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PRPS1 were set to Arts syndrome
Additional findings_Paediatric v0.2 PRODH Zornitza Stark gene: PRODH was added
gene: PRODH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRODH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRODH were set to Hyperprolinemia, type I
Additional findings_Paediatric v0.2 PRKCSH Zornitza Stark gene: PRKCSH was added
gene: PRKCSH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRKCSH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRKCSH were set to Polycystic liver disease
Additional findings_Paediatric v0.2 PRKAG2 Zornitza Stark Source BabySeq Category C gene was added to PRKAG2.
Source Expert Review Red was added to PRKAG2.
Added phenotypes Glycogen storage disease of heart, lethal congenital for gene: PRKAG2
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 PRICKLE1 Zornitza Stark gene: PRICKLE1 was added
gene: PRICKLE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRICKLE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRICKLE1 were set to Epilepsy, progressive myoclonic 1B
Additional findings_Paediatric v0.2 PREPL Zornitza Stark gene: PREPL was added
gene: PREPL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PREPL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PREPL were set to Hypotonia - cystinuria syndrome
Additional findings_Paediatric v0.2 PRDM16 Zornitza Stark gene: PRDM16 was added
gene: PRDM16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRDM16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRDM16 were set to Left ventricular noncompaction
Additional findings_Paediatric v0.2 PPOX Zornitza Stark gene: PPOX was added
gene: PPOX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PPOX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PPOX were set to Porphyria variegata
Additional findings_Paediatric v0.2 POMC Zornitza Stark gene: POMC was added
gene: POMC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: POMC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMC were set to Proopiomelanocortin deficiency
Additional findings_Paediatric v0.2 PODXL Zornitza Stark gene: PODXL was added
gene: PODXL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PODXL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PODXL were set to Focal and segmental glomerulosclerosis
Additional findings_Paediatric v0.2 PNPLA1 Zornitza Stark gene: PNPLA1 was added
gene: PNPLA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PNPLA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PNPLA1 were set to Ichthyosis, autosomal recessive congenital
Additional findings_Paediatric v0.2 PMS2 Zornitza Stark gene: PMS2 was added
gene: PMS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PMS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PMS2 were set to Lynch syndrome
Additional findings_Paediatric v0.2 PLOD2 Zornitza Stark gene: PLOD2 was added
gene: PLOD2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PLOD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLOD2 were set to Bruck syndrome
Additional findings_Paediatric v0.2 PLN Zornitza Stark Source BabySeq Category C gene was added to PLN.
Source Expert Review Red was added to PLN.
Added phenotypes Cardiomyopathy, familial hypertrophic for gene: PLN
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 PIGA Zornitza Stark gene: PIGA was added
gene: PIGA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PIGA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PIGA were set to Epileptic encephalopathy, early-onset
Additional findings_Paediatric v0.2 PHOX2A Zornitza Stark gene: PHOX2A was added
gene: PHOX2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PHOX2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PHOX2A were set to Fibrosis of extraocular muscles, congenital
Additional findings_Paediatric v0.2 PHKA1 Zornitza Stark gene: PHKA1 was added
gene: PHKA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PHKA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHKA1 were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PEX19 Zornitza Stark gene: PEX19 was added
gene: PEX19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX19 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX16 Zornitza Stark gene: PEX16 was added
gene: PEX16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX16 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX16 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX14 Zornitza Stark gene: PEX14 was added
gene: PEX14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX14 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX11B Zornitza Stark gene: PEX11B was added
gene: PEX11B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX11B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX11B were set to Peroxisome biogenesis disorder
Additional findings_Paediatric v0.2 PDSS2 Zornitza Stark gene: PDSS2 was added
gene: PDSS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDSS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDSS2 were set to Leigh syndrome with nephropathy and COQ10 deficiency
Additional findings_Paediatric v0.2 PDSS1 Zornitza Stark gene: PDSS1 was added
gene: PDSS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDSS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDSS1 were set to Deafness - encephaloneuropathy - obesity - valvulopathy Neonatal
Additional findings_Paediatric v0.2 PDP1 Zornitza Stark gene: PDP1 was added
gene: PDP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDP1 were set to Pyruvate dehydrogenase phosphatase deficiency
Additional findings_Paediatric v0.2 PDLIM3 Zornitza Stark gene: PDLIM3 was added
gene: PDLIM3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDLIM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDLIM3 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 PDE11A Zornitza Stark gene: PDE11A was added
gene: PDE11A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDE11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDE11A were set to Adrenocortical hyperplasia
Additional findings_Paediatric v0.2 PALB2 Zornitza Stark gene: PALB2 was added
gene: PALB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PALB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PALB2 were set to Breast cancer
Additional findings_Paediatric v0.2 PABPN1 Zornitza Stark gene: PABPN1 was added
gene: PABPN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PABPN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PABPN1 were set to Oculopharyngeal muscular dystrophy
Additional findings_Paediatric v0.2 P2RX2 Zornitza Stark gene: P2RX2 was added
gene: P2RX2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: P2RX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: P2RX2 were set to Hearing loss
Additional findings_Paediatric v0.2 OTUD4 Zornitza Stark gene: OTUD4 was added
gene: OTUD4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: OTUD4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTUD4 were set to Hypogonadotropic hypogonadism, ataxia & dementia
Additional findings_Paediatric v0.2 OTOG Zornitza Stark gene: OTOG was added
gene: OTOG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: OTOG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOG were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 ORC6 Zornitza Stark gene: ORC6 was added
gene: ORC6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ORC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ORC6 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 ORC4 Zornitza Stark gene: ORC4 was added
gene: ORC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ORC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ORC4 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 OPA3 Zornitza Stark Source BabySeq Category C gene was added to OPA3.
Source Expert Review Red was added to OPA3.
Mode of inheritance for gene OPA3 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Optic atrophy 3 with cataract for gene: OPA3
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 NUP62 Zornitza Stark gene: NUP62 was added
gene: NUP62 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NUP62 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NUP62 were set to Striatonigral degeneration, infantile
Additional findings_Paediatric v0.2 NUP155 Zornitza Stark gene: NUP155 was added
gene: NUP155 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NUP155 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NUP155 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 NUB1 Zornitza Stark gene: NUB1 was added
gene: NUB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NUB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NUB1 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NTRK1 Zornitza Stark Source BabySeq Category C gene was added to NTRK1.
Source Expert Review Red was added to NTRK1.
Mode of inheritance for gene NTRK1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Medullary thyroid carcinoma, familial for gene: NTRK1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 NSDHL Zornitza Stark Source BabySeq Category C gene was added to NSDHL.
Source Expert Review Red was added to NSDHL.
Added phenotypes CK syndrome for gene: NSDHL
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 NRXN1 Zornitza Stark gene: NRXN1 was added
gene: NRXN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NRXN1 was set to Unknown
Phenotypes for gene: NRXN1 were set to Autism
Additional findings_Paediatric v0.2 NRG1 Zornitza Stark gene: NRG1 was added
gene: NRG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NRG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NRG1 were set to Hirschsprung disease
Additional findings_Paediatric v0.2 NR1H4 Zornitza Stark gene: NR1H4 was added
gene: NR1H4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NR1H4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NR1H4 were set to Cholestasis, infantile
Additional findings_Paediatric v0.2 NPPA Zornitza Stark gene: NPPA was added
gene: NPPA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NPPA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NPPA were set to Atrial fibrillation
Additional findings_Paediatric v0.2 NOTCH1 Zornitza Stark gene: NOTCH1 was added
gene: NOTCH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOTCH1 were set to Aortic valve disease
Additional findings_Paediatric v0.2 NOP10 Zornitza Stark gene: NOP10 was added
gene: NOP10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NOP10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NOP10 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 NME8 Zornitza Stark gene: NME8 was added
gene: NME8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NME8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NME8 were set to Ciliary dyskinesia, primary
Additional findings_Paediatric v0.2 NLRP7 Zornitza Stark gene: NLRP7 was added
gene: NLRP7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NLRP7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NLRP7 were set to Hydatidiform mole
Additional findings_Paediatric v0.2 NLGN4X Zornitza Stark gene: NLGN4X was added
gene: NLGN4X was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NLGN4X was set to Unknown
Phenotypes for gene: NLGN4X were set to Autism
Additional findings_Paediatric v0.2 NLGN3 Zornitza Stark gene: NLGN3 was added
gene: NLGN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NLGN3 was set to Unknown
Phenotypes for gene: NLGN3 were set to Autism
Additional findings_Paediatric v0.2 NKX3-2 Zornitza Stark gene: NKX3-2 was added
gene: NKX3-2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NKX3-2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NKX3-2 were set to Spondylo-megaepiphyseal-metaphyseal dysplasia
Additional findings_Paediatric v0.2 NIN Zornitza Stark gene: NIN was added
gene: NIN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NIN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NIN were set to Seckel syndrome
Additional findings_Paediatric v0.2 NHP2 Zornitza Stark gene: NHP2 was added
gene: NHP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NHP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NHP2 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 NFATC1 Zornitza Stark gene: NFATC1 was added
gene: NFATC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NFATC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NFATC1 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NEXN Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: NEXN
Additional findings_Paediatric v0.2 NEXN Zornitza Stark gene: NEXN was added
gene: NEXN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEXN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEXN were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 NEUROG3 Zornitza Stark gene: NEUROG3 was added
gene: NEUROG3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEUROG3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEUROG3 were set to Diarrhea 4, malabsorptive, congenital
Additional findings_Paediatric v0.2 NEK8 Zornitza Stark gene: NEK8 was added
gene: NEK8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEK8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEK8 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NEK1 Zornitza Stark gene: NEK1 was added
gene: NEK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEK1 were set to Short rib-polydactyly syndorme, type II
Additional findings_Paediatric v0.2 NEDD4L Zornitza Stark gene: NEDD4L was added
gene: NEDD4L was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEDD4L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEDD4L were set to Epilepsy, photosensitive generalised
Additional findings_Paediatric v0.2 NEBL Zornitza Stark gene: NEBL was added
gene: NEBL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEBL were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 NCF4 Zornitza Stark gene: NCF4 was added
gene: NCF4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NCF4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NCF4 were set to Chronic granulomatous disease
Additional findings_Paediatric v0.2 NAA15 Zornitza Stark gene: NAA15 was added
gene: NAA15 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NAA15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NAA15 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NAA10 Zornitza Stark gene: NAA10 was added
gene: NAA10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NAA10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NAA10 were set to N-terminal acetyltransferase deficiency
Additional findings_Paediatric v0.2 MYPN Zornitza Stark Added phenotypes Cardiomyopathy, hypertrophic for gene: MYPN
Additional findings_Paediatric v0.2 MYPN Zornitza Stark gene: MYPN was added
gene: MYPN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYPN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYPN were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 MYOZ2 Zornitza Stark gene: MYOZ2 was added
gene: MYOZ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYOZ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYOZ2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 MYOT Zornitza Stark gene: MYOT was added
gene: MYOT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYOT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYOT were set to Myofibrillar myopathy
Additional findings_Paediatric v0.2 MYOM1 Zornitza Stark gene: MYOM1 was added
gene: MYOM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYOM1 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 MYO5A Zornitza Stark gene: MYO5A was added
gene: MYO5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO5A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO5A were set to Griscelli syndrome
Additional findings_Paediatric v0.2 MYO1F Zornitza Stark gene: MYO1F was added
gene: MYO1F was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO1F was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO1F were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYO1E Zornitza Stark gene: MYO1E was added
gene: MYO1E was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO1E was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO1E were set to Focal segmental glomerulosclerosis
Additional findings_Paediatric v0.2 MYO1C Zornitza Stark gene: MYO1C was added
gene: MYO1C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO1C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO1C were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYLK2 Zornitza Stark gene: MYLK2 was added
gene: MYLK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYLK2 was set to Unknown
Phenotypes for gene: MYLK2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Congenital fiber type disproportion for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Source BabySeq Category C gene was added to MYH7.
Source Expert Review Red was added to MYH7.
Added phenotypes Scapuloperoneal syndrome, myopathic type for gene: MYH7
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 MYH6 Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: MYH6
Additional findings_Paediatric v0.2 MYH6 Zornitza Stark Added phenotypes Cardiomyopathy, dilated for gene: MYH6
Additional findings_Paediatric v0.2 MYH6 Zornitza Stark gene: MYH6 was added
gene: MYH6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYH6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH6 were set to Atrial septal defect
Additional findings_Paediatric v0.2 MYBPC3 Zornitza Stark Source BabySeq Category C gene was added to MYBPC3.
Source Expert Review Red was added to MYBPC3.
Added phenotypes Cardiomyopathy, dilated for gene: MYBPC3
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 MYBPC1 Zornitza Stark gene: MYBPC1 was added
gene: MYBPC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYBPC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYBPC1 were set to Distal arthrogryposis type I
Additional findings_Paediatric v0.2 CAVIN4 Zornitza Stark gene: CAVIN4 was added
gene: CAVIN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CAVIN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CAVIN4 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 MUC5B Zornitza Stark gene: MUC5B was added
gene: MUC5B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MUC5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MUC5B were set to Pulmonary fibrosis, idiopathic
Additional findings_Paediatric v0.2 MTO1 Zornitza Stark gene: MTO1 was added
gene: MTO1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MTO1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTO1 were set to Hypertrophic cardiomyopathy & lactic acidosis
Additional findings_Paediatric v0.2 MT-ND6 Zornitza Stark gene: MT-ND6 was added
gene: MT-ND6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene gene: MT-ND6 was set to MITOCHONDRIAL
Phenotypes for gene: MT-ND6 were set to Leber hereditary optic neuropathy
Additional findings_Paediatric v0.2 MT-ND4 Zornitza Stark gene: MT-ND4 was added
gene: MT-ND4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene gene: MT-ND4 was set to MITOCHONDRIAL
Phenotypes for gene: MT-ND4 were set to Leber hereditary optic neuropathy
Additional findings_Paediatric v0.2 MT-ND1 Zornitza Stark gene: MT-ND1 was added
gene: MT-ND1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene gene: MT-ND1 was set to MITOCHONDRIAL
Phenotypes for gene: MT-ND1 were set to Leber hereditary optic neuropathy
Additional findings_Paediatric v0.2 MSRB3 Zornitza Stark gene: MSRB3 was added
gene: MSRB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MSRB3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MSRB3 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 MSH6 Zornitza Stark gene: MSH6 was added
gene: MSH6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MSH6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MSH6 were set to Lynch syndrome
Additional findings_Paediatric v0.2 MSH2 Zornitza Stark gene: MSH2 was added
gene: MSH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MSH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MSH2 were set to Lynch syndrome
Additional findings_Paediatric v0.2 MRPS22 Zornitza Stark gene: MRPS22 was added
gene: MRPS22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MRPS22 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MRPS22 were set to Mitochondrial respiratory chain disorder
Additional findings_Paediatric v0.2 MRPS16 Zornitza Stark gene: MRPS16 was added
gene: MRPS16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MRPS16 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MRPS16 were set to Mitochondrial respiratory chain disorder
Additional findings_Paediatric v0.2 MPDU1 Zornitza Stark gene: MPDU1 was added
gene: MPDU1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MPDU1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPDU1 were set to Congenital disorder of glycosylation, type If
Additional findings_Paediatric v0.2 MOGS Zornitza Stark gene: MOGS was added
gene: MOGS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MOGS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MOGS were set to Glucosidase 1 deficiency
Additional findings_Paediatric v0.2 MLPH Zornitza Stark gene: MLPH was added
gene: MLPH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MLPH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MLPH were set to Griscelli syndrome type 3
Additional findings_Paediatric v0.2 MLH1 Zornitza Stark gene: MLH1 was added
gene: MLH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MLH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MLH1 were set to Lynch syndrome
Additional findings_Paediatric v0.2 MIR96 Zornitza Stark gene: MIR96 was added
gene: MIR96 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MIR96 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MIR96 were set to Hearing loss
Additional findings_Paediatric v0.2 MIB1 Zornitza Stark gene: MIB1 was added
gene: MIB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MIB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MIB1 were set to Left ventricular noncompaction
Additional findings_Paediatric v0.2 MGAT2 Zornitza Stark gene: MGAT2 was added
gene: MGAT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MGAT2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MGAT2 were set to CDG syndrome type IIa
Additional findings_Paediatric v0.2 MESP2 Zornitza Stark gene: MESP2 was added
gene: MESP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MESP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MESP2 were set to Spondylocostal dysostosis, autosomal recessive 2
Additional findings_Paediatric v0.2 MED25 Zornitza Stark gene: MED25 was added
gene: MED25 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MED25 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MED25 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 MED20 Zornitza Stark gene: MED20 was added
gene: MED20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MED20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MED20 were set to Congenital heart disease
Additional findings_Paediatric v0.2 MED13L Zornitza Stark gene: MED13L was added
gene: MED13L was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MED13L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MED13L were set to Transposition of great arteries
Additional findings_Paediatric v0.2 MCEE Zornitza Stark gene: MCEE was added
gene: MCEE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MCEE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCEE were set to Methylmalonyl-CoA epimerase deficiency
Additional findings_Paediatric v0.2 MATN4 Zornitza Stark gene: MATN4 was added
gene: MATN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MATN4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MATN4 were set to Multiple anomalies
Additional findings_Paediatric v0.2 MAT1A Zornitza Stark gene: MAT1A was added
gene: MAT1A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MAT1A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MAT1A were set to Methionine adenosyltransferase deficiency
Additional findings_Paediatric v0.2 MAPT Zornitza Stark gene: MAPT was added
gene: MAPT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MAPT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAPT were set to Dementia, frontotemporal, with or without parkinsonism
Additional findings_Paediatric v0.2 MAPK10 Zornitza Stark gene: MAPK10 was added
gene: MAPK10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MAPK10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAPK10 were set to Epileptic encephalopathy
Additional findings_Paediatric v0.2 LYZ Zornitza Stark gene: LYZ was added
gene: LYZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LYZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LYZ were set to Amyloidosis, systemic
Additional findings_Paediatric v0.2 LUM Zornitza Stark gene: LUM was added
gene: LUM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LUM was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LUM were set to Amyotrophic lateral sclerosis
Additional findings_Paediatric v0.2 LRRK2 Zornitza Stark gene: LRRK2 was added
gene: LRRK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LRRK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LRRK2 were set to Parkinson disease
Additional findings_Paediatric v0.2 LPP Zornitza Stark gene: LPP was added
gene: LPP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LPP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LPP were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 LPIN2 Zornitza Stark gene: LPIN2 was added
gene: LPIN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LPIN2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LPIN2 were set to Majeed syndrome
Additional findings_Paediatric v0.2 LMNB2 Zornitza Stark gene: LMNB2 was added
gene: LMNB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LMNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LMNB2 were set to Lipodystrophy, partial
Additional findings_Paediatric v0.2 LHB Zornitza Stark gene: LHB was added
gene: LHB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LHB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LHB were set to Hypogonadism
Additional findings_Paediatric v0.2 LGI1 Zornitza Stark gene: LGI1 was added
gene: LGI1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LGI1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LGI1 were set to Epilepsy, familial temporal lobe, 1
Additional findings_Paediatric v0.2 LDB3 Zornitza Stark gene: LDB3 was added
gene: LDB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LDB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LDB3 were set to Myofibrillar myopathy
Additional findings_Paediatric v0.2 LBR Zornitza Stark Source BabySeq Category C gene was added to LBR.
Source Expert Review Red was added to LBR.
Mode of inheritance for gene LBR was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Reynolds syndrome for gene: LBR
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 LARS2 Zornitza Stark gene: LARS2 was added
gene: LARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LARS2 were set to Perrault syndrome
Additional findings_Paediatric v0.2 LARS Zornitza Stark gene: LARS was added
gene: LARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LARS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LARS were set to Infantile liver failure syndrome
Additional findings_Paediatric v0.2 LAMA4 Zornitza Stark gene: LAMA4 was added
gene: LAMA4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LAMA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LAMA4 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 KRT8 Zornitza Stark gene: KRT8 was added
gene: KRT8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KRT8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT8 were set to Cirrhosis, cryptogenic
Additional findings_Paediatric v0.2 KRT6B Zornitza Stark gene: KRT6B was added
gene: KRT6B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KRT6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT6B were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT18 Zornitza Stark gene: KRT18 was added
gene: KRT18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KRT18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT18 were set to Cirrhosis, cryptogenic
Additional findings_Paediatric v0.2 KPTN Zornitza Stark gene: KPTN was added
gene: KPTN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KPTN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KPTN were set to Macrocephaly, neurodevelopmental delay, and seizures
Additional findings_Paediatric v0.2 KLF1 Zornitza Stark gene: KLF1 was added
gene: KLF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KLF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KLF1 were set to Anemia, dyserythropoietic congenital, type IV
Additional findings_Paediatric v0.2 KIF22 Zornitza Stark gene: KIF22 was added
gene: KIF22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KIF22 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIF22 were set to Spondyloepimetaphyseal dysplasia with joint laxity, type 2
Additional findings_Paediatric v0.2 KIF1B Zornitza Stark gene: KIF1B was added
gene: KIF1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KIF1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIF1B were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 KIF1BP Zornitza Stark gene: KIF1BP was added
gene: KIF1BP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KIF1BP were set to Goldberg-Shprintzen megacolon syndrome
Additional findings_Paediatric v0.2 KDM5B Zornitza Stark gene: KDM5B was added
gene: KDM5B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KDM5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KDM5B were set to Congenital heart disease
Additional findings_Paediatric v0.2 KCNQ3 Zornitza Stark gene: KCNQ3 was added
gene: KCNQ3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNQ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNQ3 were set to Epilepsy, benign neonatal
Additional findings_Paediatric v0.2 KCNQ2 Zornitza Stark gene: KCNQ2 was added
gene: KCNQ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNQ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNQ2 were set to Epilepsy, benign neonatal
Additional findings_Paediatric v0.2 KCNQ1OT1 Zornitza Stark gene: KCNQ1OT1 was added
gene: KCNQ1OT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNQ1OT1 was set to Unknown
Phenotypes for gene: KCNQ1OT1 were set to Beckwith-Wiedemann syndrome
Additional findings_Paediatric v0.2 KCNJ8 Zornitza Stark gene: KCNJ8 was added
gene: KCNJ8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNJ8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ8 were set to Sudden infant death syndrom
Additional findings_Paediatric v0.2 KCNJ5 Zornitza Stark gene: KCNJ5 was added
gene: KCNJ5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNJ5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ5 were set to Long QT syndrome
Additional findings_Paediatric v0.2 KCNJ18 Zornitza Stark gene: KCNJ18 was added
gene: KCNJ18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNJ18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ18 were set to Hypokalaemic periodic paralysis
Additional findings_Paediatric v0.2 KCNE3 Zornitza Stark gene: KCNE3 was added
gene: KCNE3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNE3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNE3 were set to Brugada syndrome
Additional findings_Paediatric v0.2 KCNE5 Zornitza Stark gene: KCNE5 was added
gene: KCNE5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNE5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNE5 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 KCND3 Zornitza Stark gene: KCND3 was added
gene: KCND3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCND3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCND3 were set to Brugada syndrome
Additional findings_Paediatric v0.2 KARS Zornitza Stark Added phenotypes Hearing loss for gene: KARS
Additional findings_Paediatric v0.2 KARS Zornitza Stark gene: KARS was added
gene: KARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KARS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KARS were set to Charcot-Marie-Tooth disease, recessive intermediate
Additional findings_Paediatric v0.2 JPH2 Zornitza Stark gene: JPH2 was added
gene: JPH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: JPH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: JPH2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 IYD Zornitza Stark gene: IYD was added
gene: IYD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IYD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IYD were set to Thyroid dyshormonogenesis
Additional findings_Paediatric v0.2 ITGA7 Zornitza Stark gene: ITGA7 was added
gene: ITGA7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ITGA7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGA7 were set to Congenital muscular dystrophy with integrin deficiency
Additional findings_Paediatric v0.2 ITGA6 Zornitza Stark gene: ITGA6 was added
gene: ITGA6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ITGA6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGA6 were set to Epidermolysis bullosa, junctional, with pyloric stenosis
Additional findings_Paediatric v0.2 ITGA3 Zornitza Stark gene: ITGA3 was added
gene: ITGA3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ITGA3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGA3 were set to Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital
Additional findings_Paediatric v0.2 ISL1 Zornitza Stark gene: ISL1 was added
gene: ISL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ISL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ISL1 were set to Diabetes, type 2
Additional findings_Paediatric v0.2 ISCU Zornitza Stark gene: ISCU was added
gene: ISCU was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ISCU was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ISCU were set to Myopathy with defiency of succinate dehydrogenase
Additional findings_Paediatric v0.2 IRS1 Zornitza Stark gene: IRS1 was added
gene: IRS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IRS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: IRS1 were set to Diabetes mellitus, noninsulin dependent
Additional findings_Paediatric v0.2 IRF6 Zornitza Stark Source BabySeq Category C gene was added to IRF6.
Source Expert Review Red was added to IRF6.
Added phenotypes Popliteal pterygium syndrome for gene: IRF6
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ILK Zornitza Stark gene: ILK was added
gene: ILK was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ILK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ILK were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 IL10RB Zornitza Stark gene: IL10RB was added
gene: IL10RB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IL10RB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IL10RB were set to Inflammatory bowel disease
Additional findings_Paediatric v0.2 IGF1 Zornitza Stark gene: IGF1 was added
gene: IGF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IGF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IGF1 were set to Insulin-like growth factor deficiency
Additional findings_Paediatric v0.2 IGBP1 Zornitza Stark gene: IGBP1 was added
gene: IGBP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IGBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IGBP1 were set to Agenesis of the corpus callosum - intellectual deficit - coloboma - micrognathia
Additional findings_Paediatric v0.2 IFT80 Zornitza Stark gene: IFT80 was added
gene: IFT80 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IFT80 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT80 were set to Asphyxiating thoracic dystrophy 2
Additional findings_Paediatric v0.2 IFT43 Zornitza Stark gene: IFT43 was added
gene: IFT43 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IFT43 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT43 were set to Cranioectodermal dysplasia
Additional findings_Paediatric v0.2 IFT122 Zornitza Stark gene: IFT122 was added
gene: IFT122 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IFT122 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT122 were set to Cranioectodermal dysplasia
Additional findings_Paediatric v0.2 HYLS1 Zornitza Stark gene: HYLS1 was added
gene: HYLS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HYLS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HYLS1 were set to Hydrolethalus syndrome
Additional findings_Paediatric v0.2 HYDIN Zornitza Stark gene: HYDIN was added
gene: HYDIN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HYDIN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HYDIN were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 HPS6 Zornitza Stark gene: HPS6 was added
gene: HPS6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HPS6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS6 were set to Hermansky-Pudlak syndrome 6
Additional findings_Paediatric v0.2 HPD Zornitza Stark gene: HPD was added
gene: HPD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HPD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPD were set to Tyrosinemia, type III
Additional findings_Paediatric v0.2 HOXA1 Zornitza Stark gene: HOXA1 was added
gene: HOXA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HOXA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HOXA1 were set to Athabaskan brainstem dysgenesis syndrome
Additional findings_Paediatric v0.2 HOMEZ Zornitza Stark gene: HOMEZ was added
gene: HOMEZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HOMEZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HOMEZ were set to Congenital heart disease
Additional findings_Paediatric v0.2 HNF4A Zornitza Stark gene: HNF4A was added
gene: HNF4A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HNF4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HNF4A were set to Hypoglycaemia, hyperinsulinaemic
Additional findings_Paediatric v0.2 HNF1B Zornitza Stark gene: HNF1B was added
gene: HNF1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HNF1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HNF1B were set to Renal cysts and diabetes syndrome
Additional findings_Paediatric v0.2 HMBS Zornitza Stark gene: HMBS was added
gene: HMBS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HMBS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HMBS were set to Porphyria, acute intermittent
Additional findings_Paediatric v0.2 HK1 Zornitza Stark gene: HK1 was added
gene: HK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HK1 were set to Hemolytic anemia due to hexokinase deficiency
Additional findings_Paediatric v0.2 HIBCH Zornitza Stark gene: HIBCH was added
gene: HIBCH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HIBCH were set to Neurodegeneration, progressive infantile
Additional findings_Paediatric v0.2 HGF Zornitza Stark gene: HGF was added
gene: HGF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HGF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HGF were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 HFE2 Zornitza Stark gene: HFE2 was added
gene: HFE2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HFE2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HFE2 were set to Haemochromatosis
Additional findings_Paediatric v0.2 HFE Zornitza Stark gene: HFE was added
gene: HFE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HFE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HFE were set to Hemochromatosis
Additional findings_Paediatric v0.2 HESX1 Zornitza Stark gene: HESX1 was added
gene: HESX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HESX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HESX1 were set to Pituitary hypoplasia
Additional findings_Paediatric v0.2 HERC2 Zornitza Stark gene: HERC2 was added
gene: HERC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HERC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HERC2 were set to Autism spectrum disorder
Additional findings_Paediatric v0.2 DNAAF5 Zornitza Stark gene: DNAAF5 was added
gene: DNAAF5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAAF5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAAF5 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 HCN4 Zornitza Stark gene: HCN4 was added
gene: HCN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HCN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HCN4 were set to Brugada syndrome
Additional findings_Paediatric v0.2 HCCS Zornitza Stark gene: HCCS was added
gene: HCCS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HCCS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HCCS were set to Microphthalmia
Additional findings_Paediatric v0.2 HAS2 Zornitza Stark gene: HAS2 was added
gene: HAS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HAS2 were set to Congenital heart disease
Additional findings_Paediatric v0.2 HARS2 Zornitza Stark gene: HARS2 was added
gene: HARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HARS2 were set to Perrault syndrome
Additional findings_Paediatric v0.2 HARS Zornitza Stark gene: HARS was added
gene: HARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HARS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HARS were set to Usher syndrome type 3B
Additional findings_Paediatric v0.2 HAMP Zornitza Stark gene: HAMP was added
gene: HAMP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HAMP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HAMP were set to Haemochromatosis
Additional findings_Paediatric v0.2 HADH Zornitza Stark Source BabySeq Category C gene was added to HADH.
Source Expert Review Red was added to HADH.
Added phenotypes 3-hydroxyacyl-CoA dehydrogenase deficiency for gene: HADH
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 GYG1 Zornitza Stark gene: GYG1 was added
gene: GYG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GYG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GYG1 were set to Glycogen storage disease XV
Additional findings_Paediatric v0.2 GUCY2C Zornitza Stark gene: GUCY2C was added
gene: GUCY2C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GUCY2C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GUCY2C were set to Meconium ileus
Additional findings_Paediatric v0.2 GTF2H5 Zornitza Stark gene: GTF2H5 was added
gene: GTF2H5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GTF2H5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GTF2H5 were set to Trichothiodystrophy
Additional findings_Paediatric v0.2 GRXCR1 Zornitza Stark gene: GRXCR1 was added
gene: GRXCR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GRXCR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GRXCR1 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 GRIN2A Zornitza Stark gene: GRIN2A was added
gene: GRIN2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GRIN2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GRIN2A were set to Epilepsy with neurodevelopmental defects
Additional findings_Paediatric v0.2 GRHL2 Zornitza Stark gene: GRHL2 was added
gene: GRHL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GRHL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GRHL2 were set to Hearing loss
Additional findings_Paediatric v0.2 GPX1 Zornitza Stark gene: GPX1 was added
gene: GPX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPX1 were set to Hemolytic anemia due to glutathione peroxidase deficiency
Additional findings_Paediatric v0.2 GPHN Zornitza Stark gene: GPHN was added
gene: GPHN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPHN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPHN were set to Hyperekplexia
Additional findings_Paediatric v0.2 GPC6 Zornitza Stark gene: GPC6 was added
gene: GPC6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPC6 were set to Omodysplasia
Additional findings_Paediatric v0.2 GPC4 Zornitza Stark gene: GPC4 was added
gene: GPC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPC4 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GPC4 were set to Simpson-Golabi-Behmel syndrome
Additional findings_Paediatric v0.2 GMPPA Zornitza Stark gene: GMPPA was added
gene: GMPPA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GMPPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GMPPA were set to Congenital disorder of glycosylation
Additional findings_Paediatric v0.2 GLUL Zornitza Stark gene: GLUL was added
gene: GLUL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLUL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLUL were set to Congenital brain dysgenesis due to glutamine synthetase deficiency
Additional findings_Paediatric v0.2 GLRB Zornitza Stark gene: GLRB was added
gene: GLRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLRB were set to Hyperekplexia 2, autosomal recessive
Additional findings_Paediatric v0.2 GLIS3 Zornitza Stark gene: GLIS3 was added
gene: GLIS3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLIS3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLIS3 were set to Diabetes mellitus, neonatal, with congenital hypothyroidism
Additional findings_Paediatric v0.2 GLI2 Zornitza Stark gene: GLI2 was added
gene: GLI2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GLI2 were set to Holoprosencephaly-9
Additional findings_Paediatric v0.2 GLE1 Zornitza Stark gene: GLE1 was added
gene: GLE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLE1 were set to Lethal arthrogryposis with anterior horn cell disease
Additional findings_Paediatric v0.2 GFER Zornitza Stark gene: GFER was added
gene: GFER was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GFER was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GFER were set to Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay
Additional findings_Paediatric v0.2 GDNF Zornitza Stark Added phenotypes Central hypoventilation syndrome for gene: GDNF
Additional findings_Paediatric v0.2 GDNF Zornitza Stark gene: GDNF was added
gene: GDNF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GDNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GDNF were set to Hirschsprung disease
Additional findings_Paediatric v0.2 GDF1 Zornitza Stark gene: GDF1 was added
gene: GDF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GDF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GDF1 were set to Congenital heart defects
Additional findings_Paediatric v0.2 GCSH Zornitza Stark gene: GCSH was added
gene: GCSH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GCSH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GCSH were set to Glycine encephalopathy
Additional findings_Paediatric v0.2 GCLC Zornitza Stark gene: GCLC was added
gene: GCLC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GCLC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GCLC were set to Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency
Additional findings_Paediatric v0.2 GBE1 Zornitza Stark Source BabySeq Category C gene was added to GBE1.
Source Expert Review Red was added to GBE1.
Added phenotypes Polyglucosan body disease, adult form for gene: GBE1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 GATAD1 Zornitza Stark gene: GATAD1 was added
gene: GATAD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GATAD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GATAD1 were set to Cardiomyopathy, dilated, 2B
Additional findings_Paediatric v0.2 GATA6 Zornitza Stark gene: GATA6 was added
gene: GATA6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GATA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GATA6 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 GATA5 Zornitza Stark gene: GATA5 was added
gene: GATA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GATA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GATA5 were set to Familial atrial fibrillation
Additional findings_Paediatric v0.2 GATA1 Zornitza Stark Source BabySeq Category C gene was added to GATA1.
Source Expert Review Red was added to GATA1.
Added phenotypes Porphyria, congenital erythropoietic for gene: GATA1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 GABRG2 Zornitza Stark gene: GABRG2 was added
gene: GABRG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GABRG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GABRG2 were set to Epilepsy, childhood absence with febrile seizure
Additional findings_Paediatric v0.2 GABRA1 Zornitza Stark gene: GABRA1 was added
gene: GABRA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GABRA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GABRA1 were set to Epilepsy, idiopathic generalised
Additional findings_Paediatric v0.2 FTCD Zornitza Stark gene: FTCD was added
gene: FTCD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FTCD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FTCD were set to Glutamate formiminotransferase deficiency
Additional findings_Paediatric v0.2 FSCN2 Zornitza Stark gene: FSCN2 was added
gene: FSCN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FSCN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FSCN2 were set to Retinitis pigmentosa
Additional findings_Paediatric v0.2 FREM2 Zornitza Stark gene: FREM2 was added
gene: FREM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FREM2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FREM2 were set to Fraser syndrome
Additional findings_Paediatric v0.2 FREM1 Zornitza Stark gene: FREM1 was added
gene: FREM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FREM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FREM1 were set to Manitoba oculotrichoanal syndrome
Additional findings_Paediatric v0.2 FOXN1 Zornitza Stark gene: FOXN1 was added
gene: FOXN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FOXN1 were set to Congenital alopecia with T-cell immunodeficiency
Additional findings_Paediatric v0.2 FOXH1 Zornitza Stark gene: FOXH1 was added
gene: FOXH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FOXH1 were set to Congenital heart defects
Additional findings_Paediatric v0.2 FOXF2 Zornitza Stark gene: FOXF2 was added
gene: FOXF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FOXF2 were set to Disorders of sex development with cleft palate
Additional findings_Paediatric v0.2 FOXE1 Zornitza Stark gene: FOXE1 was added
gene: FOXE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FOXE1 were set to Bamforth-Lazarus syndrome
Additional findings_Paediatric v0.2 FMO3 Zornitza Stark gene: FMO3 was added
gene: FMO3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FMO3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FMO3 were set to Trimethylaminuria
Additional findings_Paediatric v0.2 FLNC Zornitza Stark gene: FLNC was added
gene: FLNC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FLNC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FLNC were set to Myofibrillar myopathy
Additional findings_Paediatric v0.2 FLG Zornitza Stark gene: FLG was added
gene: FLG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FLG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FLG were set to Ichthyosis vulgaris
Additional findings_Paediatric v0.2 FKBPL Zornitza Stark gene: FKBPL was added
gene: FKBPL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FKBPL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FKBPL were set to Infertility
Additional findings_Paediatric v0.2 FHL2 Zornitza Stark gene: FHL2 was added
gene: FHL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FHL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FHL2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 FHL1 Zornitza Stark Source BabySeq Category C gene was added to FHL1.
Source Expert Review Red was added to FHL1.
Added phenotypes Myofibrillar myopathy for gene: FHL1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FH Zornitza Stark Source BabySeq Category C gene was added to FH.
Source Expert Review Red was added to FH.
Mode of inheritance for gene FH was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Leiomyomatosis and renal cell cancer for gene: FH
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes LADD syndrome for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Source BabySeq Category C gene was added to FGFR3.
Source Expert Review Red was added to FGFR3.
Added phenotypes CATSHL syndrome for gene: FGFR3
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FBN1 Zornitza Stark Added phenotypes Shprintzen-Goldberg syndrome for gene: FBN1
Additional findings_Paediatric v0.2 FBN1 Zornitza Stark Source BabySeq Category C gene was added to FBN1.
Source Expert Review Red was added to FBN1.
Added phenotypes Weill-Marchesani syndrome 2, dominant for gene: FBN1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FBLN5 Zornitza Stark Source BabySeq Category C gene was added to FBLN5.
Source Expert Review Red was added to FBLN5.
Mode of inheritance for gene FBLN5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Age-related macular degeneration for gene: FBLN5
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FANCM Zornitza Stark gene: FANCM was added
gene: FANCM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCM were set to Fanconi anaemia
Additional findings_Paediatric v0.2 FANCL Zornitza Stark gene: FANCL was added
gene: FANCL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCL were set to Fanconi anaemia
Additional findings_Paediatric v0.2 FANCF Zornitza Stark gene: FANCF was added
gene: FANCF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCF were set to Fanconi anaemia
Additional findings_Paediatric v0.2 FANCE Zornitza Stark gene: FANCE was added
gene: FANCE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCE were set to Fanconi anaemia
Additional findings_Paediatric v0.2 RETREG1 Zornitza Stark gene: RETREG1 was added
gene: RETREG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RETREG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RETREG1 were set to Neuropathy, hereditary sensory and autonomic, type IIB
Additional findings_Paediatric v0.2 FAM111B Zornitza Stark gene: FAM111B was added
gene: FAM111B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FAM111B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FAM111B were set to Hereditary fibrosing poikiloderma with tendon contracture, myopathy, and pulmonary fibrosis
Additional findings_Paediatric v0.2 FAAH2 Zornitza Stark gene: FAAH2 was added
gene: FAAH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FAAH2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FAAH2 were set to Autism spectrum disorder
Additional findings_Paediatric v0.2 F5 Zornitza Stark gene: F5 was added
gene: F5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: F5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: F5 were set to Risk for deep vein thrombosis
Additional findings_Paediatric v0.2 ESPN Zornitza Stark gene: ESPN was added
gene: ESPN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ESPN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ESPN were set to Hearing loss
Additional findings_Paediatric v0.2 ERCC4 Zornitza Stark gene: ERCC4 was added
gene: ERCC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC4 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 ERCC3 Zornitza Stark gene: ERCC3 was added
gene: ERCC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERCC3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC3 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 ERCC1 Zornitza Stark gene: ERCC1 was added
gene: ERCC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERCC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC1 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 ERBB3 Zornitza Stark gene: ERBB3 was added
gene: ERBB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERBB3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERBB3 were set to Lethal congenital contractural syndrome 2
Additional findings_Paediatric v0.2 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EPHX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EPHX1 were set to Hypercholanemia, familial
Additional findings_Paediatric v0.2 EPCAM Zornitza Stark gene: EPCAM was added
gene: EPCAM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EPCAM was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EPCAM were set to Lynch syndrome
Additional findings_Paediatric v0.2 EPB42 Zornitza Stark gene: EPB42 was added
gene: EPB42 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EPB42 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EPB42 were set to Spherocytosis
Additional findings_Paediatric v0.2 EIF2B1 Zornitza Stark gene: EIF2B1 was added
gene: EIF2B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EIF2B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2B1 were set to Leukoencephalopathy with vanishing white matter
Additional findings_Paediatric v0.2 EFEMP2 Zornitza Stark gene: EFEMP2 was added
gene: EFEMP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EFEMP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EFEMP2 were set to Cutis laxa, autosomal recessive, type IB
Additional findings_Paediatric v0.2 EDNRB Zornitza Stark Added phenotypes Waardenburg syndrome for gene: EDNRB
Additional findings_Paediatric v0.2 EDNRB Zornitza Stark gene: EDNRB was added
gene: EDNRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EDNRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EDNRB were set to Hirschsprung disease
Additional findings_Paediatric v0.2 EDN3 Zornitza Stark Added phenotypes Waardenburg syndrome for gene: EDN3
Additional findings_Paediatric v0.2 EDN3 Zornitza Stark gene: EDN3 was added
gene: EDN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EDN3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EDN3 were set to Hirschsprung disease
Additional findings_Paediatric v0.2 ECE1 Zornitza Stark gene: ECE1 was added
gene: ECE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ECE1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ECE1 were set to Hirschsprung disease
Additional findings_Paediatric v0.2 DUOXA2 Zornitza Stark gene: DUOXA2 was added
gene: DUOXA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DUOXA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DUOXA2 were set to Thyroid dyshormonogenesis
Additional findings_Paediatric v0.2 DTNBP1 Zornitza Stark gene: DTNBP1 was added
gene: DTNBP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DTNBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DTNBP1 were set to Hermansky-Pudlak syndrome 7
Additional findings_Paediatric v0.2 DTNA Zornitza Stark gene: DTNA was added
gene: DTNA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DTNA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DTNA were set to Left ventricular noncompaction 1
Additional findings_Paediatric v0.2 DTHD1 Zornitza Stark gene: DTHD1 was added
gene: DTHD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DTHD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DTHD1 were set to Leber congenital amaurosis with myopathy
Additional findings_Paediatric v0.2 DPYD Zornitza Stark gene: DPYD was added
gene: DPYD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DPYD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DPYD were set to Dihydropyrimidine dehydrogenase deficiency
Additional findings_Paediatric v0.2 DPP6 Zornitza Stark gene: DPP6 was added
gene: DPP6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DPP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DPP6 were set to Ventricular fibrillation, paroxysmal familial, 2
Additional findings_Paediatric v0.2 DPM1 Zornitza Stark gene: DPM1 was added
gene: DPM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DPM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DPM1 were set to Congenital disorder of glycosylation, type Ie
Additional findings_Paediatric v0.2 DOLK Zornitza Stark gene: DOLK was added
gene: DOLK was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DOLK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DOLK were set to Congenital disorder of glycosylation, type Im
Additional findings_Paediatric v0.2 DNAL1 Zornitza Stark gene: DNAL1 was added
gene: DNAL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAL1 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DNAJC5 Zornitza Stark gene: DNAJC5 was added
gene: DNAJC5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAJC5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DNAJC5 were set to Neuronal ceroid lipofuscinosis, adult-onset
Additional findings_Paediatric v0.2 DNAJC19 Zornitza Stark gene: DNAJC19 was added
gene: DNAJC19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAJC19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAJC19 were set to 3-methylglutaconic aciduria, type V
Additional findings_Paediatric v0.2 DNAI2 Zornitza Stark gene: DNAI2 was added
gene: DNAI2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAI2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAI2 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DNAAF3 Zornitza Stark gene: DNAAF3 was added
gene: DNAAF3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAAF3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAAF3 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DNAAF2 Zornitza Stark gene: DNAAF2 was added
gene: DNAAF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAAF2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAAF2 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DLC1 Zornitza Stark gene: DLC1 was added
gene: DLC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DLC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DLC1 were set to Congenital heart disease
Additional findings_Paediatric v0.2 DIAPH1 Zornitza Stark gene: DIAPH1 was added
gene: DIAPH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DIAPH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DIAPH1 were set to Hearing loss
Additional findings_Paediatric v0.2 DIABLO Zornitza Stark gene: DIABLO was added
gene: DIABLO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DIABLO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DIABLO were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 DHCR24 Zornitza Stark gene: DHCR24 was added
gene: DHCR24 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DHCR24 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHCR24 were set to Desmosterolosis
Additional findings_Paediatric v0.2 DGKE Zornitza Stark gene: DGKE was added
gene: DGKE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DGKE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DGKE were set to Haemolytic uraemic syndrome, atypical
Additional findings_Paediatric v0.2 WHRN Zornitza Stark gene: WHRN was added
gene: WHRN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WHRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WHRN were set to Hearing loss
Additional findings_Paediatric v0.2 DECR1 Zornitza Stark gene: DECR1 was added
gene: DECR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DECR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DECR1 were set to 2,4-Dienoyl-CoA reductase deficiency
Additional findings_Paediatric v0.2 DDR2 Zornitza Stark gene: DDR2 was added
gene: DDR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DDR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDR2 were set to Spondylometaepiphyseal dysplasia, short limb-hand type
Additional findings_Paediatric v0.2 DDOST Zornitza Stark gene: DDOST was added
gene: DDOST was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DDOST was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDOST were set to Congenital disorder of glycosylation, type Ir
Additional findings_Paediatric v0.2 DDHD1 Zornitza Stark gene: DDHD1 was added
gene: DDHD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DDHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDHD1 were set to Spastic paraplegia
Additional findings_Paediatric v0.2 DCX Zornitza Stark Source BabySeq Category C gene was added to DCX.
Source Expert Review Red was added to DCX.
Added phenotypes Lennox-Gastaut syndrome for gene: DCX
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 DCTN1 Zornitza Stark gene: DCTN1 was added
gene: DCTN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DCTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DCTN1 were set to Amyotrophic lateral sclerosis
Additional findings_Paediatric v0.2 DBH Zornitza Stark gene: DBH was added
gene: DBH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DBH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DBH were set to Dopamine beta-hydroxylase deficiency
Additional findings_Paediatric v0.2 DAPK3 Zornitza Stark gene: DAPK3 was added
gene: DAPK3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DAPK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DAPK3 were set to Congenital heart disease
Additional findings_Paediatric v0.2 DAG1 Zornitza Stark gene: DAG1 was added
gene: DAG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DAG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DAG1 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9
Additional findings_Paediatric v0.2 CYP7B1 Zornitza Stark gene: CYP7B1 was added
gene: CYP7B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CYP7B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP7B1 were set to Cholestasis, severe
Additional findings_Paediatric v0.2 CYP7A1 Zornitza Stark gene: CYP7A1 was added
gene: CYP7A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CYP7A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP7A1 were set to Hypercholesterolemia due to cholesterol 7alpha-hydroxylase deficiency
Additional findings_Paediatric v0.2 CYCS Zornitza Stark gene: CYCS was added
gene: CYCS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CYCS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CYCS were set to Thrombocytopenia 4
Additional findings_Paediatric v0.2 CTF1 Zornitza Stark gene: CTF1 was added
gene: CTF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CTF1 was set to Unknown
Phenotypes for gene: CTF1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 CTDP1 Zornitza Stark gene: CTDP1 was added
gene: CTDP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CTDP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CTDP1 were set to Congenital cataracts - facial dysmorphism - neuropathy
Additional findings_Paediatric v0.2 CSTA Zornitza Stark gene: CSTA was added
gene: CSTA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CSTA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CSTA were set to Exfoliative ichthyosis
Additional findings_Paediatric v0.2 CSRP3 Zornitza Stark Source BabySeq Category C gene was added to CSRP3.
Source Expert Review Red was added to CSRP3.
Added phenotypes Cardiomyopathy, dilated, 1M for gene: CSRP3
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 CSF2RB Zornitza Stark gene: CSF2RB was added
gene: CSF2RB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CSF2RB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CSF2RB were set to Pulmonary alveolar proteinosis
Additional findings_Paediatric v0.2 CSF1R Zornitza Stark gene: CSF1R was added
gene: CSF1R was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CSF1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CSF1R were set to Leukoencephalopathy, diffuse hereditary, with spheroids
Additional findings_Paediatric v0.2 CRELD1 Zornitza Stark gene: CRELD1 was added
gene: CRELD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CRELD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CRELD1 were set to Cardiac atrioventricular septal defect
Additional findings_Paediatric v0.2 CR2 Zornitza Stark gene: CR2 was added
gene: CR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CR2 were set to Hypogammaglobulinaemia
Additional findings_Paediatric v0.2 CPZ Zornitza Stark gene: CPZ was added
gene: CPZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CPZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CPZ were set to Autism
Additional findings_Paediatric v0.2 CPOX Zornitza Stark gene: CPOX was added
gene: CPOX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CPOX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CPOX were set to Coproporphyria
Additional findings_Paediatric v0.2 COX4I2 Zornitza Stark gene: COX4I2 was added
gene: COX4I2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COX4I2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COX4I2 were set to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis
Additional findings_Paediatric v0.2 COQ6 Zornitza Stark gene: COQ6 was added
gene: COQ6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COQ6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COQ6 were set to Nephrotic syndrome with sensorineural deafness
Additional findings_Paediatric v0.2 COQ2 Zornitza Stark gene: COQ2 was added
gene: COQ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COQ2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COQ2 were set to Coenzyme Q10 deficiency, primary, 1
Additional findings_Paediatric v0.2 COL9A2 Zornitza Stark gene: COL9A2 was added
gene: COL9A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COL9A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL9A2 were set to Stickler syndrome
Additional findings_Paediatric v0.2 COL9A1 Zornitza Stark gene: COL9A1 was added
gene: COL9A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COL9A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL9A1 were set to Stickler syndrome
Additional findings_Paediatric v0.2 COL1A1 Zornitza Stark Source BabySeq Category C gene was added to COL1A1.
Source Expert Review Red was added to COL1A1.
Added phenotypes Caffey disease for gene: COL1A1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 COG7 Zornitza Stark gene: COG7 was added
gene: COG7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COG7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COG7 were set to Congenital disorder of glycosylation, type IIe
Additional findings_Paediatric v0.2 COG5 Zornitza Stark gene: COG5 was added
gene: COG5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COG5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COG5 were set to Congenital disorder of glycosylation, type IIi
Additional findings_Paediatric v0.2 COG4 Zornitza Stark gene: COG4 was added
gene: COG4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COG4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COG4 were set to Congenital disorder of glycosylation, type IIj
Additional findings_Paediatric v0.2 CNTNAP2 Zornitza Stark gene: CNTNAP2 was added
gene: CNTNAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CNTNAP2 was set to Unknown
Phenotypes for gene: CNTNAP2 were set to Autism spectrum disorder
Additional findings_Paediatric v0.2 CLPP Zornitza Stark gene: CLPP was added
gene: CLPP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLPP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLPP were set to Perrault syndrome
Additional findings_Paediatric v0.2 CLMP Zornitza Stark gene: CLMP was added
gene: CLMP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLMP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLMP were set to Congenital short-bowel syndrome
Additional findings_Paediatric v0.2 CLDN1 Zornitza Stark gene: CLDN1 was added
gene: CLDN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLDN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLDN1 were set to Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis
Additional findings_Paediatric v0.2 CLCN7 Zornitza Stark gene: CLCN7 was added
gene: CLCN7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLCN7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CLCN7 were set to Osteopetrosis
Additional findings_Paediatric v0.2 CLCN1 Zornitza Stark gene: CLCN1 was added
gene: CLCN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CLCN1 were set to Myotonia congenita
Additional findings_Paediatric v0.2 CITED2 Zornitza Stark gene: CITED2 was added
gene: CITED2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CITED2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CITED2 were set to Congenital heart defects
Additional findings_Paediatric v0.2 CISD2 Zornitza Stark gene: CISD2 was added
gene: CISD2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CISD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CISD2 were set to Wolfram syndrome
Additional findings_Paediatric v0.2 UTP4 Zornitza Stark gene: UTP4 was added
gene: UTP4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UTP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UTP4 were set to North American Indian childhood cirrhosis
Additional findings_Paediatric v0.2 CHSY1 Zornitza Stark gene: CHSY1 was added
gene: CHSY1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome
Additional findings_Paediatric v0.2 CHST3 Zornitza Stark gene: CHST3 was added
gene: CHST3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHST3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHST3 were set to Larsen syndrome
Additional findings_Paediatric v0.2 CHRNB1 Zornitza Stark gene: CHRNB1 was added
gene: CHRNB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHRNB1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHRNB1 were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.2 CHRNA2 Zornitza Stark gene: CHRNA2 was added
gene: CHRNA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHRNA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHRNA2 were set to Epilepsy
Additional findings_Paediatric v0.2 CHRM2 Zornitza Stark gene: CHRM2 was added
gene: CHRM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHRM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHRM2 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 CHEK2 Zornitza Stark gene: CHEK2 was added
gene: CHEK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHEK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHEK2 were set to Breast cancer, susceptibility to
Additional findings_Paediatric v0.2 CFI Zornitza Stark gene: CFI was added
gene: CFI was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFI was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFI were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFHR5 Zornitza Stark gene: CFHR5 was added
gene: CFHR5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CFHR5 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFHR4 Zornitza Stark gene: CFHR4 was added
gene: CFHR4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR4 was set to Unknown
Phenotypes for gene: CFHR4 were set to Hemolytic-uremic syndrome, atypical, susceptibility to
Additional findings_Paediatric v0.2 CFHR3 Zornitza Stark gene: CFHR3 was added
gene: CFHR3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFHR3 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFHR1 Zornitza Stark gene: CFHR1 was added
gene: CFHR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFHR1 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFH Zornitza Stark gene: CFH was added
gene: CFH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFH were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFD Zornitza Stark gene: CFD was added
gene: CFD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFD were set to Complement factor D deficiency
Additional findings_Paediatric v0.2 CFB Zornitza Stark gene: CFB was added
gene: CFB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CFB were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CEP41 Zornitza Stark gene: CEP41 was added
gene: CEP41 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CEP41 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP41 were set to Joubert syndrome
Additional findings_Paediatric v0.2 CENPJ Zornitza Stark gene: CENPJ was added
gene: CENPJ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CENPJ was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CENPJ were set to Primary microcephaly
Additional findings_Paediatric v0.2 CEACAM16 Zornitza Stark gene: CEACAM16 was added
gene: CEACAM16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CEACAM16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CEACAM16 were set to Hearing loss, autosomal dominant
Additional findings_Paediatric v0.2 CDT1 Zornitza Stark gene: CDT1 was added
gene: CDT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CDT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDT1 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 CDON Zornitza Stark gene: CDON was added
gene: CDON was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CDON was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDON were set to Holoprosencephaly
Additional findings_Paediatric v0.2 CDK5RAP2 Zornitza Stark gene: CDK5RAP2 was added
gene: CDK5RAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CDK5RAP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDK5RAP2 were set to Microcephaly 3, primary, autosomal recessive
Additional findings_Paediatric v0.2 CDH1 Zornitza Stark Source BabySeq Category C gene was added to CDH1.
Source Expert Review Red was added to CDH1.
Added phenotypes Orofacial clefts for gene: CDH1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 CD96 Zornitza Stark gene: CD96 was added
gene: CD96 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD96 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD96 were set to C syndrome
Additional findings_Paediatric v0.2 CD46 Zornitza Stark gene: CD46 was added
gene: CD46 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD46 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD46 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CD36 Zornitza Stark gene: CD36 was added
gene: CD36 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD36 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD36 were set to Platelet glycoprotein IV deficiency
Additional findings_Paediatric v0.2 CD2AP Zornitza Stark gene: CD2AP was added
gene: CD2AP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD2AP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD2AP were set to Glomerulosclerosis, focal segmental, 3
Additional findings_Paediatric v0.2 CCDC88C Zornitza Stark gene: CCDC88C was added
gene: CCDC88C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC88C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC88C were set to Hydrocephalus
Additional findings_Paediatric v0.2 CCDC78 Zornitza Stark gene: CCDC78 was added
gene: CCDC78 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC78 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CCDC78 were set to Congenital myopathy with prominent internal nuclei and atypical cores
Additional findings_Paediatric v0.2 CCDC50 Zornitza Stark gene: CCDC50 was added
gene: CCDC50 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC50 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC50 were set to Hearing loss
Additional findings_Paediatric v0.2 CCDC103 Zornitza Stark gene: CCDC103 was added
gene: CCDC103 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC103 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC103 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Mode of inheritance for gene CAV3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Rippling muscle disease for gene: CAV3
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Added phenotypes Long QT syndrome-9 for gene: CAV3
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Source BabySeq Category C gene was added to CAV3.
Source Expert Review Red was added to CAV3.
Added phenotypes Cardiomyopathy, familial hypertrophic for gene: CAV3
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 CASP10 Zornitza Stark gene: CASP10 was added
gene: CASP10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CASP10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CASP10 were set to Autoimmune lymphoproliferative syndrome II
Additional findings_Paediatric v0.2 CARS2 Zornitza Stark gene: CARS2 was added
gene: CARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CARS2 were set to Epileptic encephalopathy
Additional findings_Paediatric v0.2 CACNB2 Zornitza Stark gene: CACNB2 was added
gene: CACNB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNB2 were set to Brugada syndrome
Additional findings_Paediatric v0.2 CACNA2D1 Zornitza Stark gene: CACNA2D1 was added
gene: CACNA2D1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNA2D1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNA2D1 were set to Brugada syndrome
Additional findings_Paediatric v0.2 CACNA1S Zornitza Stark gene: CACNA1S was added
gene: CACNA1S was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNA1S was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNA1S were set to Malignant hyperthermia
Additional findings_Paediatric v0.2 CACNA1D Zornitza Stark gene: CACNA1D was added
gene: CACNA1D was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNA1D was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CACNA1D were set to Sinoatrial node dysfunction and deafness
Additional findings_Paediatric v0.2 C3 Zornitza Stark gene: C3 was added
gene: C3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: C3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C3 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 BVES Zornitza Stark gene: BVES was added
gene: BVES was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BVES was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BVES were set to Congenital heart disease
Additional findings_Paediatric v0.2 BSCL2 Zornitza Stark Source BabySeq Category C gene was added to BSCL2.
Source Expert Review Red was added to BSCL2.
Mode of inheritance for gene BSCL2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Silver spastic paraplegia syndrome for gene: BSCL2
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BRCA2 Zornitza Stark Source BabySeq Category C gene was added to BRCA2.
Source Expert Review Red was added to BRCA2.
Mode of inheritance for gene BRCA2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Breast-ovarian cancer, familial, 2 for gene: BRCA2
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BRCA1 Zornitza Stark gene: BRCA1 was added
gene: BRCA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BRCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BRCA1 were set to Breast-ovarian cancer, familial, 1
Additional findings_Paediatric v0.2 BRAF Zornitza Stark Source BabySeq Category C gene was added to BRAF.
Source Expert Review Red was added to BRAF.
Added phenotypes LEOPARD syndrome for gene: BRAF
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BPGM Zornitza Stark gene: BPGM was added
gene: BPGM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BPGM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BPGM were set to Erythrocytosis due to bisphosphoglycerate mutase deficiency
Additional findings_Paediatric v0.2 BNC2 Zornitza Stark gene: BNC2 was added
gene: BNC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BNC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BNC2 were set to Total anomalous pulmonary venous return
Additional findings_Paediatric v0.2 BMPR1A Zornitza Stark Source BabySeq Category C gene was added to BMPR1A.
Source Expert Review Red was added to BMPR1A.
Added phenotypes Tetralogy of Fallot for gene: BMPR1A
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BLOC1S6 Zornitza Stark gene: BLOC1S6 was added
gene: BLOC1S6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BLOC1S6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BLOC1S6 were set to Hermansky-pudlak syndrome 9
Additional findings_Paediatric v0.2 BLOC1S3 Zornitza Stark gene: BLOC1S3 was added
gene: BLOC1S3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BLOC1S3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BLOC1S3 were set to Hermansky-Pudlak syndrome 8
Additional findings_Paediatric v0.2 BDNF Zornitza Stark gene: BDNF was added
gene: BDNF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BDNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BDNF were set to Central hypoventilation syndrome
Additional findings_Paediatric v0.2 BCL9 Zornitza Stark gene: BCL9 was added
gene: BCL9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BCL9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BCL9 were set to Congenital heart disease
Additional findings_Paediatric v0.2 BARD1 Zornitza Stark gene: BARD1 was added
gene: BARD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BARD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BARD1 were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 BANF1 Zornitza Stark gene: BANF1 was added
gene: BANF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BANF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BANF1 were set to Progeroid syndrome
Additional findings_Paediatric v0.2 BAG3 Zornitza Stark Source BabySeq Category C gene was added to BAG3.
Source Expert Review Red was added to BAG3.
Added phenotypes Myopathy, myofibrillar for gene: BAG3
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 B9D2 Zornitza Stark gene: B9D2 was added
gene: B9D2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: B9D2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B9D2 were set to Meckel syndrome
Additional findings_Paediatric v0.2 B4GALT1 Zornitza Stark gene: B4GALT1 was added
gene: B4GALT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: B4GALT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B4GALT1 were set to CDG syndrome type IId
Additional findings_Paediatric v0.2 B3GAT3 Zornitza Stark gene: B3GAT3 was added
gene: B3GAT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: B3GAT3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B3GAT3 were set to Multiple joint dislocations, short stature, craniofacial dysmorphism, and congenital heart defects
Additional findings_Paediatric v0.2 AXL Zornitza Stark gene: AXL was added
gene: AXL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AXL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AXL were set to Hypogonadotropic hypogonadism
Additional findings_Paediatric v0.2 ATR Zornitza Stark gene: ATR was added
gene: ATR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATR were set to Seckel syndrome
Additional findings_Paediatric v0.2 ATP7A Zornitza Stark Source BabySeq Category C gene was added to ATP7A.
Source Expert Review Red was added to ATP7A.
Added phenotypes Spinal muscular atrophy, distal, X-linked 3 for gene: ATP7A
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ATP6AP2 Zornitza Stark gene: ATP6AP2 was added
gene: ATP6AP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATP6AP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ATP6AP2 were set to X-linked recessive intellectual deficit - epilepsy
Additional findings_Paediatric v0.2 ATP1A3 Zornitza Stark gene: ATP1A3 was added
gene: ATP1A3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATP1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ATP1A3 were set to Rapid-onset dystonia-parkinsonism
Additional findings_Paediatric v0.2 ATN1 Zornitza Stark gene: ATN1 was added
gene: ATN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ATN1 were set to Dentatorubral-pallidoluysian atrophy 1
Additional findings_Paediatric v0.2 ATIC Zornitza Stark gene: ATIC was added
gene: ATIC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATIC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATIC were set to AICA-Ribosiduria
Additional findings_Paediatric v0.2 ASNS Zornitza Stark gene: ASNS was added
gene: ASNS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ASNS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ASNS were set to Microcephaly, intellectual disability, cerebral atrophy & intractable seizures
Additional findings_Paediatric v0.2 ASCL1 Zornitza Stark gene: ASCL1 was added
gene: ASCL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ASCL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ASCL1 were set to Congenital central hypoventilation
Additional findings_Paediatric v0.2 ARSE Zornitza Stark gene: ARSE was added
gene: ARSE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARSE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ARSE were set to Chondrodysplasia punctata, X-linked recessive
Additional findings_Paediatric v0.2 ARL13B Zornitza Stark gene: ARL13B was added
gene: ARL13B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARL13B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARL13B were set to Joubert syndrome
Additional findings_Paediatric v0.2 ARID1A Zornitza Stark gene: ARID1A was added
gene: ARID1A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARID1A were set to Coffin-Siris syndrome
Additional findings_Paediatric v0.2 ARHGEF9 Zornitza Stark gene: ARHGEF9 was added
gene: ARHGEF9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARHGEF9 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ARHGEF9 were set to Hyperekplexia and epilepsy
Additional findings_Paediatric v0.2 ARHGAP31 Zornitza Stark gene: ARHGAP31 was added
gene: ARHGAP31 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARHGAP31 were set to Syndromic cutis aplasia & limb anomalies
Additional findings_Paediatric v0.2 AR Zornitza Stark Source BabySeq Category C gene was added to AR.
Source Expert Review Red was added to AR.
Added phenotypes Spinal and bulbar muscular atrophy of Kennedy for gene: AR
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 APRT Zornitza Stark gene: APRT was added
gene: APRT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: APRT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: APRT were set to Adenine phosphoribosyltransferase deficiency
Additional findings_Paediatric v0.2 APP Zornitza Stark gene: APP was added
gene: APP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: APP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: APP were set to Alzheimer disease 1, familial
Additional findings_Paediatric v0.2 APOE Zornitza Stark gene: APOE was added
gene: APOE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: APOE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: APOE were set to Sea-blue histiocyte disease
Additional findings_Paediatric v0.2 AP4M1 Zornitza Stark gene: AP4M1 was added
gene: AP4M1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AP4M1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AP4M1 were set to Spastic paraplegia 50, autosomal recessive
Additional findings_Paediatric v0.2 AP1S3 Zornitza Stark gene: AP1S3 was added
gene: AP1S3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AP1S3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AP1S3 were set to Pustular psoriasis
Additional findings_Paediatric v0.2 ANO5 Zornitza Stark Source BabySeq Category C gene was added to ANO5.
Source Expert Review Red was added to ANO5.
Mode of inheritance for gene ANO5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Gnathodiaphyseal dysplasia for gene: ANO5
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ANKRD1 Zornitza Stark Source BabySeq Category C gene was added to ANKRD1.
Source Expert Review Red was added to ANKRD1.
Added phenotypes Cardiomyopathy, hypertrophic for gene: ANKRD1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 AMPD1 Zornitza Stark gene: AMPD1 was added
gene: AMPD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AMPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AMPD1 were set to Adenosine monophosphate deaminase deficiency
Additional findings_Paediatric v0.2 AMACR Zornitza Stark Added phenotypes Alpha-methylacyl-CoA racemase deficiency for gene: AMACR
Additional findings_Paediatric v0.2 AMACR Zornitza Stark gene: AMACR was added
gene: AMACR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AMACR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AMACR were set to Bile acid synthesis defect, congenital, 4
Additional findings_Paediatric v0.2 ALG9 Zornitza Stark gene: ALG9 was added
gene: ALG9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALG9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG9 were set to Congenital disorder of glycosylation, type Il
Additional findings_Paediatric v0.2 ALG2 Zornitza Stark gene: ALG2 was added
gene: ALG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG2 were set to Congenital disorder of glycosylation, type Ii
Additional findings_Paediatric v0.2 ALG11 Zornitza Stark gene: ALG11 was added
gene: ALG11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALG11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG11 were set to Congenital disorder of glycosylation type 1P
Additional findings_Paediatric v0.2 ALDOA Zornitza Stark gene: ALDOA was added
gene: ALDOA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALDOA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDOA were set to Aldolase A deficiency
Additional findings_Paediatric v0.2 ALDH4A1 Zornitza Stark gene: ALDH4A1 was added
gene: ALDH4A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALDH4A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDH4A1 were set to Hyperprolinemia, type II
Additional findings_Paediatric v0.2 ALDH1A2 Zornitza Stark gene: ALDH1A2 was added
gene: ALDH1A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALDH1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ALDH1A2 were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 AKT3 Zornitza Stark gene: AKT3 was added
gene: AKT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AKT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AKT3 were set to Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome
Additional findings_Paediatric v0.2 AKT2 Zornitza Stark gene: AKT2 was added
gene: AKT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AKT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AKT2 were set to Severe insulin resistance and diabetes mellitus
Additional findings_Paediatric v0.2 AKAP9 Zornitza Stark gene: AKAP9 was added
gene: AKAP9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AKAP9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AKAP9 were set to Long QT syndrome
Additional findings_Paediatric v0.2 AK1 Zornitza Stark gene: AK1 was added
gene: AK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AK1 were set to Hemolytic anemia due to adenylate kinase deficiency
Additional findings_Paediatric v0.2 AHSP Zornitza Stark gene: AHSP was added
gene: AHSP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AHSP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AHSP were set to Thalassaemia
Additional findings_Paediatric v0.2 AGTR1 Zornitza Stark gene: AGTR1 was added
gene: AGTR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AGTR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGTR1 were set to Renal tubular dysgenesis
Additional findings_Paediatric v0.2 AGT Zornitza Stark gene: AGT was added
gene: AGT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AGT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGT were set to Renal tubular dysgenesis
Additional findings_Paediatric v0.2 AGPS Zornitza Stark gene: AGPS was added
gene: AGPS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AGPS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGPS were set to Rhizomelic chondrodysplasia punctata, type 3
Additional findings_Paediatric v0.2 ADAMTS2 Zornitza Stark gene: ADAMTS2 was added
gene: ADAMTS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ADAMTS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTS2 were set to Ehlers-Danlos syndrome VIIc
Additional findings_Paediatric v0.2 ADAM17 Zornitza Stark gene: ADAM17 was added
gene: ADAM17 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ADAM17 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAM17 were set to Neonatal inflammatory skin and bowel disease
Additional findings_Paediatric v0.2 ACVR2B Zornitza Stark gene: ACVR2B was added
gene: ACVR2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACVR2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACVR2B were set to Left-right axis malformation
Additional findings_Paediatric v0.2 ACTN2 Zornitza Stark Source BabySeq Category C gene was added to ACTN2.
Source Expert Review Red was added to ACTN2.
Added phenotypes Cardiomyopathy, dilated for gene: ACTN2
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark Added phenotypes Left ventricular noncompaction for gene: ACTC1
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark Source BabySeq Category C gene was added to ACTC1.
Source Expert Review Red was added to ACTC1.
Added phenotypes Atrial septal defect for gene: ACTC1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACTB Zornitza Stark Source BabySeq Category C gene was added to ACTB.
Source Expert Review Red was added to ACTB.
Added phenotypes Neutrophil dysfunction and recurrent infection for gene: ACTB
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACTA1 Zornitza Stark Source BabySeq Category C gene was added to ACTA1.
Source Expert Review Red was added to ACTA1.
Added phenotypes Congenital myopathy with fiber type disproportion for gene: ACTA1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACO2 Zornitza Stark gene: ACO2 was added
gene: ACO2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACO2 were set to Cerebellar-retinal degeneration, infantile
Additional findings_Paediatric v0.2 ACBD5 Zornitza Stark gene: ACBD5 was added
gene: ACBD5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACBD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACBD5 were set to Thrombocytopaenia
Additional findings_Paediatric v0.2 ACADSB Zornitza Stark gene: ACADSB was added
gene: ACADSB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACADSB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADSB were set to 2-Methylbutyryl-CoA dehydrogenase deficiency
Additional findings_Paediatric v0.2 ACADS Zornitza Stark gene: ACADS was added
gene: ACADS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACADS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADS were set to Acyl-CoA dehydrogenase, short-chain, deficiency of
Additional findings_Paediatric v0.2 ACADL Zornitza Stark gene: ACADL was added
gene: ACADL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACADL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADL were set to Sudden infant death
Additional findings_Paediatric v0.2 ABCD4 Zornitza Stark gene: ABCD4 was added
gene: ABCD4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABCD4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCD4 were set to Methylmalonic aciduria and homocystinuria, cblJ type
Additional findings_Paediatric v0.2 ABCC9 Zornitza Stark Source BabySeq Category C gene was added to ABCC9.
Source Expert Review Red was added to ABCC9.
Added phenotypes Atrial fibrillation, familial for gene: ABCC9
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ABCC2 Zornitza Stark gene: ABCC2 was added
gene: ABCC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCC2 were set to Dubin-Johnson syndrome
Additional findings_Paediatric v0.2 ABCB7 Zornitza Stark gene: ABCB7 was added
gene: ABCB7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ABCB7 were set to Sideroblastic anaemia and ataxia
Additional findings_Paediatric v0.2 ABAT Zornitza Stark gene: ABAT was added
gene: ABAT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABAT were set to GABA-transaminase deficiency
Additional findings_Paediatric v0.2 AARS2 Zornitza Stark gene: AARS2 was added
gene: AARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AARS2 were set to Leukoencephalopathy, and ovarian failure in females
Additional findings_Paediatric v0.2 WT1 Zornitza Stark Source BabySeq Category B gene was added to WT1.
Source Expert Review Amber was added to WT1.
Added phenotypes Wilms tumor, type 1 for gene: WT1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 VWF Zornitza Stark gene: VWF was added
gene: VWF was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: VWF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VWF were set to von Willebrand disease
Additional findings_Paediatric v0.2 VCL Zornitza Stark gene: VCL was added
gene: VCL was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: VCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VCL were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TTN Zornitza Stark Source BabySeq Category B gene was added to TTN.
Source Expert Review Amber was added to TTN.
Mode of inheritance for gene TTN was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Cardiomyopathy, dilated for gene: TTN
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 TPM1 Zornitza Stark gene: TPM1 was added
gene: TPM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TPM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TPM1 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 TNNT2 Zornitza Stark Added phenotypes Familial hypertrophic cardiomyopathy for gene: TNNT2
Additional findings_Paediatric v0.2 TNNT2 Zornitza Stark gene: TNNT2 was added
gene: TNNT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TNNT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNT2 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TNNI3 Zornitza Stark Added phenotypes Familial hypertrophic cardiomyopathy for gene: TNNI3
Additional findings_Paediatric v0.2 TNNI3 Zornitza Stark gene: TNNI3 was added
gene: TNNI3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TNNI3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNI3 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TNNC1 Zornitza Stark gene: TNNC1 was added
gene: TNNC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TNNC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNC1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TINF2 Zornitza Stark gene: TINF2 was added
gene: TINF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TINF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TINF2 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 TERT Zornitza Stark gene: TERT was added
gene: TERT was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TERT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TERT were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 TERC Zornitza Stark gene: TERC was added
gene: TERC was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TERC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TERC were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 SNTA1 Zornitza Stark gene: SNTA1 was added
gene: SNTA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SNTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SNTA1 were set to Long QT syndrome
Additional findings_Paediatric v0.2 SDHC Zornitza Stark gene: SDHC was added
gene: SDHC was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SDHC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHC were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SDHB Zornitza Stark gene: SDHB was added
gene: SDHB was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SDHB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHB were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SDHAF2 Zornitza Stark gene: SDHAF2 was added
gene: SDHAF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SDHAF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHAF2 were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SCN5A Zornitza Stark Added phenotypes Brugada syndrome for gene: SCN5A
Additional findings_Paediatric v0.2 SCN5A Zornitza Stark gene: SCN5A was added
gene: SCN5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN5A were set to Long QT syndrome
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Source BabySeq Category B gene was added to RYR1.
Source Expert Review Amber was added to RYR1.
Mode of inheritance for gene RYR1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Malignant hyperthermia for gene: RYR1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 RBM20 Zornitza Stark gene: RBM20 was added
gene: RBM20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: RBM20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RBM20 were set to Cardiomyopathy, dilated, 1DD
Additional findings_Paediatric v0.2 PRKAG2 Zornitza Stark Source BabySeq Category B gene was added to PRKAG2.
Source Expert Review Amber was added to PRKAG2.
Added phenotypes Cardiomyopathy, hypertrophic for gene: PRKAG2
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 PLN Zornitza Stark gene: PLN was added
gene: PLN was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PLN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PLN were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 PKP2 Zornitza Stark gene: PKP2 was added
gene: PKP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PKP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PKP2 were set to Arrhythmogenic right ventricular dysplasia 9
Additional findings_Paediatric v0.2 PHOX2B Zornitza Stark gene: PHOX2B was added
gene: PHOX2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PHOX2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PHOX2B were set to Central hypoventilation syndrome
Additional findings_Paediatric v0.2 PCSK9 Zornitza Stark gene: PCSK9 was added
gene: PCSK9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PCSK9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PCSK9 were set to Hypercholesterolemia
Additional findings_Paediatric v0.2 NKX2-5 Zornitza Stark gene: NKX2-5 was added
gene: NKX2-5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: NKX2-5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NKX2-5 were set to Congenital heart disease
Additional findings_Paediatric v0.2 MYLK Zornitza Stark gene: MYLK was added
gene: MYLK was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYLK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYLK were set to Aortic aneurysm, familial thoracic 7
Additional findings_Paediatric v0.2 MYL3 Zornitza Stark gene: MYL3 was added
gene: MYL3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYL3 were set to Cardiomyopathy, familial hypertrophic, 8
Additional findings_Paediatric v0.2 MYL2 Zornitza Stark gene: MYL2 was added
gene: MYL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYL2 were set to Cardiomyopathy, familial hypertrophic, 10
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Left ventricular noncompaction for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Cardiomyopathy, dilated for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Source BabySeq Category B gene was added to MYH7.
Source Expert Review Amber was added to MYH7.
Added phenotypes Cardiomyopathy, familial hypertrophic for gene: MYH7
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 MYH11 Zornitza Stark gene: MYH11 was added
gene: MYH11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYH11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH11 were set to Aortic aneurysm, familial thoracic 4
Additional findings_Paediatric v0.2 MYBPC3 Zornitza Stark gene: MYBPC3 was added
gene: MYBPC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYBPC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYBPC3 were set to Cardiomyopathy, familial hypertrophic
Additional findings_Paediatric v0.2 MTHFR Zornitza Stark gene: MTHFR was added
gene: MTHFR was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MTHFR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTHFR were set to Homocystinuria due to MTHFR deficiency
Additional findings_Paediatric v0.2 MCCC2 Zornitza Stark gene: MCCC2 was added
gene: MCCC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MCCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCCC2 were set to 3-Methylcrotonyl-CoA carboxylase 2 deficiency
Additional findings_Paediatric v0.2 MCCC1 Zornitza Stark gene: MCCC1 was added
gene: MCCC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MCCC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCCC1 were set to 3-Methylcrotonyl-CoA carboxylase 1 deficiency
Additional findings_Paediatric v0.2 LMNA Zornitza Stark Source BabySeq Category B gene was added to LMNA.
Source Expert Review Amber was added to LMNA.
Mode of inheritance for gene LMNA was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Dilated cardiomyopathy for gene: LMNA
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 KCNQ1 Zornitza Stark Source BabySeq Category B gene was added to KCNQ1.
Source Expert Review Amber was added to KCNQ1.
Mode of inheritance for gene KCNQ1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Long QT syndrome-1 for gene: KCNQ1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 KCNH2 Zornitza Stark gene: KCNH2 was added
gene: KCNH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNH2 were set to Long QT syndrome-2
Additional findings_Paediatric v0.2 KCNE2 Zornitza Stark gene: KCNE2 was added
gene: KCNE2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: KCNE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNE2 were set to Long QT syndrome-6
Additional findings_Paediatric v0.2 KCNE1 Zornitza Stark Source BabySeq Category B gene was added to KCNE1.
Source Expert Review Amber was added to KCNE1.
Mode of inheritance for gene KCNE1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Long QT syndrome-5 for gene: KCNE1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 KCNA5 Zornitza Stark gene: KCNA5 was added
gene: KCNA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: KCNA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNA5 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 JUP Zornitza Stark Source BabySeq Category B gene was added to JUP.
Source Expert Review Amber was added to JUP.
Mode of inheritance for gene JUP was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Arrhythmogenic right ventricular dysplasia 12 for gene: JUP
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 GPD1L Zornitza Stark gene: GPD1L was added
gene: GPD1L was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: GPD1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GPD1L were set to Brugada syndrome
Additional findings_Paediatric v0.2 GJA5 Zornitza Stark gene: GJA5 was added
gene: GJA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: GJA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GJA5 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 GCH1 Zornitza Stark gene: GCH1 was added
gene: GCH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: GCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GCH1 were set to Dystonia, dopa-responsive
Additional findings_Paediatric v0.2 DSP Zornitza Stark Source BabySeq Category B gene was added to DSP.
Source Expert Review Amber was added to DSP.
Added phenotypes Arrhythmogenic right ventricular dysplasia/cardiomyopathy for gene: DSP
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 DSG2 Zornitza Stark gene: DSG2 was added
gene: DSG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: DSG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DSG2 were set to Arrhythmogenic right ventricular cardiomyopathy
Additional findings_Paediatric v0.2 DSC2 Zornitza Stark gene: DSC2 was added
gene: DSC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: DSC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DSC2 were set to Arrhythmogenic right ventricular cardiomyopathy
Additional findings_Paediatric v0.2 DMD Zornitza Stark Source BabySeq Category B gene was added to DMD.
Source Expert Review Amber was added to DMD.
Added phenotypes Cardiomyopathy, dilated for gene: DMD
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 DKC1 Zornitza Stark gene: DKC1 was added
gene: DKC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: DKC1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: DKC1 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 DES Zornitza Stark Source BabySeq Category B gene was added to DES.
Source Expert Review Amber was added to DES.
Added phenotypes Cardiomyopathy, dilated for gene: DES
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 CSRP3 Zornitza Stark gene: CSRP3 was added
gene: CSRP3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CSRP3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CSRP3 were set to Cardiomyopathy, familial hypertrophic, 12
Additional findings_Paediatric v0.2 CRYAB Zornitza Stark Source BabySeq Category B gene was added to CRYAB.
Source Expert Review Amber was added to CRYAB.
Added phenotypes Cardiomyopathy, dilated for gene: CRYAB
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 CP Zornitza Stark gene: CP was added
gene: CP was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CP were set to Aceruloplasminaemia
Additional findings_Paediatric v0.2 CDKN2A Zornitza Stark gene: CDKN2A was added
gene: CDKN2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CDKN2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDKN2A were set to Melanoma
Additional findings_Paediatric v0.2 CDH1 Zornitza Stark gene: CDH1 was added
gene: CDH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CDH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDH1 were set to Gastric cancer
Additional findings_Paediatric v0.2 CACNA1C Zornitza Stark gene: CACNA1C was added
gene: CACNA1C was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CACNA1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNA1C were set to Brugada syndrome
Additional findings_Paediatric v0.2 BMPR2 Zornitza Stark gene: BMPR2 was added
gene: BMPR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: BMPR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BMPR2 were set to Pulmonary hypertension, familial primary
Additional findings_Paediatric v0.2 BAG3 Zornitza Stark gene: BAG3 was added
gene: BAG3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: BAG3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BAG3 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 ANKRD1 Zornitza Stark gene: ANKRD1 was added
gene: ANKRD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ANKRD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKRD1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 ANK2 Zornitza Stark gene: ANK2 was added
gene: ANK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ANK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANK2 were set to Long QT syndrome
Additional findings_Paediatric v0.2 AIP Zornitza Stark gene: AIP was added
gene: AIP was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: AIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AIP were set to Pituitary adenoma
Additional findings_Paediatric v0.2 ACTN2 Zornitza Stark gene: ACTN2 was added
gene: ACTN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ACTN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTN2 were set to Cardiomyopathy, familial hypertrophic
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: ACTC1
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark gene: ACTC1 was added
gene: ACTC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ACTC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTC1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 ACTA2 Zornitza Stark gene: ACTA2 was added
gene: ACTA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ACTA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTA2 were set to Aortic aneurysm, familial thoracic
Additional findings_Paediatric v0.2 ABCC9 Zornitza Stark Source BabySeq Category B gene was added to ABCC9.
Source Expert Review Amber was added to ABCC9.
Added phenotypes Cardiomyopathy, dilated for gene: ABCC9
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 ZNF469 Zornitza Stark gene: ZNF469 was added
gene: ZNF469 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZNF469 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZNF469 were set to Brittle cornea syndrome
Additional findings_Paediatric v0.2 ZMPSTE24 Zornitza Stark gene: ZMPSTE24 was added
gene: ZMPSTE24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZMPSTE24 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZMPSTE24 were set to Restrictive dermopathy
Additional findings_Paediatric v0.2 ZIC3 Zornitza Stark gene: ZIC3 was added
gene: ZIC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZIC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ZIC3 were set to Heterotaxy
Additional findings_Paediatric v0.2 ZIC2 Zornitza Stark gene: ZIC2 was added
gene: ZIC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZIC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZIC2 were set to Holoprosencephaly-5
Additional findings_Paediatric v0.2 ZEB2 Zornitza Stark gene: ZEB2 was added
gene: ZEB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZEB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZEB2 were set to Mowat-Wilson syndrome
Additional findings_Paediatric v0.2 ZAP70 Zornitza Stark gene: ZAP70 was added
gene: ZAP70 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZAP70 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZAP70 were set to ZAP70-related severe combined immunodeficiency
Additional findings_Paediatric v0.2 XPC Zornitza Stark gene: XPC was added
gene: XPC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: XPC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: XPC were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 XPA Zornitza Stark gene: XPA was added
gene: XPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: XPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: XPA were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 WT1 Zornitza Stark Added phenotypes Frasier syndrome for gene: WT1
Additional findings_Paediatric v0.2 WT1 Zornitza Stark gene: WT1 was added
gene: WT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WT1 were set to Denys-Drash syndrome
Additional findings_Paediatric v0.2 WRN Zornitza Stark gene: WRN was added
gene: WRN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WRN were set to Werner syndrome
Additional findings_Paediatric v0.2 WNT10A Zornitza Stark gene: WNT10A was added
gene: WNT10A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WNT10A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT10A were set to Ectodermal dysplasia
Additional findings_Paediatric v0.2 WFS1 Zornitza Stark gene: WFS1 was added
gene: WFS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WFS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WFS1 were set to Wolfram syndrome
Additional findings_Paediatric v0.2 WDR62 Zornitza Stark gene: WDR62 was added
gene: WDR62 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WDR62 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR62 were set to Microcephaly 2, primary, autosomal recessive, with or without cortical malformations
Additional findings_Paediatric v0.2 WAS Zornitza Stark gene: WAS was added
gene: WAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WAS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: WAS were set to Wiskott-Aldrich syndrome
Additional findings_Paediatric v0.2 VPS33B Zornitza Stark gene: VPS33B was added
gene: VPS33B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VPS33B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS33B were set to Arthrogryposis renal dysfunction cholestasis syndrome
Additional findings_Paediatric v0.2 VPS13B Zornitza Stark gene: VPS13B was added
gene: VPS13B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VPS13B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS13B were set to Cohen syndrome
Additional findings_Paediatric v0.2 VPS13A Zornitza Stark gene: VPS13A was added
gene: VPS13A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VPS13A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS13A were set to Choreoacanthocytosis
Additional findings_Paediatric v0.2 VLDLR Zornitza Stark gene: VLDLR was added
gene: VLDLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VLDLR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VLDLR were set to Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1
Additional findings_Paediatric v0.2 VIPAS39 Zornitza Stark gene: VIPAS39 was added
gene: VIPAS39 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VIPAS39 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VIPAS39 were set to Arthrogryposis, renal dysfunction and cholestasis
Additional findings_Paediatric v0.2 VHL Zornitza Stark gene: VHL was added
gene: VHL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VHL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VHL were set to von Hippel-Lindau syndrome
Additional findings_Paediatric v0.2 VDR Zornitza Stark gene: VDR was added
gene: VDR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VDR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VDR were set to Vitamin D-dependent rickets
Additional findings_Paediatric v0.2 VCP Zornitza Stark gene: VCP was added
gene: VCP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VCP were set to Inclusion body myopathy with early-onset paget disease and frontotemporal dementia
Additional findings_Paediatric v0.2 VCAN Zornitza Stark gene: VCAN was added
gene: VCAN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VCAN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VCAN were set to Wagner syndrome
Additional findings_Paediatric v0.2 USH2A Zornitza Stark gene: USH2A was added
gene: USH2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: USH2A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: USH2A were set to Usher syndrome 2
Additional findings_Paediatric v0.2 USH1G Zornitza Stark gene: USH1G was added
gene: USH1G was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: USH1G was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: USH1G were set to Usher syndrome 1
Additional findings_Paediatric v0.2 USH1C Zornitza Stark gene: USH1C was added
gene: USH1C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: USH1C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: USH1C were set to Usher syndrome 1
Additional findings_Paediatric v0.2 UROS Zornitza Stark gene: UROS was added
gene: UROS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UROS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UROS were set to Porphyria, congenital erythropoietic
Additional findings_Paediatric v0.2 UROD Zornitza Stark gene: UROD was added
gene: UROD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UROD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UROD were set to Porphyria, hepatoerythropoietic
Additional findings_Paediatric v0.2 UNC13D Zornitza Stark gene: UNC13D was added
gene: UNC13D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UNC13D was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UNC13D were set to Hemophagocytic lymphohistiocytosis, familial, 3
Additional findings_Paediatric v0.2 UMOD Zornitza Stark gene: UMOD was added
gene: UMOD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UMOD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: UMOD were set to Nephropathy
Additional findings_Paediatric v0.2 UGT1A1 Zornitza Stark gene: UGT1A1 was added
gene: UGT1A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UGT1A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A1 were set to Crigler-Najjar syndrome
Additional findings_Paediatric v0.2 UBR1 Zornitza Stark gene: UBR1 was added
gene: UBR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UBR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UBR1 were set to Johanson-Blizzard syndrome
Additional findings_Paediatric v0.2 TYR Zornitza Stark gene: TYR was added
gene: TYR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TYR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TYR were set to Albinism, oculocutaneous 1
Additional findings_Paediatric v0.2 TYMP Zornitza Stark gene: TYMP was added
gene: TYMP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TYMP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TYMP were set to Mitochondrial DNA depletion syndrome
Additional findings_Paediatric v0.2 TWIST1 Zornitza Stark gene: TWIST1 was added
gene: TWIST1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TWIST1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TWIST1 were set to Saethre-Chotzen syndrome
Additional findings_Paediatric v0.2 TTR Zornitza Stark gene: TTR was added
gene: TTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TTR were set to Amyloidosis, hereditary, transthyretin-related
Additional findings_Paediatric v0.2 TTPA Zornitza Stark gene: TTPA was added
gene: TTPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTPA were set to Ataxia with isolated vitamin E deficiency
Additional findings_Paediatric v0.2 TTN Zornitza Stark gene: TTN was added
gene: TTN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTN were set to Centronuclear myopathy
Additional findings_Paediatric v0.2 TTC7A Zornitza Stark gene: TTC7A was added
gene: TTC7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTC7A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC7A were set to Immunodeficiency, combined, with intestinal atresias
Additional findings_Paediatric v0.2 TTC37 Zornitza Stark gene: TTC37 was added
gene: TTC37 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTC37 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC37 were set to Trichohepatoenteric syndrome
Additional findings_Paediatric v0.2 TSHR Zornitza Stark gene: TSHR was added
gene: TSHR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSHR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSHR were set to Hypothyroidism
Additional findings_Paediatric v0.2 TSHB Zornitza Stark gene: TSHB was added
gene: TSHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSHB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSHB were set to Hypothryoidism, congenital, nongoitrous 4
Additional findings_Paediatric v0.2 TSEN54 Zornitza Stark gene: TSEN54 was added
gene: TSEN54 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSEN54 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSEN54 were set to Pontocerebellar hypoplasia type 4
Additional findings_Paediatric v0.2 TSC2 Zornitza Stark gene: TSC2 was added
gene: TSC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TSC2 were set to Tuberous sclerosis 2
Additional findings_Paediatric v0.2 TSC1 Zornitza Stark gene: TSC1 was added
gene: TSC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TSC1 were set to Tuberous sclerosis 1
Additional findings_Paediatric v0.2 TRPM4 Zornitza Stark gene: TRPM4 was added
gene: TRPM4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRPM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TRPM4 were set to Cardiac conduction disease
Additional findings_Paediatric v0.2 TRMU Zornitza Stark gene: TRMU was added
gene: TRMU was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRMU was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRMU were set to Liver failure, transient infantile
Additional findings_Paediatric v0.2 TRIOBP Zornitza Stark gene: TRIOBP was added
gene: TRIOBP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRIOBP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIOBP were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TRIM37 Zornitza Stark gene: TRIM37 was added
gene: TRIM37 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRIM37 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIM37 were set to Mulibrey nanism syndrome
Additional findings_Paediatric v0.2 TRIM32 Zornitza Stark gene: TRIM32 was added
gene: TRIM32 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRIM32 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIM32 were set to Muscular dystrophy, limb-girdle, type 2H
Additional findings_Paediatric v0.2 TREX1 Zornitza Stark gene: TREX1 was added
gene: TREX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TREX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TREX1 were set to Aicardi-Goutieres syndrome 1
Additional findings_Paediatric v0.2 TRAPPC2 Zornitza Stark gene: TRAPPC2 was added
gene: TRAPPC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRAPPC2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: TRAPPC2 were set to Spondyloepiphyseal dysplasia tarda
Additional findings_Paediatric v0.2 TPP1 Zornitza Stark gene: TPP1 was added
gene: TPP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TPP1 were set to Neuronal ceroid lipofuscinosis
Additional findings_Paediatric v0.2 TPO Zornitza Stark gene: TPO was added
gene: TPO was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPO was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TPO were set to Thyroid dyshormonogenesis 2A
Additional findings_Paediatric v0.2 TPM3 Zornitza Stark Added phenotypes Congenital fiber-type disproportion myopathy for gene: TPM3
Additional findings_Paediatric v0.2 TPM3 Zornitza Stark gene: TPM3 was added
gene: TPM3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TPM3 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 TPM2 Zornitza Stark Added phenotypes Arthrogryposis multiplex congenita, distal for gene: TPM2
Additional findings_Paediatric v0.2 TPM2 Zornitza Stark gene: TPM2 was added
gene: TPM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TPM2 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 TP53 Zornitza Stark gene: TP53 was added
gene: TP53 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TP53 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TP53 were set to Li-Fraumeni syndrome
Additional findings_Paediatric v0.2 TNNT3 Zornitza Stark gene: TNNT3 was added
gene: TNNT3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNNT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNT3 were set to Arthyrgryposis, distal
Additional findings_Paediatric v0.2 TNNT1 Zornitza Stark gene: TNNT1 was added
gene: TNNT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNNT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNNT1 were set to Nemaline myopathy, Amish type
Additional findings_Paediatric v0.2 TNNI2 Zornitza Stark gene: TNNI2 was added
gene: TNNI2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNNI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNI2 were set to Distal arthrogryposis syndrome 2b
Additional findings_Paediatric v0.2 TNFSF11 Zornitza Stark gene: TNFSF11 was added
gene: TNFSF11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNFSF11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNFSF11 were set to Osteopetrosis, autosomal recessive 2
Additional findings_Paediatric v0.2 TNFRSF11B Zornitza Stark gene: TNFRSF11B was added
gene: TNFRSF11B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNFRSF11B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNFRSF11B were set to Paget disease
Additional findings_Paediatric v0.2 TMPRSS3 Zornitza Stark gene: TMPRSS3 was added
gene: TMPRSS3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMPRSS3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMPRSS3 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TMIE Zornitza Stark gene: TMIE was added
gene: TMIE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMIE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMIE were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TMEM67 Zornitza Stark Added phenotypes Meckel syndrome for gene: TMEM67
Additional findings_Paediatric v0.2 TMEM67 Zornitza Stark gene: TMEM67 was added
gene: TMEM67 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMEM67 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM67 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMEM43 Zornitza Stark gene: TMEM43 was added
gene: TMEM43 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMEM43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TMEM43 were set to Arrhythmogenic right ventricular dysplasia 5
Additional findings_Paediatric v0.2 TMC1 Zornitza Stark gene: TMC1 was added
gene: TMC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMC1 were set to Deafness
Additional findings_Paediatric v0.2 TK2 Zornitza Stark gene: TK2 was added
gene: TK2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TK2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TK2 were set to Mitochondrial DNA depletion syndrome
Additional findings_Paediatric v0.2 TIMM8A Zornitza Stark gene: TIMM8A was added
gene: TIMM8A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TIMM8A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: TIMM8A were set to Mohr-Tranebjaerg syndrome
Additional findings_Paediatric v0.2 THRB Zornitza Stark gene: THRB was added
gene: THRB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: THRB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THRB were set to Thyroid hormone resistance
Additional findings_Paediatric v0.2 THRA Zornitza Stark gene: THRA was added
gene: THRA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: THRA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THRA were set to Hypothyroidism, congenital, nongoitrous, 6
Additional findings_Paediatric v0.2 TH Zornitza Stark gene: TH was added
gene: TH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TH were set to Tyrosine hydroxylase deficiency
Additional findings_Paediatric v0.2 TGM5 Zornitza Stark gene: TGM5 was added
gene: TGM5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGM5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TGM5 were set to Peeling skin syndrome, acral type
Additional findings_Paediatric v0.2 TGM1 Zornitza Stark gene: TGM1 was added
gene: TGM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TGM1 were set to Ichthyosis, congenital, autosomal recessive
Additional findings_Paediatric v0.2 TGFBR2 Zornitza Stark gene: TGFBR2 was added
gene: TGFBR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGFBR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFBR2 were set to Loeys-Dietz syndrome
Additional findings_Paediatric v0.2 TGFBR1 Zornitza Stark gene: TGFBR1 was added
gene: TGFBR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGFBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFBR1 were set to Loeys-Dietz syndrome
Additional findings_Paediatric v0.2 TG Zornitza Stark gene: TG was added
gene: TG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TG were set to Thyroid dyshormonogenesis 3
Additional findings_Paediatric v0.2 TFG Zornitza Stark gene: TFG was added
gene: TFG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TFG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TFG were set to Hereditary motor and sensory neuropathy
Additional findings_Paediatric v0.2 TFAP2B Zornitza Stark gene: TFAP2B was added
gene: TFAP2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TFAP2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TFAP2B were set to Char syndrome
Additional findings_Paediatric v0.2 TFAP2A Zornitza Stark gene: TFAP2A was added
gene: TFAP2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TFAP2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TFAP2A were set to Branchiooculofacial syndrome
Additional findings_Paediatric v0.2 TECTA Zornitza Stark gene: TECTA was added
gene: TECTA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TECTA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TECTA were set to Deafness
Additional findings_Paediatric v0.2 TCOF1 Zornitza Stark gene: TCOF1 was added
gene: TCOF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TCOF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TCOF1 were set to Treacher Collins syndrome 1
Additional findings_Paediatric v0.2 TCIRG1 Zornitza Stark gene: TCIRG1 was added
gene: TCIRG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TCIRG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCIRG1 were set to Osteopetrosis, infantile malignant
Additional findings_Paediatric v0.2 TCAP Zornitza Stark gene: TCAP was added
gene: TCAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TCAP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCAP were set to Muscular dystrophy, limb-girdle, type 2G
Additional findings_Paediatric v0.2 TBX5 Zornitza Stark gene: TBX5 was added
gene: TBX5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TBX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TBX5 were set to Holt-Oram syndrome
Additional findings_Paediatric v0.2 TBX1 Zornitza Stark gene: TBX1 was added
gene: TBX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TBX1 were set to DiGeorge syndrome
Additional findings_Paediatric v0.2 TBC1D24 Zornitza Stark gene: TBC1D24 was added
gene: TBC1D24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TBC1D24 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TBC1D24 were set to Deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndrome
Additional findings_Paediatric v0.2 TAZ Zornitza Stark gene: TAZ was added
gene: TAZ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TAZ was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: TAZ were set to Barth syndrome
Additional findings_Paediatric v0.2 TAT Zornitza Stark gene: TAT was added
gene: TAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TAT were set to Tyrosinemia, type II
Additional findings_Paediatric v0.2 SURF1 Zornitza Stark gene: SURF1 was added
gene: SURF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SURF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SURF1 were set to Leigh syndrome, due to COX deficiency
Additional findings_Paediatric v0.2 SUOX Zornitza Stark gene: SUOX was added
gene: SUOX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SUOX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SUOX were set to Sulphite oxidase deficiency
Additional findings_Paediatric v0.2 SUCLG1 Zornitza Stark gene: SUCLG1 was added
gene: SUCLG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SUCLG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SUCLG1 were set to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria)
Additional findings_Paediatric v0.2 SUCLA2 Zornitza Stark gene: SUCLA2 was added
gene: SUCLA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SUCLA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SUCLA2 were set to Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with methylmalonic aciduria)
Additional findings_Paediatric v0.2 STXBP2 Zornitza Stark gene: STXBP2 was added
gene: STXBP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STXBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STXBP2 were set to Hemophagocytic lymphohistiocytosis
Additional findings_Paediatric v0.2 STXBP1 Zornitza Stark gene: STXBP1 was added
gene: STXBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STXBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: STXBP1 were set to Epileptic encephalopathy, early infantile
Additional findings_Paediatric v0.2 STX11 Zornitza Stark gene: STX11 was added
gene: STX11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STX11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STX11 were set to Hemophagocytic lymphohistiocytosis, familial, 4
Additional findings_Paediatric v0.2 STS Zornitza Stark gene: STS was added
gene: STS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: STS were set to Ichthyosis, X-linked
Additional findings_Paediatric v0.2 STRC Zornitza Stark gene: STRC was added
gene: STRC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STRC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STRC were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 STRA6 Zornitza Stark gene: STRA6 was added
gene: STRA6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STRA6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STRA6 were set to Microphthalmia, syndromic
Additional findings_Paediatric v0.2 STK11 Zornitza Stark gene: STK11 was added
gene: STK11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STK11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: STK11 were set to Peutz-Jeghers syndrome
Additional findings_Paediatric v0.2 STAT3 Zornitza Stark gene: STAT3 was added
gene: STAT3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: STAT3 were set to Hyper-IgE recurrent infection syndrome
Additional findings_Paediatric v0.2 STAR Zornitza Stark gene: STAR was added
gene: STAR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STAR were set to Congenital lipoid adrenal hyperplasia,
Additional findings_Paediatric v0.2 SRCAP Zornitza Stark gene: SRCAP was added
gene: SRCAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SRCAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SRCAP were set to Floating-Harbor syndrome
Additional findings_Paediatric v0.2 SPTLC1 Zornitza Stark gene: SPTLC1 was added
gene: SPTLC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPTLC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTLC1 were set to Neuropathy, hereditary sensory and autonomic, type IA
Additional findings_Paediatric v0.2 SPTB Zornitza Stark gene: SPTB was added
gene: SPTB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPTB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTB were set to Spherocytosis
Additional findings_Paediatric v0.2 SPTA1 Zornitza Stark gene: SPTA1 was added
gene: SPTA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTA1 were set to Elliptocytosis
Additional findings_Paediatric v0.2 SPRED1 Zornitza Stark gene: SPRED1 was added
gene: SPRED1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPRED1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPRED1 were set to Legius syndrome
Additional findings_Paediatric v0.2 SPR Zornitza Stark gene: SPR was added
gene: SPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SPR were set to Sepiapterin reductase deficiency
Additional findings_Paediatric v0.2 SPINK5 Zornitza Stark gene: SPINK5 was added
gene: SPINK5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPINK5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SPINK5 were set to Netherton syndrome 1; Netherton syndrome
Additional findings_Paediatric v0.2 SP110 Zornitza Stark gene: SP110 was added
gene: SP110 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SP110 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SP110 were set to Hepatic venoocclusive disease with immunodeficiency
Additional findings_Paediatric v0.2 SOX9 Zornitza Stark gene: SOX9 was added
gene: SOX9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SOX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOX9 were set to Campomelic dysplasia
Additional findings_Paediatric v0.2 SOX10 Zornitza Stark gene: SOX10 was added
gene: SOX10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SOX10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOX10 were set to Shah-Waardenburg syndrome
Additional findings_Paediatric v0.2 SMPX Zornitza Stark gene: SMPX was added
gene: SMPX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMPX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SMPX were set to Deafness, X-linked
Additional findings_Paediatric v0.2 SMPD1 Zornitza Stark Added phenotypes Niemann-Pick disease, type B for gene: SMPD1
Additional findings_Paediatric v0.2 SMPD1 Zornitza Stark gene: SMPD1 was added
gene: SMPD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SMPD1 were set to Niemann-Pick disease, type A
Additional findings_Paediatric v0.2 SMN1 Zornitza Stark gene: SMN1 was added
gene: SMN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SMN1 were set to Spinal muscular atrophy
Additional findings_Paediatric v0.2 SMC1A Zornitza Stark gene: SMC1A was added
gene: SMC1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMC1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMC1A were set to Cornelia de Lange syndrome
Additional findings_Paediatric v0.2 SMARCAL1 Zornitza Stark gene: SMARCAL1 was added
gene: SMARCAL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMARCAL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SMARCAL1 were set to Schimke immunoosseous dysplasia
Additional findings_Paediatric v0.2 SMAD4 Zornitza Stark gene: SMAD4 was added
gene: SMAD4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMAD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD4 were set to Juvenile polyposis syndrome
Additional findings_Paediatric v0.2 SMAD3 Zornitza Stark gene: SMAD3 was added
gene: SMAD3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMAD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD3 were set to Loeys-Dietz syndrome
Additional findings_Paediatric v0.2 SLCO2A1 Zornitza Stark gene: SLCO2A1 was added
gene: SLCO2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLCO2A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLCO2A1 were set to Hypertrophic osteoarthropathy, primary, autosomal recessive 2
Additional findings_Paediatric v0.2 SLC9A6 Zornitza Stark gene: SLC9A6 was added
gene: SLC9A6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC9A6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC9A6 were set to Christianson syndrome
Additional findings_Paediatric v0.2 SLC7A9 Zornitza Stark gene: SLC7A9 was added
gene: SLC7A9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC7A9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC7A9 were set to Cystinuria
Additional findings_Paediatric v0.2 SLC7A7 Zornitza Stark gene: SLC7A7 was added
gene: SLC7A7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC7A7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC7A7 were set to Lysinuric protein intolerance
Additional findings_Paediatric v0.2 SLC6A8 Zornitza Stark gene: SLC6A8 was added
gene: SLC6A8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC6A8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC6A8 were set to Creatine deficiency syndrome, X-linked
Additional findings_Paediatric v0.2 SLC6A5 Zornitza Stark gene: SLC6A5 was added
gene: SLC6A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC6A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC6A5 were set to Hyperekplexia 3
Additional findings_Paediatric v0.2 SLC5A5 Zornitza Stark gene: SLC5A5 was added
gene: SLC5A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC5A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC5A5 were set to Thyroid dyshormonogenesis 1
Additional findings_Paediatric v0.2 SLC5A2 Zornitza Stark gene: SLC5A2 was added
gene: SLC5A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC5A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC5A2 were set to Renal glucosuria
Additional findings_Paediatric v0.2 SLC4A11 Zornitza Stark gene: SLC4A11 was added
gene: SLC4A11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC4A11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC4A11 were set to Corneal endothelial dystrophy
Additional findings_Paediatric v0.2 SLC4A1 Zornitza Stark gene: SLC4A1 was added
gene: SLC4A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC4A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC4A1 were set to Spherocytosis
Additional findings_Paediatric v0.2 SLC46A1 Zornitza Stark gene: SLC46A1 was added
gene: SLC46A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC46A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC46A1 were set to Folate malabsorption, hereditary
Additional findings_Paediatric v0.2 SLC45A2 Zornitza Stark gene: SLC45A2 was added
gene: SLC45A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC45A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC45A2 were set to Oculocutaneous albinism, type IV
Additional findings_Paediatric v0.2 SLC3A1 Zornitza Stark gene: SLC3A1 was added
gene: SLC3A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC3A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC3A1 were set to Cystinuria
Additional findings_Paediatric v0.2 SLC39A4 Zornitza Stark gene: SLC39A4 was added
gene: SLC39A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC39A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC39A4 were set to Acrodermatitis enteropathica
Additional findings_Paediatric v0.2 SLC37A4 Zornitza Stark gene: SLC37A4 was added
gene: SLC37A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC37A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC37A4 were set to Glycogen storage disease Ib
Additional findings_Paediatric v0.2 SLC35D1 Zornitza Stark gene: SLC35D1 was added
gene: SLC35D1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC35D1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC35D1 were set to Schneckenbecken dysplasia
Additional findings_Paediatric v0.2 SLC34A3 Zornitza Stark gene: SLC34A3 was added
gene: SLC34A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC34A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC34A3 were set to Hypophosphatemic rickets with hypercalciuria
Additional findings_Paediatric v0.2 SLC34A2 Zornitza Stark gene: SLC34A2 was added
gene: SLC34A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC34A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC34A2 were set to Pulmonary alveolar microlithiasis
Additional findings_Paediatric v0.2 SLC2A10 Zornitza Stark gene: SLC2A10 was added
gene: SLC2A10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC2A10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC2A10 were set to Arterial tortuosity syndrome
Additional findings_Paediatric v0.2 SLC2A1 Zornitza Stark gene: SLC2A1 was added
gene: SLC2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC2A1 were set to GLUT1 deficiency syndrome 1
Additional findings_Paediatric v0.2 SLC27A4 Zornitza Stark gene: SLC27A4 was added
gene: SLC27A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC27A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC27A4 were set to Ichthyosis prematurity syndrome
Additional findings_Paediatric v0.2 SLC26A4 Zornitza Stark gene: SLC26A4 was added
gene: SLC26A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC26A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC26A4 were set to Pendred syndrome
Additional findings_Paediatric v0.2 SLC26A3 Zornitza Stark gene: SLC26A3 was added
gene: SLC26A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC26A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC26A3 were set to Chloride diarrhea, congenital, Finnish type
Additional findings_Paediatric v0.2 SLC26A2 Zornitza Stark gene: SLC26A2 was added
gene: SLC26A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC26A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC26A2 were set to Achondrogenesis 1B
Additional findings_Paediatric v0.2 SLC25A4 Zornitza Stark gene: SLC25A4 was added
gene: SLC25A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC25A4 were set to Progressive external ophthalmoplegia
Additional findings_Paediatric v0.2 SLC25A38 Zornitza Stark gene: SLC25A38 was added
gene: SLC25A38 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A38 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A38 were set to Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive
Additional findings_Paediatric v0.2 SLC25A20 Zornitza Stark gene: SLC25A20 was added
gene: SLC25A20 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A20 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A20 were set to Carnitine-acylcarnitine translocase deficiency
Additional findings_Paediatric v0.2 SLC25A15 Zornitza Stark gene: SLC25A15 was added
gene: SLC25A15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A15 were set to Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome
Additional findings_Paediatric v0.2 SLC25A13 Zornitza Stark gene: SLC25A13 was added
gene: SLC25A13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A13 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A13 were set to Citrullinemia
Additional findings_Paediatric v0.2 SLC22A5 Zornitza Stark gene: SLC22A5 was added
gene: SLC22A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC22A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC22A5 were set to Carnitine deficiency, systemic primary
Additional findings_Paediatric v0.2 SLC19A3 Zornitza Stark gene: SLC19A3 was added
gene: SLC19A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC19A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC19A3 were set to Basal ganglia disease, biotin-responsive
Additional findings_Paediatric v0.2 SLC19A2 Zornitza Stark gene: SLC19A2 was added
gene: SLC19A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC19A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC19A2 were set to Thiamine-responsive megaloblastic anemia syndrome
Additional findings_Paediatric v0.2 SLC17A5 Zornitza Stark gene: SLC17A5 was added
gene: SLC17A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC17A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC17A5 were set to Sialic acid storage disorder, infantile
Additional findings_Paediatric v0.2 SLC16A2 Zornitza Stark gene: SLC16A2 was added
gene: SLC16A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC16A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC16A2 were set to Allan-Herndon-Dudley syndrome
Additional findings_Paediatric v0.2 SLC12A6 Zornitza Stark gene: SLC12A6 was added
gene: SLC12A6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC12A6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC12A6 were set to Agenesis of the corpus callosum with peripheral neuropathy
Additional findings_Paediatric v0.2 SLC12A3 Zornitza Stark gene: SLC12A3 was added
gene: SLC12A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC12A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC12A3 were set to Gitelman syndrome
Additional findings_Paediatric v0.2 SLC12A1 Zornitza Stark gene: SLC12A1 was added
gene: SLC12A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC12A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC12A1 were set to Bartter syndrome
Additional findings_Paediatric v0.2 SKI Zornitza Stark gene: SKI was added
gene: SKI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SKI was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SKI were set to Shprintzen-Goldberg syndrome
Additional findings_Paediatric v0.2 SIX3 Zornitza Stark gene: SIX3 was added
gene: SIX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SIX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX3 were set to Holoprosencephaly-2
Additional findings_Paediatric v0.2 SIX1 Zornitza Stark gene: SIX1 was added
gene: SIX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SIX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX1 were set to Branchiootorenal syndrome
Additional findings_Paediatric v0.2 SIL1 Zornitza Stark gene: SIL1 was added
gene: SIL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SIL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SIL1 were set to Marinesco-Sjogren syndrome
Additional findings_Paediatric v0.2 SHH Zornitza Stark gene: SHH was added
gene: SHH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SHH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SHH were set to Holoprosencephaly-3
Additional findings_Paediatric v0.2 SHANK3 Zornitza Stark gene: SHANK3 was added
gene: SHANK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SHANK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SHANK3 were set to Phelan-McDermid syndrome
Additional findings_Paediatric v0.2 SH3TC2 Zornitza Stark gene: SH3TC2 was added
gene: SH3TC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SH3TC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SH3TC2 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 SH2D1A Zornitza Stark gene: SH2D1A was added
gene: SH2D1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SH2D1A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SH2D1A were set to Lymphoproliferative syndrome
Additional findings_Paediatric v0.2 SGSH Zornitza Stark gene: SGSH was added
gene: SGSH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGSH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGSH were set to Mucopolysaccharidisis type IIIA (Sanfilippo A)
Additional findings_Paediatric v0.2 SGCG Zornitza Stark gene: SGCG was added
gene: SGCG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCG were set to Muscular dystrophy, limb-girdle, type 2C
Additional findings_Paediatric v0.2 SGCD Zornitza Stark gene: SGCD was added
gene: SGCD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCD were set to Muscular dystrophy, limb-girdle, type 2F
Additional findings_Paediatric v0.2 SGCB Zornitza Stark gene: SGCB was added
gene: SGCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCB were set to Muscular dystrophy, limb-girdle, type 2E
Additional findings_Paediatric v0.2 SGCA Zornitza Stark gene: SGCA was added
gene: SGCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCA were set to Muscular dystrophy, limb-girdle, type 2D
Additional findings_Paediatric v0.2 SFTPB Zornitza Stark gene: SFTPB was added
gene: SFTPB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SFTPB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SFTPB were set to Surfactant metabolism dysfunction, pulmonary
Additional findings_Paediatric v0.2 SETX Zornitza Stark gene: SETX was added
gene: SETX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SETX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SETX were set to Ataxia-ocular apraxia 2
Additional findings_Paediatric v0.2 SETBP1 Zornitza Stark gene: SETBP1 was added
gene: SETBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SETBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SETBP1 were set to Schinzel-Giedion syndrome
Additional findings_Paediatric v0.2 SEPT9 Zornitza Stark gene: SEPT9 was added
gene: SEPT9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SEPT9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SEPT9 were set to Amyotrophy, hereditary neuralgic
Additional findings_Paediatric v0.2 SELENON Zornitza Stark gene: SELENON was added
gene: SELENON was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SELENON was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SELENON were set to Myopathy, congenital, with fiber-type disproportion; Muscular dystrophy, rigid spine
Additional findings_Paediatric v0.2 SDHD Zornitza Stark gene: SDHD was added
gene: SDHD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SDHD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHD were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SCO2 Zornitza Stark gene: SCO2 was added
gene: SCO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCO2 were set to Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency
Additional findings_Paediatric v0.2 SCNN1B Zornitza Stark gene: SCNN1B was added
gene: SCNN1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCNN1B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCNN1B were set to Pseudohypoaldosteronism
Additional findings_Paediatric v0.2 SCNN1A Zornitza Stark gene: SCNN1A was added
gene: SCNN1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCNN1A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCNN1A were set to Pseudohypoaldosteronism
Additional findings_Paediatric v0.2 SCN4A Zornitza Stark gene: SCN4A was added
gene: SCN4A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCN4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN4A were set to Hyperkalemic periodic paralysis, type 2
Additional findings_Paediatric v0.2 SCN1A Zornitza Stark gene: SCN1A was added
gene: SCN1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCN1A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCN1A were set to Dravet syndrome
Additional findings_Paediatric v0.2 SCN11A Zornitza Stark gene: SCN11A was added
gene: SCN11A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCN11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN11A were set to Episodic pain syndrome
Additional findings_Paediatric v0.2 SBDS Zornitza Stark gene: SBDS was added
gene: SBDS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SBDS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SBDS were set to Shwachman-Bodian-Diamond syndrome
Additional findings_Paediatric v0.2 SAMHD1 Zornitza Stark gene: SAMHD1 was added
gene: SAMHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SAMHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SAMHD1 were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 SALL1 Zornitza Stark gene: SALL1 was added
gene: SALL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SALL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SALL1 were set to Townes-Brocks syndrome
Additional findings_Paediatric v0.2 SACS Zornitza Stark gene: SACS was added
gene: SACS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SACS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SACS were set to Spastic ataxia Charlevoix-Saguenay type
Additional findings_Paediatric v0.2 RYR2 Zornitza Stark Added phenotypes Ventricular tachycardia, catecholaminergic polymorphic for gene: RYR2
Additional findings_Paediatric v0.2 RYR2 Zornitza Stark gene: RYR2 was added
gene: RYR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RYR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RYR2 were set to Arrhythmogenic right ventricular dysplasia 2
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Added phenotypes Multiminicore disease for gene: RYR1
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Mode of inheritance for gene RYR1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Centronuclear myopathy for gene: RYR1
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark gene: RYR1 was added
gene: RYR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RYR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RYR1 were set to Central core disease
Additional findings_Paediatric v0.2 RUNX2 Zornitza Stark gene: RUNX2 was added
gene: RUNX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RUNX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RUNX2 were set to Cleidocranial dysostosis
Additional findings_Paediatric v0.2 RSPH9 Zornitza Stark gene: RSPH9 was added
gene: RSPH9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RSPH9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RSPH9 were set to Ciliary dyskinesia, primary
Additional findings_Paediatric v0.2 RSPH4A Zornitza Stark gene: RSPH4A was added
gene: RSPH4A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RSPH4A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RSPH4A were set to Ciliary dyskinesia, primary
Additional findings_Paediatric v0.2 RS1 Zornitza Stark gene: RS1 was added
gene: RS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RS1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: RS1 were set to Retinoschisis, X linked
Additional findings_Paediatric v0.2 RRM2B Zornitza Stark gene: RRM2B was added
gene: RRM2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RRM2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RRM2B were set to Mitochondrial DNA depletion syndrome
Additional findings_Paediatric v0.2 RPS6KA3 Zornitza Stark gene: RPS6KA3 was added
gene: RPS6KA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS6KA3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: RPS6KA3 were set to Coffin-Lowry syndrome
Additional findings_Paediatric v0.2 RPS26 Zornitza Stark gene: RPS26 was added
gene: RPS26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS26 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS26 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS24 Zornitza Stark gene: RPS24 was added
gene: RPS24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS24 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS24 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS19 Zornitza Stark gene: RPS19 was added
gene: RPS19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS19 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS17 Zornitza Stark gene: RPS17 was added
gene: RPS17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS17 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS15 Zornitza Stark gene: RPS15 was added
gene: RPS15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS15 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPL5 Zornitza Stark gene: RPL5 was added
gene: RPL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPL5 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPL11 Zornitza Stark gene: RPL11 was added
gene: RPL11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPL11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPL11 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPGRIP1L Zornitza Stark Added phenotypes Joubert syndrome for gene: RPGRIP1L
Additional findings_Paediatric v0.2 RPGRIP1L Zornitza Stark gene: RPGRIP1L was added
gene: RPGRIP1L was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPGRIP1L was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RPGRIP1L were set to Meckel syndrome
Additional findings_Paediatric v0.2 RPGR Zornitza Stark gene: RPGR was added
gene: RPGR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPGR was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: RPGR were set to Retinitis pigmentosa
Additional findings_Paediatric v0.2 ROR2 Zornitza Stark Mode of inheritance for gene ROR2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Brachydactyly, type B1 for gene: ROR2
Additional findings_Paediatric v0.2 ROR2 Zornitza Stark gene: ROR2 was added
gene: ROR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ROR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ROR2 were set to Robinow syndrome
Additional findings_Paediatric v0.2 RNASEH2C Zornitza Stark gene: RNASEH2C was added
gene: RNASEH2C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RNASEH2C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2C were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 RNASEH2B Zornitza Stark gene: RNASEH2B was added
gene: RNASEH2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RNASEH2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2B were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 RNASEH2A Zornitza Stark gene: RNASEH2A was added
gene: RNASEH2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RNASEH2A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2A were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 RMRP Zornitza Stark gene: RMRP was added
gene: RMRP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RMRP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RMRP were set to Cartilage-hair hypoplasia
Additional findings_Paediatric v0.2 RET Zornitza Stark Added phenotypes Multiple endocrine neoplasia IIB for gene: RET
Additional findings_Paediatric v0.2 RET Zornitza Stark gene: RET was added
gene: RET was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RET was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RET were set to Multiple endocrine neoplasia IIA
Additional findings_Paediatric v0.2 REN Zornitza Stark gene: REN was added
gene: REN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: REN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: REN were set to Renal tubular dysgenesis
Additional findings_Paediatric v0.2 RECQL4 Zornitza Stark Added phenotypes Rothmund-Thomson syndrome for gene: RECQL4
Additional findings_Paediatric v0.2 RECQL4 Zornitza Stark Added phenotypes Rapadilino syndrome for gene: RECQL4
Additional findings_Paediatric v0.2 RECQL4 Zornitza Stark gene: RECQL4 was added
gene: RECQL4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RECQL4 were set to Baller-Gerold syndrome
Additional findings_Paediatric v0.2 RBM8A Zornitza Stark gene: RBM8A was added
gene: RBM8A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RBM8A were set to Thrombocytopaenia-absent radius syndrome
Additional findings_Paediatric v0.2 RB1 Zornitza Stark gene: RB1 was added
gene: RB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RB1 were set to Retinoblastoma
Additional findings_Paediatric v0.2 RASA1 Zornitza Stark gene: RASA1 was added
gene: RASA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RASA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RASA1 were set to Capillary malformation-arteriovenous malformation
Additional findings_Paediatric v0.2 RAPSN Zornitza Stark gene: RAPSN was added
gene: RAPSN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAPSN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAPSN were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.2 RAI1 Zornitza Stark Added phenotypes Potocki-Lupski syndrome for gene: RAI1
Additional findings_Paediatric v0.2 RAI1 Zornitza Stark gene: RAI1 was added
gene: RAI1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAI1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAI1 were set to Smith-Magenis syndrome
Additional findings_Paediatric v0.2 RAG2 Zornitza Stark gene: RAG2 was added
gene: RAG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAG2 were set to Omenn syndrome
Additional findings_Paediatric v0.2 RAG1 Zornitza Stark gene: RAG1 was added
gene: RAG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAG1 were set to Omenn syndrome
Additional findings_Paediatric v0.2 RAF1 Zornitza Stark gene: RAF1 was added
gene: RAF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAF1 were set to Noonan syndrome
Additional findings_Paediatric v0.2 RAB7A Zornitza Stark gene: RAB7A was added
gene: RAB7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAB7A were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 RAB3GAP1 Zornitza Stark gene: RAB3GAP1 was added
gene: RAB3GAP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB3GAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB3GAP1 were set to Warburg micro syndrome
Additional findings_Paediatric v0.2 RAB27A Zornitza Stark gene: RAB27A was added
gene: RAB27A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB27A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB27A were set to Griscelli syndrome
Additional findings_Paediatric v0.2 RAB23 Zornitza Stark gene: RAB23 was added
gene: RAB23 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB23 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB23 were set to Carpenter syndrome
Additional findings_Paediatric v0.2 QDPR Zornitza Stark gene: QDPR was added
gene: QDPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: QDPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: QDPR were set to Dihydropteridine reductase deficiency
Additional findings_Paediatric v0.2 PYGL Zornitza Stark gene: PYGL was added
gene: PYGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PYGL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PYGL were set to Glycogen storage disease VI
Additional findings_Paediatric v0.2 PTS Zornitza Stark gene: PTS was added
gene: PTS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PTS were set to Hyperphenylalaninemia, BH4-deficient, A
Additional findings_Paediatric v0.2 CAVIN1 Zornitza Stark gene: CAVIN1 was added
gene: CAVIN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CAVIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CAVIN1 were set to Lipodystrophy, congenital generalized, type 4
Additional findings_Paediatric v0.2 PTPN11 Zornitza Stark gene: PTPN11 was added
gene: PTPN11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTPN11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTPN11 were set to Noonan syndrome
Additional findings_Paediatric v0.2 PTH1R Zornitza Stark gene: PTH1R was added
gene: PTH1R was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTH1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTH1R were set to Metaphyseal chondrodysplasia
Additional findings_Paediatric v0.2 PTEN Zornitza Stark Added phenotypes Bannayan-Riley-Ruvalcaba syndrome for gene: PTEN
Additional findings_Paediatric v0.2 PTEN Zornitza Stark gene: PTEN was added
gene: PTEN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTEN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTEN were set to Cowden disease
Additional findings_Paediatric v0.2 PTCH1 Zornitza Stark gene: PTCH1 was added
gene: PTCH1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTCH1 were set to Nevoid basal cell carcinoma syndrome
Additional findings_Paediatric v0.2 PSAP Zornitza Stark gene: PSAP was added
gene: PSAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PSAP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PSAP were set to Metachromatic leukodystrophy
Additional findings_Paediatric v0.2 PRX Zornitza Stark gene: PRX was added
gene: PRX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRX were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 PROS1 Zornitza Stark gene: PROS1 was added
gene: PROS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PROS1 were set to Protein S deficiency
Additional findings_Paediatric v0.2 PROP1 Zornitza Stark gene: PROP1 was added
gene: PROP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PROP1 were set to Pituitary hormone deficiency, combined, 2
Additional findings_Paediatric v0.2 PROKR2 Zornitza Stark gene: PROKR2 was added
gene: PROKR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROKR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PROKR2 were set to Hypogonadotropic hypogonadism
Additional findings_Paediatric v0.2 PROC Zornitza Stark gene: PROC was added
gene: PROC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PROC were set to Thrombophilia due to protein C deficiency
Additional findings_Paediatric v0.2 PRKAR1A Zornitza Stark gene: PRKAR1A was added
gene: PRKAR1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRKAR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRKAR1A were set to Carney complex
Additional findings_Paediatric v0.2 PRKAG2 Zornitza Stark gene: PRKAG2 was added
gene: PRKAG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRKAG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRKAG2 were set to Wolff-Parkinson-White syndrome
Additional findings_Paediatric v0.2 PRF1 Zornitza Stark gene: PRF1 was added
gene: PRF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRF1 were set to Hemophagocytic lymphohistiocytosis, familial, 2
Additional findings_Paediatric v0.2 PQBP1 Zornitza Stark gene: PQBP1 was added
gene: PQBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PQBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PQBP1 were set to Mental retardation
Additional findings_Paediatric v0.2 PPT1 Zornitza Stark gene: PPT1 was added
gene: PPT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PPT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PPT1 were set to Neuronal ceroid lipofuscinosis
Additional findings_Paediatric v0.2 POU4F3 Zornitza Stark gene: POU4F3 was added
gene: POU4F3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POU4F3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: POU4F3 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 POU3F4 Zornitza Stark gene: POU3F4 was added
gene: POU3F4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POU3F4 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: POU3F4 were set to Deafness, X-linked
Additional findings_Paediatric v0.2 POU1F1 Zornitza Stark gene: POU1F1 was added
gene: POU1F1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POU1F1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POU1F1 were set to Pituitary hormone deficiency
Additional findings_Paediatric v0.2 PORCN Zornitza Stark gene: PORCN was added
gene: PORCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PORCN was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PORCN were set to Focal dermal hypoplasia
Additional findings_Paediatric v0.2 POR Zornitza Stark gene: POR was added
gene: POR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POR were set to Disordered steroidogenesis with and without Antley-Bixler syndrome
Additional findings_Paediatric v0.2 POMT2 Zornitza Stark gene: POMT2 was added
gene: POMT2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POMT2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMT2 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 2
Additional findings_Paediatric v0.2 POMT1 Zornitza Stark Added phenotypes Walker-Warburg syndrome for gene: POMT1
Additional findings_Paediatric v0.2 POMT1 Zornitza Stark gene: POMT1 was added
gene: POMT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POMT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMT1 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 1
Additional findings_Paediatric v0.2 POMGNT1 Zornitza Stark Added phenotypes Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 for gene: POMGNT1
Additional findings_Paediatric v0.2 POMGNT1 Zornitza Stark gene: POMGNT1 was added
gene: POMGNT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POMGNT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMGNT1 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies)
Additional findings_Paediatric v0.2 POLH Zornitza Stark gene: POLH was added
gene: POLH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POLH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLH were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 POLG Zornitza Stark gene: POLG was added
gene: POLG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POLG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLG were set to POLG-Related Ataxia Neuropathy Spectrum Disorders
Additional findings_Paediatric v0.2 PNPO Zornitza Stark gene: PNPO was added
gene: PNPO was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PNPO was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PNPO were set to Epileptic encephalopathy, neonatal
Additional findings_Paediatric v0.2 PNKP Zornitza Stark gene: PNKP was added
gene: PNKP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PNKP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PNKP were set to Microcephaly - seizures - developmental delay
Additional findings_Paediatric v0.2 PNKD Zornitza Stark gene: PNKD was added
gene: PNKD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PNKD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PNKD were set to Paroxysmal nonkinesiogenic dyskinesia
Additional findings_Paediatric v0.2 PMP22 Zornitza Stark gene: PMP22 was added
gene: PMP22 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PMP22 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PMP22 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 PMM2 Zornitza Stark gene: PMM2 was added
gene: PMM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PMM2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PMM2 were set to Congenital disorder of glycosylation, type Ia
Additional findings_Paediatric v0.2 PLP1 Zornitza Stark Added phenotypes Spastic paraplegia 2, X-linked for gene: PLP1
Additional findings_Paediatric v0.2 PLP1 Zornitza Stark gene: PLP1 was added
gene: PLP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PLP1 were set to Pelizaeus-Merzbacher disease
Additional findings_Paediatric v0.2 PLOD1 Zornitza Stark gene: PLOD1 was added
gene: PLOD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLOD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLOD1 were set to Ehlers-Danlos syndrome, kyphoscoliotic type
Additional findings_Paediatric v0.2 PLG Zornitza Stark gene: PLG was added
gene: PLG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLG were set to Plasminogen deficiency
Additional findings_Paediatric v0.2 PLEC Zornitza Stark Added phenotypes Muscular dystrophy for gene: PLEC
Additional findings_Paediatric v0.2 PLEC Zornitza Stark gene: PLEC was added
gene: PLEC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLEC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLEC were set to Epidermolysis bullosa simplex
Additional findings_Paediatric v0.2 PLCE1 Zornitza Stark gene: PLCE1 was added
gene: PLCE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLCE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLCE1 were set to Nephrotic syndrome
Additional findings_Paediatric v0.2 PLA2G6 Zornitza Stark gene: PLA2G6 was added
gene: PLA2G6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLA2G6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLA2G6 were set to Infantile neuroaxonal dystrophy 1
Additional findings_Paediatric v0.2 PKLR Zornitza Stark gene: PKLR was added
gene: PKLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKLR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PKLR were set to Pyruvate kinase deficiency
Additional findings_Paediatric v0.2 PKHD1 Zornitza Stark gene: PKHD1 was added
gene: PKHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PKHD1 were set to Polycystic kidney and hepatic disease
Additional findings_Paediatric v0.2 PKD2 Zornitza Stark gene: PKD2 was added
gene: PKD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PKD2 were set to Polycystic kidney disease
Additional findings_Paediatric v0.2 PKD1 Zornitza Stark gene: PKD1 was added
gene: PKD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PKD1 were set to Polycystic kidney disease
Additional findings_Paediatric v0.2 PINK1 Zornitza Stark gene: PINK1 was added
gene: PINK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PINK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PINK1 were set to Parkinson disease 6, early onset
Additional findings_Paediatric v0.2 PIEZO2 Zornitza Stark gene: PIEZO2 was added
gene: PIEZO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PIEZO2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PIEZO2 were set to Arthrogryposis, distal, type 5
Additional findings_Paediatric v0.2 PHYH Zornitza Stark gene: PHYH was added
gene: PHYH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHYH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PHYH were set to Refsum disease
Additional findings_Paediatric v0.2 PHKG2 Zornitza Stark gene: PHKG2 was added
gene: PHKG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHKG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PHKG2 were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PHKB Zornitza Stark gene: PHKB was added
gene: PHKB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHKB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PHKB were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PHKA2 Zornitza Stark gene: PHKA2 was added
gene: PHKA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHKA2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHKA2 were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PHF6 Zornitza Stark gene: PHF6 was added
gene: PHF6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHF6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHF6 were set to Borjeson-Forssman-Lehmann syndrome
Additional findings_Paediatric v0.2 PFKM Zornitza Stark gene: PFKM was added
gene: PFKM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PFKM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PFKM were set to Glycogen storage disease 7
Additional findings_Paediatric v0.2 PEX7 Zornitza Stark Added phenotypes Rhizomelic chondrodysplasia punctata for gene: PEX7
Additional findings_Paediatric v0.2 PEX7 Zornitza Stark gene: PEX7 was added
gene: PEX7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX7 were set to Refsum disease
Additional findings_Paediatric v0.2 PEX6 Zornitza Stark gene: PEX6 was added
gene: PEX6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX6 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX5 Zornitza Stark gene: PEX5 was added
gene: PEX5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX5 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX3 Zornitza Stark gene: PEX3 was added
gene: PEX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX3 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX26 Zornitza Stark gene: PEX26 was added
gene: PEX26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX26 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX26 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX2 Zornitza Stark gene: PEX2 was added
gene: PEX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX2 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX13 Zornitza Stark gene: PEX13 was added
gene: PEX13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX13 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX13 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX12 Zornitza Stark gene: PEX12 was added
gene: PEX12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX12 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX10 Zornitza Stark gene: PEX10 was added
gene: PEX10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX10 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX1 Zornitza Stark gene: PEX1 was added
gene: PEX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX1 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PDHX Zornitza Stark gene: PDHX was added
gene: PDHX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PDHX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDHX were set to Pyruvate dehydrogenase complex deficiency
Additional findings_Paediatric v0.2 PDHA1 Zornitza Stark gene: PDHA1 was added
gene: PDHA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PDHA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PDHA1 were set to Pyruvate dehydrogenase deficiency
Additional findings_Paediatric v0.2 PDE4D Zornitza Stark gene: PDE4D was added
gene: PDE4D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PDE4D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDE4D were set to Acrodysostosis 2, with or without hormone resistance
Additional findings_Paediatric v0.2 PCNT Zornitza Stark gene: PCNT was added
gene: PCNT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCNT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCNT were set to Microcephalic osteodysplastic primordial dwarfism type 2
Additional findings_Paediatric v0.2 PCDH15 Zornitza Stark gene: PCDH15 was added
gene: PCDH15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCDH15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCDH15 were set to Usher syndrome
Additional findings_Paediatric v0.2 PCCB Zornitza Stark gene: PCCB was added
gene: PCCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCCB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCCB were set to Propionicacidemia
Additional findings_Paediatric v0.2 PCCA Zornitza Stark gene: PCCA was added
gene: PCCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCCA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCCA were set to Propionicacidemia
Additional findings_Paediatric v0.2 PC Zornitza Stark gene: PC was added
gene: PC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PC were set to Pyruvate carboxylase deficiency
Additional findings_Paediatric v0.2 PAX8 Zornitza Stark gene: PAX8 was added
gene: PAX8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAX8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PAX8 were set to Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia
Additional findings_Paediatric v0.2 PAX6 Zornitza Stark gene: PAX6 was added
gene: PAX6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAX6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PAX6 were set to Aniridia
Additional findings_Paediatric v0.2 PAX3 Zornitza Stark gene: PAX3 was added
gene: PAX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PAX3 were set to Waardenburg syndrome
Additional findings_Paediatric v0.2 PANK2 Zornitza Stark gene: PANK2 was added
gene: PANK2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PANK2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PANK2 were set to Neurodegeneration with brain iron accumulation 1
Additional findings_Paediatric v0.2 PAK3 Zornitza Stark gene: PAK3 was added
gene: PAK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PAK3 were set to Mental retardation syndrome, X-linked
Additional findings_Paediatric v0.2 PAH Zornitza Stark gene: PAH was added
gene: PAH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PAH were set to Phenylketonuria
Additional findings_Paediatric v0.2 OTOGL Zornitza Stark gene: OTOGL was added
gene: OTOGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTOGL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOGL were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 OTOF Zornitza Stark gene: OTOF was added
gene: OTOF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTOF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOF were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 OTOA Zornitza Stark gene: OTOA was added
gene: OTOA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTOA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOA were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 OTC Zornitza Stark gene: OTC was added
gene: OTC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: OTC were set to Ornithine transcarbamylase deficiency
Additional findings_Paediatric v0.2 OSTM1 Zornitza Stark gene: OSTM1 was added
gene: OSTM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OSTM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OSTM1 were set to Osteopetrosis
Additional findings_Paediatric v0.2 OSMR Zornitza Stark gene: OSMR was added
gene: OSMR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OSMR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: OSMR were set to Amyloidosis, primary cutaneous
Additional findings_Paediatric v0.2 ORC1 Zornitza Stark gene: ORC1 was added
gene: ORC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ORC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ORC1 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 OPA3 Zornitza Stark gene: OPA3 was added
gene: OPA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OPA3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OPA3 were set to 3-methylglutaconic aciduria, type III
Additional findings_Paediatric v0.2 OPA1 Zornitza Stark gene: OPA1 was added
gene: OPA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OPA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: OPA1 were set to Optic atrophy 1
Additional findings_Paediatric v0.2 OFD1 Zornitza Stark gene: OFD1 was added
gene: OFD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OFD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: OFD1 were set to Oral-facial-digital syndrome
Additional findings_Paediatric v0.2 OCRL Zornitza Stark gene: OCRL was added
gene: OCRL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OCRL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: OCRL were set to Lowe oculocerebrorenal syndrome
Additional findings_Paediatric v0.2 OCA2 Zornitza Stark gene: OCA2 was added
gene: OCA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OCA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OCA2 were set to Albinism, oculocutaneous
Additional findings_Paediatric v0.2 OBSL1 Zornitza Stark gene: OBSL1 was added
gene: OBSL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OBSL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OBSL1 were set to 3-M syndrome
Additional findings_Paediatric v0.2 NTRK1 Zornitza Stark gene: NTRK1 was added
gene: NTRK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NTRK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NTRK1 were set to Congenital insensitivity to pain with anhidrosis
Additional findings_Paediatric v0.2 NSDHL Zornitza Stark gene: NSDHL was added
gene: NSDHL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NSDHL were set to CHILD syndrome
Additional findings_Paediatric v0.2 NSD1 Zornitza Stark gene: NSD1 was added
gene: NSD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NSD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NSD1 were set to Sotos syndrome
Additional findings_Paediatric v0.2 NR0B1 Zornitza Stark gene: NR0B1 was added
gene: NR0B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NR0B1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NR0B1 were set to Congenital adrenal hypoplasia
Additional findings_Paediatric v0.2 NPHS1 Zornitza Stark gene: NPHS1 was added
gene: NPHS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHS1 were set to Congenital nephrotic syndrome, Finnish type
Additional findings_Paediatric v0.2 NPHP4 Zornitza Stark gene: NPHP4 was added
gene: NPHP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHP4 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NPHP3 Zornitza Stark gene: NPHP3 was added
gene: NPHP3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHP3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHP3 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NPHP1 Zornitza Stark gene: NPHP1 was added
gene: NPHP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHP1 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NPC2 Zornitza Stark gene: NPC2 was added
gene: NPC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPC2 were set to Niemann-Pick disease type C2
Additional findings_Paediatric v0.2 NPC1 Zornitza Stark gene: NPC1 was added
gene: NPC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPC1 were set to Niemann-Pick disease type C1
Additional findings_Paediatric v0.2 NOTCH3 Zornitza Stark gene: NOTCH3 was added
gene: NOTCH3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOTCH3 were set to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy
Additional findings_Paediatric v0.2 NOTCH2 Zornitza Stark gene: NOTCH2 was added
gene: NOTCH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NOTCH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOTCH2 were set to Hajdu-Cheney syndrome
Additional findings_Paediatric v0.2 NOG Zornitza Stark gene: NOG was added
gene: NOG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NOG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOG were set to Symphalangism, proximal, 1A
Additional findings_Paediatric v0.2 NKX2-1 Zornitza Stark gene: NKX2-1 was added
gene: NKX2-1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NKX2-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NKX2-1 were set to Choreoathetosis, hypothyroidism, and neonatal respiratory distress
Additional findings_Paediatric v0.2 NIPBL Zornitza Stark gene: NIPBL was added
gene: NIPBL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome
Additional findings_Paediatric v0.2 NIPAL4 Zornitza Stark gene: NIPAL4 was added
gene: NIPAL4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NIPAL4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NIPAL4 were set to Ichthyosis, autosomal recessive
Additional findings_Paediatric v0.2 NHLRC1 Zornitza Stark gene: NHLRC1 was added
gene: NHLRC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NHLRC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NHLRC1 were set to Myoclonic epilepsy of Lafora
Additional findings_Paediatric v0.2 NHEJ1 Zornitza Stark gene: NHEJ1 was added
gene: NHEJ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NHEJ1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NHEJ1 were set to Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation
Additional findings_Paediatric v0.2 NGLY1 Zornitza Stark gene: NGLY1 was added
gene: NGLY1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NGLY1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NGLY1 were set to Developmental delay, multifocal epilepsy & abnormal liver function
Additional findings_Paediatric v0.2 NF2 Zornitza Stark gene: NF2 was added
gene: NF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NF2 were set to Neurofibromatosis 2
Additional findings_Paediatric v0.2 NF1 Zornitza Stark gene: NF1 was added
gene: NF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NF1 were set to Neurofibromatosis, type 1
Additional findings_Paediatric v0.2 NEU1 Zornitza Stark gene: NEU1 was added
gene: NEU1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NEU1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEU1 were set to Sialidosis
Additional findings_Paediatric v0.2 NEFL Zornitza Stark gene: NEFL was added
gene: NEFL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NEFL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEFL were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 NEB Zornitza Stark gene: NEB was added
gene: NEB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NEB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEB were set to Nemaline myopathy
Additional findings_Paediatric v0.2 NDP Zornitza Stark gene: NDP was added
gene: NDP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NDP were set to Norrie disease
Additional findings_Paediatric v0.2 NCF2 Zornitza Stark gene: NCF2 was added
gene: NCF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NCF2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NCF2 were set to Chronic granulomatous disease
Additional findings_Paediatric v0.2 NCF1 Zornitza Stark gene: NCF1 was added
gene: NCF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NCF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NCF1 were set to Chronic granulomatous disease
Additional findings_Paediatric v0.2 NBN Zornitza Stark gene: NBN was added
gene: NBN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NBN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NBN were set to Nijmegen breakage syndrome
Additional findings_Paediatric v0.2 NAGS Zornitza Stark gene: NAGS was added
gene: NAGS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NAGS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NAGS were set to N-acetylglutamate synthetase deficiency
Additional findings_Paediatric v0.2 NAGLU Zornitza Stark gene: NAGLU was added
gene: NAGLU was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NAGLU was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NAGLU were set to Sanfilippo syndrome type B
Additional findings_Paediatric v0.2 NAGA Zornitza Stark gene: NAGA was added
gene: NAGA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NAGA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NAGA were set to N-acetylgalactosaminidase alpha deficiency
Additional findings_Paediatric v0.2 MYO7A Zornitza Stark gene: MYO7A was added
gene: MYO7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO7A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO7A were set to Usher syndrome
Additional findings_Paediatric v0.2 MYO6 Zornitza Stark gene: MYO6 was added
gene: MYO6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO6 were set to Deafness
Additional findings_Paediatric v0.2 MYO3A Zornitza Stark gene: MYO3A was added
gene: MYO3A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO3A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO3A were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYO15A Zornitza Stark gene: MYO15A was added
gene: MYO15A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO15A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO15A were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYH9 Zornitza Stark gene: MYH9 was added
gene: MYH9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH9 were set to Macrothrombocytopenia and progressive sensorineural deafness
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Myopathy, myosin storage for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark gene: MYH7 was added
gene: MYH7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH7 were set to Laing distal myopathy
Additional findings_Paediatric v0.2 MYH3 Zornitza Stark gene: MYH3 was added
gene: MYH3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH3 were set to Arthrogryposis, distal
Additional findings_Paediatric v0.2 MYH2 Zornitza Stark gene: MYH2 was added
gene: MYH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYH2 were set to Proximal myopathy and ophthalmoplegia
Additional findings_Paediatric v0.2 MYH14 Zornitza Stark gene: MYH14 was added
gene: MYH14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH14 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH14 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 MYCN Zornitza Stark gene: MYCN was added
gene: MYCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYCN were set to Feingold syndrome
Additional findings_Paediatric v0.2 MVK Zornitza Stark gene: MVK was added
gene: MVK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MVK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MVK were set to Hyperimmunoglobulin D and periodic fever syndrome
Additional findings_Paediatric v0.2 MUTYH Zornitza Stark gene: MUTYH was added
gene: MUTYH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MUTYH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MUTYH were set to MUTYH-associated polyposis
Additional findings_Paediatric v0.2 MUT Zornitza Stark gene: MUT was added
gene: MUT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MUT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MUT were set to Methylmalonic aciduria, mut(0) type
Additional findings_Paediatric v0.2 MUSK Zornitza Stark gene: MUSK was added
gene: MUSK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MUSK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MUSK were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.2 MTTP Zornitza Stark gene: MTTP was added
gene: MTTP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTTP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTTP were set to Abetalipoproteinaemia
Additional findings_Paediatric v0.2 MTRR Zornitza Stark gene: MTRR was added
gene: MTRR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTRR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTRR were set to Methylmalonic aciduria and homocystinuria
Additional findings_Paediatric v0.2 MTR Zornitza Stark gene: MTR was added
gene: MTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTR were set to Methylmalonic aciduria and homocystinuria
Additional findings_Paediatric v0.2 MTM1 Zornitza Stark gene: MTM1 was added
gene: MTM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTM1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MTM1 were set to Myotubular myopathy, X-linked
Additional findings_Paediatric v0.2 MSX2 Zornitza Stark gene: MSX2 was added
gene: MSX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MSX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MSX2 were set to Parietal foramina 1
Additional findings_Paediatric v0.2 MPZ Zornitza Stark gene: MPZ was added
gene: MPZ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MPZ were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 MPV17 Zornitza Stark gene: MPV17 was added
gene: MPV17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPV17 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPV17 were set to Mitochondrial DNA depletion syndrome, hepatic
Additional findings_Paediatric v0.2 MPL Zornitza Stark gene: MPL was added
gene: MPL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPL were set to Amegakaryocytic thrombocytopaenia, congenital
Additional findings_Paediatric v0.2 MPI Zornitza Stark gene: MPI was added
gene: MPI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPI was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPI were set to Congenital disorder of glycosylation 1b
Additional findings_Paediatric v0.2 MOCS2 Zornitza Stark gene: MOCS2 was added
gene: MOCS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MOCS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MOCS2 were set to Molybdenum cofactor deficiency
Additional findings_Paediatric v0.2 MOCS1 Zornitza Stark gene: MOCS1 was added
gene: MOCS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MOCS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MOCS1 were set to Molybdenum cofactor deficiency
Additional findings_Paediatric v0.2 MMADHC Zornitza Stark gene: MMADHC was added
gene: MMADHC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMADHC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMADHC were set to Methylmalonic aciduria and homocystinuria, cblD type
Additional findings_Paediatric v0.2 MMACHC Zornitza Stark gene: MMACHC was added
gene: MMACHC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMACHC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMACHC were set to Methylmalonic aciduria and homocystinuria, cblC type
Additional findings_Paediatric v0.2 MMAB Zornitza Stark gene: MMAB was added
gene: MMAB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMAB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMAB were set to Methylmalonic aciduria, vitamin B12-responsive, due to defect in synthesis of adenosylcobalamin, cblB complementation type
Additional findings_Paediatric v0.2 MMAA Zornitza Stark gene: MMAA was added
gene: MMAA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMAA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMAA were set to Methylmalonic aciduria, vitamin B12-responsive
Additional findings_Paediatric v0.2 MLYCD Zornitza Stark gene: MLYCD was added
gene: MLYCD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MLYCD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MLYCD were set to Malonyl-CoA decarboxylase deficiency
Additional findings_Paediatric v0.2 MLC1 Zornitza Stark gene: MLC1 was added
gene: MLC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MLC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MLC1 were set to Megalencephalic leukoencephalopathy
Additional findings_Paediatric v0.2 MKS1 Zornitza Stark gene: MKS1 was added
gene: MKS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MKS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MKS1 were set to Meckel syndrome
Additional findings_Paediatric v0.2 MKKS Zornitza Stark gene: MKKS was added
gene: MKKS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MKKS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MKKS were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.2 MITF Zornitza Stark gene: MITF was added
gene: MITF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MITF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MITF were set to Waardenburg syndrome
Additional findings_Paediatric v0.2 MGP Zornitza Stark gene: MGP was added
gene: MGP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MGP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MGP were set to Keutel syndrome
Additional findings_Paediatric v0.2 MFSD8 Zornitza Stark gene: MFSD8 was added
gene: MFSD8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MFSD8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MFSD8 were set to Ceroid lipofuscinosis, neuronal
Additional findings_Paediatric v0.2 MFN2 Zornitza Stark gene: MFN2 was added
gene: MFN2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MFN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MFN2 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 MEN1 Zornitza Stark gene: MEN1 was added
gene: MEN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MEN1 were set to Multiple endocrine neoplasia I
Additional findings_Paediatric v0.2 MEGF10 Zornitza Stark gene: MEGF10 was added
gene: MEGF10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MEGF10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MEGF10 were set to Myopathy, areflexia, respiratory distress, and dysphagia, early-onset
Additional findings_Paediatric v0.2 MEFV Zornitza Stark gene: MEFV was added
gene: MEFV was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MEFV was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MEFV were set to Mediterranean fever, familial
Additional findings_Paediatric v0.2 MED12 Zornitza Stark gene: MED12 was added
gene: MED12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MED12 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MED12 were set to Intellectual disability
Additional findings_Paediatric v0.2 MECP2 Zornitza Stark gene: MECP2 was added
gene: MECP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MECP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MECP2 were set to Rett syndrome
Additional findings_Paediatric v0.2 MCPH1 Zornitza Stark gene: MCPH1 was added
gene: MCPH1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MCPH1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCPH1 were set to Microcephaly 1, primary, autosomal recessive
Additional findings_Paediatric v0.2 MCOLN1 Zornitza Stark gene: MCOLN1 was added
gene: MCOLN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MCOLN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCOLN1 were set to Mucolipidosis IV
Additional findings_Paediatric v0.2 MCFD2 Zornitza Stark gene: MCFD2 was added
gene: MCFD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MCFD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCFD2 were set to Factor V and Factor VIII deficiency, combined
Additional findings_Paediatric v0.2 MBTPS2 Zornitza Stark gene: MBTPS2 was added
gene: MBTPS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MBTPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MBTPS2 were set to Ichthyosis follicularis, alopecia & photophobia
Additional findings_Paediatric v0.2 MARVELD2 Zornitza Stark gene: MARVELD2 was added
gene: MARVELD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MARVELD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MARVELD2 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 MAP2K2 Zornitza Stark gene: MAP2K2 was added
gene: MAP2K2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAP2K2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAP2K2 were set to Cardiofaciocutaneous syndrome
Additional findings_Paediatric v0.2 MAP2K1 Zornitza Stark gene: MAP2K1 was added
gene: MAP2K1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAP2K1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAP2K1 were set to Cardiofaciocutaneous syndrome
Additional findings_Paediatric v0.2 MAN2B1 Zornitza Stark gene: MAN2B1 was added
gene: MAN2B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAN2B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MAN2B1 were set to Mannosidosis, alpha
Additional findings_Paediatric v0.2 MAGI2 Zornitza Stark gene: MAGI2 was added
gene: MAGI2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAGI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAGI2 were set to Infantile spasms
Additional findings_Paediatric v0.2 MAFB Zornitza Stark gene: MAFB was added
gene: MAFB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAFB were set to Multicentric carpotarsal osteolysis syndrome
Additional findings_Paediatric v0.2 LYST Zornitza Stark gene: LYST was added
gene: LYST was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LYST was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LYST were set to Chediak-Higashi syndrome
Additional findings_Paediatric v0.2 LTBP4 Zornitza Stark gene: LTBP4 was added
gene: LTBP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LTBP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LTBP4 were set to Cutis laxa, autosomal recessive, type IC
Additional findings_Paediatric v0.2 LRTOMT Zornitza Stark gene: LRTOMT was added
gene: LRTOMT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRTOMT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRTOMT were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 LRSAM1 Zornitza Stark gene: LRSAM1 was added
gene: LRSAM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRSAM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LRSAM1 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 LRRC6 Zornitza Stark gene: LRRC6 was added
gene: LRRC6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRRC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRRC6 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 LRPPRC Zornitza Stark gene: LRPPRC was added
gene: LRPPRC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRPPRC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRPPRC were set to Leigh syndrome
Additional findings_Paediatric v0.2 LRP5 Zornitza Stark Mode of inheritance for gene LRP5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Osteopetrosis, autosomal dominant for gene: LRP5
Additional findings_Paediatric v0.2 LRP5 Zornitza Stark gene: LRP5 was added
gene: LRP5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRP5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRP5 were set to Osteoporosis-pseudoglioma syndrome
Additional findings_Paediatric v0.2 LRP4 Zornitza Stark gene: LRP4 was added
gene: LRP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRP4 were set to Cenani-Lenz syndactyly syndrome
Additional findings_Paediatric v0.2 LRP2 Zornitza Stark gene: LRP2 was added
gene: LRP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRP2 were set to Donnai-Barrow syndrome
Additional findings_Paediatric v0.2 LOXHD1 Zornitza Stark gene: LOXHD1 was added
gene: LOXHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LOXHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LOXHD1 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 LMX1B Zornitza Stark gene: LMX1B was added
gene: LMX1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMX1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LMX1B were set to Nail patella syndrome
Additional findings_Paediatric v0.2 LMOD3 Zornitza Stark gene: LMOD3 was added
gene: LMOD3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMOD3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LMOD3 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 LMNA Zornitza Stark Mode of inheritance for gene LMNA was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Charcot-Marie-Tooth disease for gene: LMNA
Additional findings_Paediatric v0.2 LMNA Zornitza Stark gene: LMNA was added
gene: LMNA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMNA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LMNA were set to Emery-Dreifuss muscular dystrophy 2
Additional findings_Paediatric v0.2 LMBRD1 Zornitza Stark gene: LMBRD1 was added
gene: LMBRD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMBRD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LMBRD1 were set to Methylmalonic aciduria and homocystinuria
Additional findings_Paediatric v0.2 LITAF Zornitza Stark gene: LITAF was added
gene: LITAF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LITAF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LITAF were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 LIPA Zornitza Stark gene: LIPA was added
gene: LIPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LIPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LIPA were set to Wolman syndrome
Additional findings_Paediatric v0.2 LIG4 Zornitza Stark gene: LIG4 was added
gene: LIG4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LIG4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LIG4 were set to Severe combined immunodeficiency with sensitivity to ionizing radiation
Additional findings_Paediatric v0.2 LIFR Zornitza Stark gene: LIFR was added
gene: LIFR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LIFR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LIFR were set to Stuve-Wiedemann syndrome
Additional findings_Paediatric v0.2 LHX3 Zornitza Stark gene: LHX3 was added
gene: LHX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LHX3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LHX3 were set to Pituitary hormone deficiency, combined
Additional findings_Paediatric v0.2 LHFPL5 Zornitza Stark gene: LHFPL5 was added
gene: LHFPL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LHFPL5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LHFPL5 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 LEPR Zornitza Stark gene: LEPR was added
gene: LEPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LEPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LEPR were set to Obesity, morbid, due to leptin receptor deficiency
Additional findings_Paediatric v0.2 LDLR Zornitza Stark gene: LDLR was added
gene: LDLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LDLR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LDLR were set to Hypercholesterolemia
Additional findings_Paediatric v0.2 LBR Zornitza Stark gene: LBR was added
gene: LBR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LBR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LBR were set to Pelger-Huet anomaly
Additional findings_Paediatric v0.2 LARGE1 Zornitza Stark gene: LARGE1 was added
gene: LARGE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LARGE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LARGE1 were set to Walker-Warburg syndrome
Additional findings_Paediatric v0.2 LAMP2 Zornitza Stark gene: LAMP2 was added
gene: LAMP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: LAMP2 were set to Danon disease
Additional findings_Paediatric v0.2 LAMC2 Zornitza Stark gene: LAMC2 was added
gene: LAMC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMC2 were set to Epidermolysis bullosa, junctional
Additional findings_Paediatric v0.2 LAMB3 Zornitza Stark gene: LAMB3 was added
gene: LAMB3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMB3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMB3 were set to Epidermolysis bullosa, junctional
Additional findings_Paediatric v0.2 LAMB2 Zornitza Stark gene: LAMB2 was added
gene: LAMB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMB2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMB2 were set to Pierson syndrome
Additional findings_Paediatric v0.2 LAMA3 Zornitza Stark gene: LAMA3 was added
gene: LAMA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMA3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMA3 were set to Epidermolysis bullosa, junctional
Additional findings_Paediatric v0.2 LAMA2 Zornitza Stark gene: LAMA2 was added
gene: LAMA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMA2 were set to Muscular dystrophy, congenital merosin-deficient
Additional findings_Paediatric v0.2 L1CAM Zornitza Stark gene: L1CAM was added
gene: L1CAM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: L1CAM was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: L1CAM were set to X-linked hydrocephalus syndrome
Additional findings_Paediatric v0.2 KRT6A Zornitza Stark gene: KRT6A was added
gene: KRT6A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT6A were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT5 Zornitza Stark gene: KRT5 was added
gene: KRT5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT5 were set to Epidermolysis bullosa simplex
Additional findings_Paediatric v0.2 KRT17 Zornitza Stark gene: KRT17 was added
gene: KRT17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT17 were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT16 Zornitza Stark gene: KRT16 was added
gene: KRT16 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT16 were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT14 Zornitza Stark gene: KRT14 was added
gene: KRT14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT14 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT14 were set to Epidermolysis bullosa simplex
Additional findings_Paediatric v0.2 KRAS Zornitza Stark gene: KRAS was added
gene: KRAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRAS were set to Noonan syndrome
Additional findings_Paediatric v0.2 KMT2D Zornitza Stark gene: KMT2D was added
gene: KMT2D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KMT2D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KMT2D were set to Kabuki syndrome 1
Additional findings_Paediatric v0.2 KLHL41 Zornitza Stark gene: KLHL41 was added
gene: KLHL41 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KLHL41 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KLHL41 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 KLHL40 Zornitza Stark gene: KLHL40 was added
gene: KLHL40 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KLHL40 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KLHL40 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 KIT Zornitza Stark gene: KIT was added
gene: KIT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KIT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIT were set to Piebaldism
Additional findings_Paediatric v0.2 KIF21A Zornitza Stark gene: KIF21A was added
gene: KIF21A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KIF21A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIF21A were set to Fibrosis of extraocular muscles, congenital
Additional findings_Paediatric v0.2 KDM6A Zornitza Stark gene: KDM6A was added
gene: KDM6A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KDM6A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: KDM6A were set to Kabuki syndrome 2
Additional findings_Paediatric v0.2 KCTD7 Zornitza Stark gene: KCTD7 was added
gene: KCTD7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCTD7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCTD7 were set to Epilepsy, progressive myoclonic
Additional findings_Paediatric v0.2 KCNQ4 Zornitza Stark gene: KCNQ4 was added
gene: KCNQ4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNQ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNQ4 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 KCNQ1 Zornitza Stark gene: KCNQ1 was added
gene: KCNQ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNQ1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNQ1 were set to Jervell and Lange-Nielsen syndrome
Additional findings_Paediatric v0.2 KCNJ2 Zornitza Stark gene: KCNJ2 was added
gene: KCNJ2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNJ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ2 were set to Andersen cardiodysrhythmic periodic paralysis
Additional findings_Paediatric v0.2 KCNJ11 Zornitza Stark gene: KCNJ11 was added
gene: KCNJ11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNJ11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNJ11 were set to Hyperinsulinemic hypoglycemia, familial
Additional findings_Paediatric v0.2 KCNJ1 Zornitza Stark gene: KCNJ1 was added
gene: KCNJ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNJ1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNJ1 were set to Bartter syndrome
Additional findings_Paediatric v0.2 KCNE1 Zornitza Stark gene: KCNE1 was added
gene: KCNE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNE1 were set to Jervell and Lange-Nielsen syndrome
Additional findings_Paediatric v0.2 KCNA1 Zornitza Stark gene: KCNA1 was added
gene: KCNA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNA1 were set to Episodic ataxia type 1
Additional findings_Paediatric v0.2 KBTBD13 Zornitza Stark gene: KBTBD13 was added
gene: KBTBD13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KBTBD13 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KBTBD13 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 KAT6B Zornitza Stark gene: KAT6B was added
gene: KAT6B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KAT6B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KAT6B were set to Genitopatellar syndrome
Additional findings_Paediatric v0.2 KANSL1 Zornitza Stark gene: KANSL1 was added
gene: KANSL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KANSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KANSL1 were set to Koolen-De Vries syndrome
Additional findings_Paediatric v0.2 JUP Zornitza Stark gene: JUP was added
gene: JUP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: JUP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: JUP were set to Naxos disease
Additional findings_Paediatric v0.2 JAK3 Zornitza Stark gene: JAK3 was added
gene: JAK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: JAK3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: JAK3 were set to SCID, autosomal recessive, T-negative/B-positive type
Additional findings_Paediatric v0.2 JAG1 Zornitza Stark gene: JAG1 was added
gene: JAG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: JAG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: JAG1 were set to Alagille syndrome
Additional findings_Paediatric v0.2 IVD Zornitza Stark gene: IVD was added
gene: IVD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IVD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IVD were set to Isovaleric acidemia
Additional findings_Paediatric v0.2 ITGB4 Zornitza Stark gene: ITGB4 was added
gene: ITGB4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ITGB4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGB4 were set to Epidermolysis bullosa, junctional, with pyloric atresia
Additional findings_Paediatric v0.2 ISPD Zornitza Stark gene: ISPD was added
gene: ISPD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ISPD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ISPD were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7
Additional findings_Paediatric v0.2 IRF6 Zornitza Stark gene: IRF6 was added
gene: IRF6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IRF6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: IRF6 were set to van der Woude syndrome
Additional findings_Paediatric v0.2 IQCB1 Zornitza Stark gene: IQCB1 was added
gene: IQCB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IQCB1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IQCB1 were set to Senior-Loken syndrome 5
Additional findings_Paediatric v0.2 INVS Zornitza Stark gene: INVS was added
gene: INVS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: INVS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: INVS were set to Nephronophthisis 2
Additional findings_Paediatric v0.2 INSR Zornitza Stark gene: INSR was added
gene: INSR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: INSR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: INSR were set to Leprechaunism
Additional findings_Paediatric v0.2 ILDR1 Zornitza Stark gene: ILDR1 was added
gene: ILDR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ILDR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ILDR1 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 IL2RG Zornitza Stark gene: IL2RG was added
gene: IL2RG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IL2RG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IL2RG were set to Severe combined immunodeficiency, X-linked
Additional findings_Paediatric v0.2 IL10RA Zornitza Stark gene: IL10RA was added
gene: IL10RA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IL10RA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IL10RA were set to Inflammatory bowel disease
Additional findings_Paediatric v0.2 IKBKG Zornitza Stark gene: IKBKG was added
gene: IKBKG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IKBKG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IKBKG were set to Incontinentia pigmenti 1
Additional findings_Paediatric v0.2 ELP1 Zornitza Stark gene: ELP1 was added
gene: ELP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ELP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ELP1 were set to Dysautonomia, familial
Additional findings_Paediatric v0.2 IGSF1 Zornitza Stark gene: IGSF1 was added
gene: IGSF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IGSF1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IGSF1 were set to Central hypothyroidism and testicular enlargement
Additional findings_Paediatric v0.2 IGHMBP2 Zornitza Stark gene: IGHMBP2 was added
gene: IGHMBP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IGHMBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IGHMBP2 were set to Spinal muscular atrophy with respiratory distress
Additional findings_Paediatric v0.2 IDUA Zornitza Stark gene: IDUA was added
gene: IDUA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IDUA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IDUA were set to Mucopolysaccharidosis Ih
Additional findings_Paediatric v0.2 IDS Zornitza Stark gene: IDS was added
gene: IDS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IDS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IDS were set to Mucopolysaccharidosis II
Additional findings_Paediatric v0.2 HTRA1 Zornitza Stark gene: HTRA1 was added
gene: HTRA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HTRA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HTRA1 were set to CARASIL syndrome
Additional findings_Paediatric v0.2 HSPG2 Zornitza Stark gene: HSPG2 was added
gene: HSPG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSPG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSPG2 were set to Schwartz-Jampel syndrome
Additional findings_Paediatric v0.2 HSPB8 Zornitza Stark gene: HSPB8 was added
gene: HSPB8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSPB8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HSPB8 were set to Charcot-Marie-Tooth disease, axonal, type 2L
Additional findings_Paediatric v0.2 HSD3B7 Zornitza Stark gene: HSD3B7 was added
gene: HSD3B7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD3B7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSD3B7 were set to 3 beta-hydroxysteroid dehydrogenase deficiency
Additional findings_Paediatric v0.2 HSD17B4 Zornitza Stark gene: HSD17B4 was added
gene: HSD17B4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD17B4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSD17B4 were set to D-bifunctional protein deficiency
Additional findings_Paediatric v0.2 HSD17B3 Zornitza Stark gene: HSD17B3 was added
gene: HSD17B3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD17B3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSD17B3 were set to Pseudohermaphroditism, male, with gynecomastia
Additional findings_Paediatric v0.2 HSD17B10 Zornitza Stark gene: HSD17B10 was added
gene: HSD17B10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD17B10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HSD17B10 were set to 17-beta-hydroxysteroid dehydrogenase X deficiency
Additional findings_Paediatric v0.2 HRAS Zornitza Stark gene: HRAS was added
gene: HRAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HRAS were set to Costello syndrome
Additional findings_Paediatric v0.2 HPS5 Zornitza Stark gene: HPS5 was added
gene: HPS5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS5 were set to Hermansky-Pudlak syndrome 5
Additional findings_Paediatric v0.2 HPS4 Zornitza Stark gene: HPS4 was added
gene: HPS4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS4 were set to Hermansky-Pudlak syndrome 4
Additional findings_Paediatric v0.2 HPS3 Zornitza Stark gene: HPS3 was added
gene: HPS3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS3 were set to Hermansky-Pudlak syndrome 3
Additional findings_Paediatric v0.2 HPS1 Zornitza Stark gene: HPS1 was added
gene: HPS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS1 were set to Hermansky-Pudlak syndrome 1
Additional findings_Paediatric v0.2 HPRT1 Zornitza Stark gene: HPRT1 was added
gene: HPRT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPRT1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HPRT1 were set to Lesch-Nyhan syndrome 1
Additional findings_Paediatric v0.2 HMGCL Zornitza Stark gene: HMGCL was added
gene: HMGCL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HMGCL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HMGCL were set to 3-hydroxy-3-methylglutaric aciduria
Additional findings_Paediatric v0.2 HLCS Zornitza Stark gene: HLCS was added
gene: HLCS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HLCS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HLCS were set to Holocarboxylase synthetase deficiency
Additional findings_Paediatric v0.2 HINT1 Zornitza Stark gene: HINT1 was added
gene: HINT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HINT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HINT1 were set to Axonal neuropathy with neuromyotonia
Additional findings_Paediatric v0.2 HGSNAT Zornitza Stark gene: HGSNAT was added
gene: HGSNAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HGSNAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HGSNAT were set to Mucopolysaccharidosis IIIC
Additional findings_Paediatric v0.2 HGD Zornitza Stark gene: HGD was added
gene: HGD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HGD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HGD were set to Alkaptonuria
Additional findings_Paediatric v0.2 HEXB Zornitza Stark gene: HEXB was added
gene: HEXB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HEXB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HEXB were set to Sandhoff disease, infantile, juvenile, and adult forms
Additional findings_Paediatric v0.2 HEXA Zornitza Stark gene: HEXA was added
gene: HEXA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HEXA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HEXA were set to Tay-Sachs disease
Additional findings_Paediatric v0.2 HDAC8 Zornitza Stark gene: HDAC8 was added
gene: HDAC8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HDAC8 were set to Cornelia de Lange syndrome-like features, ocular hypertelorism & large fontanelle
Additional findings_Paediatric v0.2 HBB Zornitza Stark gene: HBB was added
gene: HBB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HBB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HBB were set to Beta-thalassemia
Additional findings_Paediatric v0.2 HBA2 Zornitza Stark gene: HBA2 was added
gene: HBA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HBA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HBA2 were set to Thalassemia, alpha
Additional findings_Paediatric v0.2 HBA1 Zornitza Stark gene: HBA1 was added
gene: HBA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HBA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HBA1 were set to Thalassaemia alpha
Additional findings_Paediatric v0.2 HADHB Zornitza Stark gene: HADHB was added
gene: HADHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HADHB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HADHB were set to Mitochondrial trifunctional protein deficiency
Additional findings_Paediatric v0.2 HADHA Zornitza Stark gene: HADHA was added
gene: HADHA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HADHA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HADHA were set to Mitochondrial trifunctional protein deficiency
Additional findings_Paediatric v0.2 HADH Zornitza Stark gene: HADH was added
gene: HADH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HADH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HADH were set to Hyperinsulinemic hypoglycemia, familial, 4
Additional findings_Paediatric v0.2 H19 Zornitza Stark gene: H19 was added
gene: H19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: H19 was set to Unknown
Phenotypes for gene: H19 were set to Beckwith-Wiedemann Syndrome
Additional findings_Paediatric v0.2 GYS2 Zornitza Stark gene: GYS2 was added
gene: GYS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GYS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GYS2 were set to Glycogen storage disease 0
Additional findings_Paediatric v0.2 GUSB Zornitza Stark gene: GUSB was added
gene: GUSB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GUSB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GUSB were set to Mucopolysaccharidosis VII
Additional findings_Paediatric v0.2 GSS Zornitza Stark gene: GSS was added
gene: GSS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GSS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GSS were set to Glutathione synthetase deficiency
Additional findings_Paediatric v0.2 GRHPR Zornitza Stark gene: GRHPR was added
gene: GRHPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GRHPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GRHPR were set to Hyperoxaluria, primary, type II
Additional findings_Paediatric v0.2 GPSM2 Zornitza Stark gene: GPSM2 was added
gene: GPSM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GPSM2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPSM2 were set to Chudley-McCullough syndrome
Additional findings_Paediatric v0.2 PDZD7 Zornitza Stark Added phenotypes Usher syndrome for gene: PDZD7
Additional findings_Paediatric v0.2 ADGRG1 Zornitza Stark Added phenotypes Polymicrogyria, bilateral frontoparietal for gene: ADGRG1
Additional findings_Paediatric v0.2 GPR143 Zornitza Stark Added phenotypes Ocular albinism, type I for gene: GPR143
Additional findings_Paediatric v0.2 GPC3 Zornitza Stark Added phenotypes Simpson-Golabi-Behmel syndrome for gene: GPC3
Additional findings_Paediatric v0.2 GNS Zornitza Stark Added phenotypes Mucopolysaccharidosis IIId for gene: GNS
Additional findings_Paediatric v0.2 GNPTG Zornitza Stark Added phenotypes Mucolipidosis III gamma for gene: GNPTG
Additional findings_Paediatric v0.2 GNPTAB Zornitza Stark Added phenotypes Mucolipidosis II for gene: GNPTAB
Additional findings_Paediatric v0.2 GNE Zornitza Stark Added phenotypes Inclusion body myopathy for gene: GNE
Additional findings_Paediatric v0.2 GNAS Zornitza Stark Added phenotypes Pseudopseudohypoparathyroidism for gene: GNAS
Additional findings_Paediatric v0.2 GNAS Zornitza Stark Added phenotypes Pseudohypoparathyroidism for gene: GNAS
Additional findings_Paediatric v0.2 GLUD1 Zornitza Stark Added phenotypes Hyperinsulinism for gene: GLUD1
Additional findings_Paediatric v0.2 GLRA1 Zornitza Stark Added phenotypes Hyperekplexia, hereditary 1, autosomal dominant or recessive for gene: GLRA1
Additional findings_Paediatric v0.2 GLI3 Zornitza Stark Added phenotypes Greig cephalopolysyndactyly syndrome for gene: GLI3
Additional findings_Paediatric v0.2 GLDC Zornitza Stark Added phenotypes Glycine encephalopathy for gene: GLDC
Additional findings_Paediatric v0.2 GLB1 Zornitza Stark Added phenotypes Gangliosidosis GM1 for gene: GLB1
Additional findings_Paediatric v0.2 GLA Zornitza Stark Added phenotypes Fabry disease for gene: GLA
Additional findings_Paediatric v0.2 GJC2 Zornitza Stark Added phenotypes Pelizaeus-Merzbacher-like disease for gene: GJC2
Additional findings_Paediatric v0.2 GJB2 Zornitza Stark Mode of inheritance for gene GJB2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Deafness and palmoplantar keratoderma for gene: GJB2
Additional findings_Paediatric v0.2 GJB2 Zornitza Stark Mode of inheritance for gene GJB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Deafness for gene: GJB2
Additional findings_Paediatric v0.2 GJB1 Zornitza Stark Added phenotypes Charcot-Marie-Tooth neuropathy for gene: GJB1
Additional findings_Paediatric v0.2 GJA1 Zornitza Stark Added phenotypes Oculodentodigital dysplasia for gene: GJA1
Additional findings_Paediatric v0.2 GIPC3 Zornitza Stark Added phenotypes Hearing loss for gene: GIPC3
Additional findings_Paediatric v0.2 GFPT1 Zornitza Stark Added phenotypes Congenital myasthenic syndrome, limb-girdle for gene: GFPT1
Additional findings_Paediatric v0.2 GFM1 Zornitza Stark Added phenotypes Combined oxidative phosphorylation deficiency 1 for gene: GFM1
Additional findings_Paediatric v0.2 GFAP Zornitza Stark Added phenotypes Alexander disease for gene: GFAP
Additional findings_Paediatric v0.2 GDAP1 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: GDAP1
Additional findings_Paediatric v0.2 GCK Zornitza Stark Added phenotypes Hyperinsulinemic hypoglycemia, familial for gene: GCK
Additional findings_Paediatric v0.2 GCDH Zornitza Stark Added phenotypes Glutaricaciduria, type I for gene: GCDH
Additional findings_Paediatric v0.2 GBE1 Zornitza Stark Added phenotypes Glycogen storage disease IV for gene: GBE1
Additional findings_Paediatric v0.2 GBA Zornitza Stark Added phenotypes Gaucher disease 1 for gene: GBA
Additional findings_Paediatric v0.2 GATA4 Zornitza Stark Added phenotypes Congenital heart defects for gene: GATA4
Additional findings_Paediatric v0.2 GATA1 Zornitza Stark Added phenotypes Dyserythropoietic anemia with thrombocytopenia for gene: GATA1
Additional findings_Paediatric v0.2 GAN Zornitza Stark Added phenotypes Giant axonal neuropathy for gene: GAN
Additional findings_Paediatric v0.2 GALT Zornitza Stark Added phenotypes Galactosaemia for gene: GALT
Additional findings_Paediatric v0.2 GALNS Zornitza Stark Added phenotypes Mucopolysaccharidosis IVA for gene: GALNS
Additional findings_Paediatric v0.2 GALK1 Zornitza Stark Added phenotypes Galactokinase deficiency with cataracts for gene: GALK1
Additional findings_Paediatric v0.2 GALC Zornitza Stark Added phenotypes Krabbe disease for gene: GALC
Additional findings_Paediatric v0.2 GAA Zornitza Stark Added phenotypes Glycogen storage disease II for gene: GAA
Additional findings_Paediatric v0.2 G6PD Zornitza Stark Added phenotypes Glucose-6-phosphate dehydrogenase deficiency for gene: G6PD
Additional findings_Paediatric v0.2 G6PC3 Zornitza Stark Added phenotypes Neutropaenia, congenital for gene: G6PC3
Additional findings_Paediatric v0.2 G6PC Zornitza Stark Added phenotypes Glycogen storage disease Ia for gene: G6PC
Additional findings_Paediatric v0.2 FXN Zornitza Stark Added phenotypes Friedreich ataxia for gene: FXN
Additional findings_Paediatric v0.2 FUCA1 Zornitza Stark Added phenotypes Fucosidosis for gene: FUCA1
Additional findings_Paediatric v0.2 FTL Zornitza Stark Added phenotypes Neuroferritinopathy for gene: FTL
Additional findings_Paediatric v0.2 FRAS1 Zornitza Stark Added phenotypes Fraser syndrome for gene: FRAS1
Additional findings_Paediatric v0.2 FOXP3 Zornitza Stark Added phenotypes IPEX syndrome for gene: FOXP3
Additional findings_Paediatric v0.2 FOXF1 Zornitza Stark Added phenotypes Alveolar capillary dysplasia with misalignment of pulmonary veins for gene: FOXF1
Additional findings_Paediatric v0.2 FOXC2 Zornitza Stark Added phenotypes Lymphoedema, primary for gene: FOXC2
Additional findings_Paediatric v0.2 FOXC1 Zornitza Stark Added phenotypes Axenfeld-Rieger syndrome for gene: FOXC1
Additional findings_Paediatric v0.2 FLNA Zornitza Stark Added phenotypes Otopalatodigital spectrum disorder for gene: FLNA
Additional findings_Paediatric v0.2 FLCN Zornitza Stark Added phenotypes Birt-Hogg-Dube syndrome for gene: FLCN
Additional findings_Paediatric v0.2 FKTN Zornitza Stark Added phenotypes Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies for gene: FKTN
Additional findings_Paediatric v0.2 FKTN Zornitza Stark Added phenotypes Muscular dystrophy, Fukuyama for gene: FKTN
Additional findings_Paediatric v0.2 FKRP Zornitza Stark Added phenotypes Muscle-eye-brain disease for gene: FKRP
Additional findings_Paediatric v0.2 FKRP Zornitza Stark Added phenotypes Muscular dystrophy, limb girdle 2I for gene: FKRP
Additional findings_Paediatric v0.2 FHL1 Zornitza Stark Added phenotypes Emery-Dreifuss muscular dystrophy for gene: FHL1
Additional findings_Paediatric v0.2 FH Zornitza Stark Added phenotypes Fumarase deficiency for gene: FH
Additional findings_Paediatric v0.2 FGG Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGG
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Muenke syndrome for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Thanatophoric dysplasia type 1 for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Crouzon syndrome with acanthosis nigricans for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Hypochondroplasia for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Achondroplasia for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Jackson-Weiss syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Beare-Stevenson cutis gyrata syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Crouzon syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Apert syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Pfeiffer syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR1 Zornitza Stark Added phenotypes Kallmann syndrome for gene: FGFR1
Additional findings_Paediatric v0.2 FGF3 Zornitza Stark Added phenotypes Deafness, congenital with inner ear agenesis, microtia, and microdontia for gene: FGF3
Additional findings_Paediatric v0.2 FGD4 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: FGD4
Additional findings_Paediatric v0.2 FGD1 Zornitza Stark Added phenotypes Aarskog-Scott syndrome for gene: FGD1
Additional findings_Paediatric v0.2 FGB Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGB
Additional findings_Paediatric v0.2 FGA Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGA
Additional findings_Paediatric v0.2 FBN2 Zornitza Stark Added phenotypes Contractural arachnodactyly for gene: FBN2
Additional findings_Paediatric v0.2 FBN1 Zornitza Stark Added phenotypes Marfan's syndrome for gene: FBN1
Additional findings_Paediatric v0.2 FBLN5 Zornitza Stark Added phenotypes Cutis laxa for gene: FBLN5
Additional findings_Paediatric v0.2 FANCI Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCI
Additional findings_Paediatric v0.2 FANCG Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCG
Additional findings_Paediatric v0.2 FANCD2 Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCD2
Additional findings_Paediatric v0.2 FANCC Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCC
Additional findings_Paediatric v0.2 FANCB Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCB
Additional findings_Paediatric v0.2 FANCA Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCA
Additional findings_Paediatric v0.2 FAM58A Zornitza Stark Added phenotypes Syndactyly - telecanthus - anogenital and renal malformations for gene: FAM58A
Additional findings_Paediatric v0.2 FAM20C Zornitza Stark Added phenotypes Osteosclerotic bone dysplasia for gene: FAM20C
Additional findings_Paediatric v0.2 FAM161A Zornitza Stark Added phenotypes Retinal dystrophy for gene: FAM161A
Additional findings_Paediatric v0.2 FAM126A Zornitza Stark Added phenotypes Hypomyelination and congenital cataract for gene: FAM126A
Additional findings_Paediatric v0.2 FAH Zornitza Stark Added phenotypes Tyrosinemia, type I for gene: FAH
Additional findings_Paediatric v0.2 F9 Zornitza Stark Added phenotypes Hemophilia B for gene: F9
Additional findings_Paediatric v0.2 F8 Zornitza Stark Added phenotypes Hemophilia A for gene: F8
Additional findings_Paediatric v0.2 F2 Zornitza Stark Added phenotypes Prothrombin deficiency for gene: F2
Additional findings_Paediatric v0.2 F11 Zornitza Stark Added phenotypes Factor XI deficiency for gene: F11
Additional findings_Paediatric v0.2 EZH2 Zornitza Stark Added phenotypes Weaver syndrome 2 for gene: EZH2
Additional findings_Paediatric v0.2 EYA4 Zornitza Stark Added phenotypes Deafness, autosomal dominant for gene: EYA4
Additional findings_Paediatric v0.2 EYA1 Zornitza Stark Added phenotypes Branchiootorenal syndrome for gene: EYA1
Additional findings_Paediatric v0.2 EXT2 Zornitza Stark Added phenotypes Exostoses, multiple, type 2 for gene: EXT2
Additional findings_Paediatric v0.2 EXT1 Zornitza Stark Added phenotypes Exostoses, multiple, type 1 for gene: EXT1
Additional findings_Paediatric v0.2 EVC2 Zornitza Stark Added phenotypes Ellis-van Creveld syndrome for gene: EVC2
Additional findings_Paediatric v0.2 EVC Zornitza Stark Added phenotypes Ellis-van Creveld syndrome for gene: EVC
Additional findings_Paediatric v0.2 ETHE1 Zornitza Stark Added phenotypes Ethylmalonic encephalopathy for gene: ETHE1
Additional findings_Paediatric v0.2 ETFDH Zornitza Stark Added phenotypes Glutaric acidemia IIC for gene: ETFDH
Additional findings_Paediatric v0.2 ETFB Zornitza Stark Added phenotypes Glutaric acidemia IIB for gene: ETFB
Additional findings_Paediatric v0.2 ETFA Zornitza Stark Added phenotypes Glutaric acidemia IIA for gene: ETFA
Additional findings_Paediatric v0.2 ESRRB Zornitza Stark Added phenotypes Hearing loss for gene: ESRRB
Additional findings_Paediatric v0.2 ESCO2 Zornitza Stark Added phenotypes Roberts syndrome for gene: ESCO2
Additional findings_Paediatric v0.2 ERCC8 Zornitza Stark Added phenotypes Cockayne syndrome for gene: ERCC8
Additional findings_Paediatric v0.2 ERCC6 Zornitza Stark Added phenotypes Cockayne syndrome for gene: ERCC6
Additional findings_Paediatric v0.2 ERCC5 Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: ERCC5
Additional findings_Paediatric v0.2 ERCC2 Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: ERCC2
Additional findings_Paediatric v0.2 EPM2A Zornitza Stark Added phenotypes Epilepsy, progressive myoclonic 2A (Lafora) for gene: EPM2A
Additional findings_Paediatric v0.2 ENPP1 Zornitza Stark Added phenotypes Arterial calcification, generalized, of infancy, 1 for gene: ENPP1
Additional findings_Paediatric v0.2 ENG Zornitza Stark Added phenotypes Telangiectasia, hereditary hemorrhagic, type 1 for gene: ENG
Additional findings_Paediatric v0.2 EMD Zornitza Stark Added phenotypes Muscular dystrophy, Emery-Dreifuss for gene: EMD
Additional findings_Paediatric v0.2 ELN Zornitza Stark Added phenotypes Supravalvar aortic stenosis for gene: ELN
Additional findings_Paediatric v0.2 ELANE Zornitza Stark Added phenotypes Neutropenia, congenital for gene: ELANE
Additional findings_Paediatric v0.2 EIF2AK3 Zornitza Stark Added phenotypes Wolcott-Rallison syndrome for gene: EIF2AK3
Additional findings_Paediatric v0.2 EGR2 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: EGR2
Additional findings_Paediatric v0.2 EFTUD2 Zornitza Stark Added phenotypes Mandibulofacial dysostosis with microcephaly for gene: EFTUD2
Additional findings_Paediatric v0.2 EFHC1 Zornitza Stark Added phenotypes Myoclonic epilepsy for gene: EFHC1
Additional findings_Paediatric v0.2 EDARADD Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDARADD
Additional findings_Paediatric v0.2 EDAR Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDAR
Additional findings_Paediatric v0.2 EDA Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDA
Additional findings_Paediatric v0.2 DYSF Zornitza Stark Added phenotypes Miyoshi muscular dystrophy 1 for gene: DYSF
Additional findings_Paediatric v0.2 DYSF Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type 2B for gene: DYSF
Additional findings_Paediatric v0.2 DUOX2 Zornitza Stark Added phenotypes Thyroid dyshormonogenesis for gene: DUOX2
Additional findings_Paediatric v0.2 DSP Zornitza Stark Added phenotypes Epidermolysis bullosa, lethal acantholytic for gene: DSP
Additional findings_Paediatric v0.2 DPAGT1 Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ij for gene: DPAGT1
Additional findings_Paediatric v0.2 DOK7 Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: DOK7
Additional findings_Paediatric v0.2 DOCK8 Zornitza Stark Added phenotypes Hyper-IgE syndrome for gene: DOCK8
Additional findings_Paediatric v0.2 DNMT3B Zornitza Stark Added phenotypes Immunodeficiency-centromeric instability-facial anomalies syndrome 1 for gene: DNMT3B
Additional findings_Paediatric v0.2 DNM2 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease, axonal, type 2M for gene: DNM2
Additional findings_Paediatric v0.2 DNM2 Zornitza Stark Added phenotypes Myopathy, centronuclear for gene: DNM2
Additional findings_Paediatric v0.2 DNAJB6 Zornitza Stark Added phenotypes Muscular dystrophy, limb girdle for gene: DNAJB6
Additional findings_Paediatric v0.2 DNAI1 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAI1
Additional findings_Paediatric v0.2 DNAH5 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAH5
Additional findings_Paediatric v0.2 DNAH11 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAH11
Additional findings_Paediatric v0.2 DNAAF1 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAAF1
Additional findings_Paediatric v0.2 DMPK Zornitza Stark Added phenotypes Myotonic dystrophy 1 for gene: DMPK
Additional findings_Paediatric v0.2 DMP1 Zornitza Stark Added phenotypes Hypophosphatemic rickets, AR for gene: DMP1
Additional findings_Paediatric v0.2 DMD Zornitza Stark Added phenotypes Becker muscular dystrophy for gene: DMD
Additional findings_Paediatric v0.2 DMD Zornitza Stark Added phenotypes Duchenne muscular dystrophy for gene: DMD
Additional findings_Paediatric v0.2 DLL3 Zornitza Stark Added phenotypes Spondylocostal dysostosis, autosomal recessive, 1 for gene: DLL3
Additional findings_Paediatric v0.2 DLD Zornitza Stark Added phenotypes Maple syrup urine disease, type III for gene: DLD
Additional findings_Paediatric v0.2 DHCR7 Zornitza Stark Added phenotypes Smith-Lemli-Opitz syndrome for gene: DHCR7
Additional findings_Paediatric v0.2 DGUOK Zornitza Stark Added phenotypes Mitochondrial DNA depletion syndrome for gene: DGUOK
Additional findings_Paediatric v0.2 DFNB59 Zornitza Stark Added phenotypes Hearing loss for gene: DFNB59
Additional findings_Paediatric v0.2 DFNA5 Zornitza Stark Added phenotypes Hearing loss for gene: DFNA5
Additional findings_Paediatric v0.2 DES Zornitza Stark Added phenotypes Myopathy, myofibrillar for gene: DES
Additional findings_Paediatric v0.2 DDC Zornitza Stark Added phenotypes Aromatic L-amino acid decarboxylase deficiency for gene: DDC
Additional findings_Paediatric v0.2 DDB2 Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: DDB2
Additional findings_Paediatric v0.2 DCX Zornitza Stark Added phenotypes Lissencephaly, X-linked for gene: DCX
Additional findings_Paediatric v0.2 DCLRE1C Zornitza Stark Added phenotypes Severe combined immunodeficiency, Athabascan type for gene: DCLRE1C
Additional findings_Paediatric v0.2 DBT Zornitza Stark Added phenotypes Maple syrup urine disease for gene: DBT
Additional findings_Paediatric v0.2 D2HGDH Zornitza Stark Added phenotypes D-2-hydroxyglutaric aciduria for gene: D2HGDH
Additional findings_Paediatric v0.2 CYP4F22 Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: CYP4F22
Additional findings_Paediatric v0.2 CYP27B1 Zornitza Stark Added phenotypes Vitamin D-dependent rickets, type I for gene: CYP27B1
Additional findings_Paediatric v0.2 CYP27A1 Zornitza Stark Added phenotypes Cerebrotendinous xanthomatosis for gene: CYP27A1
Additional findings_Paediatric v0.2 CYP21A2 Zornitza Stark Added phenotypes Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency for gene: CYP21A2
Additional findings_Paediatric v0.2 CYP11B1 Zornitza Stark Added phenotypes Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency for gene: CYP11B1
Additional findings_Paediatric v0.2 CYP11A1 Zornitza Stark Added phenotypes Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete for gene: CYP11A1
Additional findings_Paediatric v0.2 CYBB Zornitza Stark Added phenotypes Chronic granulomatous disease for gene: CYBB
Additional findings_Paediatric v0.2 CYBA Zornitza Stark Added phenotypes Chronic granulomatous disease for gene: CYBA
Additional findings_Paediatric v0.2 CUL7 Zornitza Stark Added phenotypes 3-M syndrome for gene: CUL7
Additional findings_Paediatric v0.2 CUBN Zornitza Stark Added phenotypes Megaloblastic anemia-1, Finnish type for gene: CUBN
Additional findings_Paediatric v0.2 CTSK Zornitza Stark Added phenotypes Pycnodysostosis for gene: CTSK
Additional findings_Paediatric v0.2 CTSD Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 10 for gene: CTSD
Additional findings_Paediatric v0.2 CTNS Zornitza Stark Added phenotypes Cystinosis for gene: CTNS
Additional findings_Paediatric v0.2 CTC1 Zornitza Stark Added phenotypes Coats plus syndrome for gene: CTC1
Additional findings_Paediatric v0.2 CSTB Zornitza Stark Added phenotypes Epilepsy, progressive myoclonic 1A for gene: CSTB
Additional findings_Paediatric v0.2 CSF2RA Zornitza Stark Added phenotypes Pulmonary alveolar proteinosis for gene: CSF2RA