PanelApp

Activity

Date Panel Item Activity
3000 actions
Prepair 500+ v1.165 CD40 Zornitza Stark Marked gene: CD40 as ready
Prepair 500+ v1.165 CD40 Zornitza Stark Gene: cd40 has been classified as Green List (High Evidence).
Prepair 500+ v1.165 CD40 Zornitza Stark Phenotypes for gene: CD40 were changed from Immunodeficiency with hyper-IgM, type 3, 606843 (3) to Immunodeficiency with hyper-IgM, type 3, MIM# 606843
Prepair 500+ v1.164 CD3D Zornitza Stark Marked gene: CD3D as ready
Prepair 500+ v1.164 CD3D Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence).
Prepair 500+ v1.164 CD3D Zornitza Stark Phenotypes for gene: CD3D were changed from Immunodeficiency 19, 615617 (3) to Immunodeficiency 19, severe combined MIM# 615617
Prepair 500+ v1.163 CCDC88C Zornitza Stark Marked gene: CCDC88C as ready
Prepair 500+ v1.163 CCDC88C Zornitza Stark Gene: ccdc88c has been classified as Green List (High Evidence).
Prepair 500+ v1.163 CCDC88C Zornitza Stark Phenotypes for gene: CCDC88C were changed from Hydrocephalus, nonsyndromic, autosomal recessive, 236600 (3) to Hydrocephalus, congenital, 1 MIM#236600
Prepair 500+ v1.162 CCDC88C Zornitza Stark Publications for gene: CCDC88C were set to
Prepair 500+ v1.161 CCDC39 Zornitza Stark Marked gene: CCDC39 as ready
Prepair 500+ v1.161 CCDC39 Zornitza Stark Gene: ccdc39 has been classified as Green List (High Evidence).
Prepair 500+ v1.161 CCDC39 Zornitza Stark Phenotypes for gene: CCDC39 were changed from Ciliary dyskinesia, primary, 14, 613807 (3) to Ciliary dyskinesia, primary, 14 MIM#613807
Prepair 500+ v1.160 CCDC39 Zornitza Stark Publications for gene: CCDC39 were set to
Prepair 500+ v1.159 CCDC103 Zornitza Stark Marked gene: CCDC103 as ready
Prepair 500+ v1.159 CCDC103 Zornitza Stark Gene: ccdc103 has been classified as Green List (High Evidence).
Prepair 500+ v1.159 CCDC103 Zornitza Stark Phenotypes for gene: CCDC103 were changed from Ciliary dyskinesia, primary, 17, 614679 (3) to Primary ciliary dyskinesia-17, MIM # 614679
Prepair 500+ v1.158 CCDC103 Zornitza Stark Publications for gene: CCDC103 were set to
Prepair 500+ v1.157 CCBE1 Zornitza Stark Marked gene: CCBE1 as ready
Prepair 500+ v1.157 CCBE1 Zornitza Stark Gene: ccbe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.157 CCBE1 Zornitza Stark Phenotypes for gene: CCBE1 were changed from Hennekam lymphangiectasia-lymphedema syndrome 1, 235510 (3) to Hennekam lymphangiectasia-lymphoedema syndrome 1 MIM#235510
Prepair 500+ v1.156 CCBE1 Zornitza Stark Publications for gene: CCBE1 were set to
Prepair 500+ v1.155 CC2D2A Zornitza Stark Marked gene: CC2D2A as ready
Prepair 500+ v1.155 CC2D2A Zornitza Stark Gene: cc2d2a has been classified as Green List (High Evidence).
Prepair 500+ v1.155 CC2D2A Zornitza Stark Phenotypes for gene: CC2D2A were changed from Joubert syndrome 9, 612285 (3) to COACH syndrome, MIM#216360; Joubert syndrome 9, MIM#612285; Meckel syndrome 6, MIM#612284; Retinitis pigmentosa 93, MIM# 619845
Prepair 500+ v1.154 CC2D2A Zornitza Stark Publications for gene: CC2D2A were set to
Prepair 500+ v1.153 CC2D1A Zornitza Stark Marked gene: CC2D1A as ready
Prepair 500+ v1.153 CC2D1A Zornitza Stark Gene: cc2d1a has been classified as Green List (High Evidence).
Prepair 500+ v1.153 CC2D1A Zornitza Stark Phenotypes for gene: CC2D1A were changed from Mental retardation, autosomal recessive 3, 608443 (3) to Intellectual developmental disorder, autosomal recessive 3, MIM# 608443
Prepair 500+ v1.152 CC2D1A Zornitza Stark Publications for gene: CC2D1A were set to
Prepair 500+ v1.151 CASQ2 Zornitza Stark Marked gene: CASQ2 as ready
Prepair 500+ v1.151 CASQ2 Zornitza Stark Gene: casq2 has been classified as Green List (High Evidence).
Prepair 500+ v1.151 CASQ2 Zornitza Stark Phenotypes for gene: CASQ2 were changed from Ventricular tachycardia, catecholaminergic polymorphic, 2, 611938 (3) to Ventricular tachycardia, catecholaminergic polymorphic, 2 (MIM#611938)
Prepair 500+ v1.150 CASK Zornitza Stark Marked gene: CASK as ready
Prepair 500+ v1.150 CASK Zornitza Stark Gene: cask has been classified as Green List (High Evidence).
Prepair 500+ v1.150 CASK Zornitza Stark Phenotypes for gene: CASK were changed from Mental retardation, with or without nystagmus to X-linked syndromic intellectual disability MONDO:0020119
Prepair 500+ v1.149 CASK Zornitza Stark Publications for gene: CASK were set to
Prepair 500+ v1.148 GNE Zornitza Stark Marked gene: GNE as ready
Prepair 500+ v1.148 GNE Zornitza Stark Gene: gne has been classified as Red List (Low Evidence).
Prepair 500+ v1.148 GNE Zornitza Stark Phenotypes for gene: GNE were changed from Inclusion body myopathy, autosomal recessive, 600737 (3) to Nonaka myopathy MIM#605820; Thrombocytopenia 12 with or without myopathy MIM#620757
Prepair 500+ v1.147 GNE Zornitza Stark Publications for gene: GNE were set to
Prepair 500+ v1.146 GNE Zornitza Stark Classified gene: GNE as Red List (low evidence)
Prepair 500+ v1.146 GNE Zornitza Stark Gene: gne has been classified as Red List (Low Evidence).
Prepair 500+ v1.145 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Prepair 500+ v1.145 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 500+ v1.145 CLN3 Zornitza Stark Phenotypes for gene: CLN3 were changed from Ceroid lipofuscinosis, neuronal, 3, 204200 (3) to Ceroid lipofuscinosis, neuronal, 3, MIM# 204200; MONDO:0008767
Prepair 500+ v1.144 CLN3 Zornitza Stark Publications for gene: CLN3 were set to
Prepair 500+ v1.143 CLN3 Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence)
Prepair 500+ v1.143 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v2.7 GPR143 Zornitza Stark Tag for review tag was added to gene: GPR143.
Mendeliome v1.2511 NUDT2 Sangavi Sivagnanasundram reviewed gene: NUDT2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder with or without peripheral neuropathy, MONDO:0859240; Mode of inheritance: None
Mendeliome v1.2511 NLRP2 Sangavi Sivagnanasundram reviewed gene: NLRP2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Oocyte/zygote/embryo maturation arrest 18, MONDO:0957230; Mode of inheritance: None
Mendeliome v1.2511 NKAP Sangavi Sivagnanasundram reviewed gene: NKAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2511 NDUFAF8 Sangavi Sivagnanasundram reviewed gene: NDUFAF8: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Leigh Syndrome MONDO:0009723; Mode of inheritance: None
Mendeliome v1.2511 NDUFAF7 Sangavi Sivagnanasundram reviewed gene: NDUFAF7: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Pathological Myopia MONDO:0001383; Mode of inheritance: None
Ataxia - adult onset v1.46 THAP11_SCA51_CAG Bryony Thompson Marked STR: THAP11_SCA51_CAG as ready
Ataxia - adult onset v1.46 THAP11_SCA51_CAG Bryony Thompson Str: thap11_sca51_cag has been classified as Amber List (Moderate Evidence).
Ataxia - adult onset v1.46 THAP11_SCA51_CAG Bryony Thompson Classified STR: THAP11_SCA51_CAG as Amber List (moderate evidence)
Ataxia - adult onset v1.46 THAP11_SCA51_CAG Bryony Thompson Str: thap11_sca51_cag has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.256 THAP11_SCA51_CAG Bryony Thompson THAP11_SCA_CAG was changed to THAP11_SCA51_CAG
Ataxia - adult onset v1.45 THAP11_SCA51_CAG Bryony Thompson STR: THAP11_SCA51_CAG was added
STR: THAP11_SCA51_CAG was added to Ataxia - adult onset. Sources: Literature
Mode of inheritance for STR: THAP11_SCA51_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319
Phenotypes for STR: THAP11_SCA51_CAG were set to Spinocerebellar ataxia 51, MIM# 620947
Review for STR: THAP11_SCA51_CAG was set to AMBER
Added comment: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual. A 46/29 CAG THAP11 genotype has also been identified in an individual with ataxia of European ancestry, that also had a CACNA1A pathogenic expansion which causes SCA6. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association.
Sources: Literature
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Marked STR: RAPGEF2_FAME7_TTTCA as ready
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Classified STR: RAPGEF2_FAME7_TTTCA as Amber List (moderate evidence)
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.144 RAPGEF2_FAME7_TTTCA Bryony Thompson STR: RAPGEF2_FAME7_TTTCA was added
STR: RAPGEF2_FAME7_TTTCA was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: RAPGEF2_FAME7_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: RAPGEF2_FAME7_TTTCA were set to 29507423; 30351492; 33791773
Phenotypes for STR: RAPGEF2_FAME7_TTTCA were set to Epilepsy, familial adult myoclonic, 7 MIM#618075
Review for STR: RAPGEF2_FAME7_TTTCA was set to AMBER
Added comment: TTTCA expansion (without TTTTA expansion) identified in 3 affected individuals in a Chinese FAME family and another unrelated Japanese proband. Now 3 families reported.
The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.117 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Mendeliome v1.2511 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Hereditary Neuropathy - complex v1.27 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Ataxia - adult onset v1.44 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Mendeliome v1.2510 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.63 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Congenital Disorders of Glycosylation. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.115 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Skeletal dysplasia v0.308 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Skeletal dysplasia. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Corneal Dystrophy v1.12 TCF4_FECD3_CTG Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Marked STR: TBP_SCA17_CAG as ready
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Classified STR: TBP_SCA17_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.34 TBP_SCA17_CAG Bryony Thompson STR: TBP_SCA17_CAG was added
STR: TBP_SCA17_CAG was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: TBP_SCA17_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TBP_SCA17_CAG were set to 10484774; 20301611; 29325606; 27172828; 14638975; 11313753; 11914409
Phenotypes for STR: TBP_SCA17_CAG were set to Spinocerebellar ataxia 17 MIM#607136
Review for STR: TBP_SCA17_CAG was set to GREEN
STR: TBP_SCA17_CAG was marked as clinically relevant
STR: TBP_SCA17_CAG was marked as current diagnostic
Added comment: NM_003194.4:c.172_174[X]
Mechanism of disease expected to be gain of function
Normal: ≤ 40 CAG/CAA repeats
Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms.
Full-penetrance: ≥49 CAG/CAA repeats
Sources: Expert list
Ataxia - adult onset v1.43 TBP_SCA17_CAG Bryony Thompson Marked STR: TBP_SCA17_CAG as ready
Ataxia - adult onset v1.43 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Ataxia - adult onset v1.43 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Regression v0.577 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Mendeliome v1.2509 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Early-onset Dementia v1.39 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Dystonia - isolated/combined v1.40 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Early-onset Parkinson disease v2.33 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Genetic Epilepsy v1.143 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Mendeliome v1.2508 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Genetic Epilepsy v1.142 SAMD12_FAME1_TTTCA Bryony Thompson Classified STR: SAMD12_FAME1_TTTCA as Green List (high evidence)
Genetic Epilepsy v1.142 SAMD12_FAME1_TTTCA Bryony Thompson Str: samd12_fame1_tttca has been classified as Green List (High Evidence).
Mendeliome v1.2507 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Genetic Epilepsy v1.141 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Mendeliome v1.2506 RILPL1_OPDM4_CGG Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.58 RILPL1_OPDM4_CGG Bryony Thompson OPDM4_RILPL1_CGG was changed to RILPL1_OPDM4_CGG
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Marked STR: ATXN8OS_SCA8_CTG as ready
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Classified STR: ATXN8OS_SCA8_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.31 ATXN8OS_SCA8_CTG Bryony Thompson STR: ATXN8OS_SCA8_CTG was added
STR: ATXN8OS_SCA8_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN8OS_SCA8_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN8OS_SCA8_CTG were set to 24285970; 20301445; 10192387
Phenotypes for STR: ATXN8OS_SCA8_CTG were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: ATXN8OS_SCA8_CTG was set to GREEN
STR: ATXN8OS_SCA8_CTG was marked as clinically relevant
STR: ATXN8OS_SCA8_CTG was marked as current diagnostic
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Literature
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Marked STR: PPP2R2B_SCA12_CAG as ready
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Classified STR: PPP2R2B_SCA12_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.29 PPP2R2B_SCA12_CAG Bryony Thompson STR: PPP2R2B_SCA12_CAG was added
STR: PPP2R2B_SCA12_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: PPP2R2B_SCA12_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PPP2R2B_SCA12_CAG were set to 31286011; 27864267; 33811808; 10581021
Phenotypes for STR: PPP2R2B_SCA12_CAG were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: PPP2R2B_SCA12_CAG was set to GREEN
STR: PPP2R2B_SCA12_CAG was marked as clinically relevant
STR: PPP2R2B_SCA12_CAG was marked as current diagnostic
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead affects the expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Literature
Ataxia - adult onset v1.42 PPP2R2B_SCA12_CAG Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG
Mendeliome v1.2505 PPP2R2B_SCA12_CAG Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG
Mendeliome v1.2504 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV_PLIN4 was changed to PLIN4_MRUPAV_33-mer
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.57 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Classified STR: PABPN1_OPMD_GCN as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.55 PABPN1_OPMD_GCN Bryony Thompson STR: PABPN1_OPMD_GCN was added
STR: PABPN1_OPMD_GCN was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list
Mode of inheritance for STR: PABPN1_OPMD_GCN was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for STR: PABPN1_OPMD_GCN were set to 9462747; 20301305
Phenotypes for STR: PABPN1_OPMD_GCN were set to Oculopharyngeal muscular dystrophy MIM#164300
Review for STR: PABPN1_OPMD_GCN was set to GREEN
STR: PABPN1_OPMD_GCN was marked as clinically relevant
STR: PABPN1_OPMD_GCN was marked as current diagnostic
Added comment: NM_004643.3:c.4_6[X]
Expected gain of function mechanism of disease
Normal allele: (GCN)10 / Ala10
Autosomal recessive: (GCN)11/Ala11
Autosomal dominant: (GCN)12-17
Sources: Expert list
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Marked STR: NUTM2B-AS1_OPDM_CCG as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Classified STR: NUTM2B-AS1_OPDM_CCG as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.53 NUTM2B-AS1_OPDM_CCG Bryony Thompson STR: NUTM2B-AS1_OPDM_CCG was added
STR: NUTM2B-AS1_OPDM_CCG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Literature
Mode of inheritance for STR: NUTM2B-AS1_OPDM_CCG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NUTM2B-AS1_OPDM_CCG were set to 31332380; 37923380; 39308795; 38159879
Phenotypes for STR: NUTM2B-AS1_OPDM_CCG were set to Oculopharyngodistal myopathy MONDO:0025193
Review for STR: NUTM2B-AS1_OPDM_CCG was set to GREEN
STR: NUTM2B-AS1_OPDM_CCG was marked as clinically relevant
Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.
NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Marked STR: NOTCH2NLC_NIID_GGC as ready
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Str: notch2nlc_niid_ggc has been classified as Green List (High Evidence).
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Early-onset Parkinson disease v2.28 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Mendeliome v1.2503 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Regression v0.576 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Leukodystrophy - adult onset v0.147 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Hereditary Neuropathy - complex v1.26 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.52 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Ataxia - adult onset v1.41 NOP56_SCA36_GGCCTG Bryony Thompson Marked STR: NOP56_SCA36_GGCCTG as ready
Ataxia - adult onset v1.41 NOP56_SCA36_GGCCTG Bryony Thompson Str: nop56_sca36_ggcctg has been classified as Green List (High Evidence).
Ataxia - adult onset v1.41 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Regression v0.575 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Mendeliome v1.2502 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Marked STR: MARCH6_FAME3_TTTCA as ready
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Classified STR: MARCH6_FAME3_TTTCA as Green List (high evidence)
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.139 MARCH6_FAME3_TTTCA Bryony Thompson STR: MARCH6_FAME3_TTTCA was added
STR: MARCH6_FAME3_TTTCA was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: MARCH6_FAME3_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MARCH6_FAME3_TTTCA were set to 31664039
Phenotypes for STR: MARCH6_FAME3_TTTCA were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: MARCH6_FAME3_TTTCA was set to GREEN
STR: MARCH6_FAME3_TTTCA was marked as clinically relevant
STR: MARCH6_FAME3_TTTCA was marked as current diagnostic
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.51 LRP12_OPDM1_CGG Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG
Motor Neurone Disease v1.33 LRP12_ALS_CGG Bryony Thompson LRP12-ALS_CGG was changed to LRP12_ALS_CGG
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Marked STR: JPH3_HDL2_CTG as ready
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Classified STR: JPH3_HDL2_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson changed review comment from: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature; to: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included
Full penetrance: ≥40 repeats
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson STR: JPH3_HDL2_CTG was added
STR: JPH3_HDL2_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: JPH3_HDL2_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: JPH3_HDL2_CTG were set to 11558794; 20301701
Phenotypes for STR: JPH3_HDL2_CTG were set to Huntington disease-like 2 MIM#606438
Review for STR: JPH3_HDL2_CTG was set to GREEN
STR: JPH3_HDL2_CTG was marked as clinically relevant
STR: JPH3_HDL2_CTG was marked as current diagnostic
Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature
Early-onset Dementia v1.37 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Mendeliome v1.2501 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Early-onset Parkinson disease v2.25 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Incidentalome v0.316 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.137 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.113 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Aminoacidopathy v1.134 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Aminoacidopathy. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Miscellaneous Metabolic Disorders v1.49 GLS_GDPAG_GCA Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA
Mendeliome v1.2500 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.50 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia - adult onset v1.13 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Hereditary Spastic Paraplegia - adult onset v1.13 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence)
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence)
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia - adult onset v1.13 FXN_FRDA_GAA Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence)
Hereditary Spastic Paraplegia - adult onset v1.13 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.24 FXN_FRDA_GAA Bryony Thompson STR: FXN_FRDA_GAA was added
STR: FXN_FRDA_GAA was added to Hereditary Neuropathy - complex. Sources: Expert list
Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916
Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300
Review for STR: FXN_FRDA_GAA was set to GREEN
STR: FXN_FRDA_GAA was marked as clinically relevant
STR: FXN_FRDA_GAA was marked as current diagnostic
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Mitochondrial disease v0.972 FXN_FRDA_GAA Bryony Thompson STR: FXN_FRDA_GAA was added
STR: FXN_FRDA_GAA was added to Mitochondrial disease. Sources: Expert list
Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916
Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300
Review for STR: FXN_FRDA_GAA was set to GREEN
STR: FXN_FRDA_GAA was marked as clinically relevant
STR: FXN_FRDA_GAA was marked as current diagnostic
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Hereditary Spastic Paraplegia - adult onset v1.12 FXN_FRDA_GAA Bryony Thompson STR: FXN_FRDA_GAA was added
STR: FXN_FRDA_GAA was added to Hereditary Spastic Paraplegia - adult onset. Sources: Expert list
Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916
Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300
Review for STR: FXN_FRDA_GAA was set to GREEN
STR: FXN_FRDA_GAA was marked as clinically relevant
STR: FXN_FRDA_GAA was marked as current diagnostic
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Ataxia - paediatric v1.34 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Ataxia - paediatric v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Ataxia - paediatric v1.34 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Ataxia - paediatric v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Ataxia - adult onset v1.40 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Ataxia - adult onset v1.40 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Ataxia - adult onset v1.40 FXN_FRDA_GAA Bryony Thompson FRDA was changed to FXN_FRDA_GAA
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence)
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence)
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Blepharophimosis v1.2 FOXL2_BPES_GCN Bryony Thompson STR: FOXL2_BPES_GCN was added
STR: FOXL2_BPES_GCN was added to Blepharophimosis. Sources: Literature
Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808
Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996
Review for STR: FOXL2_BPES_GCN was set to GREEN
STR: FOXL2_BPES_GCN was marked as clinically relevant
STR: FOXL2_BPES_GCN was marked as current diagnostic
Added comment: NM_023067.2:c.661_702[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 14
Pathogenic repeat number: 19-24
Sources: Literature
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.346 FOXL2_BPES_GCN Bryony Thompson STR: FOXL2_BPES_GCN was added
STR: FOXL2_BPES_GCN was added to Primary Ovarian Insufficiency_Premature Ovarian Failure. Sources: Literature
Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808
Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996
Review for STR: FOXL2_BPES_GCN was set to GREEN
STR: FOXL2_BPES_GCN was marked as clinically relevant
STR: FOXL2_BPES_GCN was marked as current diagnostic
Added comment: NM_023067.2:c.661_702[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 14
Pathogenic repeat number: 19-24
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Marked STR: FMR1_FXS_CGG as ready
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Classified STR: FMR1_FXS_CGG as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.24 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Ataxia - adult onset v1.39 FMR1_FXTAS_CGG Bryony Thompson Marked STR: FMR1_FXTAS_CGG as ready
Ataxia - adult onset v1.39 FMR1_FXTAS_CGG Bryony Thompson Str: fmr1_fxtas_cgg has been classified as Green List (High Evidence).
Ataxia - adult onset v1.39 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Intellectual disability syndromic and non-syndromic v1.111 FMR1_FXS_CGG Bryony Thompson STR: FMR1_FXS_CGG was added
STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184
Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624
Review for STR: FMR1_FXS_CGG was set to GREEN
STR: FMR1_FXS_CGG was marked as clinically relevant
STR: FMR1_FXS_CGG was marked as current diagnostic
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson Marked STR: FMR1_FXPOI_CGG as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson Str: fmr1_fxpoi_cgg has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG
Ataxia - adult onset v1.38 FGF14_SCA27B_GAA Bryony Thompson SCA27B was changed to FGF14_SCA27B_GAA
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.48 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Pierre Robin Sequence. Sources: Literature
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Clefting disorders v0.263 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Mandibulofacial Acrofacial dysostosis v1.13 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Prepair 500+ v1.142 CAPN3 Zornitza Stark Marked gene: CAPN3 as ready
Prepair 500+ v1.142 CAPN3 Zornitza Stark Gene: capn3 has been classified as Green List (High Evidence).
Prepair 500+ v1.142 CAPN3 Zornitza Stark Phenotypes for gene: CAPN3 were changed from Muscular dystrophy, limb-girdle, type 2A, 253600 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM#253600
Prepair 500+ v1.141 CAPN3 Zornitza Stark Publications for gene: CAPN3 were set to
Prepair 500+ v1.140 CANT1 Zornitza Stark Marked gene: CANT1 as ready
Prepair 500+ v1.140 CANT1 Zornitza Stark Gene: cant1 has been classified as Green List (High Evidence).
Prepair 500+ v1.140 CANT1 Zornitza Stark Phenotypes for gene: CANT1 were changed from Desbuquois dysplasia, 251450 (3) to Desbuquois dysplasia 1, MIM# 251450; Epiphyseal dysplasia, multiple, 7, MIM# 617719
Prepair 500+ v1.139 CANT1 Zornitza Stark Publications for gene: CANT1 were set to
Prepair 500+ v1.138 C5orf42 Zornitza Stark Marked gene: C5orf42 as ready
Prepair 500+ v1.138 C5orf42 Zornitza Stark Gene: c5orf42 has been classified as Green List (High Evidence).
Prepair 500+ v1.138 C5orf42 Zornitza Stark Phenotypes for gene: C5orf42 were changed from Joubert syndrome 17, 614615 (3) to Joubert syndrome 17, MIM# 614615; Orofaciodigital syndrome VI, MIM# 277170
Prepair 500+ v1.137 C5orf42 Zornitza Stark Publications for gene: C5orf42 were set to
Mendeliome v1.2499 KEL Achchuthan Shanmugasundram reviewed gene: KEL: Rating: AMBER; Mode of pathogenicity: None; Publications: 30578106, 37978175; Phenotypes: vein of Galen aneurysm, MONDO:0015196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v1.2499 NOS3 Achchuthan Shanmugasundram reviewed gene: NOS3: Rating: AMBER; Mode of pathogenicity: None; Publications: 36941667, 37383439; Phenotypes: Moyamoya disease, MONDO:0016820; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 500+ v1.136 BTK Zornitza Stark Marked gene: BTK as ready
Prepair 500+ v1.136 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Prepair 500+ v1.136 BTK Zornitza Stark Phenotypes for gene: BTK were changed from Agammaglobulinemia and isolated hormone deficiency, 307200 (3) to Agammaglobulinemia, X-linked 1 MIM#300755; Bruton-type agammaglobulinemia MONDO:0010421; Isolated growth hormone deficiency, type III, with agammaglobulinemia MIM#307200 MONDO:0010615
Prepair 500+ v1.135 BTK Zornitza Stark Publications for gene: BTK were set to
Prepair 500+ v1.134 BSND Zornitza Stark Marked gene: BSND as ready
Prepair 500+ v1.134 BSND Zornitza Stark Gene: bsnd has been classified as Green List (High Evidence).
Prepair 500+ v1.134 BSND Zornitza Stark Phenotypes for gene: BSND were changed from Bartter syndrome, type 4a, 602522 (3) to Bartter syndrome, type 4a MIM#602522
Prepair 500+ v1.133 BSND Zornitza Stark Publications for gene: BSND were set to
Prepair 500+ v1.132 BRWD3 Zornitza Stark Marked gene: BRWD3 as ready
Prepair 500+ v1.132 BRWD3 Zornitza Stark Gene: brwd3 has been classified as Green List (High Evidence).
Prepair 500+ v1.132 BRWD3 Zornitza Stark Phenotypes for gene: BRWD3 were changed from Mental retardation, X-linked 93, 300659 (3) to Intellectual developmental disorder, X-linked 93 MIM#300659
Prepair 500+ v1.131 BRWD3 Zornitza Stark Publications for gene: BRWD3 were set to
Prepair 500+ v1.130 BRAT1 Zornitza Stark Marked gene: BRAT1 as ready
Prepair 500+ v1.130 BRAT1 Zornitza Stark Gene: brat1 has been classified as Green List (High Evidence).
Prepair 500+ v1.130 BRAT1 Zornitza Stark Phenotypes for gene: BRAT1 were changed from Rigidity and multifocal seizure syndrome, lethal neonatal, 614498 (3) to Rigidity and multifocal seizure syndrome, lethal neonatal, MIM#614498; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056
Prepair 500+ v1.129 BRAT1 Zornitza Stark Publications for gene: BRAT1 were set to
Prepair 500+ v1.128 BLM Zornitza Stark Marked gene: BLM as ready
Prepair 500+ v1.128 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Prepair 500+ v1.128 BLM Zornitza Stark Phenotypes for gene: BLM were changed from Bloom syndrome, 210900 (3) to Bloom Syndrome MIM# 210900
Prepair 500+ v1.127 BLM Zornitza Stark Publications for gene: BLM were set to
Prepair 500+ v1.126 BCS1L Zornitza Stark Marked gene: BCS1L as ready
Prepair 500+ v1.126 BCS1L Zornitza Stark Gene: bcs1l has been classified as Green List (High Evidence).
Prepair 500+ v1.126 BCS1L Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, 603358 (3) to GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type 1, MIM#124000
Prepair 500+ v1.125 BCS1L Zornitza Stark Publications for gene: BCS1L were set to
Prepair 500+ v1.124 BCKDHB Zornitza Stark Marked gene: BCKDHB as ready
Prepair 500+ v1.124 BCKDHB Zornitza Stark Gene: bckdhb has been classified as Green List (High Evidence).
Prepair 500+ v1.124 BCKDHB Zornitza Stark Phenotypes for gene: BCKDHB were changed from Maple syrup urine disease, type Ib, 248600 (3) to Maple syrup urine disease, type Ib 620698
Prepair 500+ v1.123 BCKDHB Zornitza Stark Publications for gene: BCKDHB were set to
Prepair 500+ v1.122 BCKDHA Zornitza Stark Marked gene: BCKDHA as ready
Prepair 500+ v1.122 BCKDHA Zornitza Stark Gene: bckdha has been classified as Green List (High Evidence).
Prepair 500+ v1.122 BCKDHA Zornitza Stark Phenotypes for gene: BCKDHA were changed from Maple syrup urine disease, type Ia, 248600 (3) to Maple syrup urine disease, type Ia, MIM# 248600
Prepair 500+ v1.121 BCKDHA Zornitza Stark Publications for gene: BCKDHA were set to
Prepair 500+ v1.120 BBS9 Zornitza Stark Marked gene: BBS9 as ready
Prepair 500+ v1.120 BBS9 Zornitza Stark Gene: bbs9 has been classified as Green List (High Evidence).
Prepair 500+ v1.120 BBS9 Zornitza Stark Phenotypes for gene: BBS9 were changed from Bardet-Biedl syndrome 9, 615986 (3) to Bardet-Biedl syndrome 9 MIM#615986
Prepair 500+ v1.119 BBS9 Zornitza Stark Publications for gene: BBS9 were set to
Prepair 500+ v1.118 BBS7 Zornitza Stark Marked gene: BBS7 as ready
Prepair 500+ v1.118 BBS7 Zornitza Stark Gene: bbs7 has been classified as Green List (High Evidence).
Prepair 500+ v1.118 BBS7 Zornitza Stark Phenotypes for gene: BBS7 were changed from Bardet-Biedl syndrome 7, 615984 (3) to Bardet-Biedl syndrome 7, MIM# 615984; MONDO:0014435
Prepair 500+ v1.117 BBS7 Zornitza Stark Publications for gene: BBS7 were set to
Prepair 500+ v1.116 BBS5 Zornitza Stark Marked gene: BBS5 as ready
Prepair 500+ v1.116 BBS5 Zornitza Stark Gene: bbs5 has been classified as Green List (High Evidence).
Prepair 500+ v1.116 BBS5 Zornitza Stark Phenotypes for gene: BBS5 were changed from Bardet-Biedl syndrome 5, 615983 (3) to Bardet-Biedl syndrome 5, MIM#615983; MONDO:0014434
Prepair 500+ v1.115 BBS5 Zornitza Stark Publications for gene: BBS5 were set to
Prepair 500+ v1.114 BBS4 Zornitza Stark Marked gene: BBS4 as ready
Prepair 500+ v1.114 BBS4 Zornitza Stark Gene: bbs4 has been classified as Green List (High Evidence).
Prepair 500+ v1.114 BBS4 Zornitza Stark Phenotypes for gene: BBS4 were changed from Bardet-Biedl syndrome 4, 615982 (3) to Bardet-Biedl syndrome 4, MIM#615982
Prepair 500+ v1.113 BBS2 Zornitza Stark Marked gene: BBS2 as ready
Prepair 500+ v1.113 BBS2 Zornitza Stark Gene: bbs2 has been classified as Green List (High Evidence).
Prepair 500+ v1.113 BBS2 Zornitza Stark Phenotypes for gene: BBS2 were changed from Bardet-Biedl syndrome 2, 615981 (3) to Bardet-Biedl syndrome 2, MIM#615981
Prepair 500+ v1.112 BBS12 Zornitza Stark Marked gene: BBS12 as ready
Prepair 500+ v1.112 BBS12 Zornitza Stark Gene: bbs12 has been classified as Green List (High Evidence).
Prepair 500+ v1.112 BBS12 Zornitza Stark Phenotypes for gene: BBS12 were changed from Bardet-Biedl syndrome 12, 615989 (3) to Bardet-Biedl syndrome 12, MIM#615989
Prepair 500+ v1.111 BBS10 Zornitza Stark Marked gene: BBS10 as ready
Prepair 500+ v1.111 BBS10 Zornitza Stark Gene: bbs10 has been classified as Green List (High Evidence).
Prepair 500+ v1.111 BBS10 Zornitza Stark Phenotypes for gene: BBS10 were changed from Bardet-Biedl syndrome 10, 615987 (3) to Bardet-Biedl syndrome 10 (MIM#615987)
Prepair 500+ v1.110 BBS10 Zornitza Stark Publications for gene: BBS10 were set to
Prepair 500+ v1.109 BBS1 Zornitza Stark Marked gene: BBS1 as ready
Prepair 500+ v1.109 BBS1 Zornitza Stark Gene: bbs1 has been classified as Green List (High Evidence).
Prepair 500+ v1.109 BBS1 Zornitza Stark Phenotypes for gene: BBS1 were changed from Bardet-Biedl syndrome 1, 209900 (3) to Bardet-Biedl syndrome 1, MIM# 209900
Prepair 500+ v1.108 BBS1 Zornitza Stark Publications for gene: BBS1 were set to
Prepair 500+ v1.107 B3GLCT Zornitza Stark Marked gene: B3GLCT as ready
Prepair 500+ v1.107 B3GLCT Zornitza Stark Gene: b3glct has been classified as Green List (High Evidence).
Prepair 500+ v1.107 B3GLCT Zornitza Stark Phenotypes for gene: B3GLCT were changed from Peters-plus syndrome, 261540 (3) to Peters-plus syndrome (MIM#261540)
Prepair 500+ v1.106 B3GLCT Zornitza Stark Publications for gene: B3GLCT were set to
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.49 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Intellectual disability syndromic and non-syndromic v1.108 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Mendeliome v1.2499 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Mendeliome v1.2498 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson Marked STR: DAB1_SCA37_ATTTC as ready
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson Str: dab1_sca37_atttc has been classified as Green List (High Evidence).
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Ataxia - adult onset v1.37 DAB1_SCA37_ATTTC Bryony Thompson Marked STR: DAB1_SCA37_ATTTC as ready
Ataxia - adult onset v1.37 DAB1_SCA37_ATTTC Bryony Thompson Str: dab1_sca37_atttc has been classified as Green List (High Evidence).
Ataxia - adult onset v1.37 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence)
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence)
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.20 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added
STR: CSTB_EPM1_CCCCGCCCCGCG was added to Progressive Myoclonic Epilepsy. Sources: Expert list
Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745
Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Genetic Epilepsy v1.135 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added
STR: CSTB_EPM1_CCCCGCCCCGCG was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745
Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Ataxia - adult onset v1.36 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready
Ataxia - adult onset v1.36 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Ataxia - adult onset v1.36 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson EPM1 was changed to CSTB_EPM1_CCCCGCCCCGCG
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Marked STR: CNBP_DM2_CCTG as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Classified STR: CNBP_DM2_CCTG as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.47 CNBP_DM2_CCTG Bryony Thompson STR: CNBP_DM2_CCTG was added
STR: CNBP_DM2_CCTG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list
Mode of inheritance for STR: CNBP_DM2_CCTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CNBP_DM2_CCTG were set to 20301639; 11486088
Phenotypes for STR: CNBP_DM2_CCTG were set to Myotonic dystrophy 2 MIM#602668
Review for STR: CNBP_DM2_CCTG was set to GREEN
STR: CNBP_DM2_CCTG was marked as clinically relevant
STR: CNBP_DM2_CCTG was marked as current diagnostic
Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X]
Toxic gain of function RNA expected mechanism of disease
Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions
Unknown significance (normal vs. mutable): 27-29 CCTG repeats
Mutable normal (premutation) alleles. ~30-~54 CCTG repeats
Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats
Pathogenic: ~75-11,000 CCTG repeats
Sources: Expert list
Mendeliome v1.2497 CNBP_DM2_CCTG Bryony Thompson DM2 was changed to CNBP_DM2_CCTG
Ataxia - adult onset v1.35 CACNA1A_SCA6_CAG Bryony Thompson Marked STR: CACNA1A_SCA6_CAG as ready
Ataxia - adult onset v1.35 CACNA1A_SCA6_CAG Bryony Thompson Str: cacna1a_sca6_cag has been classified as Green List (High Evidence).
Ataxia - adult onset v1.35 CACNA1A_SCA6_CAG Bryony Thompson SCA6 was changed to CACNA1A_SCA6_CAG
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson Marked STR: C9orf72_FTDALS_GGGGCC as ready
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson Str: c9orf72_ftdals_ggggcc has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Dystonia - complex v0.280 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Incidentalome v0.315 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Parkinson disease v2.23 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Motor Neurone Disease v1.32 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Dementia v1.36 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Ataxia - adult onset v1.34 BEAN1_SCA31_TGGAA Bryony Thompson Marked STR: BEAN1_SCA31_TGGAA as ready
Ataxia - adult onset v1.34 BEAN1_SCA31_TGGAA Bryony Thompson Str: bean1_sca31_tggaa has been classified as Green List (High Evidence).
Ataxia - adult onset v1.34 BEAN1_SCA31_TGGAA Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA
Mendeliome v1.2496 BEAN1_SCA31_TGGAA Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA
Ataxia - adult onset v1.33 ATXN8OS_SCA8_CTG Bryony Thompson Marked STR: ATXN8OS_SCA8_CTG as ready
Ataxia - adult onset v1.33 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Ataxia - adult onset v1.33 ATXN8OS_SCA8_CTG Bryony Thompson SCA8 was changed to ATXN8OS_SCA8_CTG
Ataxia - adult onset v1.32 ATXN7_SCA7_CAG Bryony Thompson Marked STR: ATXN7_SCA7_CAG as ready
Ataxia - adult onset v1.32 ATXN7_SCA7_CAG Bryony Thompson Str: atxn7_sca7_cag has been classified as Green List (High Evidence).
Mendeliome v1.2495 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Ataxia - adult onset v1.32 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Syndromic Retinopathy v0.223 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Ataxia - adult onset v1.31 ATXN3_SCA3_CAG Bryony Thompson Marked STR: ATXN3_SCA3_CAG as ready
Ataxia - adult onset v1.31 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Marked STR: ATXN3_SCA3_CAG as ready
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Classified STR: ATXN3_SCA3_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.21 ATXN3_SCA3_CAG Bryony Thompson STR: ATXN3_SCA3_CAG was added
STR: ATXN3_SCA3_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN3_SCA3_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN3_SCA3_CAG were set to 11176969; 7574470; 7874163; 20301375; 29325606
Phenotypes for STR: ATXN3_SCA3_CAG were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3
Review for STR: ATXN3_SCA3_CAG was set to GREEN
STR: ATXN3_SCA3_CAG was marked as clinically relevant
STR: ATXN3_SCA3_CAG was marked as current diagnostic
Added comment: NM_004993​.5:c.886_888CAG[X]
Toxic aggregation and mislocalization in neurons is mechanism of disease
Normal: ≤44 repeats, mostly <31 repeats
Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3
Pathogenic (full penetrance): ≥60 repeats
Sources: Literature
Ataxia - adult onset v1.31 ATXN3_SCA3_CAG Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG
Mendeliome v1.2494 ATXN3_SCA3_CAG Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Marked STR: ATXN2_SCA2_CAG as ready
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Classified STR: ATXN2_SCA2_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.19 ATXN2_SCA2_CAG Bryony Thompson STR: ATXN2_SCA2_CAG was added
STR: ATXN2_SCA2_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN2_SCA2_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN2_SCA2_CAG were set to 11761482; 17923635; 8896555; 29325606; 20301452
Phenotypes for STR: ATXN2_SCA2_CAG were set to Spinocerebellar ataxia 2 MIM#183090
Review for STR: ATXN2_SCA2_CAG was set to GREEN
STR: ATXN2_SCA2_CAG was marked as clinically relevant
STR: ATXN2_SCA2_CAG was marked as current diagnostic
Added comment: NM_002973​.3:c.496_498CAG[X]
Toxic protein aggregation is mechanism of disease
Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2)
Uncertain: 32 repeats
ALS risk allele: 30-32 repeats
Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life
Full penetrance: ≥35 repeats
Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat
Sources: Literature
Motor Neurone Disease v1.31 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Mendeliome v1.2493 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Ataxia - adult onset v1.30 ATXN2_SCA2_CAG Bryony Thompson Marked STR: ATXN2_SCA2_CAG as ready
Ataxia - adult onset v1.30 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Ataxia - adult onset v1.30 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Ataxia - adult onset v1.29 ATXN1_SCA1_CAG Bryony Thompson Marked STR: ATXN1_SCA1_CAG as ready
Ataxia - adult onset v1.29 ATXN1_SCA1_CAG Bryony Thompson Str: atxn1_sca1_cag has been classified as Green List (High Evidence).
Ataxia - adult onset v1.29 ATXN1_SCA1_CAG Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG
Mendeliome v1.2492 ATXN1_SCA1_CAG Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG
Early-onset Parkinson disease v2.18 ATXN1_SCA1_CAG Bryony Thompson ATXN1_CAG was changed to ATXN1_SCA1_CAG
Mendeliome v1.2491 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Callosome v0.541 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Ataxia - adult onset v1.28 ATXN10_SCA10_ATTCT Bryony Thompson Marked STR: ATXN10_SCA10_ATTCT as ready
Ataxia - adult onset v1.28 ATXN10_SCA10_ATTCT Bryony Thompson Str: atxn10_sca10_attct has been classified as Green List (High Evidence).
Ataxia - adult onset v1.28 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Classified gene: ATXN10 as Red List (low evidence)
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Added comment: Comment on list classification: Only a single family reported
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Gene: atxn10 has been classified as Red List (Low Evidence).
Ataxia - adult onset v1.27 ATN1_DRPLA_CAG Bryony Thompson Marked STR: ATN1_DRPLA_CAG as ready
Ataxia - adult onset v1.27 ATN1_DRPLA_CAG Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence).
Ataxia - adult onset v1.27 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Marked STR: ATN1_DRPLA_CAG as ready
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence).
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Classified STR: ATN1_DRPLA_CAG as Green List (high evidence)
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence).
Genetic Epilepsy v1.133 ATN1_DRPLA_CAG Bryony Thompson STR: ATN1_DRPLA_CAG was added
STR: ATN1_DRPLA_CAG was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: ATN1_DRPLA_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATN1_DRPLA_CAG were set to 8136840; 8136826; 29325606; 20301664
Phenotypes for STR: ATN1_DRPLA_CAG were set to Dentatorubral-pallidoluysian atrophy MIM#125370
Review for STR: ATN1_DRPLA_CAG was set to GREEN
STR: ATN1_DRPLA_CAG was marked as clinically relevant
STR: ATN1_DRPLA_CAG was marked as current diagnostic
Added comment: NM_001007026​.1:c.1462_1464CAG[X]
Toxic gain of function mechanism of disease
Benign: ≤35 repeats
Mutable normal: 20-35 repeats
Pathogenic: ≥48 repeats
Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance
Sources: Expert list
Early-onset Dementia v1.35 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Dystonia - complex v0.279 NACC1 Bryony Thompson Marked gene: NACC1 as ready
Dystonia - complex v0.279 NACC1 Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence).
Dystonia - complex v0.279 NACC1 Bryony Thompson Classified gene: NACC1 as Green List (high evidence)
Dystonia - complex v0.279 NACC1 Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence).
Dystonia - complex v0.278 NAA15 Bryony Thompson Marked gene: NAA15 as ready
Dystonia - complex v0.278 NAA15 Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence).
Dystonia - complex v0.278 NAA15 Bryony Thompson Classified gene: NAA15 as Green List (high evidence)
Dystonia - complex v0.278 NAA15 Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence).
Dystonia - complex v0.277 PAH Bryony Thompson Marked gene: PAH as ready
Dystonia - complex v0.277 PAH Bryony Thompson Gene: pah has been classified as Green List (High Evidence).
Dystonia - complex v0.277 PAH Bryony Thompson Classified gene: PAH as Green List (high evidence)
Dystonia - complex v0.277 PAH Bryony Thompson Gene: pah has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence)
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence)
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.106 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Genetic Epilepsy v1.131 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Dystonia - complex v0.275 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Genetic Epilepsy v1.130 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Genetic Epilepsy v1.130 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.129 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Genetic Epilepsy v1.129 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.128 ARX_EIEE1_GCN1 Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready
Genetic Epilepsy v1.128 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Red List (Low Evidence).
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.104 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Genetic Epilepsy v1.128 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Dystonia - complex v0.273 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Dystonia - complex. Sources: Expert Review
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert Review
Dystonia - complex v0.272 ARX Bryony Thompson Tag STR tag was added to gene: ARX.
Motor Neurone Disease v1.30 AR_SBMA_CAG Bryony Thompson SBMA was changed to AR_SBMA_CAG
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Marked STR: AFF2_FRAXE_GCC as ready
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence).
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Classified STR: AFF2_FRAXE_GCC as Green List (high evidence)
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence).
Mendeliome v1.2489 AFF2_FRAXE_GCC Bryony Thompson STR: AFF2_FRAXE_GCC was added
STR: AFF2_FRAXE_GCC was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: AFF2_FRAXE_GCC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: AFF2_FRAXE_GCC were set to 8334699; 8673085; 11388762
Phenotypes for STR: AFF2_FRAXE_GCC were set to Intellectual developmental disorder, X-linked 109 MIM#309548
Review for STR: AFF2_FRAXE_GCC was set to GREEN
STR: AFF2_FRAXE_GCC was marked as clinically relevant
STR: AFF2_FRAXE_GCC was marked as current diagnostic
Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)
Loss of function through methylation silencing is the mechanism of disease
Normal - 5-44 repeats
Inconclusive - 45-54 repeats
Premutation - 55-200 repeats
Abnormal - >200 or >230 repeats
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.103 AFF2_FRAXE_GCC Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC
Mendeliome v1.2488 ABCD3_OPDM_GCC Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.46 ABCD3_OPDM_GCC Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.144 PRNP_CJD_octapeptide Bryony Thompson STR: PRNP_CJD_octapeptide was added
STR: PRNP_CJD_octapeptide was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407
Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP_CJD_octapeptide was set to GREEN
STR: PRNP_CJD_octapeptide was marked as clinically relevant
STR: PRNP_CJD_octapeptide was marked as current diagnostic
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Literature
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Ataxia - adult onset v1.26 PRNP_CJD_octapeptide Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready
Ataxia - adult onset v1.26 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Ataxia - adult onset v1.26 PRNP_CJD_octapeptide Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)
Ataxia - adult onset v1.26 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Ataxia - adult onset v1.25 PRNP_CJD_octapeptide Bryony Thompson STR: PRNP_CJD_octapeptide was added
STR: PRNP_CJD_octapeptide was added to Ataxia - adult onset. Sources: Literature
Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407
Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP_CJD_octapeptide was set to GREEN
STR: PRNP_CJD_octapeptide was marked as clinically relevant
STR: PRNP_CJD_octapeptide was marked as current diagnostic
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Literature
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.15 PRNP_CJD_octapeptide Bryony Thompson STR: PRNP_CJD_octapeptide was added
STR: PRNP_CJD_octapeptide was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407
Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP_CJD_octapeptide was set to GREEN
STR: PRNP_CJD_octapeptide was marked as clinically relevant
STR: PRNP_CJD_octapeptide was marked as current diagnostic
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Literature
Early-onset Dementia v1.33 PRNP_CJD_octapeptide Bryony Thompson CJD was changed to PRNP_CJD_octapeptide
Repeat Disorders v0.255 ZIC3_VACTERLX_GCC Bryony Thompson VACTERLX was changed to ZIC3_VACTERLX_GCC
Repeat Disorders v0.254 NUTM2B-AS1_OPDM_CCG Bryony Thompson NUTM2B-AS1_OPML1_CCG was changed to NUTM2B-AS1_OPDM_CCG
Repeat Disorders v0.253 NUTM2B-AS1_OPML1_CCG Bryony Thompson Classified STR: NUTM2B-AS1_OPML1_CCG as Green List (high evidence)
Repeat Disorders v0.253 NUTM2B-AS1_OPML1_CCG Bryony Thompson Str: nutm2b-as1_opml1_ccg has been classified as Green List (High Evidence).
Repeat Disorders v0.252 NUTM2B-AS1_OPML1_CCG Bryony Thompson edited their review of STR: NUTM2B-AS1_OPML1_CCG: Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.; Changed rating: GREEN; Changed publications: 31332380, 37923380, 39308795, 38159879; Changed phenotypes: Oculopharyngodistal myopathy MONDO:0025193; Set clinically relevant: yes
Repeat Disorders v0.252 NUTM2B-AS1_OPML1_CCG Bryony Thompson OPML1 was changed to NUTM2B-AS1_OPML1_CCG
Repeat Disorders v0.251 NIPA1_ALS_GCG Bryony Thompson NIPA1 was changed to NIPA1_ALS_GCG
Repeat Disorders v0.250 TMEM185A_FRAXF_GCC Bryony Thompson FRAXF was changed to TMEM185A_FRAXF_GCC
Repeat Disorders v0.249 CBL_FRA11B_CCG Bryony Thompson FRA11B was changed to CBL_FRA11B_CCG
Repeat Disorders v0.248 C11orf80_FRA11A_CGG Bryony Thompson FRA11A was changed to C11orf80_FRA11A_CGG
Repeat Disorders v0.247 TNRC6A_FAME6_TTTCA Bryony Thompson FAME6 was changed to TNRC6A_FAME6_TTTCA
Repeat Disorders v0.246 YEATS2_FAME4_TTTCA Bryony Thompson FAME4 was changed to YEATS2_FAME4_TTTCA
Repeat Disorders v0.245 SAMD12_FAME1_TTTGA Bryony Thompson FAME1_TTTGA was changed to SAMD12_FAME1_TTTGA
Repeat Disorders v0.244 THAP11_SCA_CAG Bryony Thompson SCA_THAP11_CAG was changed to THAP11_SCA_CAG
Repeat Disorders v0.243 ZNF713_FRA7A_CGG Bryony Thompson FRA7A was changed to ZNF713_FRA7A_CGG
Repeat Disorders v0.242 AFF3_FRA2A_CGG Bryony Thompson FRA2A was changed to AFF3_FRA2A_CGG
Repeat Disorders v0.241 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Repeat Disorders v0.240 RAPGEF2_FAME7_TTTCA Bryony Thompson FAME7 was changed to RAPGEF2_FAME7_TTTCA
Repeat Disorders v0.239 DMD_DMD_GAA Bryony Thompson DMD was changed to DMD_DMD_GAA
Repeat Disorders v0.238 RUNX2_CCD_GCN Bryony Thompson CCD was changed to RUNX2_CCD_GCN
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence)
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.13 RFC1_CANVAS_ANNGN Bryony Thompson STR: RFC1_CANVAS_ANNGN was added
STR: RFC1_CANVAS_ANNGN was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RFC1_CANVAS_ANNGN were set to 39833204; 39152783; 38789445; 36705320; 35013364
Phenotypes for STR: RFC1_CANVAS_ANNGN were set to Parkinson disease MONDO:0005180
Review for STR: RFC1_CANVAS_ANNGN was set to GREEN
STR: RFC1_CANVAS_ANNGN was marked as clinically relevant
STR: RFC1_CANVAS_ANNGN was marked as current diagnostic
Added comment: Biallelic RFC1 expansions have been identified as a rare cause of Parkinson's disease, without ataxia or neuropathy.
Sources: Literature
Ataxia - adult onset v1.24 RFC1_CANVAS_ANNGN Bryony Thompson Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.
Ataxia - adult onset v1.23 Bryony Thompson removed STR:CANVAS_ACAGG from the panel
Ataxia - adult onset v1.22 CANVAS_ACAGG Bryony Thompson Classified STR: CANVAS_ACAGG as No list
Ataxia - adult onset v1.22 CANVAS_ACAGG Bryony Thompson Str: canvas_acagg has been removed from the panel.
Mendeliome v1.2487 Bryony Thompson removed STR:CANVAS_ACAGG from the panel
Mendeliome v1.2486 CANVAS_ACAGG Bryony Thompson Classified STR: CANVAS_ACAGG as No list
Mendeliome v1.2486 CANVAS_ACAGG Bryony Thompson Str: canvas_acagg has been removed from the panel.
Hereditary Neuropathy - complex v1.22 Bryony Thompson removed STR:CANVAS_ACAGG from the panel
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence)
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Hereditary Neuropathy_CMT - isolated v1.53 RFC1_CANVAS_ANNGN Bryony Thompson STR: RFC1_CANVAS_ANNGN was added
STR: RFC1_CANVAS_ANNGN was added to Hereditary Neuropathy_CMT - isolated. Sources: Literature
Mode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RFC1_CANVAS_ANNGN were set to 36061987
Phenotypes for STR: RFC1_CANVAS_ANNGN were set to Cerebellar ataxia with neuropathy and bilateral vestibular areflexia syndrome MONDO:0044720
Review for STR: RFC1_CANVAS_ANNGN was set to GREEN
STR: RFC1_CANVAS_ANNGN was marked as clinically relevant
STR: RFC1_CANVAS_ANNGN was marked as current diagnostic
Added comment: Cases present with HSAN without ataxia and biallelic expansions.
Sources: Literature
Hereditary Neuropathy - complex v1.21 RFC1_CANVAS_ANNGN Bryony Thompson Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.
Hereditary Neuropathy - complex v1.20 RFC1_CANVAS_ANNGN Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready
Hereditary Neuropathy - complex v1.20 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.20 RFC1_CANVAS_ANNGN Bryony Thompson CANVAS was changed to RFC1_CANVAS_ANNGN
Ataxia - adult onset v1.21 RFC1_CANVAS_ANNGN Bryony Thompson CANVAS was changed to RFC1_CANVAS_ANNGN
Repeat Disorders v0.237 Bryony Thompson removed STR:RFC1_CANVAS_ACAGG from the panel
Repeat Disorders v0.236 RFC1_CANVAS_ANNGN Bryony Thompson edited their review of STR: RFC1_CANVAS_ANNGN: Changed publications: 30926972, 32851396, 33237689, 31230722, 33237689, 32694621, 33103729, 35355059; Set clinically relevant: no
Repeat Disorders v0.236 RFC1_CANVAS_ANNGN Bryony Thompson Publications for STR: RFC1_CANVAS_ANNGN were set to 30926972; 32851396; 33237689; 31230722; 33237689; 32694621; 33103729; 35355059
Repeat Disorders v0.235 RFC1_CANVAS_ANNGN Bryony Thompson commented on STR: RFC1_CANVAS_ANNGN: Multiple apparently pathogenic expansions now reported (AGGGC, AAGGC, AGAGG, AAAGG, ACAGG) other than the common AAGGG expansion
Repeat Disorders v0.235 RFC1_CANVAS_ANNGN Bryony Thompson RFC1_CANVAS_AAGGG was changed to RFC1_CANVAS_ANNGN
Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.
Repeat Disorders v0.234 RFC1_CANVAS_AAGGG Bryony Thompson Publications for STR: RFC1_CANVAS_AAGGG were set to 30926972; 32851396; 33237689; 31230722
Mendeliome v1.2485 RFC1_CANVAS_ANNGN Bryony Thompson RFC1_CANVAS_ANNGG was changed to RFC1_CANVAS_ANNGN
Repeated Sequence for RFC1_CANVAS_ANNGN was changed from ANNGG to ANNGN.
Publications for STR: RFC1_CANVAS_ANNGN were changed from 33237689; 32694621; 33103729; 35355059 to 33237689; 32694621; 33103729; 35355059; 37450567
Mendeliome v1.2484 RFC1_CANVAS_ANNGG Bryony Thompson RFC1_CANVAS_AMRGG was changed to RFC1_CANVAS_ANNGG
Mendeliome v1.2483 RFC1_CANVAS_AMRGG Bryony Thompson CANVAS was changed to RFC1_CANVAS_AMRGG
Repeated Sequence for RFC1_CANVAS_AMRGG was changed from AAGGG to ANNGG.
Publications for STR: RFC1_CANVAS_AMRGG were changed from 30926972; 32851396 to 33237689; 32694621; 33103729; 35355059
Repeat Disorders v0.233 RFC1_CANVAS_ACAGG Bryony Thompson Publications for STR: RFC1_CANVAS_ACAGG were set to 33237689; 32694621; 33103729
Repeat Disorders v0.232 RFC1_CANVAS_ACAGG Bryony Thompson Classified STR: RFC1_CANVAS_ACAGG as Green List (high evidence)
Repeat Disorders v0.232 RFC1_CANVAS_ACAGG Bryony Thompson Str: rfc1_canvas_acagg has been classified as Green List (High Evidence).
Repeat Disorders v0.231 RFC1_CANVAS_ACAGG Bryony Thompson edited their review of STR: RFC1_CANVAS_ACAGG: Added comment: Greater than 10 families reported now. Also compound heterozygote (ACAGG)exp/(AAGGG)exp cases reported.; Changed rating: GREEN; Changed publications: 33237689, 32694621, 33103729, 35355059
Repeat Disorders v0.231 RFC1_CANVAS_ACAGG Bryony Thompson CANVAS_ACAGG was changed to RFC1_CANVAS_ACAGG
Repeat Disorders v0.230 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Repeat Disorders v0.229 TBX1_TOF_GCN Bryony Thompson TOF was changed to TBX1_TOF_GCN
Repeat Disorders v0.228 HOXD13_SPD1_GCG Bryony Thompson SPD1 was changed to HOXD13_SPD1_GCG
Repeat Disorders v0.227 ATXN8OS_SCA8_CTG Bryony Thompson SCA8 was changed to ATXN8OS_SCA8_CTG
Repeat Disorders v0.226 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Repeat Disorders v0.225 CACNA1A_SCA6_CAG Bryony Thompson SCA6 was changed to CACNA1A_SCA6_CAG
Repeat Disorders v0.224 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Repeat Disorders v0.223 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Repeat Disorders v0.222 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Repeat Disorders v0.221 BEAN1_SCA31_TGGAA Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA
Repeat Disorders v0.220 ATXN3_SCA3_CAG Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG
Repeat Disorders v0.219 FGF14_SCA27B_GAA Bryony Thompson SCA27B was changed to FGF14_SCA27B_GAA
Repeat Disorders v0.218 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Repeat Disorders v0.217 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Repeat Disorders v0.216 PPP2R2B_SCA12_CAG Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG
Repeat Disorders v0.215 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Repeat Disorders v0.214 ATXN1_SCA1_CAG Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG
Repeat Disorders v0.213 AR_SBMA_CAG Bryony Thompson SBMA was changed to AR_SBMA_CAG
Repeat Disorders v0.212 EIF4A3_RCPS_complex Bryony Thompson RCPS was changed to EIF4A3_RCPS_complex
Repeat Disorders v0.211 SOX3_PHPX_GCN Bryony Thompson PHPX was changed to SOX3_PHPX_GCN
Repeat Disorders v0.210 ABCD3_OPDM_GCC Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC
Repeat Disorders v0.209 PABPN1_OPMD_GCN Bryony Thompson OPMD was changed to PABPN1_OPMD_GCN
Repeat Disorders v0.208 RILPL1_OPDM4_CGG Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG
Repeat Disorders v0.207 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Repeat Disorders v0.206 LRP12_OPDM1_CGG Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG
Repeat Disorders v0.205 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Repeat Disorders v0.204 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer
Repeat Disorders v0.203 RFC1_CANVAS_AAGGG Bryony Thompson RFC1_CANVAS_ AAGGG was changed to RFC1_CANVAS_AAGGG
Repeat Disorders v0.202 COMP_MEDPSACH_GAC Bryony Thompson MEDPSACH was changed to COMP_MEDPSACH_GAC
Repeat Disorders v0.201 PRDM12_HSAN8_GCC Bryony Thompson HSAN8 was changed to PRDM12_HSAN8_GCC
Repeat Disorders v0.200 ZIC2_HPE5_GCN Bryony Thompson HPE5 was changed to ZIC2_HPE5_GCN
Repeat Disorders v0.199 VWA1_HMNMYO_GCGCGGAGCG Bryony Thompson HMNMYO was changed to VWA1_HMNMYO_GCGCGGAGCG
Repeat Disorders v0.198 HOXA13_HFGS_GCN3 Bryony Thompson HFGS_tract3 was changed to HOXA13_HFGS_GCN3
Repeat Disorders v0.197 HOXA13_HFGS_GCN2 Bryony Thompson HFGS_tract2 was changed to HOXA13_HFGS_GCN2
Repeat Disorders v0.196 HOXA13_HFGS_GCN1 Bryony Thompson HFGS_tract1 was changed to HOXA13_HFGS_GCN1
Repeat Disorders v0.195 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Repeat Disorders v0.194 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Repeat Disorders v0.193 GLS_GDPAG_GCA Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA
Repeat Disorders v0.192 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Repeat Disorders v0.191 FMR1_FXS_CGG Bryony Thompson FXS was changed to FMR1_FXS_CGG
Repeat Disorders v0.190 FMR1_FXPOI_CGG Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG
Repeat Disorders v0.189 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Repeat Disorders v0.188 FXN_FRDA_GAA Bryony Thompson FRDA was changed to FXN_FRDA_GAA
Repeat Disorders v0.187 AFF2_FRAXE_GCC Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC
Repeat Disorders v0.186 TCF4_FECD3_CTG Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG
Repeat Disorders v0.185 MARCH6_FAME3_TTTCA Bryony Thompson FAME3 was changed to MARCH6_FAME3_TTTCA
Repeat Disorders v0.184 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Repeat Disorders v0.183 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Repeat Disorders v0.182 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson CSTB_EPM1_dodecamer was changed to CSTB_EPM1_CCCCGCCCCGCG
Repeat Disorders v0.181 CSTB_EPM1_dodecamer Bryony Thompson CSTB_EPM1_CCCCGCCCCGCG was changed to CSTB_EPM1_dodecamer
Repeat Disorders v0.180 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson EPM1 was changed to CSTB_EPM1_CCCCGCCCCGCG
Repeat Disorders v0.179 ARX_EIEE1_GCN2 Bryony Thompson EIEE1_tract2 was changed to ARX_EIEE1_GCN2
Repeat Disorders v0.178 ARX_EIEE1_GCN1 Bryony Thompson EIEE1_tract1 was changed to ARX_EIEE1_GCN1
Repeat Disorders v0.177 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Repeat Disorders v0.176 CNBP_DM2_CCTG Bryony Thompson DM2 was changed to CNBP_DM2_CCTG
Repeat Disorders v0.175 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Repeat Disorders v0.174 XYLT1_DBQD2_GGC Bryony Thompson DBQD2 was changed to XYLT1_DBQD2_GGC
Repeat Disorders v0.173 PRNP_CJD_octapeptide Bryony Thompson PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT was changed to PRNP_CJD_octapeptide
Repeat Disorders v0.172 PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT Bryony Thompson CJD was changed to PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT
Repeat Disorders v0.171 PHOX2B_CCHS_GCN Bryony Thompson CCHS was changed to PHOX2B_CCHS_GCN
Prepair 500+ v1.105 AUH Zornitza Stark Marked gene: AUH as ready
Prepair 500+ v1.105 AUH Zornitza Stark Gene: auh has been classified as Green List (High Evidence).
Prepair 500+ v1.105 AUH Zornitza Stark Phenotypes for gene: AUH were changed from 3-methylglutaconic aciduria, type I, 250950 (3) to 3-methylglutaconic aciduria, type I, MIM# 250950; MONDO:0009610
Prepair 500+ v1.104 AUH Zornitza Stark Publications for gene: AUH were set to
Prepair 500+ v1.103 ATRX Zornitza Stark Marked gene: ATRX as ready
Prepair 500+ v1.103 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Prepair 500+ v1.103 ATRX Zornitza Stark Phenotypes for gene: ATRX were changed from Mental retardation-hypotonic facies syndrome, X-linked, 309580 (3) to Alpha thalassemia X-linked intellectual disability syndrome MONDO:0010519
Prepair 500+ v1.102 ATRX Zornitza Stark Publications for gene: ATRX were set to
Prepair 500+ v1.101 ATR Zornitza Stark Marked gene: ATR as ready
Prepair 500+ v1.101 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Prepair 500+ v1.101 ATR Zornitza Stark Phenotypes for gene: ATR were changed from Seckel syndrome 1, 210600 (3) to Seckel syndrome 1(MIM#210600)
Prepair 500+ v1.100 ATR Zornitza Stark Publications for gene: ATR were set to
Prepair 500+ v1.99 ATP8B1 Zornitza Stark Marked gene: ATP8B1 as ready
Prepair 500+ v1.99 ATP8B1 Zornitza Stark Gene: atp8b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.99 ATP8B1 Zornitza Stark Phenotypes for gene: ATP8B1 were changed from Cholestasis, progressive familial intrahepatic 1, 211600 (3) to Cholestasis, progressive familial intrahepatic 1, MIM#211600
Prepair 500+ v1.98 ATP7B Zornitza Stark Marked gene: ATP7B as ready
Prepair 500+ v1.98 ATP7B Zornitza Stark Gene: atp7b has been classified as Green List (High Evidence).
Prepair 500+ v1.98 ATP7B Zornitza Stark Phenotypes for gene: ATP7B were changed from Wilson disease, 277900 (3) to Wilson disease (MIM#277900)
Prepair 500+ v1.97 ATP7B Zornitza Stark Publications for gene: ATP7B were set to 28433102
Prepair 500+ v1.96 ATP7A Zornitza Stark Marked gene: ATP7A as ready
Prepair 500+ v1.96 ATP7A Zornitza Stark Gene: atp7a has been classified as Green List (High Evidence).
Prepair 500+ v1.96 ATP7A Zornitza Stark Phenotypes for gene: ATP7A were changed from Menkes disease, 309400 (3) to Menkes disease(MIM#309400); Occipital horn syndrome(MIM#304150)
Prepair 500+ v1.95 ATP7A Zornitza Stark Publications for gene: ATP7A were set to
Prepair 500+ v1.94 ATP6V1B1 Zornitza Stark Marked gene: ATP6V1B1 as ready
Prepair 500+ v1.94 ATP6V1B1 Zornitza Stark Gene: atp6v1b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.94 ATP6V1B1 Zornitza Stark Phenotypes for gene: ATP6V1B1 were changed from Renal tubular acidosis with deafness, 267300 (3) to Distal renal tubular acidosis 2 with progressive sensorineural hearing loss, MIM# 267300
Prepair 500+ v1.93 ATM Zornitza Stark Marked gene: ATM as ready
Prepair 500+ v1.93 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Prepair 500+ v1.93 ATM Zornitza Stark Phenotypes for gene: ATM were changed from Ataxia-telangiectasia, 208900 (3) to Ataxia-telangiectasia, MIM# 208900
Prepair 500+ v1.92 ATM Zornitza Stark Publications for gene: ATM were set to
Prepair 500+ v1.91 ASS1 Zornitza Stark Marked gene: ASS1 as ready
Prepair 500+ v1.91 ASS1 Zornitza Stark Gene: ass1 has been classified as Green List (High Evidence).
Prepair 500+ v1.91 ASS1 Zornitza Stark Phenotypes for gene: ASS1 were changed from Citrullinemia, 215700 (3) to Citrullinaemia (MIM# 215700)
Prepair 500+ v1.90 ASS1 Zornitza Stark Publications for gene: ASS1 were set to
Prepair 500+ v1.89 ASPM Zornitza Stark Marked gene: ASPM as ready
Prepair 500+ v1.89 ASPM Zornitza Stark Gene: aspm has been classified as Green List (High Evidence).
Prepair 500+ v1.89 ASPM Zornitza Stark Phenotypes for gene: ASPM were changed from Microcephaly 5, primary, autosomal recessive, 608716 (3) to Microcephaly 5, primary, autosomal recessive (MIM#608716)
Prepair 500+ v1.88 ASPM Zornitza Stark Publications for gene: ASPM were set to
Prepair 500+ v1.87 ASPA Zornitza Stark Marked gene: ASPA as ready
Prepair 500+ v1.87 ASPA Zornitza Stark Gene: aspa has been classified as Green List (High Evidence).
Prepair 500+ v1.87 ASPA Zornitza Stark Phenotypes for gene: ASPA were changed from Canavan disease, 271900 (3) to Canavan disease MIM#271900
Prepair 500+ v1.86 ASPA Zornitza Stark Publications for gene: ASPA were set to
Prepair 500+ v1.85 ASNS Zornitza Stark Marked gene: ASNS as ready
Prepair 500+ v1.85 ASNS Zornitza Stark Gene: asns has been classified as Green List (High Evidence).
Prepair 500+ v1.85 ASNS Zornitza Stark Phenotypes for gene: ASNS were changed from Asparagine synthetase deficiency, 615574 (3) to Asparagine synthetase deficiency, MIM#615574
Prepair 500+ v1.84 ASNS Zornitza Stark Publications for gene: ASNS were set to
Prepair 500+ v1.83 ASL Zornitza Stark Marked gene: ASL as ready
Prepair 500+ v1.83 ASL Zornitza Stark Gene: asl has been classified as Green List (High Evidence).
Prepair 500+ v1.83 ASL Zornitza Stark Phenotypes for gene: ASL were changed from Argininosuccinic aciduria, 207900 (3) to Argininosuccinic aciduria MIM#207900
Prepair 500+ v1.82 ASL Zornitza Stark Publications for gene: ASL were set to
Prepair 500+ v1.81 ARX Zornitza Stark Marked gene: ARX as ready
Prepair 500+ v1.81 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Prepair 500+ v1.81 ARX Zornitza Stark Phenotypes for gene: ARX were changed from Hydranencephaly with abnormal genitalia, 300215 (3) to Epileptic encephalopathy, early infantile, 1 MIM#308350; Hydranencephaly with abnormal genitalia MIM#300215; Lissencephaly, X-linked 2 MIM#300215; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510; Proud syndrome MIM#300004
Prepair 500+ v1.80 ARX Zornitza Stark Publications for gene: ARX were set to
Prepair 500+ v1.79 ARSB Zornitza Stark Marked gene: ARSB as ready
Prepair 500+ v1.79 ARSB Zornitza Stark Gene: arsb has been classified as Green List (High Evidence).
Prepair 500+ v1.79 ARSB Zornitza Stark Phenotypes for gene: ARSB were changed from Mucopolysaccharidosis type VI (Maroteaux-Lamy), 253200 (3) to Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200
Prepair 500+ v1.78 ARSB Zornitza Stark Publications for gene: ARSB were set to
Prepair 500+ v1.77 ARSA Zornitza Stark Marked gene: ARSA as ready
Prepair 500+ v1.77 ARSA Zornitza Stark Gene: arsa has been classified as Green List (High Evidence).
Prepair 500+ v1.77 ARSA Zornitza Stark Phenotypes for gene: ARSA were changed from Metachromatic leukodystrophy, 250100 (3) to Metachromatic leukodystrophy, MIM# 250100
Prepair 500+ v1.76 ARSA Zornitza Stark Publications for gene: ARSA were set to
Prepair 500+ v1.75 ARL6 Zornitza Stark Marked gene: ARL6 as ready
Prepair 500+ v1.75 ARL6 Zornitza Stark Gene: arl6 has been classified as Green List (High Evidence).
Prepair 500+ v1.75 ARL6 Zornitza Stark Phenotypes for gene: ARL6 were changed from Bardet-Biedl syndrome 3, 600151 (3) to Bardet-Biedl syndrome 3, MIM# 600151
Prepair 500+ v1.74 ARL6 Zornitza Stark Publications for gene: ARL6 were set to
Prepair 500+ v1.73 ARL13B Zornitza Stark Marked gene: ARL13B as ready
Prepair 500+ v1.73 ARL13B Zornitza Stark Gene: arl13b has been classified as Green List (High Evidence).
Prepair 500+ v1.73 ARL13B Zornitza Stark Phenotypes for gene: ARL13B were changed from Joubert syndrome 8, 612291 (3) to Joubert syndrome 8, MIM# 612291
Prepair 500+ v1.72 ARL13B Zornitza Stark Publications for gene: ARL13B were set to
Prepair 500+ v1.71 ARG1 Zornitza Stark Marked gene: ARG1 as ready
Prepair 500+ v1.71 ARG1 Zornitza Stark Gene: arg1 has been classified as Green List (High Evidence).
Prepair 500+ v1.71 ARG1 Zornitza Stark Phenotypes for gene: ARG1 were changed from Argininemia, 207800 (3) to Argininemia MIM# 207800
Prepair 500+ v1.70 ARG1 Zornitza Stark Publications for gene: ARG1 were set to
Prepair 500+ v1.69 AQP2 Zornitza Stark Marked gene: AQP2 as ready
Prepair 500+ v1.69 AQP2 Zornitza Stark Gene: aqp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.69 AQP2 Zornitza Stark Phenotypes for gene: AQP2 were changed from Diabetes insipidus, nephrogenic, 125800 (3) to Diabetes insipidus, nephrogenic, type 2 MIM# 125800
Prepair 500+ v1.68 AQP2 Zornitza Stark Publications for gene: AQP2 were set to
Prepair 500+ v1.67 AP1S2 Zornitza Stark Marked gene: AP1S2 as ready
Prepair 500+ v1.67 AP1S2 Zornitza Stark Gene: ap1s2 has been classified as Green List (High Evidence).
Prepair 500+ v1.67 AP1S2 Zornitza Stark Publications for gene: AP1S2 were set to
Prepair 500+ v1.66 AMT Zornitza Stark Marked gene: AMT as ready
Prepair 500+ v1.66 AMT Zornitza Stark Gene: amt has been classified as Green List (High Evidence).
Prepair 500+ v1.66 AMT Zornitza Stark Phenotypes for gene: AMT were changed from Glycine encephalopathy, 605899 (3) to Glycine encephalopathy MIM#620398
Prepair 500+ v1.65 AMT Zornitza Stark Publications for gene: AMT were set to
Prepair 500+ v1.64 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Prepair 500+ v1.64 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Prepair 500+ v1.64 AMPD2 Zornitza Stark Phenotypes for gene: AMPD2 were changed from Pontocerebellar hypoplasia, type 9, 615809 (3) to Pontocerebellar hypoplasia, type 9, MIM#615809
Prepair 500+ v1.63 AMPD2 Zornitza Stark Publications for gene: AMPD2 were set to
Prepair 500+ v1.62 ALPL Zornitza Stark Marked gene: ALPL as ready
Prepair 500+ v1.62 ALPL Zornitza Stark Gene: alpl has been classified as Green List (High Evidence).
Prepair 500+ v1.62 ALPL Zornitza Stark Phenotypes for gene: ALPL were changed from Hypophosphatasia, infantile, 241500 (3) to Hypophosphatasia, childhood (MIM#241510); Hypophosphatasia, infantile (MIM#241500)
Prepair 500+ v1.61 ALPL Zornitza Stark Publications for gene: ALPL were set to
Prepair 500+ v1.60 ALMS1 Zornitza Stark Marked gene: ALMS1 as ready
Prepair 500+ v1.60 ALMS1 Zornitza Stark Gene: alms1 has been classified as Green List (High Evidence).
Prepair 500+ v1.60 ALMS1 Zornitza Stark Phenotypes for gene: ALMS1 were changed from Alstrom syndrome, 203800 (3) to Alstrom syndrome, MIM# 203800
Prepair 500+ v1.59 ALG6 Zornitza Stark Marked gene: ALG6 as ready
Prepair 500+ v1.59 ALG6 Zornitza Stark Gene: alg6 has been classified as Green List (High Evidence).
Prepair 500+ v1.59 ALG6 Zornitza Stark Phenotypes for gene: ALG6 were changed from Congenital disorder of glycosylation, type Ic, 603147 (3) to Congenital disorder of glycosylation, type Ic, MIM#603147
Prepair 500+ v1.58 ALG6 Zornitza Stark Publications for gene: ALG6 were set to
Prepair 500+ v1.57 ALG3 Zornitza Stark Marked gene: ALG3 as ready
Prepair 500+ v1.57 ALG3 Zornitza Stark Gene: alg3 has been classified as Green List (High Evidence).
Prepair 500+ v1.57 ALG3 Zornitza Stark Phenotypes for gene: ALG3 were changed from Congenital disorder of glycosylation, type Id, 601110 (3) to Congenital disorder of glycosylation, type Id, MIM#601110
Prepair 500+ v1.56 ALG3 Zornitza Stark Publications for gene: ALG3 were set to
Prepair 500+ v1.55 ALG1 Zornitza Stark Marked gene: ALG1 as ready
Prepair 500+ v1.55 ALG1 Zornitza Stark Gene: alg1 has been classified as Green List (High Evidence).
Prepair 500+ v1.55 ALG1 Zornitza Stark Phenotypes for gene: ALG1 were changed from Congenital disorder of glycosylation, type Ik, 608540 (3) to Congenital disorder of glycosylation, type Ik, MIM# 608540
Prepair 500+ v1.54 ALG1 Zornitza Stark Publications for gene: ALG1 were set to
Prepair 500+ v1.53 ALDOB Zornitza Stark Marked gene: ALDOB as ready
Prepair 500+ v1.53 ALDOB Zornitza Stark Gene: aldob has been classified as Green List (High Evidence).
Prepair 500+ v1.53 ALDOB Zornitza Stark Phenotypes for gene: ALDOB were changed from Fructose intolerance, 229600 (3) to Fructose intolerance, hereditary, MIM# 229600
Prepair 500+ v1.52 ALDOB Zornitza Stark Publications for gene: ALDOB were set to
Prepair 500+ v1.51 ALDH7A1 Zornitza Stark Marked gene: ALDH7A1 as ready
Prepair 500+ v1.51 ALDH7A1 Zornitza Stark Gene: aldh7a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.51 ALDH7A1 Zornitza Stark Phenotypes for gene: ALDH7A1 were changed from Epilepsy, pyridoxine-dependent, 266100 (3) to Epilepsy, early-onset, 4, vitamin B6-dependent MIM #266100
Prepair 500+ v1.50 ALDH7A1 Zornitza Stark Publications for gene: ALDH7A1 were set to
Prepair 500+ v1.49 ALDH5A1 Zornitza Stark Marked gene: ALDH5A1 as ready
Prepair 500+ v1.49 ALDH5A1 Zornitza Stark Gene: aldh5a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.49 ALDH5A1 Zornitza Stark Phenotypes for gene: ALDH5A1 were changed from Succinic semialdehyde dehydrogenase deficiency, 271980 (3) to Succinic semialdehyde dehydrogenase deficiency, MIM# 271980
Prepair 500+ v1.48 ALDH5A1 Zornitza Stark Publications for gene: ALDH5A1 were set to
Prepair 500+ v1.47 ALDH3A2 Zornitza Stark Marked gene: ALDH3A2 as ready
Prepair 500+ v1.47 ALDH3A2 Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence).
Prepair 500+ v1.47 ALDH3A2 Zornitza Stark Phenotypes for gene: ALDH3A2 were changed from Sjogren-Larsson syndrome, 270200 (3) to Sjogren-Larsson syndrome (MIM#270200)
Prepair 500+ v1.46 ALDH18A1 Zornitza Stark Marked gene: ALDH18A1 as ready
Prepair 500+ v1.46 ALDH18A1 Zornitza Stark Gene: aldh18a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.46 ALDH18A1 Zornitza Stark Phenotypes for gene: ALDH18A1 were changed from Spastic paraplegia 9B, autosomal recessive, 616586 (3) to Cutis laxa, autosomal recessive, type IIIA (MIM#219150); Spastic paraplegia 9B, autosomal recessive (MIM#616586)
Prepair 500+ v1.45 ALDH18A1 Zornitza Stark Publications for gene: ALDH18A1 were set to
Prepair 500+ v1.44 AK2 Zornitza Stark Marked gene: AK2 as ready
Prepair 500+ v1.44 AK2 Zornitza Stark Gene: ak2 has been classified as Green List (High Evidence).
Prepair 500+ v1.44 AK2 Zornitza Stark Phenotypes for gene: AK2 were changed from Reticular dysgenesis, 267500 (3) to Reticular dysgenesis MIM# 267500
Prepair 500+ v1.43 AK2 Zornitza Stark Publications for gene: AK2 were set to
Prepair 500+ v1.42 AIPL1 Zornitza Stark Marked gene: AIPL1 as ready
Prepair 500+ v1.42 AIPL1 Zornitza Stark Gene: aipl1 has been classified as Green List (High Evidence).
Prepair 500+ v1.42 AIPL1 Zornitza Stark Phenotypes for gene: AIPL1 were changed from Cone-rod dystrophy, 604393 (3) to Leber congenital amaurosis 4, 604393; Cone-rod dystrophy, 604393; Retinitis pigmentosa, juvenile, 604393
Prepair 500+ v1.41 AIPL1 Zornitza Stark Publications for gene: AIPL1 were set to
Prepair 500+ v1.40 AIFM1 Zornitza Stark Marked gene: AIFM1 as ready
Prepair 500+ v1.40 AIFM1 Zornitza Stark Gene: aifm1 has been classified as Green List (High Evidence).
Prepair 500+ v1.40 AIFM1 Zornitza Stark Phenotypes for gene: AIFM1 were changed from Cowchock syndrome, 310490 (3) to Combined oxidative phosphorylation deficiency 6, 300816; Cowchock syndrome, 310490; Deafness, X-linked 5, 300614; Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232
Prepair 500+ v1.39 AIFM1 Zornitza Stark Publications for gene: AIFM1 were set to
Prepair 500+ v1.38 AHI1 Zornitza Stark Marked gene: AHI1 as ready
Prepair 500+ v1.38 AHI1 Zornitza Stark Gene: ahi1 has been classified as Green List (High Evidence).
Prepair 500+ v1.38 AHI1 Zornitza Stark Phenotypes for gene: AHI1 were changed from Joubert syndrome-3, 608629 (3) to Joubert syndrome 3 MIM#608629
Prepair 500+ v1.37 AHI1 Zornitza Stark Publications for gene: AHI1 were set to
Prepair 500+ v1.36 AGXT Zornitza Stark Marked gene: AGXT as ready
Prepair 500+ v1.36 AGXT Zornitza Stark Gene: agxt has been classified as Green List (High Evidence).
Prepair 500+ v1.36 AGXT Zornitza Stark Phenotypes for gene: AGXT were changed from Hyperoxaluria, primary, type 1, 259900 (3) to Hyperoxaluria, primary, type 1 MIM #259900
Prepair 500+ v1.35 AGXT Zornitza Stark Publications for gene: AGXT were set to
Prepair 500+ v1.34 AGPS Zornitza Stark Marked gene: AGPS as ready
Prepair 500+ v1.34 AGPS Zornitza Stark Gene: agps has been classified as Green List (High Evidence).
Prepair 500+ v1.34 AGPS Zornitza Stark Phenotypes for gene: AGPS were changed from Chondrodysplasia punctata, rhizomelic, type 3, 600121 (3) to Rhizomelic chondrodysplasia punctata, type 3, MIM# 600121
Prepair 500+ v1.33 AGPS Zornitza Stark Publications for gene: AGPS were set to
Prepair 500+ v1.32 AGL Zornitza Stark Marked gene: AGL as ready
Prepair 500+ v1.32 AGL Zornitza Stark Gene: agl has been classified as Green List (High Evidence).
Prepair 500+ v1.32 AGL Zornitza Stark Phenotypes for gene: AGL were changed from Glycogen storage disease IIIa, 232400 (3) to Glycogen storage disease IIIa and IIIb, MIM#232400
Prepair 500+ v1.31 AGL Zornitza Stark Publications for gene: AGL were set to
Prepair 500+ v1.30 AGK Zornitza Stark Marked gene: AGK as ready
Prepair 500+ v1.30 AGK Zornitza Stark Gene: agk has been classified as Green List (High Evidence).
Prepair 500+ v1.30 AGK Zornitza Stark Phenotypes for gene: AGK were changed from Sengers syndrome, 212350 (3) to Sengers syndrome, MIM#212350
Prepair 500+ v1.29 AGA Zornitza Stark Marked gene: AGA as ready
Prepair 500+ v1.29 AGA Zornitza Stark Gene: aga has been classified as Green List (High Evidence).
Prepair 500+ v1.29 AGA Zornitza Stark Phenotypes for gene: AGA were changed from Aspartylglucosaminuria, 208400 (3) to Aspartylglucosaminuria, MIM# 208400, MONDO:0008830
Prepair 500+ v1.28 AGA Zornitza Stark Publications for gene: AGA were set to
Prepair 500+ v1.27 ADSL Zornitza Stark Marked gene: ADSL as ready
Prepair 500+ v1.27 ADSL Zornitza Stark Gene: adsl has been classified as Green List (High Evidence).
Prepair 500+ v1.27 ADSL Zornitza Stark Phenotypes for gene: ADSL were changed from Adenylosuccinase deficiency, 103050 (3) to Adenylosuccinase deficiency MIM#103050
Prepair 500+ v1.26 ADSL Zornitza Stark Publications for gene: ADSL were set to
Prepair 500+ v1.25 ADGRV1 Zornitza Stark Marked gene: ADGRV1 as ready
Prepair 500+ v1.25 ADGRV1 Zornitza Stark Gene: adgrv1 has been classified as Green List (High Evidence).
Prepair 500+ v1.25 ADGRV1 Zornitza Stark Phenotypes for gene: ADGRV1 were changed from Usher syndrome, type 2C, 605472 (3) to Usher syndrome, type 2C, MIM# 605472
Prepair 500+ v1.24 ADGRV1 Zornitza Stark Publications for gene: ADGRV1 were set to
Prepair 500+ v1.23 ADGRG1 Zornitza Stark Marked gene: ADGRG1 as ready
Prepair 500+ v1.23 ADGRG1 Zornitza Stark Gene: adgrg1 has been classified as Green List (High Evidence).
Prepair 500+ v1.23 ADGRG1 Zornitza Stark Phenotypes for gene: ADGRG1 were changed from Polymicrogyria, bilateral frontoparietal, 606854 (3) to Polymicrogyria, bilateral frontoparietal, MIM#606854
Prepair 500+ v1.22 ADGRG1 Zornitza Stark Publications for gene: ADGRG1 were set to
Prepair 500+ v1.21 ADAR Zornitza Stark Marked gene: ADAR as ready
Prepair 500+ v1.21 ADAR Zornitza Stark Gene: adar has been classified as Green List (High Evidence).
Prepair 500+ v1.21 ADAR Zornitza Stark Phenotypes for gene: ADAR were changed from Aicardi-Goutieres syndrome 6, 615010 (3) to Aicardi-Goutieres syndrome 6, MIM#615010
Prepair 500+ v1.20 ADAMTS2 Zornitza Stark Marked gene: ADAMTS2 as ready
Prepair 500+ v1.20 ADAMTS2 Zornitza Stark Gene: adamts2 has been classified as Green List (High Evidence).
Prepair 500+ v1.20 ADAMTS2 Zornitza Stark Phenotypes for gene: ADAMTS2 were changed from Ehlers-Danlos syndrome, type VIIC, 225410 (3) to Ehlers-Danlos syndrome, dermatosparaxis type (MIM# 225410)
Prepair 500+ v1.19 ADAMTS2 Zornitza Stark Publications for gene: ADAMTS2 were set to
Prepair 500+ v1.18 ADA Zornitza Stark Marked gene: ADA as ready
Prepair 500+ v1.18 ADA Zornitza Stark Gene: ada has been classified as Green List (High Evidence).
Prepair 500+ v1.18 ADA Zornitza Stark Phenotypes for gene: ADA were changed from Adenosine deaminase deficiency, partial, 102700 (3) to Severe combined immunodeficiency due to ADA deficiency MIM#102700; Adenosine deaminase deficiency, partial MIM#102700
Prepair 500+ v1.17 ADA Zornitza Stark Publications for gene: ADA were set to
Prepair 500+ v1.16 ACOX1 Zornitza Stark Marked gene: ACOX1 as ready
Prepair 500+ v1.16 ACOX1 Zornitza Stark Gene: acox1 has been classified as Green List (High Evidence).
Prepair 500+ v1.16 ACOX1 Zornitza Stark Phenotypes for gene: ACOX1 were changed from Peroxisomal acyl-CoA oxidase deficiency, 264470 (3) to Peroxisomal acyl-CoA oxidase deficiency, MIM#264470
Prepair 500+ v1.15 ACOX1 Zornitza Stark Publications for gene: ACOX1 were set to
Prepair 500+ v1.14 ACAT1 Zornitza Stark Marked gene: ACAT1 as ready
Prepair 500+ v1.14 ACAT1 Zornitza Stark Gene: acat1 has been classified as Green List (High Evidence).
Prepair 500+ v1.14 ACAT1 Zornitza Stark Phenotypes for gene: ACAT1 were changed from Alpha-methylacetoacetic aciduria, 203750 (3) to Alpha-methylacetoacetic aciduria, MIM#203750
Prepair 500+ v1.13 ACAT1 Zornitza Stark Publications for gene: ACAT1 were set to
Prepair 500+ v1.12 ACADVL Zornitza Stark Marked gene: ACADVL as ready
Prepair 500+ v1.12 ACADVL Zornitza Stark Gene: acadvl has been classified as Green List (High Evidence).
Prepair 500+ v1.12 ACADVL Zornitza Stark Phenotypes for gene: ACADVL were changed from VLCAD deficiency, 201475 (3) to VLCAD deficiency (MIM#201475)
Prepair 500+ v1.11 ACADM Zornitza Stark Marked gene: ACADM as ready
Prepair 500+ v1.11 ACADM Zornitza Stark Gene: acadm has been classified as Green List (High Evidence).
Prepair 500+ v1.11 ACADM Zornitza Stark Publications for gene: ACADM were set to
Prepair 500+ v1.10 ACAD9 Zornitza Stark Marked gene: ACAD9 as ready
Prepair 500+ v1.10 ACAD9 Zornitza Stark Gene: acad9 has been classified as Green List (High Evidence).
Prepair 500+ v1.10 ACAD9 Zornitza Stark Phenotypes for gene: ACAD9 were changed from Mitochondrial complex I deficiency due to ACAD9 deficiency, 611126 (3) to Mitochondrial complex I deficiency, nuclear type 20 (MIM#611126)
Prepair 500+ v1.9 ACAD9 Zornitza Stark Publications for gene: ACAD9 were set to
Prepair 500+ v1.8 ABCD1 Zornitza Stark Marked gene: ABCD1 as ready
Prepair 500+ v1.8 ABCD1 Zornitza Stark Gene: abcd1 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.127 USP25 Zornitza Stark Classified gene: USP25 as Amber List (moderate evidence)
Genetic Epilepsy v1.127 USP25 Zornitza Stark Gene: usp25 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2482 USP25 Zornitza Stark Classified gene: USP25 as Amber List (moderate evidence)
Mendeliome v1.2482 USP25 Zornitza Stark Gene: usp25 has been classified as Amber List (Moderate Evidence).
Prepair 500+ v1.8 ABCC8 Zornitza Stark Marked gene: ABCC8 as ready
Prepair 500+ v1.8 ABCC8 Zornitza Stark Gene: abcc8 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCB4 Zornitza Stark Marked gene: ABCB4 as ready
Prepair 500+ v1.8 ABCB4 Zornitza Stark Gene: abcb4 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCB11 Zornitza Stark Marked gene: ABCB11 as ready
Prepair 500+ v1.8 ABCB11 Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCA3 Zornitza Stark Marked gene: ABCA3 as ready
Prepair 500+ v1.8 ABCA3 Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCA12 Zornitza Stark Marked gene: ABCA12 as ready
Prepair 500+ v1.8 ABCA12 Zornitza Stark Gene: abca12 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Prepair 500+ v1.8 AARS2 Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 AAAS Zornitza Stark Marked gene: AAAS as ready
Prepair 500+ v1.8 AAAS Zornitza Stark Gene: aaas has been classified as Green List (High Evidence).
Prepair 1000+ v2.7 ZNF469 Zornitza Stark Tag for review tag was added to gene: ZNF469.
Prepair 1000+ v2.7 TRAPPC12 Zornitza Stark Tag for review tag was added to gene: TRAPPC12.
Prepair 1000+ v2.7 PUS7 Zornitza Stark Tag for review tag was added to gene: PUS7.
Prepair 1000+ v2.7 PTPN23 Zornitza Stark Tag for review tag was added to gene: PTPN23.
Prepair 1000+ v2.7 RARB Zornitza Stark Marked gene: RARB as ready
Prepair 1000+ v2.7 RARB Zornitza Stark Gene: rarb has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v2.7 RARB Zornitza Stark Phenotypes for gene: RARB were changed from Microphthalmia, syndromic 12, 615524 (3), Autosomal recessive to Microphthalmia, syndromic 12 MIM#615524
Prepair 1000+ v2.6 RARB Zornitza Stark Publications for gene: RARB were set to
Prepair 1000+ v2.5 TMEM94 Zornitza Stark Marked gene: TMEM94 as ready
Prepair 1000+ v2.5 TMEM94 Zornitza Stark Gene: tmem94 has been classified as Green List (High Evidence).
Prepair 1000+ v2.5 TMEM94 Zornitza Stark Publications for gene: TMEM94 were set to 30526868
Prepair 1000+ v2.4 FAM20C Zornitza Stark Marked gene: FAM20C as ready
Prepair 1000+ v2.4 FAM20C Zornitza Stark Gene: fam20c has been classified as Green List (High Evidence).
Prepair 1000+ v2.4 FAM20C Zornitza Stark Phenotypes for gene: FAM20C were changed from Raine syndrome, 259775 (3) to Raine syndrome MIM#259775
Prepair 1000+ v2.3 FAM20C Zornitza Stark Publications for gene: FAM20C were set to
Prepair 1000+ v2.2 EIF2B3 Zornitza Stark Marked gene: EIF2B3 as ready
Prepair 1000+ v2.2 EIF2B3 Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence).
Prepair 1000+ v2.2 EIF2B3 Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313
Prepair 1000+ v2.1 EIF2B3 Zornitza Stark Publications for gene: EIF2B3 were set to
Prepair 1000+ v2.0 CLN8 Zornitza Stark Marked gene: CLN8 as ready
Prepair 1000+ v2.0 CLN8 Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence).
Prepair 1000+ v2.0 CLN8 Zornitza Stark reviewed gene: CLN8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 8, MIM# 600143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v2.0 Zornitza Stark promoted panel to version 2.0
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Marked gene: SCN1B as ready
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Gene: scn1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Classified gene: SCN1B as Green List (high evidence)
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Gene: scn1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2158 POLR1D Zornitza Stark Marked gene: POLR1D as ready
Prepair 1000+ v1.2158 POLR1D Zornitza Stark Gene: polr1d has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2158 POLR1D Zornitza Stark Mode of inheritance for gene: POLR1D was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2157 POLR1D Zornitza Stark Classified gene: POLR1D as Red List (low evidence)
Prepair 1000+ v1.2157 POLR1D Zornitza Stark Gene: polr1d has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2156 POLR1D Zornitza Stark reviewed gene: POLR1D: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Treacher Collins syndrome 2 MIM#613717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2156 POLE Zornitza Stark Marked gene: POLE as ready
Prepair 1000+ v1.2156 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Prepair 1000+ v1.2156 POLE Zornitza Stark Classified gene: POLE as Green List (high evidence)
Prepair 1000+ v1.2156 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Prepair 1000+ v1.2155 OXCT1 Zornitza Stark Classified gene: OXCT1 as Green List (high evidence)
Prepair 1000+ v1.2155 OXCT1 Zornitza Stark Gene: oxct1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2154 HPDL Zornitza Stark Marked gene: HPDL as ready
Prepair 1000+ v1.2154 HPDL Zornitza Stark Gene: hpdl has been classified as Green List (High Evidence).
Prepair 1000+ v1.2154 HPDL Zornitza Stark Phenotypes for gene: HPDL were changed from to Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities MIM#619026; Spastic paraplegia 83, autosomal recessive MIM#619027; Leigh syndrome MONDO:0009723
Prepair 1000+ v1.2153 HPDL Zornitza Stark Classified gene: HPDL as Green List (high evidence)
Prepair 1000+ v1.2153 HPDL Zornitza Stark Gene: hpdl has been classified as Green List (High Evidence).
Prepair 1000+ v1.2152 DLAT Zornitza Stark Classified gene: DLAT as Green List (high evidence)
Prepair 1000+ v1.2152 DLAT Zornitza Stark Gene: dlat has been classified as Green List (High Evidence).
Prepair 1000+ v1.2151 DBR1 Zornitza Stark Phenotypes for gene: DBR1 were changed from to Xerosis and growth failure with immune and pulmonary dysfunction syndrome MIM#620510
Prepair 1000+ v1.2150 DBR1 Zornitza Stark Publications for gene: DBR1 were set to
Prepair 1000+ v1.2149 DBR1 Zornitza Stark Classified gene: DBR1 as Green List (high evidence)
Prepair 1000+ v1.2149 DBR1 Zornitza Stark Gene: dbr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2148 BRIP1 Zornitza Stark Phenotypes for gene: BRIP1 were changed from Fanconi Anaemia to Fanconi Anaemia, complementation group J, MIM# 609054
Prepair 1000+ v1.2147 BRIP1 Zornitza Stark Classified gene: BRIP1 as Red List (low evidence)
Prepair 1000+ v1.2147 BRIP1 Zornitza Stark Gene: brip1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2146 BRIP1 Zornitza Stark edited their review of gene: BRIP1: Added comment: Consider for inclusion in V3 together with all FA genes.; Changed rating: RED; Changed phenotypes: Fanconi Anaemia, complementation group J, MIM# 609054; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2146 MBTPS1 Zornitza Stark Tag for review was removed from gene: MBTPS1.
Repeat Disorders v0.170 RFC1_CANVAS_ AAGGG Bryony Thompson CANVAS was changed to RFC1_CANVAS_ AAGGG
Repeat Disorders v0.169 FOXL2_BPES_GCN Bryony Thompson BPES was changed to FOXL2_BPES_GCN
Prepair 1000+ v1.2146 ITGA3 Seb Lunke Tag for review was removed from gene: ITGA3.
Prepair 1000+ v1.2146 IGHM Seb Lunke Tag for review was removed from gene: IGHM.
Prepair 1000+ v1.2146 ERBB3 Seb Lunke Tag for review was removed from gene: ERBB3.
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Tag review was removed from gene: TSPYL1.
Prepair 1000+ v1.2146 TTN Seb Lunke Tag for review was removed from gene: TTN.
Prepair 1000+ v1.2146 CERKL Seb Lunke Tag for review was removed from gene: CERKL.
Prepair 1000+ v1.2146 CLN3 Seb Lunke Tag for review was removed from gene: CLN3.
Prepair 1000+ v1.2146 LRSAM1 Seb Lunke Tag for review was removed from gene: LRSAM1.
Prepair 1000+ v1.2146 NCF1 Seb Lunke Tag for review was removed from gene: NCF1.
Prepair 1000+ v1.2146 RARB Seb Lunke Tag for review was removed from gene: RARB.
Prepair 1000+ v1.2146 SLC9A3 Seb Lunke Tag for review was removed from gene: SLC9A3.
Prepair 1000+ v1.2146 FYCO1 Zornitza Stark Tag review was removed from gene: FYCO1.
Prepair 1000+ v1.2146 PRICKLE1 Seb Lunke Tag for review was removed from gene: PRICKLE1.
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Classified gene: TSPYL1 as Green List (high evidence)
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Added comment: Comment on list classification: Assessed, meets conditions as additional non-founder variants identified
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Gene: tspyl1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2145 B9D1 Zornitza Stark Tag for review was removed from gene: B9D1.
Prepair 1000+ v1.2145 ADPRHL2 Zornitza Stark Tag for review was removed from gene: ADPRHL2.
Prepair 1000+ v1.2145 ACY1 Zornitza Stark Tag for review was removed from gene: ACY1.
Prepair 1000+ v1.2145 PEX19 Lilian Downie Classified gene: PEX19 as Green List (high evidence)
Prepair 1000+ v1.2145 PEX19 Lilian Downie Gene: pex19 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2145 SCO1 Seb Lunke Classified gene: SCO1 as Green List (high evidence)
Prepair 1000+ v1.2145 SCO1 Seb Lunke Gene: sco1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Marked gene: PIEZO1 as ready
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2144 SCO1 Seb Lunke Tag for review was removed from gene: SCO1.
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Classified gene: PIEZO1 as Green List (high evidence)
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2143 PIEZO1 Zornitza Stark Tag for review was removed from gene: PIEZO1.
Prepair 1000+ v1.2143 PDHX Zornitza Stark Classified gene: PDHX as Green List (high evidence)
Prepair 1000+ v1.2143 PDHX Zornitza Stark Gene: pdhx has been classified as Green List (High Evidence).
Prepair 1000+ v1.2143 OTULIN Seb Lunke Classified gene: OTULIN as Green List (high evidence)
Prepair 1000+ v1.2143 OTULIN Seb Lunke Gene: otulin has been classified as Green List (High Evidence).
Prepair 1000+ v1.2142 PDHX Zornitza Stark Tag for review was removed from gene: PDHX.
Prepair 1000+ v1.2142 OTULIN Seb Lunke Tag for review was removed from gene: OTULIN.
Prepair 1000+ v1.2142 MTPAP Zornitza Stark Classified gene: MTPAP as Green List (high evidence)
Prepair 1000+ v1.2142 MTPAP Zornitza Stark Gene: mtpap has been classified as Green List (High Evidence).
Prepair 1000+ v1.2142 CHMP1A Lilian Downie Classified gene: CHMP1A as Green List (high evidence)
Prepair 1000+ v1.2142 CHMP1A Lilian Downie Gene: chmp1a has been classified as Green List (High Evidence).
Prepair 1000+ v1.2141 MTPAP Zornitza Stark Tag for review was removed from gene: MTPAP.
Prepair 1000+ v1.2141 CHMP1A Lilian Downie Tag for review was removed from gene: CHMP1A.
Prepair 1000+ v1.2141 APC2 Seb Lunke Classified gene: APC2 as Green List (high evidence)
Prepair 1000+ v1.2141 APC2 Seb Lunke Gene: apc2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2140 APC2 Seb Lunke Tag for review was removed from gene: APC2.
Prepair 1000+ v1.2140 AMN Zornitza Stark Marked gene: AMN as ready
Prepair 1000+ v1.2140 AMN Zornitza Stark Added comment: Comment when marking as ready: Treatable, relatively mild disorder, not suitable for inclusion on a reproductive carrier screen.
Prepair 1000+ v1.2140 AMN Zornitza Stark Gene: amn has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2140 AMN Zornitza Stark Classified gene: AMN as Red List (low evidence)
Prepair 1000+ v1.2140 AMN Zornitza Stark Gene: amn has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2139 AMN Zornitza Stark Tag for review was removed from gene: AMN.
Prepair 1000+ v1.2139 AGTR1 Zornitza Stark Classified gene: AGTR1 as Green List (high evidence)
Prepair 1000+ v1.2139 AGTR1 Zornitza Stark Gene: agtr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2138 YIF1B Seb Lunke Tag for review was removed from gene: YIF1B.
Prepair 1000+ v1.2138 YIF1B Seb Lunke Classified gene: YIF1B as Green List (high evidence)
Prepair 1000+ v1.2138 YIF1B Seb Lunke Gene: yif1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2137 AGTR1 Zornitza Stark Tag for review was removed from gene: AGTR1.
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Marked gene: UQCRC2 as ready
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Added comment: Comment when marking as ready: Borderline gene-disease association, keep Amber in the screening context.
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Gene: uqcrc2 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Publications for gene: UQCRC2 were set to
Prepair 1000+ v1.2136 UQCRC2 Zornitza Stark Classified gene: UQCRC2 as Amber List (moderate evidence)
Prepair 1000+ v1.2136 UQCRC2 Zornitza Stark Gene: uqcrc2 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2135 UQCRC2 Zornitza Stark Tag for review was removed from gene: UQCRC2.
Prepair 1000+ v1.2135 TRAPPC6B Seb Lunke Classified gene: TRAPPC6B as Green List (high evidence)
Prepair 1000+ v1.2135 TRAPPC6B Seb Lunke Gene: trappc6b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2134 TP53RK Lilian Downie Classified gene: TP53RK as Green List (high evidence)
Prepair 1000+ v1.2134 TP53RK Lilian Downie Gene: tp53rk has been classified as Green List (High Evidence).
Prepair 1000+ v1.2133 TRAPPC6B Seb Lunke Tag for review was removed from gene: TRAPPC6B.
Prepair 1000+ v1.2133 TP53RK Lilian Downie Tag for review was removed from gene: TP53RK.
Prepair 1000+ v1.2133 TPRKB Zornitza Stark Marked gene: TPRKB as ready
Prepair 1000+ v1.2133 TPRKB Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2133 TPRKB Zornitza Stark Publications for gene: TPRKB were set to 30053862; 28805828
Prepair 1000+ v1.2132 TPRKB Zornitza Stark Classified gene: TPRKB as Green List (high evidence)
Prepair 1000+ v1.2132 TPRKB Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2131 TPRKB Zornitza Stark Tag for review was removed from gene: TPRKB.
Prepair 1000+ v1.2131 TBC1D20 Lilian Downie Tag for review was removed from gene: TBC1D20.
Prepair 1000+ v1.2131 PKD1L1 Zornitza Stark Marked gene: PKD1L1 as ready
Prepair 1000+ v1.2131 PKD1L1 Zornitza Stark Gene: pkd1l1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2131 PKD1L1 Zornitza Stark Tag for review was removed from gene: PKD1L1.
Prepair 1000+ v1.2131 TBC1D20 Lilian Downie Classified gene: TBC1D20 as Green List (high evidence)
Prepair 1000+ v1.2131 TBC1D20 Lilian Downie Gene: tbc1d20 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2130 PKD1L1 Zornitza Stark reviewed gene: PKD1L1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Heterotaxy, visceral, 8, autosomal MIM#617205; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2130 MFRP Zornitza Stark Classified gene: MFRP as Green List (high evidence)
Prepair 1000+ v1.2130 MFRP Zornitza Stark Gene: mfrp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2129 MFRP Zornitza Stark Tag for review was removed from gene: MFRP.
Prepair 1000+ v1.2129 ITGA3 Lilian Downie Classified gene: ITGA3 as Green List (high evidence)
Prepair 1000+ v1.2129 ITGA3 Lilian Downie Gene: itga3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Marked gene: ISCA1 as ready
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Gene: isca1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Classified gene: ISCA1 as Green List (high evidence)
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Gene: isca1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2127 ISCA1 Zornitza Stark Tag for review was removed from gene: ISCA1.
Prepair 1000+ v1.2127 IMPG2 Zornitza Stark Marked gene: IMPG2 as ready
Prepair 1000+ v1.2127 IMPG2 Zornitza Stark Gene: impg2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2127 IMPG2 Zornitza Stark Publications for gene: IMPG2 were set to
Prepair 1000+ v1.2126 IMPG2 Zornitza Stark Classified gene: IMPG2 as Green List (high evidence)
Prepair 1000+ v1.2126 IMPG2 Zornitza Stark Gene: impg2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2125 IMPG2 Zornitza Stark Tag for review was removed from gene: IMPG2.
Prepair 1000+ v1.2125 HBA2 Seb Lunke Tag SV/CNV tag was added to gene: HBA2.
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Marked gene: HBA2 as ready
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Added comment: Comment when marking as ready: Discussed again: remains technically challenging therefore not suitable for inclusion. Other screening publicly available in pregnancy.
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Gene: hba2 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Tag for review was removed from gene: HBA2.
Prepair 1000+ v1.2125 HBA1 Seb Lunke Tag SV/CNV tag was added to gene: HBA1.
Prepair 1000+ v1.2125 HBA1 Zornitza Stark Marked gene: HBA1 as ready
Prepair 1000+ v1.2125 HBA1 Zornitza Stark Added comment: Comment when marking as ready: Discussed again: remains technically challenging therefore not suitable for inclusion. Other screening publicly available in pregnancy.
Prepair 1000+ v1.2125 HBA1 Zornitza Stark Gene: hba1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2125 GTPBP2 Lilian Downie Classified gene: GTPBP2 as Green List (high evidence)
Prepair 1000+ v1.2125 GTPBP2 Lilian Downie Gene: gtpbp2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2124 HBA1 Zornitza Stark Tag for review was removed from gene: HBA1.
Prepair 1000+ v1.2124 GTPBP2 Lilian Downie Tag for review was removed from gene: GTPBP2.
Prepair 1000+ v1.2124 IGHM Seb Lunke Classified gene: IGHM as Green List (high evidence)
Prepair 1000+ v1.2124 IGHM Seb Lunke Added comment: Comment on list classification: Caution: Gene has annotation issues due to lack of refseq transcript annotation and maybe missed by some analysis pipelines. Checked ok for prepair+
Prepair 1000+ v1.2124 IGHM Seb Lunke Gene: ighm has been classified as Green List (High Evidence).
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Marked gene: FITM2 as ready
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Classified gene: FITM2 as Green List (high evidence)
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2122 FITM2 Zornitza Stark Tag for review was removed from gene: FITM2.
Prepair 1000+ v1.2122 CSMD1 Lilian Downie Classified gene: CSMD1 as Green List (high evidence)
Prepair 1000+ v1.2122 CSMD1 Lilian Downie Gene: csmd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2121 CSMD1 Lilian Downie Tag for review was removed from gene: CSMD1.
Prepair 1000+ v1.2121 COG5 Zornitza Stark Classified gene: COG5 as Green List (high evidence)
Prepair 1000+ v1.2121 COG5 Zornitza Stark Gene: cog5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2120 COG5 Zornitza Stark Tag for review was removed from gene: COG5.
Prepair 1000+ v1.2120 CHM Zornitza Stark Marked gene: CHM as ready
Prepair 1000+ v1.2120 CHM Zornitza Stark Added comment: Comment when marking as ready: Not suitable for reproductive carrier screening.
Prepair 1000+ v1.2120 CHM Zornitza Stark Gene: chm has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2120 BCAP31 Lilian Downie Classified gene: BCAP31 as Green List (high evidence)
Prepair 1000+ v1.2120 BCAP31 Lilian Downie Gene: bcap31 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2119 BCAP31 Lilian Downie Tag for review was removed from gene: BCAP31.
Prepair 1000+ v1.2119 CHM Zornitza Stark Tag for review was removed from gene: CHM.
Prepair 1000+ v1.2119 ACY1 Zornitza Stark Classified gene: ACY1 as Green List (high evidence)
Prepair 1000+ v1.2119 ACY1 Zornitza Stark Gene: acy1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2118 TTN Zornitza Stark Phenotypes for gene: TTN were changed from Myopathy, early-onset, with fatal cardiomyopathy, 611705 (3) to TTN-related myopathy MONDO:0100175
Prepair 1000+ v1.2117 XPNPEP3 Lilian Downie Classified gene: XPNPEP3 as Green List (high evidence)
Prepair 1000+ v1.2117 XPNPEP3 Lilian Downie Gene: xpnpep3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2116 TTN Zornitza Stark Publications for gene: TTN were set to
Prepair 1000+ v1.2115 XPNPEP3 Lilian Downie Tag for review was removed from gene: XPNPEP3.
Prepair 1000+ v1.2115 TTN Zornitza Stark Classified gene: TTN as Green List (high evidence)
Prepair 1000+ v1.2115 TTN Zornitza Stark Gene: ttn has been classified as Green List (High Evidence).
Prepair 1000+ v1.2114 TTN Zornitza Stark reviewed gene: TTN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: TTN-related myopathy MONDO:0100175; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2114 TMEM94 Lilian Downie Classified gene: TMEM94 as Green List (high evidence)
Prepair 1000+ v1.2114 TMEM94 Lilian Downie Gene: tmem94 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2113 TMEM94 Lilian Downie Tag for review was removed from gene: TMEM94.
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Marked gene: POLA1 as ready
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Added comment: Comment when marking as ready: Inclusion assumes appropriate coverage by capture method (checked for Prepair+)
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Gene: pola1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Tag for review was removed from gene: POLA1.
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Classified gene: POLA1 as Green List (high evidence)
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Gene: pola1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2112 NTNG2 Lilian Downie Classified gene: NTNG2 as Green List (high evidence)
Prepair 1000+ v1.2112 NTNG2 Lilian Downie Gene: ntng2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2111 NTNG2 Lilian Downie Tag for review was removed from gene: NTNG2.
Prepair 1000+ v1.2111 NCF1 Zornitza Stark Marked gene: NCF1 as ready
Prepair 1000+ v1.2111 NCF1 Zornitza Stark Added comment: Comment when marking as ready: Remains technically challenging, therefore exclude from V2.
Prepair 1000+ v1.2111 NCF1 Zornitza Stark Gene: ncf1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2111 MOGS Lilian Downie Classified gene: MOGS as Green List (high evidence)
Prepair 1000+ v1.2111 MOGS Lilian Downie Gene: mogs has been classified as Green List (High Evidence).
Prepair 1000+ v1.2110 MOGS Lilian Downie Tag for review was removed from gene: MOGS.
Prepair 1000+ v1.2110 MBTPS1 Zornitza Stark Phenotypes for gene: MBTPS1 were changed from ?Spondyloepiphyseal dysplasia, Kondo-Fu type, MIM #618392 to Spondyloepiphyseal dysplasia, Kondo-Fu type MIM#618392
Prepair 1000+ v1.2109 MBTPS1 Zornitza Stark Classified gene: MBTPS1 as Green List (high evidence)
Prepair 1000+ v1.2109 MBTPS1 Zornitza Stark Gene: mbtps1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2108 DYNC1I2 Seb Lunke Classified gene: DYNC1I2 as Green List (high evidence)
Prepair 1000+ v1.2108 DYNC1I2 Seb Lunke Gene: dync1i2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2107 DYNC1I2 Seb Lunke Tag for review was removed from gene: DYNC1I2.
Prepair 1000+ v1.2107 ERBB3 Zornitza Stark Phenotypes for gene: ERBB3 were changed from Visceral neuropathy, familial, 1, autosomal recessive MIM#243180 to Visceral neuropathy, familial, 1, autosomal recessive MIM#243180; Lethal congenital contractural syndrome 2 MIM#607598
Prepair 1000+ v1.2106 CSTB Seb Lunke Tag for review was removed from gene: CSTB.
Prepair 1000+ v1.2106 ERBB3 Zornitza Stark Classified gene: ERBB3 as Green List (high evidence)
Prepair 1000+ v1.2106 ERBB3 Zornitza Stark Gene: erbb3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2105 CERKL Lilian Downie commented on gene: CERKL
Prepair 1000+ v1.2105 B9D1 Zornitza Stark Classified gene: B9D1 as Green List (high evidence)
Prepair 1000+ v1.2105 B9D1 Zornitza Stark Gene: b9d1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2104 ADPRHL2 Seb Lunke Classified gene: ADPRHL2 as Green List (high evidence)
Prepair 1000+ v1.2104 ADPRHL2 Seb Lunke Gene: adprhl2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Marked gene: VKORC1 as ready
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Added comment: Comment when marking as ready: Treatable condition, vast majority receive Vitamin K at birth; not in scope for panel.
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Gene: vkorc1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Phenotypes for gene: VKORC1 were changed from Vitamin K-dependent clotting factors, combined deficiency of, 2, 607473 (3) to Vitamin K-dependent clotting factors, combined deficiency of, 2, MIM#607473
Prepair 1000+ v1.2102 VKORC1 Zornitza Stark Publications for gene: VKORC1 were set to
Prepair 1000+ v1.2101 VKORC1 Zornitza Stark Classified gene: VKORC1 as Red List (low evidence)
Prepair 1000+ v1.2101 VKORC1 Zornitza Stark Gene: vkorc1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2100 RNU4ATAC Lilian Downie commented on gene: RNU4ATAC
Prepair 1000+ v1.2100 VKORC1 Zornitza Stark Tag for review was removed from gene: VKORC1.
Prepair 1000+ v1.2100 RNU4ATAC Lilian Downie Tag for review was removed from gene: RNU4ATAC.
Prepair 1000+ v1.2100 SURF1 Zornitza Stark Tag for review was removed from gene: SURF1.
Prepair 1000+ v1.2100 SLC9A3 Seb Lunke Classified gene: SLC9A3 as Amber List (moderate evidence)
Prepair 1000+ v1.2100 SLC9A3 Seb Lunke Gene: slc9a3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Marked gene: RCBTB1 as ready
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Added comment: Comment when marking as ready: Currently, onset appears to mostly in adulthood. Demote and review in the future re new reports with earlier onset.
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Gene: rcbtb1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Phenotypes for gene: RCBTB1 were changed from Retinal dystrophy with or without extraocular anomalies, 617175 (3), Autosomal recessive to Retinal dystrophy with or without extraocular anomalies (MIM#617175)
Prepair 1000+ v1.2098 RCBTB1 Zornitza Stark Publications for gene: RCBTB1 were set to
Prepair 1000+ v1.2097 RCBTB1 Zornitza Stark Classified gene: RCBTB1 as Amber List (moderate evidence)
Prepair 1000+ v1.2097 RCBTB1 Zornitza Stark Gene: rcbtb1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2096 RCBTB1 Zornitza Stark Tag for review was removed from gene: RCBTB1.
Prepair 1000+ v1.2096 RARB Seb Lunke Classified gene: RARB as Amber List (moderate evidence)
Prepair 1000+ v1.2096 RARB Seb Lunke Added comment: Comment on list classification: Insufficient evidence for recessive disease
Prepair 1000+ v1.2096 RARB Seb Lunke Gene: rarb has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2095 PRICKLE1 Zornitza Stark Marked gene: PRICKLE1 as ready
Prepair 1000+ v1.2095 PRICKLE1 Zornitza Stark Gene: prickle1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2095 PRICKLE1 Zornitza Stark Phenotypes for gene: PRICKLE1 were changed from Epilepsy, progressive myoclonic 1B, 612437 (3) to Epilepsy, progressive myoclonic 1B, MIM# 612437
Prepair 1000+ v1.2094 PRICKLE1 Zornitza Stark Classified gene: PRICKLE1 as Red List (low evidence)
Prepair 1000+ v1.2094 PRICKLE1 Zornitza Stark Gene: prickle1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2093 LRSAM1 Seb Lunke Classified gene: LRSAM1 as Amber List (moderate evidence)
Prepair 1000+ v1.2093 LRSAM1 Seb Lunke Added comment: Comment on list classification: Insufficient evidence for recessive
Prepair 1000+ v1.2093 LRSAM1 Seb Lunke Gene: lrsam1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2092 LIPC Zornitza Stark Marked gene: LIPC as ready
Prepair 1000+ v1.2092 LIPC Zornitza Stark Gene: lipc has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2092 LIPC Zornitza Stark Phenotypes for gene: LIPC were changed from Hepatic lipase deficiency, 614025 (3) to Hepatic lipase deficiency, MIM# 614025
Prepair 1000+ v1.2091 LIPC Zornitza Stark Tag for review was removed from gene: LIPC.
Prepair 1000+ v1.2091 LIPC Zornitza Stark Classified gene: LIPC as Red List (low evidence)
Prepair 1000+ v1.2091 LIPC Zornitza Stark Gene: lipc has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2090 LIPC Zornitza Stark edited their review of gene: LIPC: Changed rating: RED
Prepair 1000+ v1.2090 LCAT Lilian Downie Classified gene: LCAT as Red List (low evidence)
Prepair 1000+ v1.2090 LCAT Lilian Downie Added comment: Comment on list classification: Adult onset
Prepair 1000+ v1.2090 LCAT Lilian Downie Gene: lcat has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2089 LCAT Lilian Downie Tag for review was removed from gene: LCAT.
Prepair 1000+ v1.2089 HPD Zornitza Stark Tag for review was removed from gene: HPD.
Prepair 1000+ v1.2089 HBB Zornitza Stark Marked gene: HBB as ready
Prepair 1000+ v1.2089 HBB Zornitza Stark Gene: hbb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2089 HBB Zornitza Stark Phenotypes for gene: HBB were changed from Thalassemias, beta-, 613985 (3) to Thalassemias, beta-, 613985; Sickle cell anaemia, MIM# 603903
Prepair 1000+ v1.2088 CSTB Seb Lunke Tag STR tag was added to gene: CSTB.
Prepair 1000+ v1.2088 HBB Zornitza Stark Tag for review was removed from gene: HBB.
Prepair 1000+ v1.2088 GNE Lilian Downie Classified gene: GNE as Red List (low evidence)
Prepair 1000+ v1.2088 GNE Lilian Downie Added comment: Comment on list classification: Adult onset
Prepair 1000+ v1.2088 GNE Lilian Downie Gene: gne has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2087 GNE Lilian Downie Tag for review was removed from gene: GNE.
Prepair 1000+ v1.2087 CTSF Zornitza Stark Marked gene: CTSF as ready
Prepair 1000+ v1.2087 CTSF Zornitza Stark Added comment: Comment when marking as ready: Generally adult onset, out of scope for panel.
Prepair 1000+ v1.2087 CTSF Zornitza Stark Gene: ctsf has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2087 CSTB Seb Lunke Classified gene: CSTB as Amber List (moderate evidence)
Prepair 1000+ v1.2087 CSTB Seb Lunke Added comment: Comment on list classification: Common dodecamer repeat accounts for 90% of variants, not detectable
Prepair 1000+ v1.2087 CSTB Seb Lunke Gene: cstb has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2086 CTSF Zornitza Stark Tag for review was removed from gene: CTSF.
Prepair 1000+ v1.2086 CTSF Zornitza Stark Classified gene: CTSF as Red List (low evidence)
Prepair 1000+ v1.2086 CTSF Zornitza Stark Gene: ctsf has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Added comment: Comment when marking as ready: Downgrade to Amber until CNV analysis included.
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence)
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2084 CLCNKB Zornitza Stark Phenotypes for gene: CLCNKB were changed from Bartter syndrome, type 4b, digenic, 613090 (3) to Bartter syndrome, type 3 MIM#607364
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Marked gene: CLCNKB as ready
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Added comment: Comment when marking as ready: Digenic forms out of scope for this panel.
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Gene: clcnkb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Tag for review was removed from gene: CLCNKB.
Prepair 1000+ v1.2083 CCDC8 Zornitza Stark Tag for review was removed from gene: CCDC8.
Prepair 1000+ v1.2083 CHMP1A Zornitza Stark Tag for review tag was added to gene: CHMP1A.
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Marked gene: BRIP1 as ready
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Added comment: Comment when marking as ready: Other FA genes not included in panel.
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Gene: brip1 has been removed from the panel.
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Tag for review tag was added to gene: BRIP1.
Prepair 1000+ v1.2083 AMN Zornitza Stark Tag for review tag was added to gene: AMN.
Prepair 1000+ v1.2083 TRAPPC12 Zornitza Stark Marked gene: TRAPPC12 as ready
Prepair 1000+ v1.2083 TRAPPC12 Zornitza Stark Added comment: Comment when marking as ready: Upgrade to Green in V2.
Prepair 1000+ v1.2083 TRAPPC12 Zornitza Stark Gene: trappc12 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Marked gene: TBC1D20 as ready
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Added comment: Comment when marking as ready: Upgrade to Green in V2.
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Gene: tbc1d20 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Tag for review tag was added to gene: TBC1D20.
Prepair 1000+ v1.2083 OPN1LW Zornitza Stark Marked gene: OPN1LW as ready
Prepair 1000+ v1.2083 OPN1LW Zornitza Stark Gene: opn1lw has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2083 OPN1LW Zornitza Stark Publications for gene: OPN1LW were set to
Prepair 1000+ v1.2082 SLC39A4 Zornitza Stark Marked gene: SLC39A4 as ready
Prepair 1000+ v1.2082 SLC39A4 Zornitza Stark Gene: slc39a4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2082 SLC39A4 Zornitza Stark Phenotypes for gene: SLC39A4 were changed from Acrodermatitis enteropathica, 201100 (3) to Acrodermatitis enteropathica, MIM# 201100
Prepair 1000+ v1.2081 SLC39A4 Zornitza Stark Publications for gene: SLC39A4 were set to
Prepair 1000+ v1.2080 SLC39A4 Zornitza Stark reviewed gene: SLC39A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 19370757; Phenotypes: Acrodermatitis enteropathica, MIM# 201100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2080 SLC30A10 Zornitza Stark Marked gene: SLC30A10 as ready
Prepair 1000+ v1.2080 SLC30A10 Zornitza Stark Gene: slc30a10 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2080 SLC30A10 Zornitza Stark Phenotypes for gene: SLC30A10 were changed from Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280 (3) to Hypermanganesemia with dystonia 1, MIM#613280
Prepair 1000+ v1.2079 SLC30A10 Zornitza Stark Publications for gene: SLC30A10 were set to
Prepair 1000+ v1.2078 SLC12A5 Zornitza Stark Marked gene: SLC12A5 as ready
Prepair 1000+ v1.2078 SLC12A5 Zornitza Stark Gene: slc12a5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2078 SLC12A5 Zornitza Stark Phenotypes for gene: SLC12A5 were changed from Epileptic encephalopathy, early infantile, 34, 616645 (3), Autosomal recessive to Developmental and epileptic encephalopathy 34 MIM#616645
Prepair 1000+ v1.2077 SLC12A5 Zornitza Stark Publications for gene: SLC12A5 were set to
Prepair 1000+ v1.2076 SEC23B Zornitza Stark Marked gene: SEC23B as ready
Prepair 1000+ v1.2076 SEC23B Zornitza Stark Gene: sec23b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2076 SEC23B Zornitza Stark Phenotypes for gene: SEC23B were changed from Dyserythropoietic anemia, congenital, type II, 224100 (3) to Dyserythropoietic anaemia, congenital, type II MIM#224100
Prepair 1000+ v1.2075 SEC23B Zornitza Stark Publications for gene: SEC23B were set to
Prepair 1000+ v1.2074 SCNN1B Zornitza Stark Marked gene: SCNN1B as ready
Prepair 1000+ v1.2074 SCNN1B Zornitza Stark Gene: scnn1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2074 SCNN1B Zornitza Stark Phenotypes for gene: SCNN1B were changed from Pseudohypoaldosteronism, type I, 264350 (3) to Pseudohypoaldosteronism, type IB2, autosomal recessive, MIM#620125
Prepair 1000+ v1.2073 SCNN1B Zornitza Stark Publications for gene: SCNN1B were set to
Prepair 1000+ v1.2072 SCN9A Zornitza Stark Marked gene: SCN9A as ready
Prepair 1000+ v1.2072 SCN9A Zornitza Stark Gene: scn9a has been classified as Green List (High Evidence).
Prepair 1000+ v1.2072 SCN9A Zornitza Stark Phenotypes for gene: SCN9A were changed from Insensitivity to pain, congenital, 243000 (3) to Insensitivity to pain, congenital, MIM# 243000
Prepair 1000+ v1.2071 SCN9A Zornitza Stark Publications for gene: SCN9A were set to
Prepair 1000+ v1.2070 SAMHD1 Zornitza Stark Marked gene: SAMHD1 as ready
Prepair 1000+ v1.2070 SAMHD1 Zornitza Stark Gene: samhd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2070 SAMHD1 Zornitza Stark Phenotypes for gene: SAMHD1 were changed from Aicardi-Goutieres syndrome 5, 612952 (3) to Aicardi-Goutieres syndrome 5, MIM# 612952
Prepair 1000+ v1.2069 SAMHD1 Zornitza Stark reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2069 RRM2B Zornitza Stark Marked gene: RRM2B as ready
Prepair 1000+ v1.2069 RRM2B Zornitza Stark Gene: rrm2b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2069 RRM2B Zornitza Stark Phenotypes for gene: RRM2B were changed from Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy), 612075 (3) to Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075; Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075
Prepair 1000+ v1.2068 RRM2B Zornitza Stark reviewed gene: RRM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075, Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Pneumothorax v1.1 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease
Prepair 1000+ v1.2068 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Prepair 1000+ v1.2068 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2068 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow syndrome, autosomal recessive, 268310 (3) to Robinow syndrome, autosomal recessive MIM# 268310
Prepair 1000+ v1.2067 ROR2 Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2067 RNASET2 Zornitza Stark Marked gene: RNASET2 as ready
Prepair 1000+ v1.2067 RNASET2 Zornitza Stark Gene: rnaset2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2067 RNASET2 Zornitza Stark Phenotypes for gene: RNASET2 were changed from Leukoencephalopathy, cystic, without megalencephaly, 612951 (3) to Leukoencephalopathy, cystic, without megalencephaly MIM#612951
Prepair 1000+ v1.2066 RNASET2 Zornitza Stark Publications for gene: RNASET2 were set to
Prepair 1000+ v1.2065 RNASEH2A Zornitza Stark Marked gene: RNASEH2A as ready
Prepair 1000+ v1.2065 RNASEH2A Zornitza Stark Gene: rnaseh2a has been classified as Green List (High Evidence).
Prepair 1000+ v1.2065 RNASEH2A Zornitza Stark Phenotypes for gene: RNASEH2A were changed from Aicardi-Goutieres syndrome 4, 610333 (3) to Aicardi-Goutieres syndrome 4 MIM#610333; RNASEH2A-related type 1 interferonopathy MONDO:0700259
Prepair 1000+ v1.2064 RNASEH2A Zornitza Stark Publications for gene: RNASEH2A were set to
Prepair 1000+ v1.2063 RFX6 Zornitza Stark Marked gene: RFX6 as ready
Prepair 1000+ v1.2063 RFX6 Zornitza Stark Gene: rfx6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2063 RFX6 Zornitza Stark Phenotypes for gene: RFX6 were changed from Mitchell-Riley syndrome, 615710 (3) to Mitchell-Riley syndrome, MIM# 615710
Prepair 1000+ v1.2062 RFX6 Zornitza Stark reviewed gene: RFX6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitchell-Riley syndrome, MIM# 615710; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2062 RFT1 Zornitza Stark Marked gene: RFT1 as ready
Prepair 1000+ v1.2062 RFT1 Zornitza Stark Gene: rft1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2062 RFT1 Zornitza Stark Phenotypes for gene: RFT1 were changed from Congenital disorder of glycosylation, type In, 612015 (3) to Congenital disorder of glycosylation, type In, MIM# 612015
Prepair 1000+ v1.2061 RFT1 Zornitza Stark Publications for gene: RFT1 were set to
Prepair 1000+ v1.2060 RFT1 Zornitza Stark reviewed gene: RFT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18313027, 19701946, 19856127, 23111317, 30071302, 29923091, 27927990, 26892341; Phenotypes: Congenital disorder of glycosylation, type In, MIM# 612015; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2060 RD3 Zornitza Stark Marked gene: RD3 as ready
Prepair 1000+ v1.2060 RD3 Zornitza Stark Gene: rd3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2060 RD3 Zornitza Stark reviewed gene: RD3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leber congenital amaurosis 12, MIM#610612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2060 RARB Zornitza Stark Tag for review tag was added to gene: RARB.
Prepair 1000+ v1.2060 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Prepair 1000+ v1.2060 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2060 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from Severe combined immunodeficiency, B cell-negative, 601457 (3) to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Prepair 1000+ v1.2059 RAG1 Zornitza Stark reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2059 PYCR1 Zornitza Stark Marked gene: PYCR1 as ready
Prepair 1000+ v1.2059 PYCR1 Zornitza Stark Gene: pycr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2059 PYCR1 Zornitza Stark Phenotypes for gene: PYCR1 were changed from Cutis laxa, autosomal recessive, type IIB, 612940 (3) to Cutis laxa, autosomal recessive, type IIB MIM#612940; Cutis laxa, autosomal recessive, type IIIB MIM#614438
Prepair 1000+ v1.2058 PYCR1 Zornitza Stark reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cutis laxa, autosomal recessive, type IIB MIM#612940, Cutis laxa, autosomal recessive, type IIIB MIM#614438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2058 PSMB8 Zornitza Stark Marked gene: PSMB8 as ready
Prepair 1000+ v1.2058 PSMB8 Zornitza Stark Gene: psmb8 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2058 PSMB8 Zornitza Stark Phenotypes for gene: PSMB8 were changed from Autoinflammation, lipodystrophy, and dermatosis syndrome, 256040 (3) to Proteasome-associated autoinflammatory syndrome 1, MIM# 256040; MONDO:0054698
Prepair 1000+ v1.2057 PSMB8 Zornitza Stark Publications for gene: PSMB8 were set to
Prepair 1000+ v1.2056 PSMB8 Zornitza Stark reviewed gene: PSMB8: Rating: GREEN; Mode of pathogenicity: None; Publications: 21129723, 21881205, 21852578, 21953331; Phenotypes: Proteasome-associated autoinflammatory syndrome 1, MIM# 256040, MONDO:0054698; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2056 PROS1 Zornitza Stark Marked gene: PROS1 as ready
Prepair 1000+ v1.2056 PROS1 Zornitza Stark Gene: pros1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2056 PROS1 Zornitza Stark Phenotypes for gene: PROS1 were changed from Thrombophilia due to protein S deficiency, autosomal recessive, 614514 (3) to Thrombophilia 5 due to protein S deficiency, autosomal recessive #614514
Prepair 1000+ v1.2055 PROS1 Zornitza Stark reviewed gene: PROS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thrombophilia 5 due to protein S deficiency, autosomal recessive #614514; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2055 PPIB Zornitza Stark Marked gene: PPIB as ready
Prepair 1000+ v1.2055 PPIB Zornitza Stark Gene: ppib has been classified as Green List (High Evidence).
Prepair 1000+ v1.2055 PPIB Zornitza Stark Phenotypes for gene: PPIB were changed from Osteogenesis imperfecta, type IX, #259440 to Osteogenesis imperfecta, type IX MIM#259440
Prepair 1000+ v1.2054 PPIB Zornitza Stark Publications for gene: PPIB were set to
Prepair 1000+ v1.2053 POMT2 Zornitza Stark Marked gene: POMT2 as ready
Prepair 1000+ v1.2053 POMT2 Zornitza Stark Gene: pomt2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2053 POMT2 Zornitza Stark Phenotypes for gene: POMT2 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, 613150 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, MIM# 613150; Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 2, MIM# 613156
Prepair 1000+ v1.2052 POMT2 Zornitza Stark Publications for gene: POMT2 were set to
Prepair 1000+ v1.2051 POLG Zornitza Stark Marked gene: POLG as ready
Prepair 1000+ v1.2051 POLG Zornitza Stark Gene: polg has been classified as Green List (High Evidence).
Prepair 1000+ v1.2051 POLG Zornitza Stark Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type), 203700 (3) to Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662
Prepair 1000+ v1.2050 POLG Zornitza Stark reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700, Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2050 PNPLA6 Zornitza Stark Marked gene: PNPLA6 as ready
Prepair 1000+ v1.2050 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2050 PNPLA6 Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Boucher-Neuhauser syndrome, 215470 (3) to Boucher-Neuhauser syndrome MIM#215470; Oliver-McFarlane syndrome MIM#275400; Spastic paraplegia 39, autosomal recessive MIM#612020
Prepair 1000+ v1.2049 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to
Prepair 1000+ v1.2048 PNP Zornitza Stark Marked gene: PNP as ready
Prepair 1000+ v1.2048 PNP Zornitza Stark Gene: pnp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2048 PNP Zornitza Stark Publications for gene: PNP were set to
Prepair 1000+ v1.2047 PNP Zornitza Stark edited their review of gene: PNP: Changed publications: 3029074, 1384322, 11453975, 32695102, 32514656
Prepair 1000+ v1.2047 PNP Zornitza Stark Phenotypes for gene: PNP were changed from Immunodeficiency due to purine nucleoside phosphorylase deficiency, 613179 (3) to Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179
Prepair 1000+ v1.2046 PNP Zornitza Stark reviewed gene: PNP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2046 PHF6 Zornitza Stark Marked gene: PHF6 as ready
Prepair 1000+ v1.2046 PHF6 Zornitza Stark Gene: phf6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2046 PHF6 Zornitza Stark Phenotypes for gene: PHF6 were changed from Borjeson-Forssman-Lehmann syndrome, 301900 (3) to Borjeson-Forssman-Lehmann syndrome, MIM# 301900
Prepair 1000+ v1.2045 PHF6 Zornitza Stark reviewed gene: PHF6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Borjeson-Forssman-Lehmann syndrome, MIM# 301900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.2045 PET100 Zornitza Stark Marked gene: PET100 as ready
Prepair 1000+ v1.2045 PET100 Zornitza Stark Gene: pet100 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2045 PET100 Zornitza Stark Phenotypes for gene: PET100 were changed from Mitochondrial complex IV deficiency, 220110 (3) to Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055
Prepair 1000+ v1.2044 PET100 Zornitza Stark reviewed gene: PET100: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2044 PDP1 Zornitza Stark Marked gene: PDP1 as ready
Prepair 1000+ v1.2044 PDP1 Zornitza Stark Gene: pdp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2044 PDP1 Zornitza Stark Phenotypes for gene: PDP1 were changed from Pyruvate dehydrogenase phosphatase deficiency, 608782 (3) to Pyruvate dehydrogenase phosphatase deficiency,MIM#608782
Prepair 1000+ v1.2043 PDP1 Zornitza Stark Publications for gene: PDP1 were set to
Prepair 1000+ v1.2042 PCSK1 Zornitza Stark Marked gene: PCSK1 as ready
Prepair 1000+ v1.2042 PCSK1 Zornitza Stark Gene: pcsk1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2042 PCSK1 Zornitza Stark Phenotypes for gene: PCSK1 were changed from Obesity with impaired prohormone processing, 600955 (3) to Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955
Prepair 1000+ v1.2041 PCSK1 Zornitza Stark Publications for gene: PCSK1 were set to
Prepair 1000+ v1.2040 PCCA Zornitza Stark Marked gene: PCCA as ready
Prepair 1000+ v1.2040 PCCA Zornitza Stark Gene: pcca has been classified as Green List (High Evidence).
Prepair 1000+ v1.2040 PCCA Zornitza Stark Phenotypes for gene: PCCA were changed from Propionicacidemia, 606054 (3) to Propionicacidemia, MIM#606054
Prepair 1000+ v1.2039 PCCA Zornitza Stark Publications for gene: PCCA were set to
Prepair 1000+ v1.2038 PAK3 Zornitza Stark Marked gene: PAK3 as ready
Prepair 1000+ v1.2038 PAK3 Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2038 PAK3 Zornitza Stark Phenotypes for gene: PAK3 were changed from Mental retardation, X-linked 30/47, 300558 (3) to Intellectual developmental disorder, X-linked 30 MIM#300558
Prepair 1000+ v1.2037 PAK3 Zornitza Stark Publications for gene: PAK3 were set to
Prepair 1000+ v1.2036 PAH Zornitza Stark Marked gene: PAH as ready
Prepair 1000+ v1.2036 PAH Zornitza Stark Gene: pah has been classified as Green List (High Evidence).
Prepair 1000+ v1.2036 PAH Zornitza Stark Phenotypes for gene: PAH were changed from Phenylketonuria, 261600 (3) to Phenylketonuria, MIM#261600
Prepair 1000+ v1.2035 PAH Zornitza Stark Publications for gene: PAH were set to
Prepair 1000+ v1.2034 OTUD6B Zornitza Stark Marked gene: OTUD6B as ready
Prepair 1000+ v1.2034 OTUD6B Zornitza Stark Gene: otud6b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2034 OTUD6B Zornitza Stark Phenotypes for gene: OTUD6B were changed from Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, 617452 (3), Autosomal recessive to Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies,MIM#617452
Prepair 1000+ v1.2033 OTUD6B Zornitza Stark Publications for gene: OTUD6B were set to
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Marked gene: LRSAM1 as ready
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Added comment: Comment when marking as ready: Only single AR family reported, insufficient evidence, downgrade to RED
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Gene: lrsam1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Publications for gene: LRSAM1 were set to
Prepair 1000+ v1.2031 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Prepair 1000+ v1.2031 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Prepair 1000+ v1.2031 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from Galloway-Mowat syndrome 3, 617729 (3), Autosomal recessive to Galloway-Mowat syndrome 3, MIM# 617729
Prepair 1000+ v1.2030 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Prepair 1000+ v1.2029 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2029 OPA1 Zornitza Stark Marked gene: OPA1 as ready
Prepair 1000+ v1.2029 OPA1 Zornitza Stark Gene: opa1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2029 OPA1 Zornitza Stark Phenotypes for gene: OPA1 were changed from Behr syndrome, 210000 (3), Autosomal recessive to Behr syndrome, MIM#210000
Prepair 1000+ v1.2028 OPA1 Zornitza Stark Publications for gene: OPA1 were set to
Prepair 1000+ v1.2027 PUS7 Lilian Downie Marked gene: PUS7 as ready
Prepair 1000+ v1.2027 PUS7 Lilian Downie Added comment: Comment when marking as ready: Upgrade to green
Prepair 1000+ v1.2027 PUS7 Lilian Downie Gene: pus7 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2027 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Prepair 1000+ v1.2027 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2027 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from Nephrotic syndrome, type 11, 616730 (3), Autosomal recessive to Galloway-Mowat syndrome 7, MIM#618348; Nephrotic syndrome, type 11, MIM#616730
Prepair 1000+ v1.2026 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Prepair 1000+ v1.2025 NUBPL Zornitza Stark Marked gene: NUBPL as ready
Prepair 1000+ v1.2025 NUBPL Zornitza Stark Gene: nubpl has been classified as Green List (High Evidence).
Prepair 1000+ v1.2025 NUBPL Zornitza Stark Phenotypes for gene: NUBPL were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 21, MIM#618242
Prepair 1000+ v1.2024 NUBPL Zornitza Stark Publications for gene: NUBPL were set to
Prepair 1000+ v1.2023 NR0B1 Zornitza Stark Marked gene: NR0B1 as ready
Prepair 1000+ v1.2023 NR0B1 Zornitza Stark Gene: nr0b1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2023 NR0B1 Zornitza Stark Phenotypes for gene: NR0B1 were changed from 46XY sex reversal 2, dosage-sensitive, 300018 (3) to Adrenal hypoplasia, congenital, MIM#300200
Prepair 1000+ v1.2022 NR0B1 Zornitza Stark Publications for gene: NR0B1 were set to
Prepair 1000+ v1.2021 NDUFV2 Zornitza Stark Marked gene: NDUFV2 as ready
Prepair 1000+ v1.2021 NDUFV2 Zornitza Stark Gene: ndufv2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2021 NDUFV2 Zornitza Stark Phenotypes for gene: NDUFV2 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 7, MIM#618229, MONDO:0044970
Prepair 1000+ v1.2020 NDUFV2 Zornitza Stark Publications for gene: NDUFV2 were set to
Prepair 1000+ v1.2019 NDUFS4 Zornitza Stark Marked gene: NDUFS4 as ready
Prepair 1000+ v1.2019 NDUFS4 Zornitza Stark Gene: ndufs4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2019 NDUFS4 Zornitza Stark Phenotypes for gene: NDUFS4 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 1, MIM#252010
Prepair 1000+ v1.2018 NCF1 Lilian Downie Tag for review tag was added to gene: NCF1.
Prepair 1000+ v1.2018 NDP Zornitza Stark Marked gene: NDP as ready
Prepair 1000+ v1.2018 NDP Zornitza Stark Gene: ndp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2018 NDP Zornitza Stark Phenotypes for gene: NDP were changed from Norrie disease, 310600 (3) to Norrie disease, MIM#310600
Prepair 1000+ v1.2017 NDP Zornitza Stark Publications for gene: NDP were set to
Prepair 1000+ v1.2016 NDE1 Zornitza Stark Marked gene: NDE1 as ready
Prepair 1000+ v1.2016 NDE1 Zornitza Stark Gene: nde1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2016 NDE1 Zornitza Stark Phenotypes for gene: NDE1 were changed from Lissencephaly 4 (with microcephaly), 614019 (3) to Lissencephaly 4 (with microcephaly), MIM#614019
Prepair 1000+ v1.2015 NDE1 Zornitza Stark Publications for gene: NDE1 were set to
Prepair 1000+ v1.2014 NCF2 Zornitza Stark Marked gene: NCF2 as ready
Prepair 1000+ v1.2014 NCF2 Zornitza Stark Gene: ncf2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2014 NCF2 Zornitza Stark Phenotypes for gene: NCF2 were changed from Chronic granulomatous disease due to deficiency of NCF-2, 233710 (3) to Chronic granulomatous disease 2, autosomal recessive, MIM# 233710
Prepair 1000+ v1.2013 NCF2 Zornitza Stark Publications for gene: NCF2 were set to
Prepair 1000+ v1.2012 NAGA Zornitza Stark Marked gene: NAGA as ready
Prepair 1000+ v1.2012 NAGA Zornitza Stark Gene: naga has been classified as Green List (High Evidence).
Prepair 1000+ v1.2012 NAGA Zornitza Stark Phenotypes for gene: NAGA were changed from Schindler disease, type I, 609241 (3) to Schindler disease, type I MIM#609241; Schindler disease, type III MIM#609241
Prepair 1000+ v1.2011 NAGA Zornitza Stark Publications for gene: NAGA were set to
Prepair 1000+ v1.2010 PDE6B Lilian Downie Marked gene: PDE6B as ready
Prepair 1000+ v1.2010 PDE6B Lilian Downie Gene: pde6b has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2010 MYD88 Zornitza Stark Marked gene: MYD88 as ready
Prepair 1000+ v1.2010 MYD88 Zornitza Stark Gene: myd88 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2010 PDE6B Lilian Downie Publications for gene: PDE6B were set to
Prepair 1000+ v1.2009 MYD88 Zornitza Stark Phenotypes for gene: MYD88 were changed from Pyogenic bacterial infections, recurrent, due to MYD88 deficiency, 612260 (3) to Immunodeficiency 68, MIM# 612260
Prepair 1000+ v1.2008 MYD88 Zornitza Stark Publications for gene: MYD88 were set to
Prepair 1000+ v1.2007 MUSK Zornitza Stark Marked gene: MUSK as ready
Prepair 1000+ v1.2007 MUSK Zornitza Stark Gene: musk has been classified as Green List (High Evidence).
Prepair 1000+ v1.2007 MUSK Zornitza Stark Phenotypes for gene: MUSK were changed from Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, 616325 (3) to Fetal akinesia deformation sequence 1 MIM#208150; Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency MIM#616325
Prepair 1000+ v1.2006 MUSK Zornitza Stark Publications for gene: MUSK were set to
Prepair 1000+ v1.2005 GBA Lilian Downie Marked gene: GBA as ready
Prepair 1000+ v1.2005 GBA Lilian Downie Added comment: Comment when marking as ready: Consider upgrading to green as most common variant detectable and suitable disease for inclusion.
Prepair 1000+ v1.2005 GBA Lilian Downie Gene: gba has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2005 CHMP1A Lilian Downie Marked gene: CHMP1A as ready
Prepair 1000+ v1.2005 CHMP1A Lilian Downie Added comment: Comment when marking as ready: Inclusion, green on PanelApp and severe childhood disease
Prepair 1000+ v1.2005 CHMP1A Lilian Downie Gene: chmp1a has been removed from the panel.
Prepair 1000+ v1.2005 MTTP Zornitza Stark Marked gene: MTTP as ready
Prepair 1000+ v1.2005 MTTP Zornitza Stark Gene: mttp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2005 MTTP Zornitza Stark Phenotypes for gene: MTTP were changed from Abetalipoproteinemia, 200100 (3) to Abetalipoproteinemia MIM#200100
Prepair 1000+ v1.2004 MTTP Zornitza Stark Publications for gene: MTTP were set to
Prepair 1000+ v1.2003 MTHFD1 Zornitza Stark Marked gene: MTHFD1 as ready
Prepair 1000+ v1.2003 MTHFD1 Zornitza Stark Gene: mthfd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2003 MTHFD1 Zornitza Stark Phenotypes for gene: MTHFD1 were changed from Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia, 617780 (3), Autosomal recessive to Combined immunodeficiency and megaloblastic anaemia with or without hyperhomocysteinemia, 617780 (3), Autosomal recessive
Prepair 1000+ v1.2002 MTHFD1 Zornitza Stark Publications for gene: MTHFD1 were set to
Prepair 1000+ v1.2001 MSTO1 Zornitza Stark Marked gene: MSTO1 as ready
Prepair 1000+ v1.2001 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2001 MSTO1 Zornitza Stark Publications for gene: MSTO1 were set to 30684668; 31463572
Prepair 1000+ v1.2000 MMP2 Zornitza Stark Marked gene: MMP2 as ready
Prepair 1000+ v1.2000 MMP2 Zornitza Stark Gene: mmp2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2000 MMP2 Zornitza Stark Phenotypes for gene: MMP2 were changed from Multicentric osteolysis, nodulosis, and arthropathy, 259600 (3) to Multicentric osteolysis, nodulosis, and arthropathy, MIM#259600
Prepair 1000+ v1.1999 MMP2 Zornitza Stark Publications for gene: MMP2 were set to
Prepair 1000+ v1.1998 MLC1 Zornitza Stark Marked gene: MLC1 as ready
Prepair 1000+ v1.1998 MLC1 Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1998 MLC1 Zornitza Stark Phenotypes for gene: MLC1 were changed from Megalencephalic leukoencephalopathy with subcortical cysts, 604004 (3) to Megalencephalic leukoencephalopathy with subcortical cysts 1, MIM #604004
Prepair 1000+ v1.1997 MLC1 Zornitza Stark Publications for gene: MLC1 were set to
Prepair 1000+ v1.1996 MKS1 Zornitza Stark Marked gene: MKS1 as ready
Prepair 1000+ v1.1996 MKS1 Zornitza Stark Gene: mks1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1996 MKS1 Zornitza Stark Phenotypes for gene: MKS1 were changed from Meckel syndrome 1, 249000 (3) to Bardet-Biedl syndrome 13 MIM#615990; Joubert syndrome 28 MIM#617121; Meckel syndrome 1 MIM#249000; Ciliopathy MONDO:0005308
Prepair 1000+ v1.1995 MKS1 Zornitza Stark Publications for gene: MKS1 were set to
Prepair 1000+ v1.1994 MICU1 Zornitza Stark Marked gene: MICU1 as ready
Prepair 1000+ v1.1994 MICU1 Zornitza Stark Gene: micu1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1994 MICU1 Zornitza Stark Phenotypes for gene: MICU1 were changed from Myopathy with extrapyramidal signs, 615673 (3) to Myopathy with extrapyramidal signs, MIM# 615673
Prepair 1000+ v1.1993 MICU1 Zornitza Stark Publications for gene: MICU1 were set to
Prepair 1000+ v1.1992 MFN2 Zornitza Stark Marked gene: MFN2 as ready
Prepair 1000+ v1.1992 MFN2 Zornitza Stark Gene: mfn2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1992 MFN2 Zornitza Stark Phenotypes for gene: MFN2 were changed from Charcot-Marie-Tooth disease, axonal, type 2A2B, 617087 (3), Autosomal recessive to Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087; Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800
Prepair 1000+ v1.1991 MFN2 Zornitza Stark reviewed gene: MFN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1991 MFN2 Zornitza Stark Publications for gene: MFN2 were set to
Prepair 1000+ v1.1990 METTL23 Zornitza Stark Marked gene: METTL23 as ready
Prepair 1000+ v1.1990 METTL23 Zornitza Stark Gene: mettl23 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1990 METTL23 Zornitza Stark Phenotypes for gene: METTL23 were changed from Mental retardation, autosomal recessive 44, 615942 (3) to Intellectual developmental disorder, autosomal recessive 44, MIM #615942
Prepair 1000+ v1.1989 METTL23 Zornitza Stark Publications for gene: METTL23 were set to
Prepair 1000+ v1.1988 MEGF10 Zornitza Stark Marked gene: MEGF10 as ready
Prepair 1000+ v1.1988 MEGF10 Zornitza Stark Gene: megf10 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1988 MEGF10 Zornitza Stark Phenotypes for gene: MEGF10 were changed from Myopathy, areflexia, respiratory distress, and dysphagia, early-onset, 614399 (3) to Congenital myopathy 10A, severe variant, MIM #614399; Congenital myopathy 10B, mild variant, MIM #620249
Prepair 1000+ v1.1987 MEGF10 Zornitza Stark Publications for gene: MEGF10 were set to
Prepair 1000+ v1.1986 MED12 Zornitza Stark Marked gene: MED12 as ready
Prepair 1000+ v1.1986 MED12 Zornitza Stark Gene: med12 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1986 MED12 Zornitza Stark Phenotypes for gene: MED12 were changed from Lujan-Fryns syndrome, 309520 (3) to MED12-related intellectual disability syndrome, MONDO:0100000
Prepair 1000+ v1.1985 MED12 Zornitza Stark Publications for gene: MED12 were set to
Prepair 1000+ v1.1984 MBTPS2 Zornitza Stark Marked gene: MBTPS2 as ready
Prepair 1000+ v1.1984 MBTPS2 Zornitza Stark Gene: mbtps2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1984 MBTPS2 Zornitza Stark Phenotypes for gene: MBTPS2 were changed from IFAP syndrome with or without BRESHECK syndrome, 308205 (3) to IFAP syndrome with or without BRESHECK syndrome MIM#308205; Osteogenesis imperfecta, type XIX MIM#301014
Prepair 1000+ v1.1983 MBTPS2 Zornitza Stark Publications for gene: MBTPS2 were set to
Prepair 1000+ v1.1982 MAPKBP1 Zornitza Stark Marked gene: MAPKBP1 as ready
Prepair 1000+ v1.1982 MAPKBP1 Zornitza Stark Gene: mapkbp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1982 MAPKBP1 Zornitza Stark Phenotypes for gene: MAPKBP1 were changed from Nephronophthisis 20, 617271 (3), Autosomal recessive to Nephronophthisis 20, MIM# 617271; MONDO:0014997
Prepair 1000+ v1.1981 MAPKBP1 Zornitza Stark Publications for gene: MAPKBP1 were set to
Prepair 1000+ v1.1980 LYST Zornitza Stark Marked gene: LYST as ready
Prepair 1000+ v1.1980 LYST Zornitza Stark Gene: lyst has been classified as Green List (High Evidence).
Prepair 1000+ v1.1980 LYST Zornitza Stark Phenotypes for gene: LYST were changed from Chediak-Higashi syndrome, 214500 (3) to Chediak-Higashi syndrome MIM#214500
Prepair 1000+ v1.1979 LYST Zornitza Stark Publications for gene: LYST were set to
Prepair 1000+ v1.1978 LRMDA Zornitza Stark Marked gene: LRMDA as ready
Prepair 1000+ v1.1978 LRMDA Zornitza Stark Gene: lrmda has been classified as Green List (High Evidence).
Prepair 1000+ v1.1978 LRMDA Zornitza Stark Phenotypes for gene: LRMDA were changed from Albinism, oculocutaneous, type VII, 615179 (3) to Albinism, oculocutaneous, type VII MIM#615179; MONDO:0014070
Prepair 1000+ v1.1977 LRMDA Zornitza Stark Publications for gene: LRMDA were set to
Prepair 1000+ v1.1976 LRAT Zornitza Stark Marked gene: LRAT as ready
Prepair 1000+ v1.1976 LRAT Zornitza Stark Gene: lrat has been classified as Green List (High Evidence).
Prepair 1000+ v1.1976 LRAT Zornitza Stark Phenotypes for gene: LRAT were changed from Leber congenital amaurosis 14, 613341 (3) to Retinal dystrophy, early-onset severe; Leber congenital amaurosis 14; Retinitis pigmentosa, juvenile, all under MIM #613341
Prepair 1000+ v1.1975 LRAT Zornitza Stark Publications for gene: LRAT were set to
Prepair 1000+ v1.1974 LONP1 Zornitza Stark Marked gene: LONP1 as ready
Prepair 1000+ v1.1974 LONP1 Zornitza Stark Gene: lonp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1974 LONP1 Zornitza Stark Phenotypes for gene: LONP1 were changed from CODAS syndrome, 600373 (3) to CODAS syndrome, MIM#600373
Prepair 1000+ v1.1973 LONP1 Zornitza Stark Publications for gene: LONP1 were set to
Prepair 1000+ v1.1972 LMOD3 Zornitza Stark Marked gene: LMOD3 as ready
Prepair 1000+ v1.1972 LMOD3 Zornitza Stark Gene: lmod3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1972 LMOD3 Zornitza Stark Phenotypes for gene: LMOD3 were changed from Nemaline myopathy 10, 616165 (3) to Nemaline myopathy 10, MIM#616165
Prepair 1000+ v1.1971 LMOD3 Zornitza Stark Publications for gene: LMOD3 were set to
Prepair 1000+ v1.1970 LIPC Zornitza Stark Tag for review tag was added to gene: LIPC.
Prepair 1000+ v1.1970 LIPC Zornitza Stark reviewed gene: LIPC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hepatic lipase deficiency, MIM# 614025; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1970 LARS2 Zornitza Stark Marked gene: LARS2 as ready
Prepair 1000+ v1.1970 LARS2 Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1970 LARS2 Zornitza Stark Phenotypes for gene: LARS2 were changed from Perrault syndrome 4, 615300 (3) to Hydrops, lactic acidosis, and sideroblastic anaemia MIM#617021; Perrault syndrome 4 MIM#615300
Prepair 1000+ v1.1969 LARS2 Zornitza Stark Publications for gene: LARS2 were set to
Prepair 1000+ v1.1968 LAMB2 Zornitza Stark Marked gene: LAMB2 as ready
Prepair 1000+ v1.1968 LAMB2 Zornitza Stark Gene: lamb2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1968 LAMB2 Zornitza Stark Phenotypes for gene: LAMB2 were changed from Pierson syndrome, 609049 (3) to Pierson syndrome, MIM# 609049; Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199
Prepair 1000+ v1.1967 LAMB2 Zornitza Stark reviewed gene: LAMB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pierson syndrome, MIM# 609049, Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1967 SLC7A7 Lilian Downie Marked gene: SLC7A7 as ready
Prepair 1000+ v1.1967 SLC7A7 Lilian Downie Gene: slc7a7 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1967 SLC7A7 Lilian Downie Publications for gene: SLC7A7 were set to
Prepair 1000+ v1.1966 STIM1 Lilian Downie Marked gene: STIM1 as ready
Prepair 1000+ v1.1966 STIM1 Lilian Downie Gene: stim1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1966 STIM1 Lilian Downie Publications for gene: STIM1 were set to
Prepair 1000+ v1.1965 TOE1 Lilian Downie Marked gene: TOE1 as ready
Prepair 1000+ v1.1965 TOE1 Lilian Downie Gene: toe1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1965 TOE1 Lilian Downie Phenotypes for gene: TOE1 were changed from Pontocerebellar hypoplasia, type 7, 614969 (3), Autosomal recessive to Pontocerebellar hypoplasia, type 7 MIM#614969
Prepair 1000+ v1.1964 TOE1 Lilian Downie Publications for gene: TOE1 were set to
Prepair 1000+ v1.1963 TPP1 Lilian Downie Marked gene: TPP1 as ready
Prepair 1000+ v1.1963 TPP1 Lilian Downie Gene: tpp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1963 TPP1 Lilian Downie Phenotypes for gene: TPP1 were changed from Ceroid lipofuscinosis, neuronal, 2, 204500 (3) to Ceroid lipofuscinosis, neuronal, 2 MIM#204500; Spinocerebellar ataxia, autosomal recessive 7 MIM#609270
Prepair 1000+ v1.1962 TPP1 Lilian Downie Publications for gene: TPP1 were set to
Prepair 1000+ v1.1961 TRAPPC11 Lilian Downie Marked gene: TRAPPC11 as ready
Prepair 1000+ v1.1961 TRAPPC11 Lilian Downie Gene: trappc11 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1961 TRAPPC11 Lilian Downie Publications for gene: TRAPPC11 were set to
Prepair 1000+ v1.1960 TRMT10A Lilian Downie Marked gene: TRMT10A as ready
Prepair 1000+ v1.1960 TRMT10A Lilian Downie Gene: trmt10a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1960 TRMT10A Lilian Downie Publications for gene: TRMT10A were set to
Prepair 1000+ v1.1959 UBE3B Lilian Downie Marked gene: UBE3B as ready
Prepair 1000+ v1.1959 UBE3B Lilian Downie Gene: ube3b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1959 UBE3B Lilian Downie Publications for gene: UBE3B were set to
Prepair 1000+ v1.1958 USH1G Lilian Downie Marked gene: USH1G as ready
Prepair 1000+ v1.1958 USH1G Lilian Downie Gene: ush1g has been classified as Green List (High Evidence).
Prepair 1000+ v1.1958 USH1G Lilian Downie Publications for gene: USH1G were set to
Prepair 1000+ v1.1957 VIPAS39 Lilian Downie Marked gene: VIPAS39 as ready
Prepair 1000+ v1.1957 VIPAS39 Lilian Downie Gene: vipas39 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1957 VIPAS39 Lilian Downie Publications for gene: VIPAS39 were set to
Prepair 1000+ v1.1956 VKORC1 Lilian Downie Marked gene: VKORC1 as ready
Prepair 1000+ v1.1956 VKORC1 Lilian Downie Added comment: Comment when marking as ready: Single homozygous missense variant, Arg98Trp reported to cause the AR phenotype (PMID: 12704386). (ClinGen 2023) This phenotype causes intracranial haemmorhage in the first weeks of life and ongoing bleeding predisposition but this is reversed with vit K administration so highly treatable.
Prepair 1000+ v1.1956 VKORC1 Lilian Downie Gene: vkorc1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1956 XRCC4 Lilian Downie Marked gene: XRCC4 as ready
Prepair 1000+ v1.1956 XRCC4 Lilian Downie Gene: xrcc4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1956 XRCC4 Lilian Downie Phenotypes for gene: XRCC4 were changed from Short stature, microcephaly, and endocrine dysfunction, 616541 (3), Autosomal recessive to Short stature, microcephaly, and endocrine dysfunction MIM#616541
Prepair 1000+ v1.1955 XRCC4 Lilian Downie Publications for gene: XRCC4 were set to
Prepair 1000+ v1.1954 XYLT2 Lilian Downie Marked gene: XYLT2 as ready
Prepair 1000+ v1.1954 XYLT2 Lilian Downie Gene: xylt2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1954 XYLT2 Lilian Downie Phenotypes for gene: XYLT2 were changed from Spondyloocular syndrome, 605822 (3), Autosomal recessive to Spondyloocular syndrome MIM#605822
Prepair 1000+ v1.1953 XYLT2 Lilian Downie Publications for gene: XYLT2 were set to
Prepair 1000+ v1.1952 KIF7 Zornitza Stark Marked gene: KIF7 as ready
Prepair 1000+ v1.1952 KIF7 Zornitza Stark Gene: kif7 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1952 KIF7 Zornitza Stark Phenotypes for gene: KIF7 were changed from Hydrolethalus syndrome 2, 614120 (3) to Al-Gazali-Bakalinova syndrome MIM#607131; Hydrolethalus syndrome 2 MIM#614120; Acrocallosal syndrome MIM#200990; Joubert syndrome 12 MIM#200990
Prepair 1000+ v1.1951 KIF7 Zornitza Stark Publications for gene: KIF7 were set to
Prepair 1000+ v1.1950 KIAA1109 Zornitza Stark Marked gene: KIAA1109 as ready
Prepair 1000+ v1.1950 KIAA1109 Zornitza Stark Gene: kiaa1109 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1950 KIAA1109 Zornitza Stark Phenotypes for gene: KIAA1109 were changed from Alkuraya-Kucinskas syndrome, 617822 (3), Autosomal recessive to Alkuraya-Kucinskas syndrome MIM#617822
Prepair 1000+ v1.1949 KIAA1109 Zornitza Stark Publications for gene: KIAA1109 were set to
Prepair 1000+ v1.1948 KIAA1109 Zornitza Stark Tag new gene name tag was added to gene: KIAA1109.
Prepair 1000+ v1.1948 KCNV2 Zornitza Stark Marked gene: KCNV2 as ready
Prepair 1000+ v1.1948 KCNV2 Zornitza Stark Gene: kcnv2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1948 KCNV2 Zornitza Stark Phenotypes for gene: KCNV2 were changed from Retinal cone dystrophy 3B, 610356 (3) to Retinal cone dystrophy 3B MIM#610356
Prepair 1000+ v1.1947 KCNV2 Zornitza Stark Publications for gene: KCNV2 were set to
Prepair 1000+ v1.1946 ITK Zornitza Stark Marked gene: ITK as ready
Prepair 1000+ v1.1946 ITK Zornitza Stark Gene: itk has been classified as Green List (High Evidence).
Prepair 1000+ v1.1946 ITK Zornitza Stark Phenotypes for gene: ITK were changed from Lymphoproliferative syndrome 1, 613011 (3) to Lymphoproliferative syndrome 1 MIM# 613011
Prepair 1000+ v1.1945 ITK Zornitza Stark Publications for gene: ITK were set to
Prepair 1000+ v1.1944 ITK Zornitza Stark changed review comment from: Established gene-disease association characterized by onset in early childhood of Epstein-Barr virus (EBV)-associated immune dysregulation, manifest as lymphoma, lymphomatoid granulomatosis, haemophagocytic lymphohistiocytosis, Hodgkin disease, and/or hypogammaglobulinaemia. Autoimmune disorders, such as autoimmune haemolytic anemia or renal disease, may also occur.; to: Established gene-disease association characterized by onset in early childhood of Epstein-Barr virus (EBV)-associated immune dysregulation, manifest as lymphoma, lymphomatoid granulomatosis, haemophagocytic lymphohistiocytosis, Hodgkin disease, and/or hypogammaglobulinaemia. Autoimmune disorders, such as autoimmune haemolytic anaemia or renal disease, may also occur.
Prepair 1000+ v1.1944 ITK Zornitza Stark reviewed gene: ITK: Rating: GREEN; Mode of pathogenicity: None; Publications: 19425169, 22289921, 25061172, 26056787, 9311799, 10213685; Phenotypes: Lymphoproliferative syndrome 1 MIM# 613011; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1944 INVS Zornitza Stark Marked gene: INVS as ready
Prepair 1000+ v1.1944 INVS Zornitza Stark Gene: invs has been classified as Green List (High Evidence).
Prepair 1000+ v1.1944 INVS Zornitza Stark Phenotypes for gene: INVS were changed from Nephronophthisis 2, infantile, 602088 (3) to Nephronophthisis 2, infantile, (MIM#602088)
Prepair 1000+ v1.1943 INVS Zornitza Stark reviewed gene: INVS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Nephronophthisis 2, infantile, (MIM#602088); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1943 INPP5K Zornitza Stark Marked gene: INPP5K as ready
Prepair 1000+ v1.1943 INPP5K Zornitza Stark Gene: inpp5k has been classified as Green List (High Evidence).
Prepair 1000+ v1.1943 INPP5K Zornitza Stark Phenotypes for gene: INPP5K were changed from Muscular dystrophy, congenital, with cataracts and intellectual disability, 617404 (3), Autosomal recessive to Muscular dystrophy, congenital, with cataracts and intellectual disability MIM#617404
Prepair 1000+ v1.1942 INPP5K Zornitza Stark Publications for gene: INPP5K were set to
Prepair 1000+ v1.1941 INPP5K Zornitza Stark Tag founder tag was added to gene: INPP5K.
Prepair 1000+ v1.1941 IFT172 Zornitza Stark Marked gene: IFT172 as ready
Prepair 1000+ v1.1941 IFT172 Zornitza Stark Gene: ift172 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1941 IFT172 Zornitza Stark Phenotypes for gene: IFT172 were changed from Short-rib thoracic dysplasia 10 with or without polydactyly, 615630 (3) to Bardet-Biedl syndrome 20 MIM#619471; Retinitis pigmentosa 71 MIM#616394; Short-rib thoracic dysplasia 10 with or without polydactyly MIM#615630
Prepair 1000+ v1.1940 IFT172 Zornitza Stark Publications for gene: IFT172 were set to
Prepair 1000+ v1.1939 IDUA Zornitza Stark Marked gene: IDUA as ready
Prepair 1000+ v1.1939 IDUA Zornitza Stark Gene: idua has been classified as Green List (High Evidence).
Prepair 1000+ v1.1939 IDUA Zornitza Stark Phenotypes for gene: IDUA were changed from Mucopolysaccharidosis Ih, 607014 (3) to Mucopolysaccharidosis Ih/s (Hurler syndrome) 607014
Prepair 1000+ v1.1938 IDUA Zornitza Stark reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mucopolysaccharidosis Ih/s (Hurler syndrome) 607014; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1938 IBA57 Zornitza Stark Marked gene: IBA57 as ready
Prepair 1000+ v1.1938 IBA57 Zornitza Stark Gene: iba57 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1938 IBA57 Zornitza Stark Phenotypes for gene: IBA57 were changed from Multiple mitochondrial dysfunctions syndrome 3, 615330 (3), Autosomal recessive to Multiple mitochondrial dysfunctions syndrome 3 MIM#615330
Prepair 1000+ v1.1937 IBA57 Zornitza Stark Publications for gene: IBA57 were set to
Prepair 1000+ v1.1936 HYLS1 Zornitza Stark Marked gene: HYLS1 as ready
Prepair 1000+ v1.1936 HYLS1 Zornitza Stark Gene: hyls1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1936 HYLS1 Zornitza Stark Phenotypes for gene: HYLS1 were changed from Hydrolethalus syndrome, 236680 (3) to Hydrolethalus syndrome (MIM#236680)
Prepair 1000+ v1.1935 HYLS1 Zornitza Stark Publications for gene: HYLS1 were set to
Prepair 1000+ v1.1934 HSPD1 Zornitza Stark Marked gene: HSPD1 as ready
Prepair 1000+ v1.1934 HSPD1 Zornitza Stark Gene: hspd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1934 HSPD1 Zornitza Stark Phenotypes for gene: HSPD1 were changed from Leukodystrophy, hypomyelinating, 4, 612233 (3) to Leukodystrophy, hypomyelinating, 4 MIM#612233
Prepair 1000+ v1.1933 HSPD1 Zornitza Stark Publications for gene: HSPD1 were set to
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark edited their review of gene: HSD3B7: Changed publications: 27604308
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark Marked gene: HSD3B7 as ready
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark Gene: hsd3b7 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark Publications for gene: HSD3B7 were set to
Prepair 1000+ v1.1931 HSD3B7 Zornitza Stark Phenotypes for gene: HSD3B7 were changed from Bile acid synthesis defect, congenital, 1, 607765 (3) to Bile acid synthesis defect, congenital, 1 MIM#607765
Prepair 1000+ v1.1930 HSD3B7 Zornitza Stark reviewed gene: HSD3B7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Bile acid synthesis defect, congenital, 1 MIM#607765; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1930 HPS3 Zornitza Stark Marked gene: HPS3 as ready
Prepair 1000+ v1.1930 HPS3 Zornitza Stark Gene: hps3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1930 HPS3 Zornitza Stark Phenotypes for gene: HPS3 were changed from Hermansky-Pudlak syndrome 3, 614072 (3) to Hermansky-Pudlak syndrome 3 MIM#614072
Prepair 1000+ v1.1929 HPS3 Zornitza Stark Publications for gene: HPS3 were set to
Prepair 1000+ v1.1928 HAMP Zornitza Stark Marked gene: HAMP as ready
Prepair 1000+ v1.1928 HAMP Zornitza Stark Gene: hamp has been classified as Green List (High Evidence).
Prepair 1000+ v1.1928 HAMP Zornitza Stark Phenotypes for gene: HAMP were changed from Hemochromatosis, type 2B, 613313 (3) to Haemochromatosis, type 2B MIM#613313
Prepair 1000+ v1.1927 HAMP Zornitza Stark Publications for gene: HAMP were set to
Prepair 1000+ v1.1926 HADH Zornitza Stark Marked gene: HADH as ready
Prepair 1000+ v1.1926 HADH Zornitza Stark Gene: hadh has been classified as Green List (High Evidence).
Prepair 1000+ v1.1926 HADH Zornitza Stark Phenotypes for gene: HADH were changed from 3-hydroxyacyl-CoA dehydrogenase deficiency, 231530 (3) to 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530
Prepair 1000+ v1.1925 HADH Zornitza Stark Publications for gene: HADH were set to
Prepair 1000+ v1.1924 GM2A Zornitza Stark Marked gene: GM2A as ready
Prepair 1000+ v1.1924 GM2A Zornitza Stark Gene: gm2a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1924 GM2A Zornitza Stark Phenotypes for gene: GM2A were changed from GM2-gangliosidosis, AB variant, 272750 (3) to GM2-gangliosidosis, AB variant MIM #272750
Prepair 1000+ v1.1923 GM2A Zornitza Stark Publications for gene: GM2A were set to
Prepair 1000+ v1.1922 GLDN Zornitza Stark Marked gene: GLDN as ready
Prepair 1000+ v1.1922 GLDN Zornitza Stark Gene: gldn has been classified as Green List (High Evidence).
Prepair 1000+ v1.1922 GLDN Zornitza Stark Phenotypes for gene: GLDN were changed from Lethal congenital contracture syndrome 11, 617194 (3), Autosomal recessive to Lethal congenital contracture syndrome 11 MIM#617194
Prepair 1000+ v1.1921 GLDN Zornitza Stark Publications for gene: GLDN were set to
Prepair 1000+ v1.1920 FYCO1 Zornitza Stark Marked gene: FYCO1 as ready
Prepair 1000+ v1.1920 FYCO1 Zornitza Stark Gene: fyco1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1920 FYCO1 Zornitza Stark Phenotypes for gene: FYCO1 were changed from Cataract 18, autosomal recessive, 610019 (3) to Cataract 18, MIM#610019
Prepair 1000+ v1.1919 FYCO1 Zornitza Stark reviewed gene: FYCO1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cataract 18, MIM#610019; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1919 FTSJ1 Zornitza Stark Marked gene: FTSJ1 as ready
Prepair 1000+ v1.1919 FTSJ1 Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1919 FTSJ1 Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Mental retardation, X-linked 9, 309549 (3) to Intellectual developmental disorder, X-linked 9 MIM#309549
Prepair 1000+ v1.1918 FTSJ1 Zornitza Stark Publications for gene: FTSJ1 were set to
Prepair 1000+ v1.1917 FRAS1 Zornitza Stark Marked gene: FRAS1 as ready
Prepair 1000+ v1.1917 FRAS1 Zornitza Stark Gene: fras1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1917 FRAS1 Zornitza Stark Phenotypes for gene: FRAS1 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome 1 MIM#219000
Prepair 1000+ v1.1916 FRAS1 Zornitza Stark Publications for gene: FRAS1 were set to
Prepair 1000+ v1.1915 FLAD1 Zornitza Stark Marked gene: FLAD1 as ready
Prepair 1000+ v1.1915 FLAD1 Zornitza Stark Gene: flad1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1915 FLAD1 Zornitza Stark Phenotypes for gene: FLAD1 were changed from Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency, 255100 (3), Autosomal recessive to Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100
Prepair 1000+ v1.1914 FLAD1 Zornitza Stark Publications for gene: FLAD1 were set to
Prepair 1000+ v1.1913 FLAD1 Zornitza Stark reviewed gene: FLAD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34454814, 34718578, 31392824, 30982706, 30311138, 30427553, 28433476, 27259049, 25058219; Phenotypes: Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1913 FKBP14 Zornitza Stark Marked gene: FKBP14 as ready
Prepair 1000+ v1.1913 FKBP14 Zornitza Stark Gene: fkbp14 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1913 FKBP14 Zornitza Stark Phenotypes for gene: FKBP14 were changed from Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss, 614557 (3) to Ehlers-Danlos syndrome, kyphoscoliotic type, 2 MIM#614557
Prepair 1000+ v1.1912 FKBP14 Zornitza Stark Publications for gene: FKBP14 were set to
Prepair 1000+ v1.1911 FHL1 Zornitza Stark Marked gene: FHL1 as ready
Prepair 1000+ v1.1911 FHL1 Zornitza Stark Gene: fhl1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1911 FHL1 Zornitza Stark Phenotypes for gene: FHL1 were changed from Emery-Dreifuss muscular dystrophy 6, X-linked, 300696 (3) to Reducing body myopathy MONDO:0019948; X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680
Prepair 1000+ v1.1910 FHL1 Zornitza Stark Publications for gene: FHL1 were set to
Prepair 1000+ v1.1909 FHL1 Zornitza Stark Mode of inheritance for gene: FHL1 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Prepair 1000+ v1.1908 FGD4 Zornitza Stark Marked gene: FGD4 as ready
Prepair 1000+ v1.1908 FGD4 Zornitza Stark Gene: fgd4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1908 FGD4 Zornitza Stark Phenotypes for gene: FGD4 were changed from Charcot-Marie-Tooth disease, type 4H, 609311 (3) to Charcot-Marie-Tooth disease, type 4H MIM#609311; Charcot-Marie-Tooth disease MONDO:0015626
Prepair 1000+ v1.1907 FGD4 Zornitza Stark Publications for gene: FGD4 were set to
Prepair 1000+ v1.1906 FANCL Zornitza Stark Marked gene: FANCL as ready
Prepair 1000+ v1.1906 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Prepair 1000+ v1.1906 FANCL Zornitza Stark Phenotypes for gene: FANCL were changed from Fanconi anemia, complementation group L, 614083 (3) to Fanconi anaemia, complementation group L MIM#614083
Prepair 1000+ v1.1905 FANCL Zornitza Stark Publications for gene: FANCL were set to
Prepair 1000+ v1.1904 FANCD2 Zornitza Stark Marked gene: FANCD2 as ready
Prepair 1000+ v1.1904 FANCD2 Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1904 FANCD2 Zornitza Stark Phenotypes for gene: FANCD2 were changed from Fanconi anemia, complementation group D2, 227646 (3) to Fanconi anaemia, complementation group D2 MIM#227646
Prepair 1000+ v1.1903 FANCD2 Zornitza Stark Publications for gene: FANCD2 were set to
Prepair 1000+ v1.1902 ERCC4 Zornitza Stark Marked gene: ERCC4 as ready
Prepair 1000+ v1.1902 ERCC4 Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1902 ERCC4 Zornitza Stark Phenotypes for gene: ERCC4 were changed from Fanconi anemia, complementation group Q, 615272 (3) to Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108; Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215; XFE progeroid syndrome, MIM# 610965 MONDO:0012590
Prepair 1000+ v1.1901 ERCC4 Zornitza Stark reviewed gene: ERCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108, Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215, XFE progeroid syndrome, MIM# 610965 MONDO:0012590; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1901 DOLK Zornitza Stark Marked gene: DOLK as ready
Prepair 1000+ v1.1901 DOLK Zornitza Stark Gene: dolk has been classified as Green List (High Evidence).
Prepair 1000+ v1.1901 DOLK Zornitza Stark Phenotypes for gene: DOLK were changed from Congenital disorder of glycosylation, type Im, 610768 (3) to Congenital disorder of glycosylation, type Im, MIM# 610768
Prepair 1000+ v1.1900 DOLK Zornitza Stark Publications for gene: DOLK were set to
Prepair 1000+ v1.1899 DOLK Zornitza Stark reviewed gene: DOLK: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273964, 22242004, 23890587, 30653653, 28816422, 24144945; Phenotypes: Congenital disorder of glycosylation, type Im, MIM# 610768; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Marked gene: COL11A2 as ready
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Added comment: Comment when marking as ready: Deafness currently out of scope for this panel.
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Gene: col11a2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Phenotypes for gene: COL11A2 were changed from Fibrochondrogenesis 2, 614524 (3) to Fibrochondrogenesis 2 MIM#614524
Prepair 1000+ v1.1898 COL11A2 Zornitza Stark Publications for gene: COL11A2 were set to
Prepair 1000+ v1.1897 AGK Zornitza Stark Marked gene: AGK as ready
Prepair 1000+ v1.1897 AGK Zornitza Stark Gene: agk has been classified as Green List (High Evidence).
Prepair 1000+ v1.1897 AGK Zornitza Stark Phenotypes for gene: AGK were changed from Sengers syndrome, 212350 (3) to Sengers syndrome, MIM#212350
Prepair 1000+ v1.1896 AGK Zornitza Stark reviewed gene: AGK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sengers syndrome, MIM#212350; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2481 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164; Cranioectodermal dysplasia 5, MIM# 621180
Mendeliome v1.2480 IFT140 Zornitza Stark Publications for gene: IFT140 were set to 34890546; 22503633; 23418020; 28288023; 28724397; 26216056; 26968735
Mendeliome v1.2479 IFT140 Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; Changed publications: 22503633, 23418020, 28288023, 28724397, 26216056, 26968735, 32007091, 35873489, 37628605; Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, {Polycystic kidney disease 9, susceptibility to} MIM#621164, Cranioectodermal dysplasia 5, MIM# 621180
Ciliopathies v1.66 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180
Ciliopathies v1.65 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180
Ciliopathies v1.64 IFT140 Zornitza Stark Publications for gene: IFT140 were set to 22503633; 23418020; 28288023; 28724397; 26216056; 26968735; 34890546
Ciliopathies v1.63 IFT140 Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; Changed publications: 22503633, 23418020, 28288023, 28724397, 26216056, 26968735, 34890546, 32007091, 35873489, 37628605; Changed phenotypes: Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant, Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, Cranioectodermal dysplasia 5, MIM# 621180
Genetic Epilepsy v1.126 USP25 Sangavi Sivagnanasundram reviewed gene: USP25: Rating: AMBER; Mode of pathogenicity: Other; Publications: 38875478; Phenotypes: USP25-related epilepsy (epilepsy MONDO:0005027); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2479 USP25 Sangavi Sivagnanasundram edited their review of gene: USP25: Added comment: This gene-disease association has been DISPUTED by ClinGen Epilepsy GCEP on 01/04/2025 - https://search.clinicalgenome.org/CCID:008786

ClinGen's reason for disuputed classification - "Case-level data was not considered strong enough to score. Functional data was not consistent among the variants and was difficult to interpret in relationship to a seizure phenotype. The knock-out mouse model did not exhibit spontaneous seizures so was not scored."

Downgrade to Amber due to the uncertainty was agreed within the user group.; Changed rating: AMBER; Changed phenotypes: USP25-related epilepsy (epilepsy MONDO:0005027)
Mendeliome v1.2479 FOXM1 Achchuthan Shanmugasundram gene: FOXM1 was added
gene: FOXM1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: FOXM1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXM1 were set to 38969938
Phenotypes for gene: FOXM1 were set to Moyamoya disease, MONDO:0016820
Review for gene: FOXM1 was set to AMBER
Added comment: PMID:38969938 reported a 60-year-old father and 31-year-old daughter with unilateral Moyamoya Disease and with c.1205 C > A variant in FOXM1 gene (p.(Ala402Glu). There is also functional evidence available for the identified variant from the publication. This gene should be rated amber with current evidence.
Sources: Literature
Hereditary Neuropathy_CMT - isolated v1.52 NARS Chris Ciotta changed review comment from: Three families reported in the literature with heterozygous NARS1 variants and an isolated peripheral neuropathy phenotype, lacking the global developmental delay, seizures and intellectual disability and more seen in the dominant and recessive neurodevelopmental disorder phenotypes listed in OMIM (MIM#619091 and MIM#619092).

Beijer (2024) (PMID: 38495304): Two families with previously unreported missense variants and an isolated neuropathy phenotype. Segregation of this variant with disease also shown. Both missense variants severely reduced yeast growth compared to wildtype in a yeast rescue complementation assay. A mouse model expressing the p.Ser461Phe variant did not show any signs of peripheral neuropathy in mice heterozygous for this variant at multiple time points to 18 months of age.

Theuriet (2024) (PMID: 38769024): A novel missense reported in a French family with distal hereditary motor neuropathy. A mother and two sons all with an isolated phenotype with no seizures or ID. Mother presented in 30s and two sons presented 5 and 3 with toe walking. A yeast model was also done here with this variant allowing for no growth compared to wildtype.
Sources: Literature; to: Three families reported in the literature with heterozygous NARS1 variants and an isolated peripheral neuropathy phenotype, lacking the global developmental delay, seizures and intellectual disability and more seen in the dominant and recessive neurodevelopmental disorder phenotypes listed in OMIM (MIM#619091 and MIM#619092).

Beijer (2024) (PMID: 38495304): Two families with previously unreported missense variants and an isolated neuropathy phenotype. Segregation of these variants with disease also shown. Both missense variants severely reduced yeast growth compared to wildtype in a yeast rescue complementation assay. A mouse model expressing the p.Ser461Phe variant did not show any signs of peripheral neuropathy in mice heterozygous for this variant at multiple time points to 18 months of age.

Theuriet (2024) (PMID: 38769024): A novel missense reported in a French family with distal hereditary motor neuropathy. A mother and two sons all with an isolated phenotype with no seizures or ID. Mother presented in 30s and two sons presented 5 and 3 with toe walking. A yeast model was also done here with this variant allowing for no growth compared to wildtype.
Sources: Literature
Hereditary Neuropathy_CMT - isolated v1.52 NARS Chris Ciotta gene: NARS was added
gene: NARS was added to Hereditary Neuropathy_CMT - isolated. Sources: Literature
Mode of inheritance for gene: NARS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NARS were set to PMID: 38495304; 38769024
Phenotypes for gene: NARS were set to Axonal neuropathy; Charcot-Marie-Tooth disease; distal hereditary motor neuropathy
Review for gene: NARS was set to AMBER
Added comment: Three families reported in the literature with heterozygous NARS1 variants and an isolated peripheral neuropathy phenotype, lacking the global developmental delay, seizures and intellectual disability and more seen in the dominant and recessive neurodevelopmental disorder phenotypes listed in OMIM (MIM#619091 and MIM#619092).

Beijer (2024) (PMID: 38495304): Two families with previously unreported missense variants and an isolated neuropathy phenotype. Segregation of this variant with disease also shown. Both missense variants severely reduced yeast growth compared to wildtype in a yeast rescue complementation assay. A mouse model expressing the p.Ser461Phe variant did not show any signs of peripheral neuropathy in mice heterozygous for this variant at multiple time points to 18 months of age.

Theuriet (2024) (PMID: 38769024): A novel missense reported in a French family with distal hereditary motor neuropathy. A mother and two sons all with an isolated phenotype with no seizures or ID. Mother presented in 30s and two sons presented 5 and 3 with toe walking. A yeast model was also done here with this variant allowing for no growth compared to wildtype.
Sources: Literature
Prepair 1000+ v1.1896 SLC37A4 Lilian Downie Marked gene: SLC37A4 as ready
Prepair 1000+ v1.1896 SLC37A4 Lilian Downie Gene: slc37a4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1896 SLC37A4 Lilian Downie Phenotypes for gene: SLC37A4 were changed from Glycogen storage disease Ib, 232220 (3) to Glycogen storage disease Ib MIM#232220; Glycogen storage disease Ic MIM#232240; Glycogen Storage Disease I MONDO:0002413
Prepair 1000+ v1.1895 SP110 Lilian Downie Marked gene: SP110 as ready
Prepair 1000+ v1.1895 SP110 Lilian Downie Gene: sp110 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1895 SP110 Lilian Downie Publications for gene: SP110 were set to
Prepair 1000+ v1.1894 SPR Lilian Downie Marked gene: SPR as ready
Prepair 1000+ v1.1894 SPR Lilian Downie Gene: spr has been classified as Green List (High Evidence).
Prepair 1000+ v1.1894 SPR Lilian Downie Phenotypes for gene: SPR were changed from Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, 612716 (3) to Dystonia, dopa-responsive, due to sepiapterin reductase deficiency MIM#612716
Prepair 1000+ v1.1893 SPR Lilian Downie Publications for gene: SPR were set to
Prepair 1000+ v1.1892 STRA6 Lilian Downie Marked gene: STRA6 as ready
Prepair 1000+ v1.1892 STRA6 Lilian Downie Gene: stra6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1892 STRA6 Lilian Downie Phenotypes for gene: STRA6 were changed from Microphthalmia MIM#601186 to Microphthalmia, isolated, with coloboma 8 MIM#601186; Microphthalmia, syndromic 9 MIM#601186
Prepair 1000+ v1.1891 STRA6 Lilian Downie Phenotypes for gene: STRA6 were changed from Microphthalmia, isolated, with coloboma 8, 601186 (3) to Microphthalmia MIM#601186
Mendeliome v1.2479 B3GALT6 Sangavi Sivagnanasundram reviewed gene: B3GALT6: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008674; Phenotypes: B3GALT6-congenital disorder of glycosylation MONDO:0100586; Mode of inheritance: None
Prepair 1000+ v1.1890 STRA6 Lilian Downie Publications for gene: STRA6 were set to
Prepair 1000+ v1.1889 TRIM32 Lilian Downie Marked gene: TRIM32 as ready
Prepair 1000+ v1.1889 TRIM32 Lilian Downie Gene: trim32 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1889 TRIM32 Lilian Downie Phenotypes for gene: TRIM32 were changed from Muscular dystrophy, limb-girdle, type 2H, 254110 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110
Prepair 1000+ v1.1888 TRIM32 Lilian Downie Publications for gene: TRIM32 were set to
Prepair 1000+ v1.1887 TRPM6 Lilian Downie Marked gene: TRPM6 as ready
Prepair 1000+ v1.1887 TRPM6 Lilian Downie Gene: trpm6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1887 TRPM6 Lilian Downie Publications for gene: TRPM6 were set to
Prepair 1000+ v1.1886 TTI2 Lilian Downie Marked gene: TTI2 as ready
Prepair 1000+ v1.1886 TTI2 Lilian Downie Gene: tti2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1886 TTI2 Lilian Downie Phenotypes for gene: TTI2 were changed from Mental retardation, autosomal recessive 39, 615541 (3) to Intellectual developmental disorder, autosomal recessive 39 MIM#615541
Mendeliome v1.2479 PIK3R5 Sangavi Sivagnanasundram reviewed gene: PIK3R5: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008779; Phenotypes: ataxia with oculomotor apraxia type 3 MONDO:0014084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1885 TTI2 Lilian Downie Publications for gene: TTI2 were set to
Prepair 1000+ v1.1884 TTPA Lilian Downie Marked gene: TTPA as ready
Prepair 1000+ v1.1884 TTPA Lilian Downie Gene: ttpa has been classified as Green List (High Evidence).
Prepair 1000+ v1.1884 TTPA Lilian Downie Publications for gene: TTPA were set to
Prepair 1000+ v1.1883 VARS Lilian Downie Marked gene: VARS as ready
Prepair 1000+ v1.1883 VARS Lilian Downie Gene: vars has been classified as Green List (High Evidence).
Prepair 1000+ v1.1883 VARS Lilian Downie Phenotypes for gene: VARS were changed from Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy, 617802 (3), Autosomal recessive to Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy MIM#617802
Prepair 1000+ v1.1882 VARS Lilian Downie Publications for gene: VARS were set to
Mendeliome v1.2479 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Mendeliome. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Prepair 1000+ v1.1881 WNT10B Lilian Downie Marked gene: WNT10B as ready
Prepair 1000+ v1.1881 WNT10B Lilian Downie Gene: wnt10b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1881 WNT10B Lilian Downie Publications for gene: WNT10B were set to
Prepair 1000+ v1.1880 CSPP1 Lilian Downie Marked gene: CSPP1 as ready
Prepair 1000+ v1.1880 CSPP1 Lilian Downie Gene: cspp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1880 CSPP1 Lilian Downie Phenotypes for gene: CSPP1 were changed from Joubert syndrome 21, 615636 (3) to Joubert syndrome 21 MIM#615636; MONDO:0014288
Prepair 1000+ v1.1879 CSPP1 Lilian Downie Publications for gene: CSPP1 were set to
Prepair 1000+ v1.1878 DNAH5 Lilian Downie Marked gene: DNAH5 as ready
Prepair 1000+ v1.1878 DNAH5 Lilian Downie Gene: dnah5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1878 DNAH5 Lilian Downie Publications for gene: DNAH5 were set to
Prepair 1000+ v1.1877 PEX5 Lilian Downie Marked gene: PEX5 as ready
Prepair 1000+ v1.1877 PEX5 Lilian Downie Gene: pex5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1877 PEX5 Lilian Downie Phenotypes for gene: PEX5 were changed from Peroxisome biogenesis disorder 2A (Zellweger), 214110 to Peroxisome Biogenesis Disorder, MONDO:0019234
Prepair 1000+ v1.1876 PEX5 Lilian Downie Publications for gene: PEX5 were set to 21031596; 7719337; 26220973; 20301621
Prepair 1000+ v1.1875 PEX5 Lilian Downie Publications for gene: PEX5 were set to
Prepair 1000+ v1.1874 PIGN Lilian Downie Marked gene: PIGN as ready
Prepair 1000+ v1.1874 PIGN Lilian Downie Gene: pign has been classified as Green List (High Evidence).
Prepair 1000+ v1.1874 PIGN Lilian Downie Publications for gene: PIGN were set to
Prepair 1000+ v1.1873 PLAA Lilian Downie Marked gene: PLAA as ready
Prepair 1000+ v1.1873 PLAA Lilian Downie Gene: plaa has been classified as Green List (High Evidence).
Prepair 1000+ v1.1873 PLAA Lilian Downie Phenotypes for gene: PLAA were changed from Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, 617527 (3), Autosomal recessive to Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies,MIM#617527
Prepair 1000+ v1.1872 PLAA Lilian Downie Publications for gene: PLAA were set to
Prepair 1000+ v1.1871 PLCE1 Lilian Downie Marked gene: PLCE1 as ready
Prepair 1000+ v1.1871 PLCE1 Lilian Downie Gene: plce1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1871 PLCE1 Lilian Downie Publications for gene: PLCE1 were set to
Prepair 1000+ v1.1870 POLR3B Lilian Downie Marked gene: POLR3B as ready
Prepair 1000+ v1.1870 POLR3B Lilian Downie Gene: polr3b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1870 POLR3B Lilian Downie Mode of pathogenicity for gene: POLR3B was changed from to None
Prepair 1000+ v1.1869 POLR3B Lilian Downie Publications for gene: POLR3B were set to
Mendeliome v1.2479 ANKZF1 Sangavi Sivagnanasundram reviewed gene: ANKZF1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008790; Phenotypes: inflammatory bowel disease MONDO:0005265; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Inflammatory bowel disease v0.124 ANKZF1 Sangavi Sivagnanasundram reviewed gene: ANKZF1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008790; Phenotypes: inflammatory bowel disease MONDO:0005265; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Monogenic Diabetes v0.137 SIRT1 Sangavi Sivagnanasundram gene: SIRT1 was added
gene: SIRT1 was added to Monogenic Diabetes. Sources: ClinGen
Mode of inheritance for gene: SIRT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SIRT1 were set to https://search.clinicalgenome.org/CCID:008794
Phenotypes for gene: SIRT1 were set to monogenic diabetes MONDO:0015967
Review for gene: SIRT1 was set to RED
Added comment: Classified as LIMITED by Monogenic Diabetes GCEP on 18/04/2025 - https://search.clinicalgenome.org/CCID:008794
Sources: ClinGen
Mendeliome v1.2479 SIRT1 Sangavi Sivagnanasundram reviewed gene: SIRT1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008794; Phenotypes: monogenic diabetes MONDO:0015967; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genomic newborn screening: ICoNS v0.0 Zornitza Stark Added Panel Genomic newborn screening: ICoNS
Genomic newborn screening: BabyScreen+ v1.117 Zornitza Stark Panel name changed from BabyScreen+ newborn screening to Genomic newborn screening: BabyScreen+
Mendeliome v1.2479 FGFR3 Bryony Thompson Mode of inheritance for gene: FGFR3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2478 FGFR1 Bryony Thompson Publications for gene: FGFR1 were set to 18034870; 23812909; 26942290; 16470795; 15625620; 29147600; 20339250
Mendeliome v1.2477 FGFR1 Bryony Thompson Publications for gene: FGFR1 were set to 18034870; 23812909; 26942290
Mendeliome v1.2476 FGF8 Bryony Thompson Publications for gene: FGF8 were set to 34433009; 32664970; 7768185; 32664970; 10603341; 19509466; 9462741; 10603341; 12223415
Mendeliome v1.2475 FGF8 Bryony Thompson Publications for gene: FGF8 were set to 34433009
Mendeliome v1.2474 FGA Bryony Thompson Publications for gene: FGA were set to 31064749; 17295221; 19073821; 11739173
Mendeliome v1.2473 FGA Bryony Thompson Mode of inheritance for gene: FGA was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Bleeding and Platelet Disorders v1.55 FGA Bryony Thompson Mode of inheritance for gene: FGA was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Bleeding and Platelet Disorders v1.54 FGB Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396; 24560896
Bleeding and Platelet Disorders v1.54 FGB Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396
Bleeding and Platelet Disorders v1.53 FGB Bryony Thompson Mode of inheritance for gene: FGB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Bleeding and Platelet Disorders v1.52 FGB Bryony Thompson reviewed gene: FGB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24560896; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2472 FGB Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396
Mendeliome v1.2471 FGB Bryony Thompson Mode of inheritance for gene: FGB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2470 FGB Bryony Thompson reviewed gene: FGB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24560896; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2470 FGA Bryony Thompson reviewed gene: FGA: Rating: GREEN; Mode of pathogenicity: None; Publications: 10602365, 11460510; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes
Bleeding and Platelet Disorders v1.52 FGA Bryony Thompson edited their review of gene: FGA: Changed rating: GREEN
Bleeding and Platelet Disorders v1.52 FGA Bryony Thompson reviewed gene: FGA: Rating: ; Mode of pathogenicity: None; Publications: 10602365, 11460510; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2470 FAR1 Bryony Thompson reviewed gene: FAR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33586168, 25439727; Phenotypes: Fatty acyl-CoA reductase 1 deficiency MONDO:0014510; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v1.2470 FANCM Bryony Thompson edited their review of gene: FANCM: Added comment: Now 4 families with biallelic variants reported with spermatogenic failure; Changed publications: 29231814, 28837162, 33036707, 25010009, 38927643, 35413094, 30075111, 29895858; Changed phenotypes: Premature ovarian failure 15 MIM#618096, spermatogenic failure 28 MONDO:0054732; Set current diagnostic: yes
Mendeliome v1.2470 FANCI Bryony Thompson Publications for gene: FANCI were set to 17452773
Bleeding and Platelet Disorders v1.52 F9 Bryony Thompson changed review comment from: Classified as LIMITED by the Hemostasis Thrombosis GCEP in 2023 with 2 families reported with missense variants, however 3 additional families/cases have been reported with increased factor 9 activity and large duplications involving F9. Gain of function is the mechanism of disease for the thrombophilia.; to: Classified as LIMITED by the Hemostasis Thrombosis GCEP in 2023 with 2 families reported with missense variants; however, 3 additional families/cases have been reported with increased factor 9 activity and large duplications involving F9. Gain of function is the mechanism of disease for thrombophilia.
Mendeliome v1.2469 F9 Bryony Thompson reviewed gene: F9: Rating: GREEN; Mode of pathogenicity: Other; Publications: 19846852, 32079698, 38886735, 38358900, 37414287, 33656538; Phenotypes: thrombophilia, X-linked, due to factor 9 defect MONDO:0010432; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2469 F9 Bryony Thompson Publications for gene: F9 were set to 19846852; 34015304; 33656538; 3001143; 9016521; 19815722
Bleeding and Platelet Disorders v1.52 F9 Bryony Thompson edited their review of gene: F9: Changed mode of pathogenicity: Other
Bleeding and Platelet Disorders v1.52 F9 Bryony Thompson reviewed gene: F9: Rating: GREEN; Mode of pathogenicity: None; Publications: 19846852, 32079698, 38886735, 38358900, 37414287, 33656538; Phenotypes: thrombophilia, X-linked, due to factor 9 defect MONDO:0010432; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2468 F9 Bryony Thompson Publications for gene: F9 were set to 19846852; 34015304; 33656538
Mendeliome v1.2467 F5 Bryony Thompson Publications for gene: F5 were set to
Mendeliome v1.2466 F2 Bryony Thompson Classified gene: F2 as Green List (high evidence)
Mendeliome v1.2466 F2 Bryony Thompson Added comment: Comment on list classification: Gain of function is the mechanism of disease for dominant thrombophilia, and biallelic loss of function is the mechanism for congenital prothrombin deficiency.
Mendeliome v1.2466 F2 Bryony Thompson Gene: f2 has been classified as Green List (High Evidence).
Mendeliome v1.2465 F2 Bryony Thompson Tag 5'UTR was removed from gene: F2.
Tag UTR tag was added to gene: F2.
Mendeliome v1.2465 F2 Bryony Thompson Publications for gene: F2 were set to 30297698
Renal Macrocystic Disease v0.83 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Cystic Kidney Disease, MONDO# 0002473 to {Polycystic kidney disease 9, susceptibility to} MIM#621164
Renal Macrocystic Disease v0.82 IFT140 Zornitza Stark reviewed gene: IFT140: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: {Polycystic kidney disease 9, susceptibility to} MIM#621164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Renal Ciliopathies and Nephronophthisis v1.27 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Cystic Kidney Disease, MONDO# 0002473, IFT140-related, dominant to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; {Polycystic kidney disease 9, susceptibility to} MIM#621164
Renal Ciliopathies and Nephronophthisis v1.26 IFT140 Zornitza Stark edited their review of gene: IFT140: Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, MONDO:0009964, {Polycystic kidney disease 9, susceptibility to} MIM#621164
Mendeliome v1.2464 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164
Mendeliome v1.2463 IFT140 Zornitza Stark edited their review of gene: IFT140: Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, {Polycystic kidney disease 9, susceptibility to} MIM#621164
Prepair 1000+ v1.1868 POLR3B Karina Sandoval reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 27512013, 23355746, 22036171, 22036172, 25339210, 33005949, 22855961, 33417887; Phenotypes: Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism,MIM#614381; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PLCE1 Karina Sandoval reviewed gene: PLCE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17086182, 18065803, 20591883; Phenotypes: Nephrotic syndrome, type 3,MIM#610725; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PLAA Karina Sandoval reviewed gene: PLAA: Rating: GREEN; Mode of pathogenicity: None; Publications: 28007986, 28413018, 31322726; Phenotypes: Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies,MIM#617527; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PIGN Karina Sandoval reviewed gene: PIGN: Rating: GREEN; Mode of pathogenicity: None; Publications: 21493957, 24253414, 26364997, 26394714, 33193741, 32585529, 33528536, 38693247, 36322149; Phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 1,MIM#614080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PEX5 Karina Sandoval reviewed gene: PEX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 21031596, 7719337, 26220973, 20301621; Phenotypes: Peroxisome Biogenesis Disorder, MONDO:0019234; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2463 EYA4 Bryony Thompson reviewed gene: EYA4: Rating: AMBER; Mode of pathogenicity: None; Publications: 10769282, 30155266, 33745059; Phenotypes: dilated cardiomyopathy 1J MONDO:0011541; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 1000+ v1.1868 DNAH5 Andrew Coventry reviewed gene: DNAH5: Rating: GREEN; Mode of pathogenicity: None; Publications: 16627867, 11788826, 40033371; Phenotypes: Ciliary dyskinesia, primary, 3, with or without situs inversus MIM#608644; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 CSPP1 Andrew Coventry reviewed gene: CSPP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360808, 24360803, 24360807, 25997910; Phenotypes: Joubert syndrome 21 MIM#615636, MONDO:0014288; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 WNT10B Andrew Coventry reviewed gene: WNT10B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20635353, 16688749, 29427788, 24211389, 38058757, 39310870; Phenotypes: Split-hand/foot malformation 6 MIM#225300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 VARS Andrew Coventry reviewed gene: VARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30755616, 30755602, 26539891, 29691655, 30275004, 30755616; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy MIM#617802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TTPA Andrew Coventry reviewed gene: TTPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 7719340; Phenotypes: Ataxia with isolated vitamin E deficiency MIM#277460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TTI2 Andrew Coventry reviewed gene: TTI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32061250, 23956177, 31737043; Phenotypes: Intellectual developmental disorder, autosomal recessive 39 MIM#615541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TRPM6 Andrew Coventry reviewed gene: TRPM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 35903165, 18818955; Phenotypes: Hypomagnesemia 1, intestinal MIM#602014; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TRIM32 Andrew Coventry reviewed gene: TRIM32: Rating: GREEN; Mode of pathogenicity: None; Publications: 9634523, 10399877, 17994549, 25351777, 19492423, 19303295, 31309175; Phenotypes: Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2463 ERLIN2 Bryony Thompson Mode of inheritance for gene: ERLIN2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 STRA6 Andrew Coventry reviewed gene: STRA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273977, 17503335, 19213032, 26373900, 30880327, 26373900, 25457163; Phenotypes: Microphthalmia, isolated, with coloboma 8 MIM#601186, Microphthalmia, syndromic 9 MIM#601186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Marked gene: ERLIN2 as ready
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Gene: erlin2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1868 SPR Andrew Coventry reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522443, 26131547, 33903016, 31777525, 16650784, 21431957, 28189489; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency MIM#612716; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Classified gene: ERLIN2 as Green List (high evidence)
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Gene: erlin2 has been classified as Green List (High Evidence).
Motor Neurone Disease v1.28 ERLIN2 Bryony Thompson gene: ERLIN2 was added
gene: ERLIN2 was added to Motor Neurone Disease. Sources: Literature
Mode of inheritance for gene: ERLIN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ERLIN2 were set to 38607533; 38427163; 34734492; 32042907
Phenotypes for gene: ERLIN2 were set to hereditary spastic paraplegia 18 MONDO:0012639
Review for gene: ERLIN2 was set to GREEN
gene: ERLIN2 was marked as current diagnostic
Added comment: HSP phenoconversion to ALS has been reported in AD and AR families.
Sources: Literature
Prepair 1000+ v1.1868 SP110 Andrew Coventry reviewed gene: SP110: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301448, 16648851, 23448538, 22621957, 32395362; Phenotypes: Hepatic venoocclusive disease with immunodeficiency MIM#235550; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SLC37A4 Andrew Coventry reviewed gene: SLC37A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 33964207, 9675154, 9758626; Phenotypes: Glycogen storage disease Ib MIM#232220, Glycogen storage disease Ic MIM#232240, Glycogen Storage Disease I MONDO:0002413; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2462 ERLIN2 Bryony Thompson edited their review of gene: ERLIN2: Added comment: AR and AD variants appear to have a different mechanism of disease. AR is presumably loss of function. The mechanism of disease for AD HSP is expected to be dominant negative but has not been confirmed; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SLC12A5 Andrew Coventry reviewed gene: SLC12A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26333769, 27436767, 24928908, 30763027, 24668262; Phenotypes: Developmental and epileptic encephalopathy 34 MIM#616645; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SEC23B Andrew Coventry reviewed gene: SEC23B: Rating: GREEN; Mode of pathogenicity: None; Publications: 19561605, 19621418, 26522472, 27471141, 37373084; Phenotypes: Dyserythropoietic anemia, congenital, type II MIM#224100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RNASET2 Andrew Coventry reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31349848, 19525954, 27091087, 29336640, 18545798, 15851732; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly MIM#612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RNASEH2A Andrew Coventry reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 15870678, 25604658, 23592335, 20301648, 29239743, 16845400, 24183309, 35551623; Phenotypes: Aicardi-Goutieres syndrome 4 MIM#610333, RNASEH2A-related type 1 interferonopathy MONDO:0700259; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RARB Andrew Coventry reviewed gene: RARB: Rating: AMBER; Mode of pathogenicity: None; Publications: 30880327, 30281527, 24075189, 27120018, 25457163, 17506106; Phenotypes: Microphthalmia, syndromic 12 MIM#615524; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RAB23 Andrew Coventry reviewed gene: RAB23: Rating: GREEN; Mode of pathogenicity: None; Publications: 17503333, 21412941, 23599695, 25168863; Phenotypes: Carpenter syndrome MIM#201000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PUS7 Andrew Coventry reviewed gene: PUS7: Rating: GREEN; Mode of pathogenicity: None; Publications: 30526862, 30778726, 31583274, 35144859; Phenotypes: Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature MIM#618342; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PPIB Andrew Coventry reviewed gene: PPIB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19781681, 32392875; Phenotypes: Osteogenesis imperfecta, type IX MIM#259440; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2462 SIRT6 Achchuthan Shanmugasundram gene: SIRT6 was added
gene: SIRT6 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SIRT6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SIRT6 were set to 29555651; 30135584
Review for gene: SIRT6 was set to GREEN
Added comment: PMID:29555651 reported a family with four consecutive cases of late foetal loss with gestational ages between 17 and 35 weeks. The foetuses showed prenatal abnormalities including intrauterine growth restriction (IUGR), microcephaly, craniofacial anomalies, sex reversal in male foetuses, and congenital heart defects. A homozygous inactivating variant in SIRT6 gene (c.187G > C; p.(Asp63His)) was identified by WES in the four foetuses. There is also functional data available from in vitro studies, SIRT6 D63H mouse embryonic stem cells and human induced pluripotent stem cells (iPSCs) derived from D63H homozygous foetuses.

There is also functional evidence available from several other studies including PMID:30135584, where CRISPR-Cas9-based approach was used to generate a SIRT6-null cynomolgus monkey (Macaca fascicularis) model. SIRT6-deficient monkeys died hours after birth and exhibited severe prenatal developmental retardation.

This gene has not been associated with any phenotypes either in OMIM or in Gene2Phenotype.
Sources: Literature
Prepair 1000+ v1.1868 OPA1 Cassandra Muller reviewed gene: OPA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25012220; Phenotypes: Behr syndrome, 210000 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PDP1 Karina Sandoval reviewed gene: PDP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15855260, 31392110, 19184109; Phenotypes: Pyruvate dehydrogenase phosphatase deficiency,MIM#608782; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 NUBPL Cassandra Muller changed review comment from: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression.; to: Well established gene-disease association. Severe, multi system, mitochondrial condition with variable severity and progression.
Prepair 1000+ v1.1868 NUBPL Cassandra Muller changed review comment from: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression. Onset in infancy or childhood.; to: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression.
Prepair 1000+ v1.1868 NUBPL Cassandra Muller reviewed gene: NUBPL: Rating: GREEN; Mode of pathogenicity: None; Publications: 20818383, 32518176, 23553477, 31917109, 32518176, 31787496, 30897263, 22826544; Phenotypes: Mitochondrial complex I deficiency, nuclear type 21, 618242 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 NR2E3 Cassandra Muller Deleted their review
Prepair 1000+ v1.1868 NR2E3 Cassandra Muller reviewed gene: NR2E3: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval reviewed gene: PCSK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14617756, 17595246, 27187081, 27288825, 23562752; Phenotypes: Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 NDUFS4 Cassandra Muller reviewed gene: NDUFS4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex I deficiency, nuclear type 1, 252010 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval Deleted their review
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval changed review comment from: Unsure if severe enough to include in panel.

MM- Tricky - Hyperphagia & obesity but associated metabolic problems can be severe includeing cases of death in childhood.

PMID:27187081 - some patients displayed morbid obesity and severe hyperphagia, other subjects were only moderately obese. BMI rises from 2 years and patients became obese from early childhood. However, the extreme obesity of the index case at 3 years of age has not been reported in any subsequent patients. Presentation is severe malabsorptive diarrhea, becoming clinically evident within the first 3 months of life. This can be so severe as to lead to a metabolic acidosis. After the age of 2 years, the severity of the malabsorption appears to spontaneously improve, and many children can discontinue
parenteral feeding.

PMID: 27288825 - Nutrition significantly diminshed beyond 2 years and patients can thrive despite the presence of persistent diarrhea that is lifelong and malabsorption throughout life, and early in life will require intravenous support
that may be tapered off as the child ages.; to: Unsure if severe enough to include in panel.

MM- Tricky - Hyperphagia & obesity but associated metabolic problems can be severe includeing cases of death in childhood.

PMID:27187081 - some patients displayed morbid obesity and severe hyperphagia, other subjects were only moderately obese. BMI rises from 2 years and patients became obese from early childhood. However, the extreme obesity of the index case at 3 years of age has not been reported in any subsequent patients. Presentation is severe malabsorptive diarrhea, becoming clinically evident within the first 3 months of life. This can be so severe as to lead to a metabolic acidosis. After the age of 2 years, the severity of the malabsorption appears to spontaneously improve, and many children can discontinue
parenteral feeding.

PMID: 27288825 - Nutrition significantly diminshed beyond 2 years and patients can thrive despite the presence of persistent diarrhea that is lifelong and malabsorption throughout life, and early in life will require intravenous support
that may be tapered off as the child ages.
Prepair 1000+ v1.1868 NDE1 Cassandra Muller reviewed gene: NDE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30637988, 21529751, 34562061; Phenotypes: Lissencephaly 4 (with microcephaly), 614019 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Adult Cardiac SuperPanel v2.9 Bryony Thompson Changed child panels to: Dilated Cardiomyopathy; Short QT syndrome; Atrial Fibrillation; Cardiac conduction disease; Hypertrophic cardiomyopathy_HCM; Arrhythmogenic Cardiomyopathy; Long QT Syndrome; Catecholaminergic Polymorphic Ventricular Tachycardia; Brugada syndrome; Ventricular Fibrillation
Prepair 1000+ v1.1868 MMP2 Cassandra Muller reviewed gene: MMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 11431697, 15691365, 17059372, 17400654; Phenotypes: Multicentric osteolysis, nodulosis, and arthropathy, 259600 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2462 RNU2-2P Achchuthan Shanmugasundram reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: 40210679; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval reviewed gene: PCSK1: Rating: AMBER; Mode of pathogenicity: None; Publications: 14617756, 17595246, 27187081, 27288825; Phenotypes: Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PAH Karina Sandoval reviewed gene: PAH: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 3008810, 31636599, 32141105; Phenotypes: Phenylketonuria,MIM#261600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 OTUD6B Karina Sandoval reviewed gene: OTUD6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28343629, 32924626, 31147255; Phenotypes: Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies,MIM#617452; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 OPN1LW Karina Sandoval reviewed gene: OPN1LW: Rating: RED; Mode of pathogenicity: None; Publications: 25168334, 32860923, 8213841; Phenotypes: Blue cone monochromacy,MIM#303700, Colorblindness, protan,MIM#303900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.1868 MED12 Melanie Marty reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: 33244166, 32174975, 30006928, 27312080; Phenotypes: MED12-related intellectual disability syndrome, MONDO:0100000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Prepair 1000+ v1.1868 HYLS1 Melanie Marty reviewed gene: HYLS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15843405, 18648327, 19400947, 19656802, 32509774, 39626953, 26830932; Phenotypes: Hydrolethalus syndrome (MIM#236680), Ciliopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FHL1 Melanie Marty changed review comment from: The FHL1 gene is associated with a diverse spectrum of X-linked diseases affecting skeletal and cardiac muscle (PMID: 21310615, 40017287).

Well-established gene-disease association. FHL1 encodes 3 alternatively spliced isoforms - FHL1A, FHL1B, FHL1C composed of different LIM domains. FHL1A is predominant in muscle. Pathogenic variants affected isoform expression differently depending on location in alternatively spliced exons. Location of the variant appears to be related to severity of phenotype. Loss of function is the mechanism of disease.

Reducing body myopathy (RBM) PMID: 18179901, 19716112, 18274675, 19181672, 25274776, 34366191 - XLD inheritance with clinical spectrum that includes severe early-onset to later-onset less progressive conditions including X-linked scapuloperoneal muscular dystrophy & X-linked myopathy with postural muscle atrophy. Pathogenic variants mainly located in more proximal exons (3-6). Fhl1 W122S knock-in mouse model has late-onset mild myopathy.

XL-EDMD PMID: 19716112, 20186852, 20301609 - at least 7 families reported with XLD inheritance (female heterozygous carriers were asymptomatic or had mild myopathy and/or cardiomyopathy). EDMD-associated variants are localized in the distal exons (5-8) and associated with reduced function.; to: The FHL1 gene is associated with a diverse spectrum of X-linked diseases affecting skeletal and cardiac muscle (PMID: 21310615, 40017287).

Well-established gene-disease association. FHL1 encodes 3 alternatively spliced isoforms - FHL1A, FHL1B, FHL1C composed of different LIM domains. FHL1A is predominant in muscle. Pathogenic variants affected isoform expression differently depending on location in alternatively spliced exons. Location of the variant appears to be related to severity of phenotype. Loss of function is the mechanism of disease.

Reducing body myopathy (RBM) PMID: 18179901, 19716112, 18274675, 19181672, 25274776, 34366191 - XLD inheritance with clinical spectrum that includes severe early-onset to later-onset less progressive conditions including X-linked scapuloperoneal muscular dystrophy & X-linked myopathy with postural muscle atrophy. Pathogenic variants mainly located in more proximal exons (3-6). Fhl1 W122S knock-in mouse model has late-onset mild myopathy. Female carriers may experience mild proximal muscle weakness or be asymptomatic.

XL-EDMD PMID: 19716112, 20186852, 20301609 - at least 7 families reported with XLD inheritance (female heterozygous carriers were asymptomatic or had mild myopathy and/or cardiomyopathy). EDMD-associated variants are localized in the distal exons (5-8) and associated with reduced function.
Prepair 1000+ v1.1868 FHL1 Melanie Marty reviewed gene: FHL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19716112, 20186852, 20301609, 18179901, 25274776, 34366191, 18274675, 19181672, 21310615, 40017287; Phenotypes: Reducing body myopathy MONDO:0019948, X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v1.2462 ENAM Bryony Thompson Added comment: Comment on mode of inheritance: Same mechanism of disease for monoallelic vs biallelic. Biallelic phenotype is more severe
Mendeliome v1.2462 ENAM Bryony Thompson Mode of inheritance for gene: ENAM was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v1.3 EMILIN1 Bryony Thompson Marked gene: EMILIN1 as ready
Osteogenesis Imperfecta and Osteoporosis v1.3 EMILIN1 Bryony Thompson Gene: emilin1 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v1.3 EMILIN1 Bryony Thompson Phenotypes for gene: EMILIN1 were changed from arterial tortuosity-bone fragility syndrome to arterial tortuosity-bone fragility syndrome MONDO:0971179
Osteogenesis Imperfecta and Osteoporosis v1.2 EMILIN1 Bryony Thompson Classified gene: EMILIN1 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v1.2 EMILIN1 Bryony Thompson Gene: emilin1 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v1.1 EMILIN1 Bryony Thompson gene: EMILIN1 was added
gene: EMILIN1 was added to Osteogenesis Imperfecta and Osteoporosis. Sources: Literature
Mode of inheritance for gene: EMILIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EMILIN1 were set to 36351433
Phenotypes for gene: EMILIN1 were set to arterial tortuosity-bone fragility syndrome
Review for gene: EMILIN1 was set to GREEN
gene: EMILIN1 was marked as current diagnostic
Added comment: Prenatal and neonatal fractures are a feature of the condition.
Sources: Literature
Macular Dystrophy/Stargardt Disease v0.54 ELOVL4 Bryony Thompson Mode of inheritance for gene: ELOVL4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Macular Dystrophy/Stargardt Disease v0.53 ELOVL4 Bryony Thompson reviewed gene: ELOVL4: Rating: GREEN; Mode of pathogenicity: Other; Publications: 11138005, 15028284, 11726641, 17208947; Phenotypes: Stargardt disease MONDO:0019353; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Marked gene: ELOVL4 as ready
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Gene: elovl4 has been classified as Red List (Low Evidence).
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Classified gene: ELOVL4 as Red List (low evidence)
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Gene: elovl4 has been classified as Red List (Low Evidence).
Syndromic Retinopathy v0.221 ELOVL4 Bryony Thompson changed review comment from: Well-established gene-disease associations. Monoallelic loss-of-function variants are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.; to: The macular dystrophy/Stargardt disease phenotype is nonsyndromic and the biallelic congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome doesn't include any retinal findings. Parents who were heterozygous for the variants did not have macular dystrophy.
Syndromic Retinopathy v0.221 ELOVL4 Bryony Thompson edited their review of gene: ELOVL4: Changed rating: RED; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2461 ELOVL4 Bryony Thompson changed review comment from: Well-established gene-disease associations. Monoallelic loss-of-function variants are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.; to: Well-established gene-disease associations. Monoallelic truncating variants in the last exon with an expected dominant effect are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.
Mendeliome v1.2461 ELOVL1 Bryony Thompson Publications for gene: ELOVL1 were set to
Mendeliome v1.2460 ELOVL1 Bryony Thompson Mode of inheritance for gene: ELOVL1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2459 ELOVL1 Bryony Thompson reviewed gene: ELOVL1: Rating: RED; Mode of pathogenicity: None; Publications: 35379526; Phenotypes: ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facial features MONDO:0032798; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2459 ELOVL1 Bryony Thompson Deleted their review
Mendeliome v1.2459 EIF2AK4 Bryony Thompson Publications for gene: EIF2AK4 were set to
Mendeliome v1.2458 EIF2AK2 Bryony Thompson Phenotypes for gene: EIF2AK2 were changed from Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness; Dystonia to Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness; Dystonia; complex neurodevelopmental disorder MONDO:0100038
Mendeliome v1.2457 EIF2A Bryony Thompson Phenotypes for gene: EIF2A were changed from Intellectual disability, epilepsy to Intellectual disability, epilepsy; MONDO:0700092
Mendeliome v1.2456 EIF2AK1 Bryony Thompson Phenotypes for gene: EIF2AK1 were changed from Intellectual disability; white matter abnormalities to Intellectual disability; white matter abnormalities; MONDO:0100038
Mendeliome v1.2455 EGR2 Bryony Thompson Mode of inheritance for gene: EGR2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2454 EGR2 Bryony Thompson Mode of inheritance for gene: EGR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Fetal anomalies v1.321 EFNA4 Bryony Thompson Publications for gene: EFNA4 were set to 29215649; 29168297; 16540516
Fetal anomalies v1.320 EFNA4 Bryony Thompson Classified gene: EFNA4 as Red List (low evidence)
Fetal anomalies v1.320 EFNA4 Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence).
Fetal anomalies v1.319 EFNA4 Bryony Thompson reviewed gene: EFNA4: Rating: RED; Mode of pathogenicity: None; Publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816; Phenotypes: craniosynostosis MONDO:0015469; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Craniosynostosis v1.69 EFNA4 Bryony Thompson Classified gene: EFNA4 as Red List (low evidence)
Craniosynostosis v1.69 EFNA4 Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence).
Craniosynostosis v1.68 EFNA4 Bryony Thompson reviewed gene: EFNA4: Rating: RED; Mode of pathogenicity: None; Publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816; Phenotypes: craniosynostosis MONDO:0015469; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2453 EFNA4 Bryony Thompson Classified gene: EFNA4 as Red List (low evidence)
Mendeliome v1.2453 EFNA4 Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence).
Mendeliome v1.2452 EFNA4 Bryony Thompson changed review comment from: Supporting animal models, but no compelling evidence in human cases. There’s no supporting segregation evidence and most of the variants reports to date are more common than expected for a dominant disease.

PMID: 34586326 - 3 missense variants identified in a cohort of 101 children with non-syndromic craniosynostosis (EFNA4, c.178C>T: p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1, c.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr - 337 hets in gnomAD v2.1). All 3 variants were present in at least one non-affected family member

PMID: 23983218, 33065355 - Efna4 KO mouse line demonstrates skeletal variance. Homozygous Epha4 null mice had substantially less trabecular bone in femur and vertebra compared to wild-type controls

PMID: 29215649 - 1 missense variant (c.211G>A, p.(Glu71Lys) - 7 hets in gnomAD v2.1) identified in a unicoronal craniosynostosis case in a cohort of 309 craniosynostosis cases

PMID: 29168297 - 1 missense variant (c.550C>T; p.(Leu184Phe) - 1 het in gnomAD v2.1) in a metopic craniosynostosis case from a cohort of 391 single suture craniosynostosis cases. The variant was inherited from an unaffected parent.

PMID: 19772933 - a de novo 1.4 Mb microdeletion of chromosome 1q21.3, including EFNA1, EFNA3 and EFNA4, was identified in a child with moderate mental retardation, microcephaly, arching eyebrows, low set ears, long eyelashes, persistent fetal pads and clinodactyly.

PMID: 19201948 - EphA4 -/- mutant mice exhibit defects in the coronal suture and neural crest-mesoderm boundary that phenocopy those of Twist1+/- mice. The EphA4 +/- mice were similar to the wild-type controls.

PMID: 16540516 - 3 variants (178C>T p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1; c.349C>A p.Pro117Thr - 337 hets in gnomAD v2.1; frameshift 471_472delCCinsA) in cohort of 81 non-syndromic coronal synostosis cases. 2 of the variants were inherited from unaffected parents and Pro117Thr was de novo (confirmed). In vitro functional assays demonstrated partial or complete loss of function for the missense variants. Fibroblasts from the patient with the frameshift expressed in an alternatively spliced minor isoform of EFNA4.; to: Supporting animal models, but no compelling evidence in human cases has been reported since 2006. There’s no supporting segregation evidence and most of the variants reports to date are more common than expected for a dominant disease.

PMID: 34586326 - 3 missense variants identified in a cohort of 101 children with non-syndromic craniosynostosis (EFNA4, c.178C>T: p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1, c.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr - 337 hets in gnomAD v2.1). All 3 variants were present in at least one non-affected family member

PMID: 23983218, 33065355 - Efna4 KO mouse line demonstrates skeletal variance. Homozygous Epha4 null mice had substantially less trabecular bone in femur and vertebra compared to wild-type controls

PMID: 29215649 - 1 missense variant (c.211G>A, p.(Glu71Lys) - 7 hets in gnomAD v2.1) identified in a unicoronal craniosynostosis case in a cohort of 309 craniosynostosis cases

PMID: 29168297 - 1 missense variant (c.550C>T; p.(Leu184Phe) - 1 het in gnomAD v2.1) in a metopic craniosynostosis case from a cohort of 391 single suture craniosynostosis cases. The variant was inherited from an unaffected parent.

PMID: 19772933 - a de novo 1.4 Mb microdeletion of chromosome 1q21.3, including EFNA1, EFNA3 and EFNA4, was identified in a child with moderate mental retardation, microcephaly, arching eyebrows, low set ears, long eyelashes, persistent fetal pads and clinodactyly.

PMID: 19201948 - EphA4 -/- mutant mice exhibit defects in the coronal suture and neural crest-mesoderm boundary that phenocopy those of Twist1+/- mice. The EphA4 +/- mice were similar to the wild-type controls.

PMID: 16540516 - 3 variants (178C>T p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1; c.349C>A p.Pro117Thr - 337 hets in gnomAD v2.1; frameshift 471_472delCCinsA) in cohort of 81 non-syndromic coronal synostosis cases. 2 of the variants were inherited from unaffected parents and Pro117Thr was de novo (confirmed). In vitro functional assays demonstrated partial or complete loss of function for the missense variants. Fibroblasts from the patient with the frameshift expressed in an alternatively spliced minor isoform of EFNA4.
Mendeliome v1.2452 EFNA4 Bryony Thompson edited their review of gene: EFNA4: Changed rating: RED; Changed publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Marked gene: EFEMP1 as ready
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Gene: efemp1 has been classified as Green List (High Evidence).
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Added comment: Comment on phenotypes: Singe missense variant (p.Arg345Trp) associated with disease
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Phenotypes for gene: EFEMP1 were changed from Inherited macular dystrophy (Doyne/dominant drusen) to Doyne honeycomb retinal dystrophy MONDO:0007471
Macular Dystrophy/Stargardt Disease v0.52 EFEMP1 Bryony Thompson Publications for gene: EFEMP1 were set to
Mendeliome v1.2452 EFEMP1 Bryony Thompson Publications for gene: EFEMP1 were set to 32006683; 31792352; 33807164
Intellectual disability syndromic and non-syndromic v1.102 EEF1D Bryony Thompson Classified gene: EEF1D as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.102 EEF1D Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.101 EEF1D Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321
Mendeliome v1.2451 EEF1D Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321
Intellectual disability syndromic and non-syndromic v1.100 EEF1D Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2450 EEF1D Bryony Thompson Classified gene: EEF1D as Green List (high evidence)
Mendeliome v1.2450 EEF1D Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence).
Mendeliome v1.2449 EEF1D Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: None
Deafness_IsolatedAndComplex v1.214 EDN3 Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed
Deafness_IsolatedAndComplex v1.214 EDN3 Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Hirschsprung disease v0.26 EDN3 Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed
Hirschsprung disease v0.26 EDN3 Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Gastrointestinal neuromuscular disease v1.25 EDN3 Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed
Gastrointestinal neuromuscular disease v1.25 EDN3 Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Deafness_Isolated v1.70 EDN3 Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2449 EDARADD Bryony Thompson Publications for gene: EDARADD were set to
Prepair 1000+ v1.1868 MFN2 Melanie Marty reviewed gene: MFN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15064763, 15549395, 16437557, 20008656; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087, Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PDE6B Melanie Marty reviewed gene: PDE6B: Rating: RED; Mode of pathogenicity: None; Publications: 8394174, 8075643, 17044014, 7599633, 18854872, 33673512; Phenotypes: Retinitis pigmentosa-40, MIM#613801; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SCN9A Melanie Marty reviewed gene: SCN9A: Rating: GREEN; Mode of pathogenicity: None; Publications: 18060017; Phenotypes: Insensitivity to pain, congenital, MIM# 243000, Neuropathy, hereditary sensory and autonomic, type IID, MIM# 243000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v1.1 BLK Bryony Thompson Marked gene: BLK as ready
Predominantly Antibody Deficiency v1.1 BLK Bryony Thompson Gene: blk has been classified as Red List (Low Evidence).
Predominantly Antibody Deficiency v1.1 BLK Bryony Thompson gene: BLK was added
gene: BLK was added to Predominantly Antibody Deficiency. Sources: Literature
Mode of inheritance for gene: BLK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BLK were set to 25926555
Phenotypes for gene: BLK were set to Common variable immunodeficiency, MONDO:0015517
Review for gene: BLK was set to RED
Added comment: Two individuals in a single family heterozygous for a missense variant p.L3P (46 hets in gnomAD v4) reported with CVID. There have been no other reports in the last 10 years. In vitro functional assays of the variant.
Sources: Literature
Mendeliome v1.2448 BLK Bryony Thompson Classified gene: BLK as Red List (low evidence)
Mendeliome v1.2448 BLK Bryony Thompson Added comment: Comment on list classification: Two individuals in a single family heterozygous for a missense variant p.L3P (46 hets in gnomAD v4) reported with CVID. There have been no other reports in the last 10 years.
Mendeliome v1.2448 BLK Bryony Thompson Gene: blk has been classified as Red List (Low Evidence).
Prepair 1000+ v1.1868 PNPLA6 Andrew Coventry reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 38735647, 25480986, 33818269, 32758583, 30097146; Phenotypes: Boucher-Neuhauser syndrome MIM#215470, Oliver-McFarlane syndrome MIM#275400, Spastic paraplegia 39, autosomal recessive MIM#612020; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PAK3 Andrew Coventry reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9731525, 10946356, 12884430, 17853471, 18523455, 24556213, 25666757, 27753653, 28481730, 28126652; Phenotypes: Intellectual developmental disorder, X-linked 30 MIM#300558; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.1868 NAGA Andrew Coventry reviewed gene: NAGA: Rating: GREEN; Mode of pathogenicity: None; Publications: 11313741, 31468281, 15619430, 8782044; Phenotypes: Schindler disease, type I MIM#609241, Schindler disease, type III MIM#609241; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SEC23A Melanie Marty changed review comment from: SEC23A is an essential component of coat protein complex II (COPII)-coated vesicles that transport secretory proteins from the endoplasmic reticulum (ER) to the Golgi complex.

Boyadjiev et al 2006 (PMID:16980979): One family was reported with a homozygous missense variant and craniolenticulosutural dysplasia (CLSD), with some functional studies supporting pathogenicity.

Boyadjiev et al 2011 (PMID: 21039434): The same authors as above later reported another individual with similar phenotype with a paternally inherited heterozygous missense variant, this variant has 91 hets in gnomAD and the father was unaffected. They suggest digenic inheritance but found no other variants in 3 candidate genes.

Wang et al 2023 (PMID: 37828500): 2 x compound heterozygous missense variants were identified in a patient with CLSD.

Cisarova et al 2022 (PMID: 34580982) 1 x patient with het missense variant inherited from his affected father. Shown to be de novo in the father.

Minale et al 2024 (PMID: 38275611): 1 x patient with de novo het missense variant

Zebrafish models lend some support to the gene-disease association (PMID:16980979, 16980978)

Summary: 2 reports of AR inheritance, 2 reports of AD inheritance, 1 uncertain; to: SEC23A is an essential component of coat protein complex II (COPII)-coated vesicles that transport secretory proteins from the endoplasmic reticulum (ER) to the Golgi complex.

Boyadjiev et al 2006 (PMID:16980979): One family was reported with a homozygous missense variant and craniolenticulosutural dysplasia (CLSD), with some functional studies supporting pathogenicity.

Boyadjiev et al 2011 (PMID: 21039434): The same authors as above later reported another individual with similar phenotype with a paternally inherited heterozygous missense variant, this variant has 91 hets in gnomAD and the father was unaffected. They suggest digenic inheritance but found no other variants in 3 candidate genes.

Wang et al 2023 (PMID: 37828500): 2 x compound heterozygous missense variants were identified in a patient with CLSD.

Cisarova et al 2022 (PMID: 34580982) 1 x patient with CLSD and a het missense variant inherited from his affected father. Shown to be de novo in the father.

Minale et al 2024 (PMID: 38275611): 1 x patient with CLSD and a de novo het missense variant

Zebrafish models lend some support to the gene-disease association (PMID:16980979, 16980978)

Summary: 2 reports of AR inheritance, 2 reports of AD inheritance, 1 uncertain
Prepair 1000+ v1.1868 SEC23A Melanie Marty edited their review of gene: SEC23A: Changed rating: RED; Changed publications: 16980979, 21039434, 16980978, 27148587, 37828500, 34580982, 38275611
Prepair 1000+ v1.1868 SEC23A Melanie Marty reviewed gene: SEC23A: Rating: AMBER; Mode of pathogenicity: None; Publications: 16980979, 21039434, 16980978, 27148587, 37828500, 34580982, PMID: 38275611; Phenotypes: Craniolenticulosutural dysplasia, MIM#607812; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 MUSK Andrew Coventry reviewed gene: MUSK: Rating: GREEN; Mode of pathogenicity: None; Publications: 25537362, 25612909, 8653786, 31750350, 15496425, 19949040, 20371544, 32253145; Phenotypes: Fetal akinesia deformation sequence 1 MIM#208150, Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency MIM#616325; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 MTTP Andrew Coventry reviewed gene: MTTP: Rating: GREEN; Mode of pathogenicity: None; Publications: 17275380, 34078172, 34052173, 33258201; Phenotypes: Abetalipoproteinemia MIM#200100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 MTHFD1 Andrew Coventry reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32414565, 19033438; Phenotypes: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia MIM#617780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 MKS1 Andrew Coventry reviewed gene: MKS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17377820, 24886560, 19776033, 33193692, 27570071, 27377014, 18327255, 24608809; Phenotypes: Bardet-Biedl syndrome 13 MIM#615990, Joubert syndrome 28 MIM#617121, Meckel syndrome 1 MIM#249000, Ciliopathy MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 MBTPS2 Andrew Coventry reviewed gene: MBTPS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 19361614, 27380894, 34902613, 14708109, 22105905, 24313295, 19689518, 24090718, 21600032; Phenotypes: IFAP syndrome with or without BRESHECK syndrome MIM#308205, Osteogenesis imperfecta, type XIX MIM#301014; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.1868 LYST Andrew Coventry reviewed gene: LYST: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896560, 9215680, 31906877, 9215679, 26499269, 24112114, 28145517; Phenotypes: Chediak-Higashi syndrome MIM#214500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 LRMDA Andrew Coventry reviewed gene: LRMDA: Rating: GREEN; Mode of pathogenicity: None; Publications: 37053367, 23395477, 38555393; Phenotypes: Albinism, oculocutaneous, type VII MIM#615179, MONDO:0014070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 LARS2 Andrew Coventry reviewed gene: LARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29205794, 32423379, 30737337, 26537577, 23541342; Phenotypes: Hydrops, lactic acidosis, and sideroblastic anemia MIM#617021, Perrault syndrome 4 MIM#615300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 KIF7 Andrew Coventry reviewed gene: KIF7: Rating: GREEN; Mode of pathogenicity: None; Publications: 21552264, 36580738, 21633164, 19666503, 30445565, 26648833, 26349186, 26174511, 25714560; Phenotypes: Al-Gazali-Bakalinova syndrome MIM#607131, Hydrolethalus syndrome 2 MIM#614120, Acrocallosal syndrome MIM#200990, Joubert syndrome 12 MIM#200990; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 KIAA1109 Andrew Coventry reviewed gene: KIAA1109: Rating: GREEN; Mode of pathogenicity: None; Publications: 29290337, 30906834, 25558065; Phenotypes: Alkuraya-Kucinskas syndrome MIM#617822; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 KCNV2 Andrew Coventry reviewed gene: KCNV2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16909397, 18235024, 21882291, 15722315, 30820446, 21882291, 23115240; Phenotypes: Inherited retinal dystrophy MONDO:0019118, Retinal cone dystrophy 3B MIM#610356; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 INPP5K Andrew Coventry reviewed gene: INPP5K: Rating: GREEN; Mode of pathogenicity: None; Publications: 28190456, 28190459, 28940338, 31630891, 33193651, 33792664; Phenotypes: Muscular dystrophy, congenital, with cataracts and intellectual disability MIM#617404; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 IFT172 Andrew Coventry reviewed gene: IFT172: Rating: GREEN; Mode of pathogenicity: None; Publications: 30761183, 26763875, 25168386, 24140113, 25168386; Phenotypes: Bardet-Biedl syndrome 20 MIM#619471, Retinitis pigmentosa 71 MIM#616394, Short-rib thoracic dysplasia 10 with or without polydactyly MIM#615630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 IBA57 Andrew Coventry reviewed gene: IBA57: Rating: GREEN; Mode of pathogenicity: None; Publications: 23462291, 25971455, 25609768, 28913435, 28671726, 30258207; Phenotypes: Mitochondrial disease MONDO:0044970, Multiple mitochondrial dysfunctions syndrome 3 MIM#615330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 HSPD1 Andrew Coventry reviewed gene: HSPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571143, 27405012, 32532876, 28377887, 27405012; Phenotypes: Leukodystrophy, hypomyelinating, 4 MIM#612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 HPS3 Andrew Coventry reviewed gene: HPS3: Rating: GREEN; Mode of pathogenicity: None; Publications: 11455388, 31880485, 31621111, 30990103; Phenotypes: Hermansky-Pudlak syndrome 3 MIM#614072; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 HAMP Andrew Coventry reviewed gene: HAMP: Rating: GREEN; Mode of pathogenicity: None; Publications: 12469120, 12490283, 34828384, 15198949; Phenotypes: Hemochromatosis, type 2B MIM#613313; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 HADH Andrew Coventry reviewed gene: HADH: Rating: GREEN; Mode of pathogenicity: None; Publications: 1835339, 10347277, 10931422; Phenotypes: 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 GLDN Andrew Coventry reviewed gene: GLDN: Rating: GREEN; Mode of pathogenicity: None; Publications: 27616481, 32812332, 28726266, 35806855; Phenotypes: Lethal congenital contracture syndrome 11 MIM#617194; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 GBA Andrew Coventry reviewed gene: GBA: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Gaucher disease, perinatal lethal MIM#608013; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FTSJ1 Andrew Coventry reviewed gene: FTSJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15342698, 18081026, 15162322, 26310293; Phenotypes: Intellectual developmental disorder, X-linked 9 MIM#309549, X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.1868 FRAS1 Andrew Coventry reviewed gene: FRAS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12766769, 18671281, 16894541, 17163535; Phenotypes: Fraser syndrome 1 MIM#219000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FKBP14 Andrew Coventry reviewed gene: FKBP14: Rating: GREEN; Mode of pathogenicity: None; Publications: 22265013, 24773188, 27149304, 31132235, 30561154, 28617417; Phenotypes: Ehlers-Danlos syndrome, kyphoscoliotic type, 2 MIM#614557; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FGD4 Andrew Coventry reviewed gene: FGD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 17564959, 31152969, 28847448, 28543957, 17564972; Phenotypes: Charcot-Marie-Tooth disease, type 4H MIM#609311, Charcot-Marie-Tooth disease MONDO:0015626; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FANCL Andrew Coventry reviewed gene: FANCL: Rating: GREEN; Mode of pathogenicity: None; Publications: 19405097, 25754594, 33394227, 33224012, 12973351, 31513304; Phenotypes: Fanconi anemia, complementation group L MIM#614083; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FANCD2 Andrew Coventry reviewed gene: FANCD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301575, 17436244, 25703294, 23613520; Phenotypes: Fanconi anemia, complementation group D2 MIM#227646; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FAM20C Andrew Coventry reviewed gene: FAM20C: Rating: GREEN; Mode of pathogenicity: None; Publications: 19250384, 32299476, 20825432, 33676444, 32833257; Phenotypes: Raine syndrome MIM#259775; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 EIF2B3 Andrew Coventry reviewed gene: EIF2B3: Rating: GREEN; Mode of pathogenicity: None; Publications: 11835386, 19158808, 21484434, 18263758, 25843247, 25761052, 28904586, 28597716; Phenotypes: Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 POLE Andrew Coventry gene: POLE was added
gene: POLE was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: POLE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLE were set to 30503519; 23230001; 25948378; 36071887
Phenotypes for gene: POLE were set to IMAGE-I syndrome MIM#618336; FILS syndrome MIM#615139
Review for gene: POLE was set to GREEN
Added comment: IMAGE-I Syndrome
Autosomal recessive disorder characterised by intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency. Patients exhibit distinctive facial features and variable immune dysfunction with evidence of lymphocyte deficiency.
Well established gene-disease association. Reported in greater than 10 families.
Note recurrent intronic variant, c.1686+32C-G (intron 15) in IMAGE-I, found in combination with multiple other variants.

FILS syndrome
FILS syndrome is characterised by mild facial dysmorphism, mainly malar hypoplasia, livedo on the skin since birth, immunodeficiency resulting in recurrent infections, and short stature.
PMID: 23230001 - French consanguineoius kindred: 11 affected individuals displayed mild facial dysmorphism, immunodeficiency, livedo, and short stature. 3 additional members displayed two or three of these four features. Homozygous for splicing site variant: c.4444+3A>G.
PMID: 25948378 - Palestinian girl, with same homozygous variant as reported in French family.
PMID: 36071887 - 4y.o. Chinese boy with c.5811 + 2T > C and c.2006G > A variants.
PMID: 32705701 - 6y.o. hispanic boy reported with homozygous c.100C>T(p.Arg34Cys
Total of 14 affected individuals across 4 families.
Sources: Literature
Prepair 1000+ v1.1868 CHMP1A Andrew Coventry gene: CHMP1A was added
gene: CHMP1A was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: CHMP1A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHMP1A were set to 23023333; 37789895
Phenotypes for gene: CHMP1A were set to Pontocerebellar hypoplasia, type 8 MIM#614961
Review for gene: CHMP1A was set to AMBER
Added comment: Pontocerebellar hypoplasia type 8 is an autosomal recessive neurodevelopmental disorder characterised by severe psychomotor impediment, abnormal movements, hypotonia, spasticity, and variable visual defects. Brain MRI shows pontocerebellar hypoplasia, decreased cerebral white matter, and a thin corpus callosum.

Zebrafish model present.
PMID: 23023333 - Three families reported, 2 variants; two families likely with founder effect.
PMID: 37789895 - describe novel variants in an affected individual, one is deletion of exon 1, other is c.53 T > C (p.Leu18Pro).
Total 4 families now reported with 4 variants.
Sources: Literature
Prepair 1000+ v1.1868 POLR1D Andrew Coventry gene: POLR1D was added
gene: POLR1D was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: POLR1D was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: POLR1D were set to 21131976; 24603435; 27448281; 25790162
Phenotypes for gene: POLR1D were set to Treacher Collins syndrome 2 MIM#613717
Review for gene: POLR1D was set to AMBER
Added comment: Treacher Collins syndrome is a disorder of craniofacial development characterised by a combination of bilateral downward slanting of the palpebral fissures, colobomas of the lower eyelids with a paucity of eyelashes medial to the defect, hypoplasia of the facial bones, cleft palate, malformation of the external ears, atresia of the external auditory canals, and bilateral conductive hearing loss.

Currently, only one study reporting AR TCS, 1 pathogenic variant in 4 affected individuals, across 2 unrelated consanguineous families. PMID: 24603435.
Adding gene, requiring further evidence in humans for consideration for inclusion in screening of AR TCS.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.100 SPOUT1 Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154
Intellectual disability syndromic and non-syndromic v1.99 SPOUT1 Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v1.126 SPOUT1 Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154
Genetic Epilepsy v1.125 SPOUT1 Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v1.303 SPOUT1 Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154
Microcephaly v1.302 SPOUT1 Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2447 SPOUT1 Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2447 SPOUT1 Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154
Fetal anomalies v1.319 DISP1 Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly (MONDO:0016296), DISP1-related to Holoprosencephaly 10, MIM# 621143
Fetal anomalies v1.318 DISP1 Zornitza Stark edited their review of gene: DISP1: Changed phenotypes: Holoprosencephaly 10, MIM# 621143
Intellectual disability syndromic and non-syndromic v1.99 DISP1 Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly (MONDO:0016296), DISP1-related to Holoprosencephaly 10, MIM# 621143
Intellectual disability syndromic and non-syndromic v1.98 DISP1 Zornitza Stark edited their review of gene: DISP1: Changed phenotypes: Holoprosencephaly 10, MIM# 621143
Mendeliome v1.2446 DISP1 Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly, MONDO:0016296 to Holoprosencephaly 10, MIM# 621143
Holoprosencephaly and septo-optic dysplasia v1.18 DISP1 Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly, MONDO:0016296 to Holoprosencephaly 10, MIM# 621143
Hair disorders v0.73 KRT83 Zornitza Stark Phenotypes for gene: KRT83 were changed from Monilethrix, 158000 to Monilethrix, MIM#621170
Hair disorders v0.72 KRT83 Zornitza Stark edited their review of gene: KRT83: Changed phenotypes: Monilethrix , MIM#621170
Mendeliome v1.2445 KRT83 Zornitza Stark Phenotypes for gene: KRT83 were changed from Erythrokeratodermia variabilis et progressiva 5, MIM# 617756; Monilethrix , MIM#158000 to Erythrokeratodermia variabilis et progressiva 5, MIM# 617756; Monilethrix , MIM#621170
Mendeliome v1.2444 KRT83 Zornitza Stark edited their review of gene: KRT83: Changed phenotypes: Erythrokeratodermia variabilis et progressiva 5, MIM# 617756, Monilethrix , MIM#621170
Hair disorders v0.72 KRT81 Zornitza Stark Phenotypes for gene: KRT81 were changed from Monilethrix, MIM# 158000 to Monilethrix, MIM# 621169
Hair disorders v0.71 KRT81 Zornitza Stark edited their review of gene: KRT81: Changed phenotypes: Monilethrix, MIM# 621169
Mendeliome v1.2444 KRT81 Zornitza Stark Phenotypes for gene: KRT81 were changed from Monilethrix, MIM# 158000 to Monilethrix, MIM# 621169
Mendeliome v1.2443 KRT81 Zornitza Stark edited their review of gene: KRT81: Changed phenotypes: Monilethrix, MIM# 621169
Arrhythmia_SuperPanel v3.28 Bryony Thompson Panel status changed from promoted to public
Changed child panels to: Short QT syndrome; Atrial Fibrillation; Cardiac conduction disease; Arrhythmogenic Cardiomyopathy; Long QT Syndrome; Catecholaminergic Polymorphic Ventricular Tachycardia; Brugada syndrome; Ventricular Fibrillation
Cardiac conduction disease v1.0 Bryony Thompson promoted panel to version 1.0
Cardiac conduction disease v0.38 Bryony Thompson Panel status changed from internal to public
Cardiac conduction disease v0.36 GNB2 Bryony Thompson Deleted their review
Cardiac conduction disease v0.36 GNB2 Bryony Thompson gene: GNB2 was added
gene: GNB2 was added to Cardiac conduction disease. Sources: Literature
Mode of inheritance for gene: GNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GNB2 were set to 28219978
Phenotypes for gene: GNB2 were set to Sick sinus syndrome 4, MIM# 619464
Review for gene: GNB2 was set to RED
Added comment: Sources: Literature
Cardiac conduction disease v0.35 GJA5 Bryony Thompson Marked gene: GJA5 as ready
Cardiac conduction disease v0.35 GJA5 Bryony Thompson Gene: gja5 has been classified as Amber List (Moderate Evidence).
Cardiac conduction disease v0.35 GJA5 Bryony Thompson Classified gene: GJA5 as Amber List (moderate evidence)
Cardiac conduction disease v0.35 GJA5 Bryony Thompson Gene: gja5 has been classified as Amber List (Moderate Evidence).
Cardiac conduction disease v0.34 GJA5 Bryony Thompson gene: GJA5 was added
gene: GJA5 was added to Cardiac conduction disease. Sources: NHS GMS
Mode of inheritance for gene: GJA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GJA5 were set to 9501069; 10086977; 22247482; 36352534
Phenotypes for gene: GJA5 were set to heart conduction disease MONDO:0000992
Review for gene: GJA5 was set to AMBER
Added comment: PMID: 9501069, 10086977 - null mouse model with cardiac conduction abnormalities characteristic of first-degree atrioventricular block with associated bundle branch block
PMID: 22247482 - Q58L (absent from gnomAD v4) identified in a proband with progressive familial heart block, segregated to affected sibling and was likely present in mother that died of sudden cardiac death (the variant was absent from the probands father and maternal grandparents, suggesting the variant is de novo in the probands mother but no DNA was available for testing). In vitro functional assays showed the variant (Cx40-Q58L) impairs gap junction formation at cell-cell interfaces.
PMID: 36352534 - a VUS p.(Arg316His) was identified in a case with idiopathic atrioventricular conduction disease. 49 hets in gnomAD v4.
Sources: NHS GMS
Prepair 1000+ v1.1868 NUP107 Karina Sandoval reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065, 26411495; Phenotypes: Galloway-Mowat syndrome 7, MIM#618348, Nephrotic syndrome, type 11, MIM#616730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 NR0B1 Karina Sandoval reviewed gene: NR0B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19508677, 26030781; Phenotypes: Adrenal hypoplasia, congenital, MIM#300200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.1868 NDUFV2 Karina Sandoval reviewed gene: NDUFV2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33811136, 34405929, 12754703, 26008862, 30770271, 19167255; Phenotypes: Mitochondrial complex I deficiency, nuclear type 7, MIM#618229, MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 MAPKBP1 Karina Sandoval reviewed gene: MAPKBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28089251, 33623699, 32505465, 32055034; Phenotypes: Nephronophthisis 20, MIM# 617271, MONDO:0014997; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v1.125 ATP11A Bryony Thompson Marked gene: ATP11A as ready
Genetic Epilepsy v1.125 ATP11A Bryony Thompson Gene: atp11a has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.125 ATP11A Bryony Thompson Classified gene: ATP11A as Amber List (moderate evidence)
Genetic Epilepsy v1.125 ATP11A Bryony Thompson Gene: atp11a has been classified as Amber List (Moderate Evidence).
Leukodystrophy - paediatric v0.320 ATP11A Bryony Thompson Publications for gene: ATP11A were set to PMID: 34403372
Leukodystrophy - paediatric v0.319 ATP11A Bryony Thompson Classified gene: ATP11A as Green List (high evidence)
Leukodystrophy - paediatric v0.319 ATP11A Bryony Thompson Gene: atp11a has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.134 TRPM4 Bryony Thompson Publications for gene: TRPM4 were set to 30528822
Palmoplantar Keratoderma and Erythrokeratoderma v0.133 TRPM4 Bryony Thompson Classified gene: TRPM4 as Amber List (moderate evidence)
Palmoplantar Keratoderma and Erythrokeratoderma v0.133 TRPM4 Bryony Thompson Gene: trpm4 has been classified as Amber List (Moderate Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.132 TRPM4 Bryony Thompson reviewed gene: TRPM4: Rating: AMBER; Mode of pathogenicity: Other; Publications: 30528822, 36341417, 35796031; Phenotypes: erythrokeratodermia variabilis MONDO:0017851; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cardiac conduction disease v0.33 TRPM4 Bryony Thompson Marked gene: TRPM4 as ready
Cardiac conduction disease v0.33 TRPM4 Bryony Thompson Gene: trpm4 has been classified as Amber List (Moderate Evidence).
Cardiac conduction disease v0.33 TRPM4 Bryony Thompson Classified gene: TRPM4 as Amber List (moderate evidence)
Cardiac conduction disease v0.33 TRPM4 Bryony Thompson Gene: trpm4 has been classified as Amber List (Moderate Evidence).
Cardiac conduction disease v0.32 TRPM4 Bryony Thompson gene: TRPM4 was added
gene: TRPM4 was added to Cardiac conduction disease. Sources: NHS GMS
Mode of inheritance for gene: TRPM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPM4 were set to 19726882; 26820365; 21887725; 32681584; 20562447; 25531103; 27207958; 29568272; 29748318; 36352534; 35205305
Phenotypes for gene: TRPM4 were set to progressive familial heart block type IB MONDO:0011474
Mode of pathogenicity for gene: TRPM4 was set to Other
Review for gene: TRPM4 was set to AMBER
Added comment: A lot of the originally reported variants are more common in gnomAD than is expected for a dominant condition. However, there are at least 2 families that have decent segregation evidence and that suggest gain of function is the mechanism of disease. Loss of function variants are common in gnomAD.
Publications that contribute to gene-disease association:
PMID: 19726882 - linkage analysis in a large South African Afrikaner family with progressive familial heart block identified linkage to chromosomal locus 19q13.3. p.E7K was found to segregate with PFHB in the family. The variant was found to lead to a gain of function. The variant is rare in gnomAD v4 - 2 hets.
PMID: 26820365 - identified 13 “rare” TRPM4 variants in 95 unrelated patients with progressive cardiac conduction disease (PCCD). Some of the variants are a bit too common in gnomAD to be associated with dominant disease. One of the variants (p.Ile376Thr - 3 hets in gnomAD v4) segregated with PCCD in a large French 4-generation pedigree. TRPM4-p.I376T results in an increased current density in patch-clamp assays & augmented TRPM4 channel expression at the cell surface.
PMID: 21887725 - 8 “rare” TRPM4 variants identified in 160 cases with cardiac conduction disturbances. 3 of the variants had some supporting segregation evidence (Y790H - 3 segs, P970S - 1 seg, K914R - 1 seg)
PMID: 32681584 - in vitro functional assays on K914R which demonstrate a gain of function
Publications with uncertainty:
PMID: 20562447 - 3 families with dominant isolated cardiac conduction blocks were used for linkage analysis and a genomic interval on the long arm of chromosome 19 in an interval of ~300 genes. Screened 12 genes. TRPM4 p.Ala432Thr (L1 family), p.Arg164Trp (F1 family), p.Gly844Asp (F2 family). Ala432Thr and Gly844Asp are too common in gnomAD for a Mendelian AD disease (see below). Incomplete penetrance for p.Arg164Trp in family F1. All 3 variants increased current density in patch-clamp assays compared to WT (p<0.05).
PMID: 25531103 - null mouse model has cardiac hypertrophy and electrophysiological alterations
PMID: 27207958 - “rare” missense variants identified in children with atrioventricular block. Asp198Gly (2 hets in gnomAD v4), Ala432Thr/Gly582Ser present in 2 families (A432T - 558 alleles, 5 homs; G582S - 604 alleles, 7 homs in gnomAD v4) and also carried variants in SCN5 & NKX2.5, Thr677Ile (1 het in gnomAD v4), Val921Ile (101 alleles, 1 hom in gnomAD v4). Ala432Thr/Gly582Ser demonstrated loss of function in patch clamp assay - A432T alone was LoF, while G582S alone was GoF. D198G, T677I, and V921I didn’t alter function in the assays
PMID: 29568272 - p.A101T (3299 alleles, 51 homs), p.Q854R (1610 alleles, 5 homs), p.S1044C (7 hets), p.A101T/P1204L (5013 alleles, 11 homs). In patch-clamp assays, all variants reduced current except Q854R which increased the current (GoF)
PMID: 29748318 - synonymous variant c.858G>A shown to lead to exon 7 skipping, expected to cause loss of function identified in 2 siblings with cardiac conduction defects. It was inherited from apparently unaffected mother
PMID: 36352534, 35205305 - both report TRPM4 c.2351G>A, p.Gly844Asp in association with conduction disease. However, the variant is highly prevalent in gnomAD v4 (2200 alleles, 1 homozygote)
Sources: NHS GMS
Cardiac conduction disease v0.31 TBX5 Bryony Thompson Marked gene: TBX5 as ready
Cardiac conduction disease v0.31 TBX5 Bryony Thompson Gene: tbx5 has been classified as Green List (High Evidence).
Cardiac conduction disease v0.31 TBX5 Bryony Thompson Classified gene: TBX5 as Green List (high evidence)
Cardiac conduction disease v0.31 TBX5 Bryony Thompson Gene: tbx5 has been classified as Green List (High Evidence).
Cardiac conduction disease v0.30 TBX5 Bryony Thompson gene: TBX5 was added
gene: TBX5 was added to Cardiac conduction disease. Sources: NHS GMS
Mode of inheritance for gene: TBX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TBX5 were set to 20301290
Phenotypes for gene: TBX5 were set to Holt-Oram syndrome MONDO:0007732
Review for gene: TBX5 was set to GREEN
gene: TBX5 was marked as current diagnostic
Added comment: Conduction disease is a characteristic feature of the condition.
Sources: NHS GMS
Cardiac conduction disease v0.29 SCN1B Bryony Thompson Marked gene: SCN1B as ready
Cardiac conduction disease v0.29 SCN1B Bryony Thompson Gene: scn1b has been classified as Amber List (Moderate Evidence).
Cardiac conduction disease v0.29 SCN1B Bryony Thompson Classified gene: SCN1B as Amber List (moderate evidence)
Cardiac conduction disease v0.29 SCN1B Bryony Thompson Gene: scn1b has been classified as Amber List (Moderate Evidence).
Cardiac conduction disease v0.28 SCN1B Bryony Thompson gene: SCN1B was added
gene: SCN1B was added to Cardiac conduction disease. Sources: NHS GMS
Mode of inheritance for gene: SCN1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SCN1B were set to 19808477; 18464934; 28878239; 29758173
Phenotypes for gene: SCN1B were set to Heart conduction disease MONDO:0000992
Review for gene: SCN1B was set to AMBER
Added comment: This gene is disputed for Brugada syndrome. There is a single family reported with decent segregation evidence of a missense variant (p.Glu87Gln) with conduction disease, and another missense that has been reported in a case with AF, that has been reported as pathogenic for epilepsy.
PMID: 19808477 - R85H (8 hets in gnomAD v4) identified in a case with atrial fibrillation. This variant has also been reported in patients with GEFS and is reported LP/P in ClinVar. D153N (277 hets in gnomAD v4) also identified in a case with AF, but the variant is classified as a VUS.
PMID: 18464934 - Glu87Gln (3 hets in gnomAD v4) identified in a Turkish family with 2 siblings with conduction abnormalities, inherited from mother with no cardiac phenotype (later determined to have clinical atrioventricular nodal reentry tachycardia in PMID: 29758173). c.536G>A Trp179Ter in beta1B transcript (NM_001037.5:c.448+88G>A - 44 hets gnomAD v4) identified in a family with conduction disease (3 affected cases & 1 unaffected individual). c.537G>A p.Trp179Ter (NM_001037.5(SCN1B):c.448+89G>A - 1 het in gnomAD v4) identified in fam 3 - 1 affected case & 1 unaffected individual. Haploinsufficiency is the suggested mechanism of disease supported by electrophysiologic data.
PMID: 28878239 - in vitro functional assays suggesting Glu87Gln reduces sodium channel function.
PMID: 29758173 - study suggesting p.Trp179Ter is not associated with disease, but has updated information for the Turkish family with p.Glu87Gln strengthening the segregation of the variant with conduction disease
Sources: NHS GMS
Mendeliome v1.2443 ATP11A Sangavi Sivagnanasundram changed review comment from: PMID: 39432785 (upgraded to GREEN on leukodystrophy panel)
3 unrelated probands with variable neurological features presenting in childhood however only two presented with leukodystrophy like symptoms
Patient 1 (canadian) and 3 (USA) showed bilateral hypomyelination on brain MRI

PMID: 40185629 - refractory focal epilepsy (AMBER for epilepsy)
chinese probands - childhood cases
De novo missense variants were identified in the two unrelated probands of chinese descent
Case 1 - female patient experiencing epileptic seizures from the age of 4 - Lys812Ile
Case 2 - male patient experienceing epileptic seizures from the age of 7 - Trp1036Cys; to: PMID: 39432785 (upgraded to GREEN on leukodystrophy panel)
3 unrelated probands with variable neurological features presenting in childhood however only two presented with leukodystrophy like symptoms
Patient 1 (canadian) and 3 (USA) showed bilateral hypomyelination on brain MRI

PMID: 40185629 - Two chinese individuals reported with refractory focal epilepsy (AMBER for epilepsy)

De novo missense variants were identified in the two unrelated probands of chinese descent
Case 1 - female patient experiencing epileptic seizures from the age of 4 - Lys812Ile
Case 2 - male patient experienceing epileptic seizures from the age of 7 - Trp1036Cys
Genetic Epilepsy v1.124 ATP11A Sangavi Sivagnanasundram gene: ATP11A was added
gene: ATP11A was added to Genetic Epilepsy. Sources: Other
Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP11A were set to 40185629
Phenotypes for gene: ATP11A were set to Focal Epilepsy MONDO:0005384
Review for gene: ATP11A was set to AMBER
Added comment: PMID: 40185629 - Two chinese individuals reported with refractory focal epilepsy

De novo missense variants were identified in the two unrelated probands of chinese descent
Case 1 - female patient experiencing epileptic seizures from the age of 4 - Lys812Ile
Case 2 - male patient experienceing epileptic seizures from the age of 7 - Trp1036Cys
Sources: Other
Mendeliome v1.2443 ATP11A Sangavi Sivagnanasundram reviewed gene: ATP11A: Rating: GREEN; Mode of pathogenicity: None; Publications: 39432785, 40185629; Phenotypes: leukodystrophy, hypomyelinating, 24, MONDO:0859242, Focal epilepsy MONDO:0005384; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - paediatric v0.318 ATP11A Sangavi Sivagnanasundram reviewed gene: ATP11A: Rating: GREEN; Mode of pathogenicity: None; Publications: 39432785; Phenotypes: leukodystrophy, hypomyelinating, 24, MONDO:0859242; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lysosomal Storage Disorder v1.17 AP5B1 Bryony Thompson Marked gene: AP5B1 as ready
Lysosomal Storage Disorder v1.17 AP5B1 Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence).
Lysosomal Storage Disorder v1.17 AP5B1 Bryony Thompson Classified gene: AP5B1 as Amber List (moderate evidence)
Lysosomal Storage Disorder v1.17 AP5B1 Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence).
Lysosomal Storage Disorder v1.16 AP5B1 Bryony Thompson gene: AP5B1 was added
gene: AP5B1 was added to Lysosomal Storage Disorder. Sources: Literature
Mode of inheritance for gene: AP5B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP5B1 were set to 40081374
Phenotypes for gene: AP5B1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related
Review for gene: AP5B1 was set to AMBER
Added comment: Currently only 2 unrelated cases with macular dystrophy (1 hom & 1 chet). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. The AP-5 complex containing AP5Z1, AP5M1, and AP5B1, is integral to lysosome function. AP-5 deficiency results in the accumulation of aberrant endolysosomes, which is a lysosome storage disorder.
Sources: Literature
Macular Dystrophy/Stargardt Disease v0.51 AP5B1 Bryony Thompson Marked gene: AP5B1 as ready
Macular Dystrophy/Stargardt Disease v0.51 AP5B1 Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence).
Macular Dystrophy/Stargardt Disease v0.51 AP5B1 Bryony Thompson Classified gene: AP5B1 as Amber List (moderate evidence)
Macular Dystrophy/Stargardt Disease v0.51 AP5B1 Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2443 AP5B1 Bryony Thompson Marked gene: AP5B1 as ready
Mendeliome v1.2443 AP5B1 Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2443 AP5B1 Bryony Thompson Classified gene: AP5B1 as Amber List (moderate evidence)
Mendeliome v1.2443 AP5B1 Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence).
Macular Dystrophy/Stargardt Disease v0.50 AP5B1 Bryony Thompson gene: AP5B1 was added
gene: AP5B1 was added to Macular Dystrophy/Stargardt Disease. Sources: Literature
Mode of inheritance for gene: AP5B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP5B1 were set to 40081374
Phenotypes for gene: AP5B1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related
Review for gene: AP5B1 was set to AMBER
Added comment: Currently only 2 unrelated cases with macular dystrophy (1 hom & 1 chet). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants.
Sources: Literature
Mendeliome v1.2442 AP5B1 Bryony Thompson gene: AP5B1 was added
gene: AP5B1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: AP5B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP5B1 were set to 40081374
Phenotypes for gene: AP5B1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related
Review for gene: AP5B1 was set to AMBER
Added comment: Currently only 2 unrelated cases with macular dystrophy (1 hom & 1 chet). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants.
Sources: Literature
Mendeliome v1.2441 AP5M1 Bryony Thompson Marked gene: AP5M1 as ready
Mendeliome v1.2441 AP5M1 Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence).
Lysosomal Storage Disorder v1.15 AP5M1 Bryony Thompson Classified gene: AP5M1 as Green List (high evidence)
Lysosomal Storage Disorder v1.15 AP5M1 Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence).
Lysosomal Storage Disorder v1.14 AP5M1 Bryony Thompson gene: AP5M1 was added
gene: AP5M1 was added to Lysosomal Storage Disorder. Sources: Literature
Mode of inheritance for gene: AP5M1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP5M1 were set to 40081374
Phenotypes for gene: AP5M1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related
Review for gene: AP5M1 was set to GREEN
Added comment: 3 unrelated cases with macular dystrophy and homozygous variants (2x nonsense & a missense). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. The AP-5 complex containing AP5Z1, AP5M1, and AP5B1, is integral to lysosome function. AP-5 deficiency results in the accumulation of aberrant endolysosomes, which is a lysosome storage disorder.
Sources: Literature
Lysosomal Storage Disorder v1.13 AP5Z1 Bryony Thompson Marked gene: AP5Z1 as ready
Lysosomal Storage Disorder v1.13 AP5Z1 Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence).
Lysosomal Storage Disorder v1.13 AP5Z1 Bryony Thompson reviewed gene: AP5Z1: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081374, 29381698, 26085577; Phenotypes: Spastic paraplegia 48, autosomal recessive, MIM# 613647; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Macular Dystrophy/Stargardt Disease v0.49 AP5M1 Bryony Thompson Marked gene: AP5M1 as ready
Macular Dystrophy/Stargardt Disease v0.49 AP5M1 Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence).
Macular Dystrophy/Stargardt Disease v0.49 AP5M1 Bryony Thompson Classified gene: AP5M1 as Green List (high evidence)
Macular Dystrophy/Stargardt Disease v0.49 AP5M1 Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence).
Macular Dystrophy/Stargardt Disease v0.48 AP5M1 Bryony Thompson gene: AP5M1 was added
gene: AP5M1 was added to Macular Dystrophy/Stargardt Disease. Sources: Literature
Mode of inheritance for gene: AP5M1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP5M1 were set to 40081374
Phenotypes for gene: AP5M1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related
Review for gene: AP5M1 was set to GREEN
Added comment: 3 unrelated cases with macular dystrophy and homozygous variants (2x nonsense & a missense). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants.
Sources: Literature
Mendeliome v1.2441 AP5M1 Bryony Thompson Classified gene: AP5M1 as Green List (high evidence)
Mendeliome v1.2441 AP5M1 Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence).
Mendeliome v1.2440 AP5M1 Bryony Thompson gene: AP5M1 was added
gene: AP5M1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: AP5M1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP5M1 were set to 40081374
Phenotypes for gene: AP5M1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related
Review for gene: AP5M1 was set to GREEN
Added comment: 3 unrelated cases with macular dystrophy and homozygous variants (2x nonsense & a missense). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants.
Sources: Literature
Mendeliome v1.2439 AP5Z1 Bryony Thompson reviewed gene: AP5Z1: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081374, 33543803; Phenotypes: Spastic paraplegia 48, autosomal recessive, MIM# 613647, MONDO:0013342, Hereditary macular dystrophy MONDO:0020242; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Macular Dystrophy/Stargardt Disease v0.47 AP5Z1 Bryony Thompson Marked gene: AP5Z1 as ready
Macular Dystrophy/Stargardt Disease v0.47 AP5Z1 Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence).
Macular Dystrophy/Stargardt Disease v0.47 AP5Z1 Bryony Thompson Classified gene: AP5Z1 as Green List (high evidence)
Macular Dystrophy/Stargardt Disease v0.47 AP5Z1 Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence).
Macular Dystrophy/Stargardt Disease v0.46 AP5Z1 Bryony Thompson gene: AP5Z1 was added
gene: AP5Z1 was added to Macular Dystrophy/Stargardt Disease. Sources: Literature
Mode of inheritance for gene: AP5Z1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP5Z1 were set to 40081374
Phenotypes for gene: AP5Z1 were set to Hereditary macular dystrophy MONDO:0020242
Review for gene: AP5Z1 was set to GREEN
gene: AP5Z1 was marked as current diagnostic
Added comment: 14 families reported with biallelic variants in AP5Z1 with mainly adult-onset macular dystrophy, isolated or with extraocular features (including Parkinsonism, mild ID, HSP, peripheral neuropathy, hearing loss). The authors' suggest that macular dystrophy could be a presenting feature before HSP (or other extraocular features).
Sources: Literature
Hereditary Spastic Paraplegia - paediatric v1.90 AP5Z1 Bryony Thompson Classified gene: AP5Z1 as Green List (high evidence)
Hereditary Spastic Paraplegia - paediatric v1.90 AP5Z1 Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia - paediatric v1.89 AP5Z1 Bryony Thompson reviewed gene: AP5Z1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39059408, 26085577, 33543803; Phenotypes: Spastic paraplegia 48, autosomal recessive, MIM# 613647; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Congenital Heart Defect v0.439 KCTD10 Bryony Thompson Classified gene: KCTD10 as Green List (high evidence)
Congenital Heart Defect v0.439 KCTD10 Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.438 KCTD10 Bryony Thompson Classified gene: KCTD10 as Green List (high evidence)
Congenital Heart Defect v0.438 KCTD10 Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.437 KCTD10 Bryony Thompson Marked gene: KCTD10 as ready
Congenital Heart Defect v0.437 KCTD10 Bryony Thompson Gene: kctd10 has been classified as Red List (Low Evidence).
Mendeliome v1.2439 KCTD10 Bryony Thompson Marked gene: KCTD10 as ready
Mendeliome v1.2439 KCTD10 Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.437 KCTD10 Bryony Thompson gene: KCTD10 was added
gene: KCTD10 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: KCTD10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCTD10 were set to 24705121; 24430697; 38489388; 40121532
Phenotypes for gene: KCTD10 were set to multiple congenital anomalies/dysmorphic syndrome MONDO:0019042, KCTD10-related
Review for gene: KCTD10 was set to GREEN
Added comment: Two unrelated probands with multiple congenital anomalies, both with abnormalities of the cardiovascular system and confirmed de novo novel missense variants (p.R248Q and p.N169S). There were also additional individuals (<5) in the GeneDx in-house database who didn’t consent to case-level publication with confirmed de novo missesne variants in KCTD10 and overlapping phenotypes (100% with abnormalities of the cardiovascular system). Other congenital anomalies of different organs systems were present in 33-67% of the individuals. Further elucidation of the phenotypes associated with this gene are required. Additionally, null mouse and zebrafish models suggest Kctd10 is critical for cardiovascular development and is involved in the regulation of brain development.
Sources: Literature
Mendeliome v1.2439 KCTD10 Bryony Thompson Classified gene: KCTD10 as Green List (high evidence)
Mendeliome v1.2439 KCTD10 Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence).
Mendeliome v1.2438 KCTD10 Bryony Thompson gene: KCTD10 was added
gene: KCTD10 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: KCTD10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCTD10 were set to 24705121; 24430697; 38489388; 40121532
Phenotypes for gene: KCTD10 were set to multiple congenital anomalies/dysmorphic syndrome MONDO:0019042, KCTD10-related
Review for gene: KCTD10 was set to GREEN
Added comment: Two unrelated probands with multiple congenital anomalies, both with abnormalities of the cardiovascular system and confirmed de novo novel missense variants (p.R248Q and p.N169S). There were also additional individuals (<5) in the GeneDx in-house database who didn’t consent to case-level publication with confirmed de novo missesne variants in KCTD10 and overlapping phenotypes (100% with abnormalities of the cardiovascular system). Other congenital anomalies of different organs systems were present in 33-67% of the individuals. Further elucidation of the phenotypes associated with this gene are required. Additionally, null mouse and zebrafish models suggest Kctd10 is critical for cardiovascular development and is involved in the regulation of brain development.
Sources: Literature
Mendeliome v1.2437 ATP6V1B1 Sarah Leigh reviewed gene: ATP6V1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39837581, 9916796, 12566520, 18798332; Phenotypes: Distal renal tubular acidosis 2 with progressive sensorineural hearing loss, MIM#267300; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 COL11A2 Melanie Marty edited their review of gene: COL11A2: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 COL11A2 Melanie Marty changed review comment from: The gene-disease association with otospondylomegaepiphyseal dysplasia is well established (DEFINITIVE) by ClinGen, and deafness is part of the phenotype, both mono-allelic and bi-allelic variants are reported. Otospondylomegaepiphyseal dysplasia AD (OSMED, MIM#184840) is also known as non-ocular Stickler syndrome or Type III Stickler syndrome.

There are also a number of reports of mono-allelic and bi-allelic variants associated with isolated deafness (PMIDs: 10581026;25633957;16033917), and rated as MODERATE by ClinGen for AR and DEFINITIVE for AD. Bi-allelic variants are associated with severe pre lingual deafness.

Fibrochondrogenesis 2 a severe skeletal dysplasia is associated with AD and AR.; to: The gene-disease association with otospondylomegaepiphyseal dysplasia is well established (DEFINITIVE) by ClinGen, and deafness is part of the phenotype, both mono-allelic and bi-allelic variants are reported. Otospondylomegaepiphyseal dysplasia AD (OSMED, MIM#184840) is also known as non-ocular Stickler syndrome or Type III Stickler syndrome.

There are also a number of reports of mono-allelic and bi-allelic variants associated with isolated deafness (PMIDs: 10581026;25633957;16033917), and rated as MODERATE by ClinGen for AR and DEFINITIVE for AD. Bi-allelic variants are associated with severe pre lingual deafness.

Fibrochondrogenesis 2 a severe skeletal dysplasia is associated with AD and AR.

Only including the AR phenotypes for this screening panel.
Prepair 1000+ v1.1868 COL11A2 Melanie Marty reviewed gene: COL11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10581026, 25633957, 16033917, 25240749, 22796475, 20112039; Phenotypes: Deafness, autosomal recessive 53 MIM#609706, Fibrochondrogenesis 2 MIM#614524, Otospondylomegaepiphyseal dysplasia, autosomal recessive MIM#215150; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2437 CDKL2 Zornitza Stark Marked gene: CDKL2 as ready
Mendeliome v1.2437 CDKL2 Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2437 CDKL2 Zornitza Stark Classified gene: CDKL2 as Amber List (moderate evidence)
Mendeliome v1.2437 CDKL2 Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2436 CDKL2 Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Marked gene: CDKL2 as ready
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Classified gene: CDKL2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.98 CDKL2 Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.97 CDKL2 Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Marked gene: CDKL1 as ready
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Classified gene: CDKL1 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v1.97 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2436 CDKL1 Zornitza Stark Marked gene: CDKL1 as ready
Mendeliome v1.2436 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence).
Mendeliome v1.2436 CDKL1 Zornitza Stark Classified gene: CDKL1 as Red List (low evidence)
Mendeliome v1.2436 CDKL1 Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence).
Mendeliome v1.2435 CDKL1 Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 1000+ v1.1868 TRIT1 Zornitza Stark Marked gene: TRIT1 as ready
Prepair 1000+ v1.1868 TRIT1 Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1868 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from Combined oxidative phosphorylation deficiency 35, 617873 (3), Autosomal recessive to Combined oxidative phosphorylation deficiency 35 MIM#617873
Prepair 1000+ v1.1867 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Prepair 1000+ v1.1866 NEB Zornitza Stark Publications for gene: NEB were set to 27228465
Prepair 500+ v1.7 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Prepair 500+ v1.7 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Prepair 500+ v1.7 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from Galloway-Mowat syndrome 3, 617729 (3), Autosomal recessive to Galloway-Mowat syndrome 3, MIM# 617729
Prepair 500+ v1.6 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Prepair 1000+ v1.1865 OSTM1 Zornitza Stark Marked gene: OSTM1 as ready
Prepair 1000+ v1.1865 OSTM1 Zornitza Stark Gene: ostm1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1865 OSTM1 Zornitza Stark Phenotypes for gene: OSTM1 were changed from Osteopetrosis, autosomal recessive 5, 259720 (3) to Osteopetrosis, autosomal recessive 5, MIM#259720
Prepair 1000+ v1.1864 OSTM1 Zornitza Stark Publications for gene: OSTM1 were set to
Prepair 1000+ v1.1863 OSTM1 Zornitza Stark reviewed gene: OSTM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Osteopetrosis, autosomal recessive 5, MIM#259720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1863 PCDH15 Zornitza Stark Marked gene: PCDH15 as ready
Prepair 1000+ v1.1863 PCDH15 Zornitza Stark Gene: pcdh15 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1863 PCDH15 Zornitza Stark Phenotypes for gene: PCDH15 were changed from Usher syndrome, type 1F, 602083 (3) to Usher syndrome, type 1F, MIM# 602083
Prepair 1000+ v1.1862 PCDH15 Zornitza Stark Publications for gene: PCDH15 were set to
Prepair 1000+ v1.1861 SLC39A8 Zornitza Stark Marked gene: SLC39A8 as ready
Prepair 1000+ v1.1861 SLC39A8 Zornitza Stark Gene: slc39a8 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1861 SLC39A8 Zornitza Stark Phenotypes for gene: SLC39A8 were changed from Congenital disorder of glycosylation, type IIn, 616721 (3), Autosomal recessive to Congenital disorder of glycosylation, type IIn MIM#616721
Prepair 1000+ v1.1860 SLC39A8 Zornitza Stark Publications for gene: SLC39A8 were set to
Prepair 1000+ v1.1859 SRD5A3 Zornitza Stark Marked gene: SRD5A3 as ready
Prepair 1000+ v1.1859 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1859 SRD5A3 Zornitza Stark Phenotypes for gene: SRD5A3 were changed from Congenital disorder of glycosylation, type Iq, 612379 (3) to Congenital disorder of glycosylation, type Iq MIM#612379; Kahrizi syndrome#612713; SRD5A3-congenital disorder of glycosylation (MONDO:0012885)
Prepair 1000+ v1.1858 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Prepair 1000+ v1.1857 TBC1D23 Zornitza Stark Marked gene: TBC1D23 as ready
Prepair 1000+ v1.1857 TBC1D23 Zornitza Stark Gene: tbc1d23 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1857 TBC1D23 Zornitza Stark Phenotypes for gene: TBC1D23 were changed from Pontocerebellar hypoplasia, type 11, 617695 (3), Autosomal recessive to Pontocerebellar hypoplasia, type 11, MIM#617695
Prepair 1000+ v1.1856 TBC1D23 Zornitza Stark Publications for gene: TBC1D23 were set to
Prepair 1000+ v1.1855 LRSAM1 Zornitza Stark Tag for review tag was added to gene: LRSAM1.
Prepair 1000+ v1.1855 TCIRG1 Zornitza Stark Marked gene: TCIRG1 as ready
Prepair 1000+ v1.1855 TCIRG1 Zornitza Stark Gene: tcirg1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1855 TCIRG1 Zornitza Stark Phenotypes for gene: TCIRG1 were changed from Osteopetrosis, autosomal recessive 1, 259700 (3) to Osteopetrosis, autosomal recessive 1 MIM#259700
Prepair 1000+ v1.1854 TCIRG1 Zornitza Stark Publications for gene: TCIRG1 were set to
Prepair 1000+ v1.1853 PEX7 Zornitza Stark Marked gene: PEX7 as ready
Prepair 1000+ v1.1853 PEX7 Zornitza Stark Gene: pex7 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1853 PEX7 Zornitza Stark Phenotypes for gene: PEX7 were changed from Chondrodysplasia punctata, rhizomelic, type 1, 215100 (3) to Peroxisome biogenesis disorder 9B, MIM# 614879; Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100
Prepair 1000+ v1.1852 PEX7 Zornitza Stark Publications for gene: PEX7 were set to
Prepair 1000+ v1.1851 PGAP1 Zornitza Stark Marked gene: PGAP1 as ready
Prepair 1000+ v1.1851 PGAP1 Zornitza Stark Gene: pgap1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1851 PGAP1 Zornitza Stark Phenotypes for gene: PGAP1 were changed from Mental retardation, autosomal recessive 42, 615802 (3), Autosomal recessive to Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802
Prepair 1000+ v1.1850 PGAP1 Zornitza Stark Publications for gene: PGAP1 were set to
Prepair 1000+ v1.1849 POC1A Zornitza Stark Marked gene: POC1A as ready
Prepair 1000+ v1.1849 POC1A Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1849 POC1A Zornitza Stark Phenotypes for gene: POC1A were changed from Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, 614813 (3) to Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813
Prepair 1000+ v1.1848 POC1A Zornitza Stark Publications for gene: POC1A were set to
Prepair 1000+ v1.1847 PPA2 Zornitza Stark Marked gene: PPA2 as ready
Prepair 1000+ v1.1847 PPA2 Zornitza Stark Gene: ppa2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1847 PPA2 Zornitza Stark Phenotypes for gene: PPA2 were changed from Sudden cardiac failure, infantile, 617222 (3), Autosomal recessive to Sudden cardiac failure, infantile, MIM#617222; Sudden cardiac failure, alcohol-induced, MIM#617223
Prepair 1000+ v1.1846 PPA2 Zornitza Stark Publications for gene: PPA2 were set to
Prepair 1000+ v1.1845 VPS33B Zornitza Stark Marked gene: VPS33B as ready
Prepair 1000+ v1.1845 VPS33B Zornitza Stark Gene: vps33b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1845 VPS33B Zornitza Stark Phenotypes for gene: VPS33B were changed from Arthrogryposis, renal dysfunction, and cholestasis 1, 208085 (3) to Arthrogryposis, renal dysfunction, and cholestasis 1 MIM#208085; Cholestasis, progressive familial intrahepatic, 12 MIM#620010; Keratoderma-ichthyosis-deafness syndrome, autosomal recessive MIM#620009
Prepair 1000+ v1.1844 VPS33B Zornitza Stark Publications for gene: VPS33B were set to
Prepair 1000+ v1.1843 PRDM12 Zornitza Stark Marked gene: PRDM12 as ready
Prepair 1000+ v1.1843 PRDM12 Zornitza Stark Gene: prdm12 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1843 PRDM12 Zornitza Stark Phenotypes for gene: PRDM12 were changed from Neuropathy, hereditary sensory and autonomic, type VIII, 616488 (3), Autosomal recessive to Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488
Prepair 1000+ v1.1842 PRDM12 Zornitza Stark Publications for gene: PRDM12 were set to
Prepair 1000+ v1.1841 PRX Zornitza Stark Marked gene: PRX as ready
Prepair 1000+ v1.1841 PRX Zornitza Stark Gene: prx has been classified as Green List (High Evidence).
Prepair 1000+ v1.1841 PRX Zornitza Stark Phenotypes for gene: PRX were changed from Dejerine-Sottas disease, 145900 (3) to Charcot-Marie-Tooth disease, type 4F, MIM# 614895; Dejerine-Sottas disease, MIM# 145900
Prepair 1000+ v1.1840 PRX Zornitza Stark Publications for gene: PRX were set to
Prepair 1000+ v1.1839 PUS1 Zornitza Stark Marked gene: PUS1 as ready
Prepair 1000+ v1.1839 PUS1 Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1839 PUS1 Zornitza Stark Phenotypes for gene: PUS1 were changed from Mitochondrial myopathy and sideroblastic anemia 1, 600462 (3) to Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462
Prepair 1000+ v1.1838 PUS1 Zornitza Stark Publications for gene: PUS1 were set to
Prepair 1000+ v1.1837 QDPR Zornitza Stark Marked gene: QDPR as ready
Prepair 1000+ v1.1837 QDPR Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence).
Prepair 1000+ v1.1837 QDPR Zornitza Stark Phenotypes for gene: QDPR were changed from Hyperphenylalaninemia, BH4-deficient, C, 261630 (3) to Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630
Prepair 1000+ v1.1836 QDPR Zornitza Stark Publications for gene: QDPR were set to
Prepair 1000+ v1.1835 RAB27A Zornitza Stark Marked gene: RAB27A as ready
Prepair 1000+ v1.1835 RAB27A Zornitza Stark Gene: rab27a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1835 RAB27A Zornitza Stark Phenotypes for gene: RAB27A were changed from Griscelli syndrome, type 2, 607624 (3) to Griscelli syndrome, type 2, MIM# 607624
Prepair 1000+ v1.1834 RAB27A Zornitza Stark Publications for gene: RAB27A were set to
Prepair 1000+ v1.1833 RAD50 Zornitza Stark Marked gene: RAD50 as ready
Prepair 1000+ v1.1833 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1833 RAD50 Zornitza Stark Phenotypes for gene: RAD50 were changed from Nijmegen breakage syndrome-like disorder, 613078 (3) to Nijmegen breakage syndrome-like disorder, MIM# 613078
Prepair 1000+ v1.1832 RAD50 Zornitza Stark Publications for gene: RAD50 were set to
Prepair 1000+ v1.1831 RPGRIP1L Zornitza Stark Marked gene: RPGRIP1L as ready
Prepair 1000+ v1.1831 RPGRIP1L Zornitza Stark Gene: rpgrip1l has been classified as Green List (High Evidence).
Prepair 1000+ v1.1831 RPGRIP1L Zornitza Stark Phenotypes for gene: RPGRIP1L were changed from Meckel syndrome 5, 611561 (3) to Joubert syndrome 7, MIM# 611560; Meckel syndrome 5, MIM# 611561; COACH syndrome 3, MIM# 619113; Ciliopathy, RPGRIP1L-related, MONDO:0005308
Prepair 1000+ v1.1830 RPGRIP1L Zornitza Stark Publications for gene: RPGRIP1L were set to
Prepair 1000+ v1.1829 SLC1A4 Zornitza Stark Marked gene: SLC1A4 as ready
Prepair 1000+ v1.1829 SLC1A4 Zornitza Stark Gene: slc1a4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1829 SLC1A4 Zornitza Stark Publications for gene: SLC1A4 were set to
Prepair 1000+ v1.1828 ABCB11 Zornitza Stark Marked gene: ABCB11 as ready
Prepair 1000+ v1.1828 ABCB11 Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1828 ABCB11 Zornitza Stark Phenotypes for gene: ABCB11 were changed from Cholestasis, progressive familial intrahepatic 2, 601847 (3) to Cholestasis, progressive familial intrahepatic 2, MIM# 601847
Prepair 1000+ v1.1827 ABCB11 Zornitza Stark Publications for gene: ABCB11 were set to
Prepair 1000+ v1.1826 FITM2 Zornitza Stark Tag for review tag was added to gene: FITM2.
Mendeliome v1.2435 EIF4ENIF1 Zornitza Stark Publications for gene: EIF4ENIF1 were set to 31810472; 23902945; 33095795
Mendeliome v1.2434 EIF4ENIF1 Zornitza Stark Classified gene: EIF4ENIF1 as Green List (high evidence)
Mendeliome v1.2434 EIF4ENIF1 Zornitza Stark Gene: eif4enif1 has been classified as Green List (High Evidence).
Mendeliome v1.2433 EIF4ENIF1 Zornitza Stark reviewed gene: EIF4ENIF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23902945, 39827467, 36030004, 38604507, 31810472, 33095795; Phenotypes: Primary ovarian insufficiency, MONDO:0005387, EIF4ENIF1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.344 EIF4ENIF1 Zornitza Stark Publications for gene: EIF4ENIF1 were set to 31810472; 23902945; 33095795
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.343 EIF4ENIF1 Zornitza Stark Classified gene: EIF4ENIF1 as Green List (high evidence)
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.343 EIF4ENIF1 Zornitza Stark Gene: eif4enif1 has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.342 EIF4ENIF1 Zornitza Stark reviewed gene: EIF4ENIF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23902945, 39827467, 36030004, 38604507, 31810472, 33095795; Phenotypes: Primary ovarian insufficiency, MONDO:0005387, EIF4ENIF1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 1000+ v1.1826 FITM2 Melanie Marty edited their review of gene: FITM2: Changed publications: 28067622, 30214770, 30288795, 35754111
Prepair 1000+ v1.1826 FITM2 Melanie Marty reviewed gene: FITM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 28067622, 30214770, 30288795, 28067622, 35754111; Phenotypes: Siddiqi syndrome, MIM#618635; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 ABCB11 Melanie Marty reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 SLC1A4 Melanie Marty reviewed gene: SLC1A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25930971, 26138499, 26041762, 27193218, 29989513; Phenotypes: Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 SETX Melanie Marty reviewed gene: SETX: Rating: GREEN; Mode of pathogenicity: None; Publications: 23129421; Phenotypes: Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 (MIM#606002); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 RPGRIP1L Melanie Marty reviewed gene: RPGRIP1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 17558409, 17558407, 17960139, 26071364, 19574260, 29991045; Phenotypes: Joubert syndrome 7, MIM# 611560, Meckel syndrome 5, MIM# 611561, COACH syndrome 3, MIM# 619113, Ciliopathy, RPGRIP1L-related, MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 RAD50 Melanie Marty reviewed gene: RAD50: Rating: GREEN; Mode of pathogenicity: None; Publications: 19409520, 32212377, 33378670; Phenotypes: Nijmegen breakage syndrome-like disorder, MIM# 613078; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 RAB27A Melanie Marty reviewed gene: RAB27A: Rating: GREEN; Mode of pathogenicity: None; Publications: 32374962, 32107531; Phenotypes: Griscelli syndrome, type 2, MIM# 607624; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 QDPR Melanie Marty reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 11153907; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 PUS1 Melanie Marty reviewed gene: PUS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25227147, 17056637, 15108122, 32287105, 31641589, 28832011; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 PRX Melanie Marty reviewed gene: PRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 11133365, 11157804, 15197604, 21079185, 22847150, 10839370, 32460404, 31523542, 31426691; Phenotypes: Charcot-Marie-Tooth disease, type 4F, MIM# 614895, Dejerine-Sottas disease, MIM# 145900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 PRDM12 Melanie Marty reviewed gene: PRDM12: Rating: GREEN; Mode of pathogenicity: None; Publications: 26005867, 33789102, 33010785, 32828702; Phenotypes: Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 VPS33B Michelle Torres reviewed gene: VPS33B: Rating: GREEN; Mode of pathogenicity: None; Publications: 31479177, 30561130, 28017832; Phenotypes: Arthrogryposis, renal dysfunction, and cholestasis 1 MIM#208085, Cholestasis, progressive familial intrahepatic, 12 MIM#620010, Keratoderma-ichthyosis-deafness syndrome, autosomal recessive MIM#620009; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 PPA2 Melanie Marty reviewed gene: PPA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27523598, 34400813; Phenotypes: Sudden cardiac failure, infantile, MIM#617222, Sudden cardiac failure, alcohol-induced, MIM#617223; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 POC1A Melanie Marty reviewed gene: POC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22840364, 22840363, 26374189, 26162852, 26791357; Phenotypes: Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 PGAP1 Melanie Marty reviewed gene: PGAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24784135, 25823418, 25804403, 26050939; Phenotypes: Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 PEX7 Melanie Marty reviewed gene: PEX7: Rating: GREEN; Mode of pathogenicity: None; Publications: 11781871, 12522768, 12325024; Phenotypes: Peroxisome biogenesis disorder 9B, MIM# 614879, Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 TCIRG1 Michelle Torres reviewed gene: TCIRG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34624559, 34210262, 30084437, 28816234; Phenotypes: Osteopetrosis, autosomal recessive 1 MIM#259700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 LRSAM1 Melanie Marty changed review comment from: Only a single family reported with recessive inheritance.

Over 30 families reported with dominant disease.

Age of onset typically between the second and fifth decades of life.

Marking as red for carrier screening due to age of onset and limited evidence for recessive disease.; to: Only a single family reported with recessive inheritance.

Over 30 families reported with dominant disease.

Age of onset typically between the second and fifth decades of life. Peak age of onset in second decade (range childhood to 76 years) (OMIM).

Marking as red for carrier screening due to age of onset and limited evidence for recessive disease.
Prepair 1000+ v1.1826 LRSAM1 Melanie Marty changed review comment from: Only a single family reported with recessive inheritance.

Over 30 families reported with dominant disease.

Age of onset typically between the second and fifth decades of life.; to: Only a single family reported with recessive inheritance.

Over 30 families reported with dominant disease.

Age of onset typically between the second and fifth decades of life.

Marking as red for carrier screening due to age of onset and limited evidence for recessive disease.
Prepair 1000+ v1.1826 LRSAM1 Melanie Marty edited their review of gene: LRSAM1: Changed publications: 38330802, 33568173
Prepair 1000+ v1.1826 TBC1D23 Michelle Torres reviewed gene: TBC1D23: Rating: GREEN; Mode of pathogenicity: None; Publications: 28823707, 28823706; Phenotypes: Pontocerebellar hypoplasia, type 11 MIM#617695; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 SRD5A3 Michelle Torres reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323, 20301507; Phenotypes: Congenital disorder of glycosylation, type Iq MIM#612379, Kahrizi syndrome#612713, SRD5A3-congenital disorder of glycosylation (MONDO:0012885); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1826 SLC39A8 Michelle Torres reviewed gene: SLC39A8: Rating: GREEN; Mode of pathogenicity: None; Publications: 37023243, 26637978, 26637979, 29453449; Phenotypes: Congenital disorder of glycosylation, type IIn MIM#616721; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2433 CDC20 Zornitza Stark Marked gene: CDC20 as ready
Mendeliome v1.2433 CDC20 Zornitza Stark Gene: cdc20 has been classified as Green List (High Evidence).
Mendeliome v1.2433 CDC20 Zornitza Stark Classified gene: CDC20 as Green List (high evidence)
Mendeliome v1.2433 CDC20 Zornitza Stark Gene: cdc20 has been classified as Green List (High Evidence).
Mendeliome v1.2432 CDC20 Zornitza Stark gene: CDC20 was added
gene: CDC20 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CDC20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDC20 were set to 32666501; 33683667; 33898437; 34218387
Phenotypes for gene: CDC20 were set to Oocyte/zygote/embryo maturation arrest 14, MIM# 620276
Review for gene: CDC20 was set to GREEN
Added comment: i) PMID: 32666501- Biallelic (homozygous/compound heterozygous) variants in 5 unrelated Chinese women with infertility due to oocyte maturation arrest. Knocked down mouse oocytes showed an metaphase I (MI) arrest phenotype that could be rescued by injection of wildtype human CDC20 cRNA; all of the variants significantly reduced the ability of CDC20 to rescue the phenotype.

ii) PMID: 33683667- a compound heterozygous (missense and nonsense) variant in a Chinese woman with infertility due to oocyte maturation abnormalities and early embryonic arrest.

iii) PMID: 33898437- 4 patients from 3 Chinese families with homozygous or compound heterozygous variants with infertility due to oocyte maturation arrest, fertilization failure, and early embryonic arrest. Functional analysis in mouse oocytes with knockdown of Cdc20 showed that the homozygous and compound heterozygous variants significantly reduced the ability of CDC20 to rescue the lack of PB1 extrusion (MI arrest).

iv) PMID: 34218387- homozygous missense variant in a Chinese woman with infertility due to oocyte maturation arrest at MI and fertilization failure of MII oocytes.
Sources: Literature
Mendeliome v1.2431 CCNB3 Zornitza Stark Marked gene: CCNB3 as ready
Mendeliome v1.2431 CCNB3 Zornitza Stark Gene: ccnb3 has been classified as Green List (High Evidence).
Mendeliome v1.2431 CCNB3 Zornitza Stark Classified gene: CCNB3 as Green List (high evidence)
Mendeliome v1.2431 CCNB3 Zornitza Stark Gene: ccnb3 has been classified as Green List (High Evidence).
Mendeliome v1.2430 CCNB3 Zornitza Stark gene: CCNB3 was added
gene: CCNB3 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: CCNB3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCNB3 were set to 35722368; 32938693; 34021051; 30770433; 34850816
Phenotypes for gene: CCNB3 were set to Recurrent pregnancy loss, susceptibility to, MONDO:0000144, CCNB3-related
Review for gene: CCNB3 was set to GREEN
Added comment: i) PMID: 35722368- homozygous missense variant (p.P119Q) in the female of unexplained recurrent pregnancy loss (RPL) couple (couple 29)
ii) PMID: 32938693- homozygous missense variant (p.V1251D) in two sisters with RPL and two of their POCs were characterised and found to be triploid digynic due to the failure of meiosis II.
iii) PMID: 34021051- novel homozygous frameshift variant (p.Val1321Glyfs*4, due to splicing causing exon skipping) in a patient with 16 RPL and one of her miscarriages is triploid digynic resulted from the failure of meiosis I.

Supporting mouse evidence:
iv) PMID: 30770433- Ccnb3 knockout also causes female infertility due to the failure of metaphase to anaphase transition in meiosis I and the extrusion of the first polar body. The infertility in these mice appeared to be due to embryonic lethality before embryonic day 7.5 and some of their oocytes fertilised by intracytoplasmic sperm injection led to triploid embryos.
v) PMID: 34850816- Ccnb3-deficient mouse model is similar to a human infertility condition—recurrent pregnancy loss (RPL). Their findings demonstrate that the triploidy of embryos derived from Ccnb3-deficient oocytes is the primary cause of embryo death (i.e., such embryos can be rescued with euploid nuclei, whereas cytoplasmic Ccnb3 transcript is dispensable for zygotic genome activation and embryo development).
Sources: Expert Review
Prepair 1000+ v1.1826 WDR35 Zornitza Stark Marked gene: WDR35 as ready
Prepair 1000+ v1.1826 WDR35 Zornitza Stark Gene: wdr35 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1826 WDR35 Zornitza Stark Phenotypes for gene: WDR35 were changed from Short-rib thoracic dysplasia 7 with or without polydactyly, 614091 (3) to Cranioectodermal dysplasia 2 MIM#613610; Short-rib thoracic dysplasia 7 with or without polydactyly MIM#614091
Prepair 1000+ v1.1825 WDR35 Zornitza Stark Publications for gene: WDR35 were set to
Prepair 1000+ v1.1824 WISP3 Zornitza Stark Marked gene: WISP3 as ready
Prepair 1000+ v1.1824 WISP3 Zornitza Stark Gene: wisp3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1824 WISP3 Zornitza Stark Phenotypes for gene: WISP3 were changed from Arthropathy, progressive pseudorheumatoid, of childhood, 208230 (3) to Progressive pseudorheumatoid dysplasia MIM#208230
Prepair 1000+ v1.1823 WISP3 Zornitza Stark Publications for gene: WISP3 were set to
Prepair 1000+ v1.1822 WISP3 Zornitza Stark Tag new gene name tag was added to gene: WISP3.
Prepair 1000+ v1.1822 PCDH15 Melanie Marty reviewed gene: PCDH15: Rating: GREEN; Mode of pathogenicity: None; Publications: 11398101, 11487575, 11138007, 12782354, 16260500, 14570705, 25930172, 28281779; Phenotypes: Usher syndrome, type 1F, MIM# 602083, Deafness, autosomal recessive 23, MIM# 609533; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 PCCA Melanie Marty edited their review of gene: PCCA: Changed rating: GREEN; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 PCCA Melanie Marty reviewed gene: PCCA: Rating: ; Mode of pathogenicity: None; Publications: 17966092, 10101253, 9887338; Phenotypes: Propionicacidemia, MIM#606054; Mode of inheritance: None
Prepair 1000+ v1.1822 OSTM1 Melanie Marty reviewed gene: OSTM1: Rating: ; Mode of pathogenicity: None; Publications: 12627228, 15108279, 16813530, 23772242, 32048120; Phenotypes: Osteopetrosis, autosomal recessive 5, MIM#259720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 500+ v1.5 OSGEP Melanie Marty reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 NEB Melanie Marty reviewed gene: NEB: Rating: GREEN; Mode of pathogenicity: None; Publications: 10051637, 22367672, 26578207, 33376055; Phenotypes: Nemaline myopathy 2, autosomal recessive 256030, Arthrogryposis multiplex congenita 6, MIM# 619334; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 TRIT1 Michelle Torres reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 36047296, 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35 MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 WISP3 Michelle Torres reviewed gene: WISP3: Rating: GREEN; Mode of pathogenicity: None; Publications: 26610319; Phenotypes: Progressive pseudorheumatoid dysplasia MIM#208230; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 WDR35 Michelle Torres reviewed gene: WDR35: Rating: GREEN; Mode of pathogenicity: None; Publications: 33421337, 29134781, 28870638, 26691894, 24027799, 21473986; Phenotypes: Cranioectodermal dysplasia 2 MIM#613610, Short-rib thoracic dysplasia 7 with or without polydactyly MIM#614091; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 NDP Melanie Marty reviewed gene: NDP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23444378, 8268931, 17325173, 27217716, 29181528, 31827910; Phenotypes: Norrie disease, MIM# 310600; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.1822 NCF2 Melanie Marty reviewed gene: NCF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27178966, 7795241, 10498624; Phenotypes: Chronic granulomatous disease 2, autosomal recessive, MIM# 233710; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 MYD88 Melanie Marty reviewed gene: MYD88: Rating: GREEN; Mode of pathogenicity: None; Publications: 18669862, 20538326, 31301515; Phenotypes: Immunodeficiency 68, MIM# 612260; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 MSTO1 Melanie Marty reviewed gene: MSTO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28554942, 28544275, 31604776, 31463572, 31130378, 30684668, 29339779; Phenotypes: Myopathy, mitochondrial, and ataxia, MIM# 617675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 MICU1 Melanie Marty reviewed gene: MICU1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24336167, 29721912, 32395406; Phenotypes: Myopathy with extrapyramidal signs, MIM# 615673; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 VIPAS39 Michelle Torres reviewed gene: VIPAS39: Rating: GREEN; Mode of pathogenicity: None; Publications: 20190753, 35151346; Phenotypes: Arthrogryposis, renal dysfunction, and cholestasis 2 MIM#613404; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 TRMT10A Michelle Torres reviewed gene: TRMT10A: Rating: GREEN; Mode of pathogenicity: None; Publications: 24204302, 25053765, 33448213, 33067246, 26535115, 26526202, 26297882; Phenotypes: Microcephaly, short stature, and impaired glucose metabolism 1 MIM#616033; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 TRAPPC12 Michelle Torres reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity MIM#617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 SCNN1B Crystle Lee reviewed gene: SCNN1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 26807262; Phenotypes: Pseudohypoaldosteronism, type IB2, autosomal recessive, MIM#620125; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 TRAPPC11 Michelle Torres reviewed gene: TRAPPC11: Rating: GREEN; Mode of pathogenicity: None; Publications: 23830518, 26322222, 29855340, 30105108, 38564972; Phenotypes: Muscular dystrophy, limb-girdle, autosomal recessive 18 MIM#615356; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 SLC30A10 Crystle Lee reviewed gene: SLC30A10: Rating: GREEN; Mode of pathogenicity: None; Publications: 38283630, 34877518, 22341971; Phenotypes: Hypermanganesemia with dystonia 1, MIM#613280; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 SLC7A7 Crystle Lee reviewed gene: SLC7A7: Rating: GREEN; Mode of pathogenicity: None; Publications: 17764084; Phenotypes: Lysinuric protein intolerance, MIM#222700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 STIM1 Crystle Lee reviewed gene: STIM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31448844, 20876309, 25935105; Phenotypes: Immunodeficiency 10, MIM#612783; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 LRSAM1 Melanie Marty reviewed gene: LRSAM1: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 38330802, 33568173; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2P, MIM# 614436; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 TPP1 Michelle Torres reviewed gene: TPP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31283065; Phenotypes: Ceroid lipofuscinosis, neuronal, 2 MIM#204500, Spinocerebellar ataxia, autosomal recessive 7 MIM#609270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 TOE1 Michelle Torres reviewed gene: TOE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28092684, 36738896; Phenotypes: Pontocerebellar hypoplasia, type 7 MIM#614969; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 LONP1 Melanie Marty reviewed gene: LONP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31636596; Phenotypes: CODAS syndrome, MIM#600373; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 TBC1D20 Michelle Torres reviewed gene: TBC1D20: Rating: GREEN; Mode of pathogenicity: None; Publications: 24239381, 32740904, 32162791; Phenotypes: Warburg micro syndrome 4 MIM#615663; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 XYLT2 Michelle Torres reviewed gene: XYLT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34925453, 26027496, 26987875, 30891060, 28484880; Phenotypes: Spondyloocular syndrome MIM#605822; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 CLN3 Lilian Downie Marked gene: CLN3 as ready
Prepair 1000+ v1.1822 CLN3 Lilian Downie Added comment: Comment when marking as ready: Consider exclusion (Amber) as we will miss a high proportion of cases due to the founder variant being a 1kb deletion
Prepair 1000+ v1.1822 CLN3 Lilian Downie Gene: cln3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1822 CLN3 Lilian Downie Tag for review tag was added to gene: CLN3.
Prepair 1000+ v1.1822 XRCC4 Michelle Torres reviewed gene: XRCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 24389050, 25728776, 25872942; Phenotypes: Short stature, microcephaly, and endocrine dysfunction MIM#616541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 MLC1 Kate Scarff reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11254442, 18757878, 20301707, 29661901; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 1, MIM #604004; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 USH1G Michelle Torres reviewed gene: USH1G: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301442; Phenotypes: Usher syndrome, type 1G MIM#606943; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 METTL23 Kate Scarff reviewed gene: METTL23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24501276, 24626631, 39152716, 32878022, 32439618, 32067349; Phenotypes: Intellectual developmental disorder, autosomal recessive 44, MIM #615942; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 UBE3B Michelle Torres reviewed gene: UBE3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 23200864, 23200864, 34012380, 32949109, 27763745; Phenotypes: Kaufman oculocerebrofacial syndrome MIM#244450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2429 CDKL1 Sarah Milton gene: CDKL1 was added
gene: CDKL1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL1 were set to PMID: 40088891
Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related
Mode of pathogenicity for gene: CDKL1 was set to Other
Review for gene: CDKL1 was set to AMBER
Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4).

Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Sarah Milton gene: CDKL1 was added
gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL1 were set to PMID: 40088891
Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related
Mode of pathogenicity for gene: CDKL1 was set to Other
Review for gene: CDKL1 was set to AMBER
Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4).

Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Mendeliome v1.2429 CDKL2 Sarah Milton gene: CDKL2 was added
gene: CDKL2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL2 were set to PMID: 40088891
Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related
Mode of pathogenicity for gene: CDKL2 was set to Other
Review for gene: CDKL2 was set to AMBER
Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion.
2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging.

Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5)

Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 CDKL2 Sarah Milton gene: CDKL2 was added
gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL2 were set to PMID: 40088891
Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related
Penetrance for gene: CDKL2 were set to Complete
Mode of pathogenicity for gene: CDKL2 was set to Other
Review for gene: CDKL2 was set to AMBER
Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion.
2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging.

Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5)

Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Prepair 1000+ v1.1822 MEGF10 Kate Scarff reviewed gene: MEGF10: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22101682, 22371254, 39654599, 36349186, 35370044, 34828389; Phenotypes: Congenital myopathy 10A, severe variant, MIM #614399, Congenital myopathy 10B, mild variant, MIM #620249; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1822 LRAT Kate Scarff reviewed gene: LRAT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11381255, 18055821, 22570351, 29973277, 24625443, 31448181; Phenotypes: Retinal dystrophy, early-onset severe, Leber congenital amaurosis 14, Retinitis pigmentosa, juvenile, all under MIM #613341; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2429 TEX11 Zornitza Stark Marked gene: TEX11 as ready
Mendeliome v1.2429 TEX11 Zornitza Stark Gene: tex11 has been classified as Green List (High Evidence).
Mendeliome v1.2429 TEX11 Zornitza Stark Classified gene: TEX11 as Green List (high evidence)
Mendeliome v1.2429 TEX11 Zornitza Stark Gene: tex11 has been classified as Green List (High Evidence).
Mendeliome v1.2428 TEX11 Zornitza Stark gene: TEX11 was added
gene: TEX11 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: TEX11 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: TEX11 were set to 25970010; 29661171; 34621296; 37124723
Phenotypes for gene: TEX11 were set to Spermatogenic failure, X-linked 2, MIM# 309120
Review for gene: TEX11 was set to GREEN
Added comment: i) PMID:25970010- hemizygous variants in 7 out of of 289 azoospermic men, including a 90kb exonic deletion (Ex10-12) in 2 European men, 2 missense variants in 2 European/German men, and 3 splice variants in two white and one Arabic men.
ii) PMID: 29661171 (2018)- a novel hemizygous missense variant (W856C) in two brothers with azoospermia (absent in the mother- ?can it be gonadal mosaicism). Their testicular biopsy revealed meiotic arrest and no post-meiotic round spermatids and mature spermatozoa were observed.
iii) PMID: 34621296 (2021)- seven novel hemizygous variants in three familial (one missense, two splice) and four NOA-affected sporadic (three frameshift, one nonsense) cases iv) PMID: 37124723 (2023)- three novel hemizygous variants ( p.R105*, p.K143Q, and p.G859R) in three unrelated NOA males and their histological analysis of testicular biopsy specimens revealed thicker basement membrane of the seminiferous tubules and poorly developed spermatocytes.
Sources: Expert Review
Mendeliome v1.2427 SPAG6 Zornitza Stark Marked gene: SPAG6 as ready
Mendeliome v1.2427 SPAG6 Zornitza Stark Gene: spag6 has been classified as Green List (High Evidence).
Mendeliome v1.2427 SPAG6 Zornitza Stark Classified gene: SPAG6 as Green List (high evidence)
Mendeliome v1.2427 SPAG6 Zornitza Stark Gene: spag6 has been classified as Green List (High Evidence).
Mendeliome v1.2426 SPAG6 Zornitza Stark gene: SPAG6 was added
gene: SPAG6 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SPAG6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPAG6 were set to 35232447; 38073178; 32124190
Phenotypes for gene: SPAG6 were set to Spermatogenic failure, MONDO:0004983, SPAG6-related
Review for gene: SPAG6 was set to GREEN
Added comment: i) PMID: 35232447- two homozygous variants (F1 II-1: p. A103D; F2 II-1:p. K196Sfs*6) in two unrelated Han Chinese men with nonsyndromic asthenoteratozoospermia with severe multiple morphological abnormalities of the sperm flagella. Immunostaining and WB showed lower SPAG6 expression in spermatozoa of both affected males. The couple with the missense variant as able to conceive successfully after undergoing ICSI.
ii) PMID: 38073178- a homozygous missense p.R310W in three brothers (two brothers with both asthenozoospermia and oligozoospermia, third brother with azoospermia)
iii) PMID: 32124190- a novel compound heterozygous variant (c.143_145del: p.48_49del, c.585delA: p.Lys196Serfs*6) in an infertile PCD patient with severe with asthenoteratozoospermia, presented with morphological defects of sperm flagella and lower mRNA and protein expression in mutant sperm.
Sources: Literature
Mendeliome v1.2425 SEPT12 Zornitza Stark Marked gene: SEPT12 as ready
Mendeliome v1.2425 SEPT12 Zornitza Stark Gene: sept12 has been classified as Green List (High Evidence).
Mendeliome v1.2425 SEPT12 Zornitza Stark Classified gene: SEPT12 as Green List (high evidence)
Mendeliome v1.2425 SEPT12 Zornitza Stark Gene: sept12 has been classified as Green List (High Evidence).
Mendeliome v1.2424 SEPT12 Zornitza Stark gene: SEPT12 was added
gene: SEPT12 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SEPT12 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: SEPT12 were set to 22479503; 22275165; 35547809
Phenotypes for gene: SEPT12 were set to Spermatogenic failure 10, MIM#614822
Review for gene: SEPT12 was set to GREEN
Added comment: i) PMID: 22479503- A homozygous truncating variant (c.474 G>A) in 15 unrelated infertile men and 9 of them had teratozoospermia (88 to 99% of abnormal sperm);Transfection studies also showed that the mutant SEPT12 disrupted filament formation of wildtype SEPT12 in a dose-dependent manner.
ii) PMID:22275165- Two heterozygous missense variants (T89M and D197N) in a man with asthenoteratozoospermia and another man with oligoasthenozoospermia. Functional analysis demonstrated that both mutations adversely affected filament formation of wildtype SEPT12 in a dose-dependent manner.
iii) PMID: 35547809- A heterozygous missense variant (p.Cys24Ter) in the male partner of a patient couple, who had a previous fertilization failure (FF) after intracytoplasmic sperm injection (ICSI) and became pregnant after ICSI together with artificial oocyte activation (AOA). Their Septin12 knockout mice study also showed that Septin12 -/- male mice are infertile with reduced sperm counts and abnormal sperm morphology but male Septin12 +/− mice are fertile. This observation contradicted with the previous studies showed that male Septin12 +/− chimeric mice are infertile (Lin et al., 2009, PMID: 19359518). The main difference is that the Septin12 +/− chimeric mice were generated in Lin et al., 2009 (PMID: 19359518) was by blastocyst injection of Septin12 +/− embryonic stem cells (ESCs), while their Septin12 +/− founder mice were established by CRISPR/Cas9 mediated gene editing in the zygote. The quality of injected Septin12 +/− ESCs might affect the experimental result.
Sources: Literature
Mendeliome v1.2423 PLCZ1 Zornitza Stark Marked gene: PLCZ1 as ready
Mendeliome v1.2423 PLCZ1 Zornitza Stark Gene: plcz1 has been classified as Green List (High Evidence).
Mendeliome v1.2423 PLCZ1 Zornitza Stark Classified gene: PLCZ1 as Green List (high evidence)
Mendeliome v1.2423 PLCZ1 Zornitza Stark Gene: plcz1 has been classified as Green List (High Evidence).
Mendeliome v1.2422 PLCZ1 Zornitza Stark gene: PLCZ1 was added
gene: PLCZ1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: PLCZ1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLCZ1 were set to 26721930; 31463947; 36593593; 37004249
Phenotypes for gene: PLCZ1 were set to Spermatogenic failure 17, MIM# 617214
Review for gene: PLCZ1 was set to GREEN
Added comment: i) PMID:26721930- homozygous missense variant (I489F) in 2 Tunisian brothers with infertility due to oocyte activation failure.
ii) PMID:31463947- 3 homozygous variants (C196X, S350P, L246F) in 4 Chinese men from 3 consanguineous families with SPGF17 and total fertilization failure of oocytes after intracytoplasmic sperm injection.
iii) PMID: 36593593- compound heterozygosity for splice site and missense variants (c.1174+3A-C and N425S in case 2; c.136-1G-C and G453D in case 3) in 2 unrelated Chinese men with infertility due to acrosomal abnormalities and total fertilization failure.
iv) PMID: 37004249- previously reported homozygous variant (C196X) in two unrelated men with infertility due to total fertilization failure
Sources: Literature
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.342 EXO1 Zornitza Stark Marked gene: EXO1 as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.342 EXO1 Zornitza Stark Gene: exo1 has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.342 EXO1 Zornitza Stark Classified gene: EXO1 as Green List (high evidence)
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.342 EXO1 Zornitza Stark Gene: exo1 has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.341 EXO1 Zornitza Stark gene: EXO1 was added
gene: EXO1 was added to Primary Ovarian Insufficiency_Premature Ovarian Failure. Sources: Literature
Mode of inheritance for gene: EXO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EXO1 were set to 39595984; 32772095; 36385415
Phenotypes for gene: EXO1 were set to Primary ovarian failure, MONDO:0005387, EXO1-related
Review for gene: EXO1 was set to GREEN
Added comment: 1. PMID:39595984- heterozygous nonsense variant (p.Glu829Ter) in an European female with diminished ovarian reserve
2. PMID:32772095- heterozygous missense variant (p.Thr52Ser) in a Chinese patient with POI, which impaired the meiotic process in budding yeast cells and analysis of transfected HEK293 cells demonstrated impaired efficiency of homologous recombination repair for DNA double-stranded breaks with the mutant compared to wildtype EXO1
3. PMID:36385415- heterozygous nonsense variant (p.Tyr742Ter) in a case (C23) with recurrent pregnancy loss (RPL), primary infertility (PI), recurrent implantation failure (RIF)
Sources: Literature
Mendeliome v1.2421 EXO1 Zornitza Stark Marked gene: EXO1 as ready
Mendeliome v1.2421 EXO1 Zornitza Stark Gene: exo1 has been classified as Green List (High Evidence).
Mendeliome v1.2421 EXO1 Zornitza Stark Classified gene: EXO1 as Green List (high evidence)
Mendeliome v1.2421 EXO1 Zornitza Stark Gene: exo1 has been classified as Green List (High Evidence).
Mendeliome v1.2420 EXO1 Zornitza Stark gene: EXO1 was added
gene: EXO1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: EXO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EXO1 were set to 39595984; 32772095; 36385415
Phenotypes for gene: EXO1 were set to Primary ovarian failure, MONDO:0005387, EXO1-related
Review for gene: EXO1 was set to GREEN
Added comment: 1. PMID:39595984- heterozygous nonsense variant (p.Glu829Ter) in an European female with diminished ovarian reserve
2. PMID:32772095- heterozygous missense variant (p.Thr52Ser) in a Chinese patient with POI, which impaired the meiotic process in budding yeast cells and analysis of transfected HEK293 cells demonstrated impaired efficiency of homologous recombination repair for DNA double-stranded breaks with the mutant compared to wildtype EXO1
3. PMID:36385415- heterozygous nonsense variant (p.Tyr742Ter) in a case (C23) with recurrent pregnancy loss (RPL), primary infertility (PI), recurrent implantation failure (RIF)
Sources: Literature
Mendeliome v1.2419 DDX3Y Zornitza Stark Marked gene: DDX3Y as ready
Mendeliome v1.2419 DDX3Y Zornitza Stark Gene: ddx3y has been classified as Green List (High Evidence).
Mendeliome v1.2419 DDX3Y Zornitza Stark Classified gene: DDX3Y as Green List (high evidence)
Mendeliome v1.2419 DDX3Y Zornitza Stark Gene: ddx3y has been classified as Green List (High Evidence).
Mendeliome v1.2418 DDX3Y Zornitza Stark gene: DDX3Y was added
gene: DDX3Y was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: DDX3Y was set to Other
Publications for gene: DDX3Y were set to 36997603
Phenotypes for gene: DDX3Y were set to Azoospermia, MONDO:0100459, DDX3Y-related
Review for gene: DDX3Y was set to GREEN
Added comment: PMID:36997603- Four (3 German, 1 Estonian) unrelated men with non-obstructive azoospermia carrying different LOF variants- absent in the gnomAD database (v2.1.1), abrogate at least the sequence of the C-terminal helicase domain, and are predicted to lead to degradation of the transcripts by nonsense-mediated decay. All four patients shared histological phenotype of Sertoli cell-only (SCO), reduced testicular volume, and had elevated FSH upon primary or later presentation indicative of spermatogenic failure.

Mode of inheritance: Y-linked
Sources: Expert Review
Mendeliome v1.2417 CFAP221 Achchuthan Shanmugasundram reviewed gene: CFAP221: Rating: AMBER; Mode of pathogenicity: None; Publications: 31636325, 39362668; Phenotypes: primary ciliary dyskinesia, MONDO:0016575; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Diarrhoea v1.14 EZR Zornitza Stark Marked gene: EZR as ready
Congenital Diarrhoea v1.14 EZR Zornitza Stark Gene: ezr has been classified as Red List (Low Evidence).
Congenital Diarrhoea v1.14 EZR Zornitza Stark gene: EZR was added
gene: EZR was added to Congenital Diarrhoea. Sources: Literature
Mode of inheritance for gene: EZR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EZR were set to 40137958
Phenotypes for gene: EZR were set to Congenital enteropathy, MONDO:0009173, EZR-related
Review for gene: EZR was set to RED
Added comment: Homozygous LoF variant c. 356dup (p. Glu120*) - present in gnomAD v4.1 (rare enough for AR condition) Infant from consanguineous parents with intractable diarrhea and failure to thrive. A supportive functional assay showing the variant is predicted to result in NMD was conducted. No other reports of other variants in this gene to support this gene disease association as of yet.
Sources: Literature
Mendeliome v1.2417 EZR Zornitza Stark Marked gene: EZR as ready
Mendeliome v1.2417 EZR Zornitza Stark Gene: ezr has been classified as Red List (Low Evidence).
Mendeliome v1.2417 EZR Zornitza Stark Classified gene: EZR as Red List (low evidence)
Mendeliome v1.2417 EZR Zornitza Stark Gene: ezr has been classified as Red List (Low Evidence).
Mendeliome v1.2416 IDH3G Zornitza Stark Marked gene: IDH3G as ready
Mendeliome v1.2416 IDH3G Zornitza Stark Gene: idh3g has been classified as Green List (High Evidence).
Mendeliome v1.2416 IDH3G Zornitza Stark Classified gene: IDH3G as Green List (high evidence)
Mendeliome v1.2416 IDH3G Zornitza Stark Gene: idh3g has been classified as Green List (High Evidence).
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.158 IDH3G Zornitza Stark Marked gene: IDH3G as ready
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.158 IDH3G Zornitza Stark Gene: idh3g has been classified as Green List (High Evidence).
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.158 IDH3G Zornitza Stark Classified gene: IDH3G as Green List (high evidence)
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.158 IDH3G Zornitza Stark Gene: idh3g has been classified as Green List (High Evidence).
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.157 C19orf44 Zornitza Stark Marked gene: C19orf44 as ready
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.157 C19orf44 Zornitza Stark Gene: c19orf44 has been classified as Green List (High Evidence).
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.157 C19orf44 Zornitza Stark Classified gene: C19orf44 as Green List (high evidence)
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.157 C19orf44 Zornitza Stark Gene: c19orf44 has been classified as Green List (High Evidence).
Mendeliome v1.2415 C19orf44 Zornitza Stark Marked gene: C19orf44 as ready
Mendeliome v1.2415 C19orf44 Zornitza Stark Gene: c19orf44 has been classified as Green List (High Evidence).
Mendeliome v1.2415 C19orf44 Zornitza Stark Classified gene: C19orf44 as Green List (high evidence)
Mendeliome v1.2415 C19orf44 Zornitza Stark Gene: c19orf44 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1822 LMBR1 Zornitza Stark Marked gene: LMBR1 as ready
Prepair 1000+ v1.1822 LMBR1 Zornitza Stark Gene: lmbr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1822 LMBR1 Zornitza Stark Phenotypes for gene: LMBR1 were changed from Acheiropody, 200500 (3) to Acheiropody, MIM #200500
Prepair 1000+ v1.1821 LMBR1 Zornitza Stark Publications for gene: LMBR1 were set to
Mitochondrial disease v0.971 TIMM29 Zornitza Stark Marked gene: TIMM29 as ready
Mitochondrial disease v0.971 TIMM29 Zornitza Stark Gene: timm29 has been classified as Red List (Low Evidence).
Mitochondrial disease v0.971 TIMM29 Zornitza Stark gene: TIMM29 was added
gene: TIMM29 was added to Mitochondrial disease. Sources: Literature
Mode of inheritance for gene: TIMM29 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TIMM29 were set to 40022150
Phenotypes for gene: TIMM29 were set to Sengers syndrome MONDO:0008922, TIMM29-related
Review for gene: TIMM29 was set to RED
Added comment: One large Arab family presenting with a range of clinical and biochemical phenotypes suggestive of Sengers Syndrome. Biallelic p.Trp172Arg was identified that segregated through the family - this variant is absent from gnomADv4.1 Knockdown drosophillia assay recapitulated the phenotype and pathology observed in the cohort of senger syndrome affected patients.
Sources: Literature
Mendeliome v1.2414 TIMM29 Zornitza Stark Marked gene: TIMM29 as ready
Mendeliome v1.2414 TIMM29 Zornitza Stark Gene: timm29 has been classified as Red List (Low Evidence).
Mendeliome v1.2414 TIMM29 Zornitza Stark Classified gene: TIMM29 as Red List (low evidence)
Mendeliome v1.2414 TIMM29 Zornitza Stark Gene: timm29 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.1820 LMBR1 Kate Scarff reviewed gene: LMBR1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11090342, 10780921, 33863876; Phenotypes: Acheiropody, MIM #200500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1820 LAMC2 Zornitza Stark Phenotypes for gene: LAMC2 were changed from Epidermolysis bullosa, junctional, Herlitz type, MIM#619785; Epidermolysis bullosa, junctional, non-Herlitz type, MIM#619786 to Epidermolysis bullosa, junctional 3B, severe MIM #619786; Epidermolysis bullosa, junctional 3A, intermediate MIM #619785
Prepair 1000+ v1.1819 LAMC2 Zornitza Stark Publications for gene: LAMC2 were set to
Prepair 1000+ v1.1818 LAMC2 Kate Scarff reviewed gene: LAMC2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 32017015, 11810295, 24533970, 20301304; Phenotypes: Epidermolysis bullosa, junctional 3B, severe MIM #619786, Epidermolysis bullosa, junctional 3A, intermediate MIM #619785; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2413 TIMM29 Sangavi Sivagnanasundram gene: TIMM29 was added
gene: TIMM29 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: TIMM29 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TIMM29 were set to 40022150
Phenotypes for gene: TIMM29 were set to Sengers syndrome MONDO:0008922, TIMM29-related
Review for gene: TIMM29 was set to RED
Added comment: One large Arab family presenting with a range of clinical and biochemical phenotypes suggestive of Sengers Syndrome.
Biallelic p.Trp172Arg was identified that segregated through the family - this variant is absent from gnomADv4.1
Knockdown drosophillia assay recapitulated the phenotype and pathology observed in the cohort of senger syndrome affected patients.
Sources: Literature
Prepair 1000+ v1.1818 TSPAN7 Michelle Torres reviewed gene: TSPAN7: Rating: AMBER; Mode of pathogenicity: None; Publications: 26350204, 36625203; Phenotypes: Intellectual developmental disorder, X-linked 58, MIM #300210, MONDO:0010266; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2413 C19orf44 Sangavi Sivagnanasundram edited their review of gene: C19orf44: Changed phenotypes: Late onset retinal dystrophy, MONDO:0019118
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.156 C19orf44 Sangavi Sivagnanasundram gene: C19orf44 was added
gene: C19orf44 was added to Retinitis pigmentosa_Autosomal Recessive/X-linked. Sources: Literature
Mode of inheritance for gene: C19orf44 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C19orf44 were set to 40079362
Phenotypes for gene: C19orf44 were set to Late onset retinal dystrophy, MONDO:0019118
Review for gene: C19orf44 was set to GREEN
Added comment: 5 biallelic LoF variants were identified in 11 unrelated families of Jewish or Israeli ancestry. All affected individuals present with a form of retinal disorder including perifoveal chorioretinal atrophy and electroretinographic features of rod-cone degeneration.
All 5 variants were present in gnomAD v4.1 with varying AF (p.Ser325PhefsTer16 being the most common).
Sources: Literature
Mendeliome v1.2413 C19orf44 Sangavi Sivagnanasundram gene: C19orf44 was added
gene: C19orf44 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: C19orf44 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C19orf44 were set to 40079362
Phenotypes for gene: C19orf44 were set to Late onset retinal dystrophy; MONDO:0019118
Review for gene: C19orf44 was set to GREEN
Added comment: 5 biallelic LoF variants were identified in 11 unrelated families of Jewish or Israeli ancestry. All affected individuals present with a form of retinal disorder including perifoveal chorioretinal atrophy and electroretinographic features of rod-cone degeneration.
All 5 variants were present in gnomAD v4.1 with varying AF (p.Ser325PhefsTer16 being the most common).
Sources: Literature
Retinitis pigmentosa_Autosomal Recessive/X-linked v0.156 IDH3G Sangavi Sivagnanasundram gene: IDH3G was added
gene: IDH3G was added to Retinitis pigmentosa_Autosomal Recessive/X-linked. Sources: Literature
Mode of inheritance for gene: IDH3G was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: IDH3G were set to 40119724
Phenotypes for gene: IDH3G were set to X-linked retinitis pigmentosa, MONDO:0019200
Review for gene: IDH3G was set to GREEN
Added comment: PMID: 40119724
5 unrelated male probands with retinal pigmentosa (RP) identifed with hemizygous variants in IDH3G and was shown to segregate with disease in some families.
Sources: Literature
Mendeliome v1.2413 IDH3G Sangavi Sivagnanasundram gene: IDH3G was added
gene: IDH3G was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: IDH3G was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: IDH3G were set to 40119724
Phenotypes for gene: IDH3G were set to X-linked retinitis pigmentosa, MONDO:0019200
Review for gene: IDH3G was set to GREEN
Added comment: PMID: 40119724
5 unrelated male probands with retinal pigmentosa (RP) identifed with hemizygous variants in IDH3G and was shown to segregate with disease in some families.
Sources: Literature
Anophthalmia_Microphthalmia_Coloboma v1.45 MYH10 Zornitza Stark changed review comment from: Three individuals reported with coloboma and ptosis as features, pheno expansion.
Sources: Literature; to: Three individuals reported with coloboma and ptosis as features, pheno expansion.
Sources: Literature
Mendeliome v1.2413 TFRC Zornitza Stark Phenotypes for gene: TFRC were changed from Immunodeficiency 46, MIM# 616740; T cells: normal number, poor proliferation; B cells: normal number, low memory B cells; recurrent infections, neutorpaenia; thrombocytopaenia to TFRC-related combined immunodeficiency MONDO:0014760; Immunodeficiency 46, MIM# 616740; T cells: normal number, poor proliferation; B cells: normal number, low memory B cells; recurrent infections, neutorpaenia; thrombocytopaenia
Mendeliome v1.2412 TFRC Zornitza Stark Classified gene: TFRC as Green List (high evidence)
Mendeliome v1.2412 TFRC Zornitza Stark Gene: tfrc has been classified as Green List (High Evidence).
Combined Immunodeficiency v1.118 TFRC Zornitza Stark Phenotypes for gene: TFRC were changed from Immunodeficiency 46, MIM# 616740; T cells: normal number, poor proliferation; B cells: normal number, low memory B cells; recurrent infections, neutorpaenia; thrombocytopaenia to Immunodeficiency 46, MIM# 616740; TFRC-related combined immunodeficiency MONDO:0014760
Combined Immunodeficiency v1.117 TFRC Zornitza Stark Publications for gene: TFRC were set to 26642240
Combined Immunodeficiency v1.116 TFRC Zornitza Stark Classified gene: TFRC as Green List (high evidence)
Combined Immunodeficiency v1.116 TFRC Zornitza Stark Gene: tfrc has been classified as Green List (High Evidence).
Mendeliome v1.2411 TAX1BP3 Zornitza Stark Marked gene: TAX1BP3 as ready
Mendeliome v1.2411 TAX1BP3 Zornitza Stark Gene: tax1bp3 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2411 TAX1BP3 Zornitza Stark Classified gene: TAX1BP3 as Amber List (moderate evidence)
Mendeliome v1.2411 TAX1BP3 Zornitza Stark Gene: tax1bp3 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2410 TAX1BP3 Zornitza Stark gene: TAX1BP3 was added
gene: TAX1BP3 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: TAX1BP3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TAX1BP3 were set to 39963794
Phenotypes for gene: TAX1BP3 were set to Familial cardiomyopathy, MONDO:0005217, TAX1BP3-related
Review for gene: TAX1BP3 was set to AMBER
Added comment: Biallelic variants (1 x del, 1 x missense) in TAX1BP3 cause a novel autosomal recessive form of arrhythmogenic cardiomyopathy. One family only, but 3 affected sibs had the bialleic variants which were absent in an unaffected sister. Carrier parents were normal. Experimental work on patient-derived induced pluripotent stem cell cardiac myocytes and a knockout mouse showed that show loss of TAX1BP3 causes calcium dysregulation in cardiomyocytes, a known mechanism for arrhythmia. AMBER until more case level data evolves.
Sources: Literature
Arrhythmogenic Cardiomyopathy v0.70 TAX1BP3 Zornitza Stark Marked gene: TAX1BP3 as ready
Arrhythmogenic Cardiomyopathy v0.70 TAX1BP3 Zornitza Stark Gene: tax1bp3 has been classified as Amber List (Moderate Evidence).
Arrhythmogenic Cardiomyopathy v0.70 TAX1BP3 Zornitza Stark Phenotypes for gene: TAX1BP3 were changed from arrhythmogenic cardiomyopathy to Familial cardiomyopathy, MONDO:0005217, TAX1BP3-related; arrhythmogenic cardiomyopathy
Arrhythmogenic Cardiomyopathy v0.69 TAX1BP3 Zornitza Stark Classified gene: TAX1BP3 as Amber List (moderate evidence)
Arrhythmogenic Cardiomyopathy v0.69 TAX1BP3 Zornitza Stark Gene: tax1bp3 has been classified as Amber List (Moderate Evidence).
Ciliary Dyskinesia v1.49 CFAP54 Zornitza Stark Publications for gene: CFAP54 were set to PMID: 26224312; 36593121; 37725231
Ciliary Dyskinesia v1.48 CFAP54 Zornitza Stark Classified gene: CFAP54 as Green List (high evidence)
Ciliary Dyskinesia v1.48 CFAP54 Zornitza Stark Gene: cfap54 has been classified as Green List (High Evidence).
Ciliary Dyskinesia v1.47 CFAP54 Zornitza Stark edited their review of gene: CFAP54: Added comment: PMID:39362668 reported four unrelated patients aged between 2 and 25 years old, three of whom were compound heterozygous and one homozygous for pathogenic variants in CFAP54. All reported chronic respiratory symptoms and all three patients for whom data was available had bronchiectasis. Two patients reported neonatal chest symptoms, one did not and data was missing for the other patient. No data were available on fertility status. In keeping with other C1d mutations they all had situs solitus and normal EM and HSVMA in those where data were available, but studies of in vitro ciliary transport performed in two subjects found that this was impaired in both.; Changed rating: GREEN; Changed publications: 36593121, 37725231, 39362668
Mendeliome v1.2409 CFAP54 Zornitza Stark Phenotypes for gene: CFAP54 were changed from Spermatogenic failure 98, MIM# 621124; Hydrocephalus, male infertility, mucus accumulation to Ciliary dyskinesia, primary, 54, MIM:621125; Spermatogenic failure 98, MIM# 621124; Hydrocephalus, male infertility, mucus accumulation
Mendeliome v1.2408 CFAP54 Zornitza Stark Publications for gene: CFAP54 were set to 26224312; 36593121
Mendeliome v1.2407 CFAP54 Zornitza Stark Classified gene: CFAP54 as Green List (high evidence)
Mendeliome v1.2407 CFAP54 Zornitza Stark Gene: cfap54 has been classified as Green List (High Evidence).
Anophthalmia_Microphthalmia_Coloboma v1.45 MYH10 Zornitza Stark Marked gene: MYH10 as ready
Anophthalmia_Microphthalmia_Coloboma v1.45 MYH10 Zornitza Stark Gene: myh10 has been classified as Amber List (Moderate Evidence).
Anophthalmia_Microphthalmia_Coloboma v1.45 MYH10 Zornitza Stark Classified gene: MYH10 as Amber List (moderate evidence)
Anophthalmia_Microphthalmia_Coloboma v1.45 MYH10 Zornitza Stark Gene: myh10 has been classified as Amber List (Moderate Evidence).
Anophthalmia_Microphthalmia_Coloboma v1.44 MYH10 Zornitza Stark gene: MYH10 was added
gene: MYH10 was added to Anophthalmia_Microphthalmia_Coloboma. Sources: Literature
Mode of inheritance for gene: MYH10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYH10 were set to 40044823
Phenotypes for gene: MYH10 were set to Neurodevelopmental disorder, MONDO:0700092, MYH10-related
Review for gene: MYH10 was set to AMBER
Added comment: Three individuals reported with coloboma and ptosis as features, pheno expansion.
Sources: Literature
Congenital Heart Defect v0.436 MED16 Zornitza Stark Marked gene: MED16 as ready
Congenital Heart Defect v0.436 MED16 Zornitza Stark Gene: med16 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.436 MED16 Zornitza Stark Classified gene: MED16 as Green List (high evidence)
Congenital Heart Defect v0.436 MED16 Zornitza Stark Gene: med16 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.435 MED16 Zornitza Stark gene: MED16 was added
gene: MED16 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED16 were set to 40081376
Phenotypes for gene: MED16 were set to Neurodevelopmental disorder, MONDO:0700092, MED16-related
Review for gene: MED16 was set to GREEN
Added comment: 18 families reported with DD/ID +/- multiple congenital anomalies including CHD (predominantly Tetralogy of Fallot).
Sources: Literature
Mendeliome v1.2406 EZR Sangavi Sivagnanasundram gene: EZR was added
gene: EZR was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: EZR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EZR were set to 40137958
Phenotypes for gene: EZR were set to Congenital enteropathy, MONDO:0009173
Review for gene: EZR was set to RED
Added comment: Homozygous LoF variant c. 356dup (p. Glu120*) - present in gnomAD v4.1 (rare enough for AR condition)
Infant from consanguineous parents with intractable diarrhea and failure to thrive.
A supportive functional assay showing the variant is predicted to result in NMD was conducted.
No other reports of other variants in this gene to support this gene disease association as of yet.
Sources: Literature
Clefting disorders v0.262 MED16 Zornitza Stark Marked gene: MED16 as ready
Clefting disorders v0.262 MED16 Zornitza Stark Gene: med16 has been classified as Green List (High Evidence).
Clefting disorders v0.262 MED16 Zornitza Stark Classified gene: MED16 as Green List (high evidence)
Clefting disorders v0.262 MED16 Zornitza Stark Gene: med16 has been classified as Green List (High Evidence).
Clefting disorders v0.261 MED16 Zornitza Stark gene: MED16 was added
gene: MED16 was added to Clefting disorders. Sources: Literature
Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED16 were set to 40081376
Phenotypes for gene: MED16 were set to Neurodevelopmental disorder, MONDO:0700092, MED16-related
Review for gene: MED16 was set to GREEN
Added comment: 18 families reported with bi-allelic variants in this gene with DD/ID +/- multiple congenital anomalies, including cleft palate in multiple individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 MED16 Zornitza Stark Phenotypes for gene: MED16 were changed from complex neurodevelopmental disorder MONDO:0100038 to Neurodevelopmental disorder, MONDO:0700092, MED16-related
Intellectual disability syndromic and non-syndromic v1.95 MED16 Zornitza Stark Publications for gene: MED16 were set to
Intellectual disability syndromic and non-syndromic v1.94 MED16 Zornitza Stark reviewed gene: MED16: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081376; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, MED16-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2406 CELF4 Zornitza Stark Marked gene: CELF4 as ready
Mendeliome v1.2406 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Mendeliome v1.2406 CELF4 Zornitza Stark Classified gene: CELF4 as Green List (high evidence)
Mendeliome v1.2406 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Mendeliome v1.2405 CELF4 Zornitza Stark gene: CELF4 was added
gene: CELF4 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF4 were set to 40108438
Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related
Review for gene: CELF4 was set to GREEN
Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype.
Sources: Literature
Severe early-onset obesity v1.15 CELF4 Zornitza Stark Marked gene: CELF4 as ready
Severe early-onset obesity v1.15 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Severe early-onset obesity v1.15 CELF4 Zornitza Stark Classified gene: CELF4 as Green List (high evidence)
Severe early-onset obesity v1.15 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Severe early-onset obesity v1.14 CELF4 Zornitza Stark gene: CELF4 was added
gene: CELF4 was added to Severe early-onset obesity. Sources: Literature
Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF4 were set to 40108438
Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related
Review for gene: CELF4 was set to GREEN
Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype.
Sources: Literature
Genetic Epilepsy v1.124 CELF4 Zornitza Stark Marked gene: CELF4 as ready
Genetic Epilepsy v1.124 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.124 CELF4 Zornitza Stark Classified gene: CELF4 as Green List (high evidence)
Genetic Epilepsy v1.124 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.123 CELF4 Zornitza Stark gene: CELF4 was added
gene: CELF4 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF4 were set to 40108438
Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related
Review for gene: CELF4 was set to GREEN
Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Marked gene: CELF4 as ready
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Classified gene: CELF4 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.94 CELF4 Zornitza Stark Gene: celf4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.93 CELF4 Zornitza Stark gene: CELF4 was added
gene: CELF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF4 were set to 40108438
Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related
Review for gene: CELF4 was set to GREEN
Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype.
Sources: Literature
Mendeliome v1.2404 CSNK1A1 Zornitza Stark Marked gene: CSNK1A1 as ready
Mendeliome v1.2404 CSNK1A1 Zornitza Stark Gene: csnk1a1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2404 CSNK1A1 Zornitza Stark Classified gene: CSNK1A1 as Amber List (moderate evidence)
Mendeliome v1.2404 CSNK1A1 Zornitza Stark Gene: csnk1a1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2403 CSNK1A1 Zornitza Stark gene: CSNK1A1 was added
gene: CSNK1A1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CSNK1A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CSNK1A1 were set to 40156289
Phenotypes for gene: CSNK1A1 were set to Infantile spasms, MONDO:0018097, CSNK1A1-related
Review for gene: CSNK1A1 was set to AMBER
Added comment: Two individuals with de novo variants and some supportive functional data.
Sources: Literature
Genetic Epilepsy v1.122 CSNK1A1 Zornitza Stark Marked gene: CSNK1A1 as ready
Genetic Epilepsy v1.122 CSNK1A1 Zornitza Stark Gene: csnk1a1 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.122 CSNK1A1 Zornitza Stark Classified gene: CSNK1A1 as Amber List (moderate evidence)
Genetic Epilepsy v1.122 CSNK1A1 Zornitza Stark Gene: csnk1a1 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.121 CSNK1A1 Zornitza Stark gene: CSNK1A1 was added
gene: CSNK1A1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: CSNK1A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CSNK1A1 were set to 40156289
Phenotypes for gene: CSNK1A1 were set to Infantile spasms, MONDO:0018097, CSNK1A1-related
Review for gene: CSNK1A1 was set to AMBER
Added comment: Two individuals with de novo variants and some supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.92 SVBP Zornitza Stark Phenotypes for gene: SVBP were changed from Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569 to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569; Spastic paraplegia 94, autosomal recessive, MIM# 621150
Intellectual disability syndromic and non-syndromic v1.91 SVBP Zornitza Stark Publications for gene: SVBP were set to PMID: 31363758; 30607023
Intellectual disability syndromic and non-syndromic v1.90 SVBP Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150
Mendeliome v1.2402 SVBP Zornitza Stark Phenotypes for gene: SVBP were changed from Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569 to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569; Spastic paraplegia 94, autosomal recessive, MIM# 621150
Mendeliome v1.2401 SVBP Zornitza Stark Publications for gene: SVBP were set to 31363758; 30607023
Mendeliome v1.2400 SVBP Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 31363758, 30607023, 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150
Hereditary Spastic Paraplegia - paediatric v1.89 SVBP Zornitza Stark Marked gene: SVBP as ready
Hereditary Spastic Paraplegia - paediatric v1.89 SVBP Zornitza Stark Gene: svbp has been classified as Amber List (Moderate Evidence).
Hereditary Spastic Paraplegia - paediatric v1.89 SVBP Zornitza Stark Classified gene: SVBP as Amber List (moderate evidence)
Hereditary Spastic Paraplegia - paediatric v1.89 SVBP Zornitza Stark Gene: svbp has been classified as Amber List (Moderate Evidence).
Hereditary Spastic Paraplegia - paediatric v1.88 SVBP Zornitza Stark gene: SVBP was added
gene: SVBP was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature
founder tags were added to gene: SVBP.
Mode of inheritance for gene: SVBP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SVBP were set to 39412222
Phenotypes for gene: SVBP were set to Spastic paraplegia 94, autosomal recessive, MIM# 621150
Review for gene: SVBP was set to AMBER
Added comment: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).
Sources: Literature
Mendeliome v1.2400 CFAP54 Achchuthan Shanmugasundram reviewed gene: CFAP54: Rating: GREEN; Mode of pathogenicity: None; Publications: 39362668; Phenotypes: Ciliary dyskinesia, primary, 54, OMIM:621125; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Arrhythmogenic Cardiomyopathy v0.68 TAX1BP3 Ivan Macciocca gene: TAX1BP3 was added
gene: TAX1BP3 was added to Arrhythmogenic Cardiomyopathy. Sources: Literature
Mode of inheritance for gene: TAX1BP3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TAX1BP3 were set to (PMID: 39963794)
Phenotypes for gene: TAX1BP3 were set to arrhythmogenic cardiomyopathy
Penetrance for gene: TAX1BP3 were set to unknown
Review for gene: TAX1BP3 was set to AMBER
Added comment: Biallelic variants (1 x del, 1 x missense) in TAX1BP3 cause a novel autosomal recessive form of arrhythmogenic cardiomyopathy.
One family only, but 3 affected sibs had the bialleic variants which were absent in an unaffected sister. Carrier parents were normal.
Experimental work on patient-derived induced pluripotent stem cell cardiac myocytes and a knockout mouse showed that show loss of TAX1BP3 causes calcium dysregulation in cardiomyocytes, a known mechanism for arrhythmia.

Suggest this one is AMBER until more case level data evolves.
Sources: Literature
Mendeliome v1.2400 NR2F2 Elena Savva Phenotypes for gene: NR2F2 were changed from 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 Current 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 Edit; 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 to Syndromic disease, MONDO:0002254, NR2F2-related
Mendeliome v1.2399 NR2F2 Elena Savva Phenotypes for gene: NR2F2 were changed from Krithika Murali (Victorian Clinical Genetics Services) 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 Current 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 Edit; 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 to 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 Current 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779 Edit; 46,XX sex reversal 5 - MIM#618901; Congenital heart defects, multiple types, 4 - MIM#615779
Mendeliome v1.2398 CFAP74 Achchuthan Shanmugasundram reviewed gene: CFAP74: Rating: GREEN; Mode of pathogenicity: None; Publications: 32555313, 36047773, 39362668; Phenotypes: Ciliary dyskinesia, primary, 49, without situs inversus, OMIM:620197; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2398 NEB Sangavi Sivagnanasundram reviewed gene: NEB: Rating: AMBER; Mode of pathogenicity: None; Publications: 39802796, 30679003, 33933294; Phenotypes: congenital structural myopathy MONDO:0002921; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v1.2398 FAM126A Sangavi Sivagnanasundram commented on gene: FAM126A
Combined Immunodeficiency v1.115 TFRC Sangavi Sivagnanasundram reviewed gene: TFRC: Rating: GREEN; Mode of pathogenicity: None; Publications: 32851577, 38270687; Phenotypes: TFRC-related combined immunodeficiency MONDO:0014760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2398 TFRC Sangavi Sivagnanasundram reviewed gene: TFRC: Rating: GREEN; Mode of pathogenicity: None; Publications: 32851577, 38270687; Phenotypes: TFRC-related combined immunodeficiency MONDO:0014760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Marked gene: CRMP1 as ready
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Classified gene: CRMP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.90 CRMP1 Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.89 CRMP1 Zornitza Stark gene: CRMP1 was added
gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CRMP1 were set to 36511780; 39758889
Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related
Review for gene: CRMP1 was set to GREEN
Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants.

PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID.

Four individuals with neurodevelopmental disorders and de novo variants in this gene.
Sources: Expert Review
Mendeliome v1.2398 CRMP1 Zornitza Stark Marked gene: CRMP1 as ready
Mendeliome v1.2398 CRMP1 Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence).
Mendeliome v1.2398 CRMP1 Zornitza Stark Phenotypes for gene: CRMP1 were changed from neurodevelopmental disorder, MONDO:0700092 to neurodevelopmental disorder, MONDO:0700092, CRMP2-related
Mendeliome v1.2397 CRMP1 Zornitza Stark Classified gene: CRMP1 as Green List (high evidence)
Mendeliome v1.2397 CRMP1 Zornitza Stark Gene: crmp1 has been classified as Green List (High Evidence).
Mendeliome v1.2396 CRMP1 Zornitza Stark reviewed gene: CRMP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder, MONDO:0700092, CRMP2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Metal Metabolism Disorders v0.48 HEPHL1 Zornitza Stark Classified gene: HEPHL1 as Red List (low evidence)
Metal Metabolism Disorders v0.48 HEPHL1 Zornitza Stark Gene: hephl1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.1818 PDHX Zornitza Stark Marked gene: PDHX as ready
Prepair 1000+ v1.1818 PDHX Zornitza Stark Added comment: Comment when marking as ready: Meets criteria, for inclusion in next version.
Prepair 1000+ v1.1818 PDHX Zornitza Stark Gene: pdhx has been removed from the panel.
Prepair 1000+ v1.1818 PDHX Zornitza Stark Tag for review tag was added to gene: PDHX.
Prepair 1000+ v1.1818 OTULIN Zornitza Stark Marked gene: OTULIN as ready
Prepair 1000+ v1.1818 OTULIN Zornitza Stark Added comment: Comment when marking as ready: For review. Likely meets criteria for inclusion in next version.
Prepair 1000+ v1.1818 OTULIN Zornitza Stark Gene: otulin has been removed from the panel.
Prepair 1000+ v1.1818 OTULIN Zornitza Stark Phenotypes for gene: OTULIN were changed from to Autoinflammation, panniculitis, and dermatosis syndrome, autosomal recessive MIM#617099
Prepair 1000+ v1.1817 OTULIN Zornitza Stark Publications for gene: OTULIN were set to
Prepair 1000+ v1.1816 OTULIN Zornitza Stark Tag for review tag was added to gene: OTULIN.
Prepair 1000+ v1.1816 AGTR1 Zornitza Stark Marked gene: AGTR1 as ready
Prepair 1000+ v1.1816 AGTR1 Zornitza Stark Added comment: Comment when marking as ready: Meets criteria, for inclusion in next version.
Prepair 1000+ v1.1816 AGTR1 Zornitza Stark Gene: agtr1 has been removed from the panel.
Prepair 1000+ v1.1816 AGTR1 Zornitza Stark Tag for review tag was added to gene: AGTR1.
Prepair 1000+ v1.1816 MTPAP Zornitza Stark Marked gene: MTPAP as ready
Prepair 1000+ v1.1816 MTPAP Zornitza Stark Added comment: Comment when marking as ready: Meets criteria, for inclusion in next version.
Prepair 1000+ v1.1816 MTPAP Zornitza Stark Gene: mtpap has been removed from the panel.
Prepair 1000+ v1.1816 MTPAP Zornitza Stark Tag for review tag was added to gene: MTPAP.
Prepair 1000+ v1.1816 RBM8A Zornitza Stark Marked gene: RBM8A as ready
Prepair 1000+ v1.1816 RBM8A Zornitza Stark Gene: rbm8a has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.1816 RBM8A Zornitza Stark Classified gene: RBM8A as Amber List (moderate evidence)
Prepair 1000+ v1.1816 RBM8A Zornitza Stark Gene: rbm8a has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.1815 RBM8A Zornitza Stark reviewed gene: RBM8A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Thrombocytopenia-absent radius syndrome MIM#274000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1815 SCO1 Zornitza Stark Marked gene: SCO1 as ready
Prepair 1000+ v1.1815 SCO1 Zornitza Stark Added comment: Comment when marking as ready: Meets criteria, for inclusion in next version.
Prepair 1000+ v1.1815 SCO1 Zornitza Stark Gene: sco1 has been removed from the panel.
Prepair 1000+ v1.1815 SCO1 Zornitza Stark Tag for review tag was added to gene: SCO1.
Prepair 1000+ v1.1815 PEX19 Zornitza Stark Marked gene: PEX19 as ready
Prepair 1000+ v1.1815 PEX19 Zornitza Stark Added comment: Comment when marking as ready: Meets criteria, for inclusion in next version.
Prepair 1000+ v1.1815 PEX19 Zornitza Stark Gene: pex19 has been removed from the panel.
Prepair 1000+ v1.1815 PEX19 Zornitza Stark Tag for review tag was added to gene: PEX19.
Prepair 1000+ v1.1815 BRWD3 Zornitza Stark Marked gene: BRWD3 as ready
Prepair 1000+ v1.1815 BRWD3 Zornitza Stark Gene: brwd3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1815 BRWD3 Zornitza Stark Phenotypes for gene: BRWD3 were changed from Mental retardation, X-linked 93, 300659 (3) to Intellectual developmental disorder, X-linked 93 MIM#300659
Prepair 1000+ v1.1814 BRWD3 Zornitza Stark Publications for gene: BRWD3 were set to
Prepair 1000+ v1.1813 CASK Zornitza Stark Marked gene: CASK as ready
Prepair 1000+ v1.1813 CASK Zornitza Stark Gene: cask has been classified as Green List (High Evidence).
Prepair 1000+ v1.1813 CASK Zornitza Stark Phenotypes for gene: CASK were changed from Mental retardation, with or without nystagmus to X-linked syndromic intellectual disability MONDO:0020119
Prepair 1000+ v1.1812 CASK Zornitza Stark Publications for gene: CASK were set to
Mendeliome v1.2396 PIGQ Sangavi Sivagnanasundram reviewed gene: PIGQ: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008756; Phenotypes: developmental and epileptic encephalopathy, 77 MONDO:0032808; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.47 HEPHL1 Sangavi Sivagnanasundram gene: HEPHL1 was added
gene: HEPHL1 was added to Metal Metabolism Disorders. Sources: ClinGen
Mode of inheritance for gene: HEPHL1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HEPHL1 were set to 31125343
Phenotypes for gene: HEPHL1 were set to pili torti-developmental delay-neurological abnormalities syndrome MONDO:0009871
Review for gene: HEPHL1 was set to RED
Added comment: Classified as LIMITED by General Inborn Errors of Metabolism GCEP on 28/03/2025 - https://search.clinicalgenome.org/CCID:008755

Reported in a proband with biallelic variant. The variant was shown to affect ferroxidase activity result in abnormal hair phenotype. ?inborn error of iron metabolism
Sources: ClinGen
Mendeliome v1.2396 HEPHL1 Sangavi Sivagnanasundram changed review comment from: Classified as LIMITED by General Inborn Errors of Metabolism GCEP on 28/03/2025 - https://search.clinicalgenome.org/CCID:008755

Reported in a proband with chet variant. The variant was shown to affect ferroxidase activity result in abnormal hair phenotype. ?inborn error of iron metabolism; to: Classified as LIMITED by General Inborn Errors of Metabolism GCEP on 28/03/2025 - https://search.clinicalgenome.org/CCID:008755

Reported in a proband with biallelic variant. The variant was shown to affect ferroxidase activity result in abnormal hair phenotype. ?inborn error of iron metabolism
Mendeliome v1.2396 HEPHL1 Sangavi Sivagnanasundram changed review comment from: Classified as LIMITED by General Inborn Errors of Metabolism GCEP on 28/03/2025 - https://search.clinicalgenome.org/CCID:008755

Reported in a proband with chet variants. The variant was shown to affect ferroxidase activity result in abnormal hair phenotype. ?inborn error of iron metabolism; to: Classified as LIMITED by General Inborn Errors of Metabolism GCEP on 28/03/2025 - https://search.clinicalgenome.org/CCID:008755

Reported in a proband with chet variant. The variant was shown to affect ferroxidase activity result in abnormal hair phenotype. ?inborn error of iron metabolism
Mendeliome v1.2396 HEPHL1 Sangavi Sivagnanasundram reviewed gene: HEPHL1: Rating: RED; Mode of pathogenicity: None; Publications: 31125343; Phenotypes: pili torti-developmental delay-neurological abnormalities syndrome MONDO:0009871; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2396 MAN2B2 Zornitza Stark Phenotypes for gene: MAN2B2 were changed from Congenital disorder of glycosylation, MONDO:0015286, MAN2B2-related; immunodeficiency to Congenital disorder of glycosylation type 1EE with or without immunodeficiency, MIM# 621140
Mendeliome v1.2395 MAN2B2 Zornitza Stark Classified gene: MAN2B2 as Green List (high evidence)
Mendeliome v1.2395 MAN2B2 Zornitza Stark Gene: man2b2 has been classified as Green List (High Evidence).
Mendeliome v1.2394 MAN2B2 Zornitza Stark edited their review of gene: MAN2B2: Added comment: Third individual reported PMID 38622837 with compound het missense variants, supportive functional data.; Changed rating: GREEN; Changed publications: 31775018, 35637269, 38622837; Changed phenotypes: Congenital disorder of glycosylation type 1EE with or without immunodeficiency, MIM# 621140
Congenital Disorders of Glycosylation v1.62 MAN2B2 Zornitza Stark Phenotypes for gene: MAN2B2 were changed from Congenital disorder of glycosylation, MONDO:0015286, MAN2B2-related to Congenital disorder of glycosylation type 1EE with or without immunodeficiency, MIM# 621140
Congenital Disorders of Glycosylation v1.61 MAN2B2 Zornitza Stark Classified gene: MAN2B2 as Green List (high evidence)
Congenital Disorders of Glycosylation v1.61 MAN2B2 Zornitza Stark Gene: man2b2 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.61 MAN2B2 Zornitza Stark Classified gene: MAN2B2 as Green List (high evidence)
Congenital Disorders of Glycosylation v1.61 MAN2B2 Zornitza Stark Gene: man2b2 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.60 MAN2B2 Zornitza Stark edited their review of gene: MAN2B2: Added comment: Third individual reported PMID 38622837 with compound het missense variants, supportive functional data.; Changed rating: GREEN; Changed publications: 31775018, 35637269, 38622837; Changed phenotypes: Congenital disorder of glycosylation type 1EE with or without immunodeficiency, MIM# 621140
Progressive Neurological Conditions v19.84 Zornitza Stark Panel types changed to Superpanel; Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease
Prepair 1000+ v1.1811 CASK Andrew Coventry reviewed gene: CASK: Rating: GREEN; Mode of pathogenicity: None; Publications: 21954287, 12522552, 19377476, 20029458, 28139025, 28944139; Phenotypes: X-linked syndromic intellectual disability MONDO:0020119; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Prepair 1000+ v1.1811 BRWD3 Andrew Coventry reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: 17668385, 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93 MIM#300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v1.2394 MKKS Zornitza Stark Phenotypes for gene: MKKS were changed from Bardet-Biedl syndrome 6 (MIM#605231); McKusick-Kaufman syndrome, MIM# 236700; Retinitis pigmentosa to Ciliopathy, MONDO:0005308, MKKS-related; Bardet-Biedl syndrome 6 (MIM#605231); McKusick-Kaufman syndrome, MIM# 236700; Retinitis pigmentosa
Ciliopathies v1.63 MKKS Zornitza Stark Phenotypes for gene: MKKS were changed from Bardet-Biedl syndrome 6 (MIM#605231); McKusick-Kaufman syndrome, MIM# 236700; Retinitis pigmentosa to Ciliopathy, MONDO:0005308, MKKS-related; Bardet-Biedl syndrome 6 (MIM#605231); McKusick-Kaufman syndrome, MIM# 236700; Retinitis pigmentosa
Ciliopathies v1.62 MKKS Zornitza Stark edited their review of gene: MKKS: Changed phenotypes: Ciliopathy, MONDO:0005308, MKKS-related, McKusick-Kaufman syndrome, MIM# 236700, Retinitis pigmentosa.
Deafness_Isolated v1.69 MEPE Zornitza Stark Marked gene: MEPE as ready
Deafness_Isolated v1.69 MEPE Zornitza Stark Gene: mepe has been classified as Amber List (Moderate Evidence).
Deafness_Isolated v1.69 MEPE Zornitza Stark Classified gene: MEPE as Amber List (moderate evidence)
Deafness_Isolated v1.69 MEPE Zornitza Stark Gene: mepe has been classified as Amber List (Moderate Evidence).
Deafness_Isolated v1.68 MEPE Zornitza Stark gene: MEPE was added
gene: MEPE was added to Deafness_Isolated. Sources: Expert Review
Mode of inheritance for gene: MEPE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MEPE were set to 30287925
Phenotypes for gene: MEPE were set to Nonsyndromic genetic hearing loss, MONDO:0019497, MEPE-related; hereditary congenital facial paresis; otosclerosis
Review for gene: MEPE was set to AMBER
Added comment: Single four-generation family reported with variant in this gene segregating nonprogressive HCFP and mixed hearing loss (HL). Damaging variants (truncating/frameshift) found to be enriched in otosclerosis cohort (p = 0.0006–0.0060).
Sources: Expert Review
Mendeliome v1.2393 MEPE Zornitza Stark Phenotypes for gene: MEPE were changed from hereditary congenital facial paresis; otosclerosis to Nonsyndromic genetic hearing loss, MONDO:0019497, MEPE-related; hereditary congenital facial paresis; otosclerosis
Mendeliome v1.2392 MEPE Zornitza Stark edited their review of gene: MEPE: Changed phenotypes: Nonsyndromic genetic hearing loss, MONDO:0019497, MEPE-related, hereditary congenital facial paresis, otosclerosis
Lipodystrophy_Lipoatrophy v1.20 MCM7 Zornitza Stark Phenotypes for gene: MCM7 were changed from Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency to Syndromic disease, MONDO:0002254, MCM7-related; Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency
Fetal anomalies v1.318 MCM7 Zornitza Stark Phenotypes for gene: MCM7 were changed from Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency to Syndromic disease, MONDO:0002254, MCM7-related; Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency
Microcephaly v1.302 MCM7 Zornitza Stark Phenotypes for gene: MCM7 were changed from Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency to Syndromic disease, MONDO:0002254, MCM7-related; Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency
Microcephaly v1.301 MCM7 Zornitza Stark edited their review of gene: MCM7: Changed phenotypes: Syndromic disease, MONDO:0002254, MCM7-related, Meier-Gorlin syndrome, Microcephaly, Intellectual disability, Lipodystrophy, Adrenal insufficiency
Mendeliome v1.2392 MCM7 Zornitza Stark Phenotypes for gene: MCM7 were changed from Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency to Syndromic disease, MONDO:0002254, MCM7-related; Meier-Gorlin syndrome; Microcephaly; Intellectual disability; Lipodystrophy; Adrenal insufficiency
Mendeliome v1.2391 MCM7 Zornitza Stark reviewed gene: MCM7: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Syndromic disease, MONDO:0002254, MCM7-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2391 MACROD2 Zornitza Stark Phenotypes for gene: MACROD2 were changed from intellectual disability; dysmorphic features; microcephaly to Syndromic disease, MONDO:0002254, MACROD2-related; intellectual disability; dysmorphic features; microcephaly
Mendeliome v1.2390 MACROD2 Zornitza Stark edited their review of gene: MACROD2: Changed phenotypes: Syndromic disease, MONDO:0002254, MACROD2-related, intellectual disability, dysmorphic features, microcephaly
Intellectual disability syndromic and non-syndromic v1.88 MACROD2 Zornitza Stark Phenotypes for gene: MACROD2 were changed from Syndromic disease, MONDO:0002254, MACROD2-related to Syndromic disease, MONDO:0002254, MACROD2-related
Intellectual disability syndromic and non-syndromic v1.88 MACROD2 Zornitza Stark Phenotypes for gene: MACROD2 were changed from no OMIM number yet to Syndromic disease, MONDO:0002254, MACROD2-related
Prepair 1000+ v1.1811 PEX19 Andrew Coventry gene: PEX19 was added
gene: PEX19 was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: PEX19 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX19 were set to 10051604; 20683989; 39757991; 21031596; 30561787; 36931687
Phenotypes for gene: PEX19 were set to Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886; Peroxisome biogenesis disorder MONDO:0019234
Review for gene: PEX19 was set to GREEN
Added comment: Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of life.

Functional studies and animal models are present.
Reported in individuals across at least 4 unrelated families.
Sources: Literature
Prepair 1000+ v1.1811 SCO1 Andrew Coventry changed review comment from: Four unrelated families reported, typically presenting with lactatic acidosis and encephalopathy in infancy. SCO1 pathogenic variants were first described in an infant with respiratory distress, metabolic acidosis, hepatic failure, and encephalopathy in the setting of profound complex IV deficiency in muscle and liver. Further reports have shown phenotypic spectrum to include cardiomyopathy, encephalopathy, and lactic acidosis without cardiac or hepatic involvement. Many cases are fatal in the first few months of life.
Functional studies and model organisms also present.

ClinGen: While various names have been given to the constellation of features seen in those with SCO1-related disease, pathogenic variants in this gene cause a primary mitochondrial disease. Therefore, the SCO1 phenotype has been lumped into one disease entity.
Sources: Literature; to: Six unrelated families reported.
Typically presenting with lactatic acidosis and encephalopathy in infancy. SCO1 pathogenic variants were first described in an infant with respiratory distress, metabolic acidosis, hepatic failure, and encephalopathy in the setting of profound complex IV deficiency in muscle and liver. Further reports have shown phenotypic spectrum to include cardiomyopathy, encephalopathy, and lactic acidosis without cardiac or hepatic involvement. Many cases are fatal in the first few months of life.
Functional studies and model organisms also present.

ClinGen: While various names have been given to the constellation of features seen in those with SCO1-related disease, pathogenic variants in this gene cause a primary mitochondrial disease. Therefore, the SCO1 phenotype has been lumped into one disease entity.

PMID: 39214134: 3 cases from 2 unrelated families, with developmental and epileptic encephalopathy, hypopituitarism.
Prepair 1000+ v1.1811 SCO1 Andrew Coventry gene: SCO1 was added
gene: SCO1 was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: SCO1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCO1 were set to 11013136; 19295170; 31352446; 23878101
Phenotypes for gene: SCO1 were set to Mitochondrial disease MONDO:0044970; Mitochondrial complex IV deficiency, nuclear type 4 MIM#619048
Review for gene: SCO1 was set to GREEN
Added comment: Four unrelated families reported, typically presenting with lactatic acidosis and encephalopathy in infancy. SCO1 pathogenic variants were first described in an infant with respiratory distress, metabolic acidosis, hepatic failure, and encephalopathy in the setting of profound complex IV deficiency in muscle and liver. Further reports have shown phenotypic spectrum to include cardiomyopathy, encephalopathy, and lactic acidosis without cardiac or hepatic involvement. Many cases are fatal in the first few months of life.
Functional studies and model organisms also present.

ClinGen: While various names have been given to the constellation of features seen in those with SCO1-related disease, pathogenic variants in this gene cause a primary mitochondrial disease. Therefore, the SCO1 phenotype has been lumped into one disease entity.
Sources: Literature
Prepair 1000+ v1.1811 RBM8A Andrew Coventry gene: RBM8A was added
gene: RBM8A was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RBM8A were set to 22366785; 17236129; 26550033; 32227665
Phenotypes for gene: RBM8A were set to Thrombocytopenia-absent radius syndrome MIM#274000
Review for gene: RBM8A was set to AMBER
Added comment: The thrombocytopenia-absent radius syndrome (TAR) is characterised by reduction in the number of platelets and absence of the radius; preservation of the thumb distinguishes TAR from other syndromes that combine blood abnormalities with absence of the radius, such as Fanconi anemia. Individuals with TAR have low numbers of megakaryocytes, platelet precursor cells that reside in bone marrow, and frequently present with bleeding episodes in the first year of life that diminish in frequency and severity with age. The severity of skeletal anomalies varies from absence of radii to virtual absence of upper limbs, with or without lower limb defects such as malformations of the hip and knee.

Vast majority of cases include a recurrent 200kb deletion on one allele (although truncations are seen) and the presence of 1 of 2 SNPs in trans. The SNPs have a MAF of 3.05% and 0.42%. Cases have been reported with this phenotype without the 200kb deletion (PMID: 22366785, 32227665).

Currently, the large CNV in majority of cases would not be detected.
Sources: Literature
Prepair 1000+ v1.1811 MTPAP Andrew Coventry gene: MTPAP was added
gene: MTPAP was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: MTPAP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MTPAP were set to 20970105; 33340416; 32376682; 15769737; 31779033; 35235001; 27391121
Phenotypes for gene: MTPAP were set to Mitochondrial disease MONDO:0044970
Review for gene: MTPAP was set to GREEN
Added comment: Definitive disease-gene classification by ClinGen - "Identified in five individuals from four publications (PMIDs: 20970105, 31779033, 35235001, 27391121). Supported by a biochemical function (mitochondrial translation) shared with other genes associated with primary mitochondrial disease, early embryonic lethality and failure of developmental progression in a knockout mouse model, and disrupted expression of mitochondrial proteins and mitochondrial dysfunction following gene knockdown in HeLa cells (PMIDs: 33340416, 32376682, 15769737)."

Note that 6 individuals with spastic ataxia all had same founder variant and were traced as distantly related (Amish community - c.1432A>G (p.Asn478Asp).
Further additional families reported with a much more severe phenotype of lethal encephalopathy.

Phenotypes previous reported to be associated with MTPAP are likely to represent a continuum of severity associated with a mitochondrial disorder.
Clingen "While various names have been given to the constellation of features seen in those with MTPAP-related disease, including autosomal recessive spastic ataxia 4 (SPAX4) (MIM 613672) in additional to other mitochondrial disorders, pathogenic variants in this gene cause a primary mitochondrial disease.... lumped into one disease entity..."
Sources: Literature
Prepair 1000+ v1.1811 AGTR1 Andrew Coventry gene: AGTR1 was added
gene: AGTR1 was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: AGTR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AGTR1 were set to 16116425; 22095942
Phenotypes for gene: AGTR1 were set to Renal tubular dysgenesis MIM#267430
Review for gene: AGTR1 was set to GREEN
Added comment: Severe disorder of renal tubular development characterised by early onset and persistent fetal anuria leading to oligohydramnios and the Potter sequence, associated with skull ossification defects. Can cause stillbirth. Three unrelated families reported for AGTR1 variants.
Other genes associated with this phenotype are included in 1000+.
Sources: Literature
Prepair 1000+ v1.1811 OTULIN Andrew Coventry reviewed gene: OTULIN: Rating: AMBER; Mode of pathogenicity: None; Publications: 27523608, 27559085, 30796585, 35170849; Phenotypes: Autoinflammation, panniculitis, and dermatosis syndrome, autosomal recessive MIM#617099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1811 PDHX Andrew Coventry gene: PDHX was added
gene: PDHX was added to Prepair 1000+. Sources: Literature
Mode of inheritance for gene: PDHX was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDHX were set to 20002125; 34873726; 33092611; 30981218; 25087164; 22766002; 12557299; 14518830; 15303005; 16566017; 27343776
Phenotypes for gene: PDHX were set to Lacticacidemia due to PDX1 deficiency MIM#245349; Mitochondrial disease MONDO:0044970
Review for gene: PDHX was set to GREEN
Added comment: Established gene-disease association.
Clingen definitive for mitochondrial disease: "While various names have been given to the constellation of features seen in those with PDHX-related disorders, including pyruvate dehydrogenase complex deficiency or PDCD, pathogenic variants in this gene ultimately cause a primary mitochondrial disease. Therefore, the PDHX phenotype has been lumped into one disease entity according to the ClinGen Lumping and Splitting Framework."

Condition is a metabolic disorder associated with abnormal function of the mitochondria in cells, thus depriving the body of energy. Progressive neurological symptoms usually start in infancy but may be evident at birth, or in later childhood; these symptoms may include developmental delay, intermittent ataxia, poor muscle tone (hypotonia), abnormal eye movements, or seizures. Severe lethargy, poor feeding, and tachypnea (rapid breathing) commonly occur, especially during times of illness, stress, or high carbohydrate intake.

Clingen: Age of onset ranges from the first days of life to later in childhood, with some individuals living well into adulthood. Clinical features in affected individuals include neonatal lactic acidosis, LSS, seizures, spasticity, agenesis of the corpus callosum, cerebral atrophy, vomiting, and optic atrophy.

Note:
PDHX c.1336C>T (p.Arg446Ter) is a Roma founder variant;
c.1182+2T>C (p.Ile386SerfsTer13) is a Moroccan founder variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.87 SLC35F1 Zornitza Stark Phenotypes for gene: SLC35F1 were changed from Neruodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome to Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome
Intellectual disability syndromic and non-syndromic v1.86 SLC35F1 Zornitza Stark edited their review of gene: SLC35F1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated, Rett-like syndrome
Mendeliome v1.2390 SLC35F1 Zornitza Stark Phenotypes for gene: SLC35F1 were changed from Neruodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome to Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome
Mendeliome v1.2389 SIX5 Zornitza Stark Classified gene: SIX5 as Red List (low evidence)
Mendeliome v1.2389 SIX5 Zornitza Stark Gene: six5 has been classified as Red List (Low Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.146 SIX5 Zornitza Stark Classified gene: SIX5 as Red List (low evidence)
Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic v0.146 SIX5 Zornitza Stark Gene: six5 has been classified as Red List (Low Evidence).
Fetal anomalies v1.317 SLC30A5 Zornitza Stark Phenotypes for gene: SLC30A5 were changed from Perinatal lethal cardiomyopathy to Cardiomyopathy MONDO:0004994, SLC30A5-related; Perinatal lethal cardiomyopathy
Cardiomyopathy_Paediatric v0.197 SLC30A5 Zornitza Stark Phenotypes for gene: SLC30A5 were changed from Perinatal lethal cardiomyopathy to Cardiomyopathy MONDO:0004994, SLC30A5-related; Perinatal lethal cardiomyopathy
Mendeliome v1.2388 SLC30A5 Zornitza Stark Phenotypes for gene: SLC30A5 were changed from Perinatal lethal cardiomyopathy to Cardiomyopathy MONDO:0004994, SLC30A5-related; Perinatal lethal cardiomyopathy
Hydrops fetalis v0.325 SLC30A5 Zornitza Stark Phenotypes for gene: SLC30A5 were changed from Perinatal lethal cardiomyopathy to Cardiomyopathy MONDO:0004994, SLC30A5-related; Perinatal lethal cardiomyopathy
Mendeliome v1.2387 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from GLUT1 deficiency syndrome 1, infantile onset, severe, MIM#606777; Dystonia 9, MIM#601042; Stomatin-deficient cryohydrocytosis with neurologic defects, MIM#608885; GLUT1 deficiency syndrome 2, childhood onset, MIM#612126; {Epilepsy, idiopathic generalized, susceptibility to, 12}, MIM#614847 to GLUT1 deficiency syndrome, MONDO:0000188; GLUT1 deficiency syndrome 1, infantile onset, severe, MIM#606777; Dystonia 9, MIM#601042; Stomatin-deficient cryohydrocytosis with neurologic defects, MIM#608885; GLUT1 deficiency syndrome 2, childhood onset, MIM#612126; {Epilepsy, idiopathic generalized, susceptibility to, 12}, MIM#614847
Mendeliome v1.2386 RALGAPB Lucy Spencer reviewed gene: RALGAPB: Rating: RED; Mode of pathogenicity: None; Publications: 35830182; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), RALGAPB-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2386 CRMP1 Achchuthan Shanmugasundram changed review comment from: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants.

PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID.

There are three unrelated cases reported with moderate intellectual disability and with monoallelic CRMP1 variants. However, one patient with a different monoallelic CRMP1 variant had normal IQ. Hence, this gene should be rated amber with current evidence.
Sources: Literature; to: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants.

PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID.

Summary: There are three unrelated cases reported with moderate intellectual disability and with monoallelic CRMP1 variants. However, one patient with a different monoallelic CRMP1 variant had normal IQ. Hence, this gene should be rated amber with current evidence.
Sources: Literature
Mendeliome v1.2386 CRMP1 Achchuthan Shanmugasundram gene: CRMP1 was added
gene: CRMP1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CRMP1 were set to 36511780; 39758889
Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092
Review for gene: CRMP1 was set to AMBER
Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants.

PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID.

There are three unrelated cases reported with moderate intellectual disability and with monoallelic CRMP1 variants. However, one patient with a different monoallelic CRMP1 variant had normal IQ. Hence, this gene should be rated amber with current evidence.
Sources: Literature
Mendeliome v1.2386 GAP43 Achchuthan Shanmugasundram gene: GAP43 was added
gene: GAP43 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GAP43 were set to 39738362
Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092
Review for gene: GAP43 was set to RED
Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities.

The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation.
Sources: Literature
Prepair 1000+ v1.1811 MFRP Zornitza Stark Tag for review tag was added to gene: MFRP.
Prepair 1000+ v1.1811 FAM161A Zornitza Stark Marked gene: FAM161A as ready
Prepair 1000+ v1.1811 FAM161A Zornitza Stark Gene: fam161a has been classified as Red List (Low Evidence).
Prepair 1000+ v1.1811 CBS Zornitza Stark Marked gene: CBS as ready
Prepair 1000+ v1.1811 CBS Zornitza Stark Gene: cbs has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.1811 CBS Zornitza Stark Phenotypes for gene: CBS were changed from Homocystinuria, B6-responsive and nonresponsive types, 236200 (3) to Homocystinuria, B6-responsive and nonresponsive types, MIM#236200
Prepair 1000+ v1.1810 CBS Zornitza Stark Publications for gene: CBS were set to
Prepair 1000+ v1.1809 CBS Zornitza Stark Classified gene: CBS as Amber List (moderate evidence)
Prepair 1000+ v1.1809 CBS Zornitza Stark Gene: cbs has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.1808 CBS Zornitza Stark reviewed gene: CBS: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: classic homocystinuria, MONDO:0009352; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1808 ABCC6 Zornitza Stark Marked gene: ABCC6 as ready
Prepair 1000+ v1.1808 ABCC6 Zornitza Stark Gene: abcc6 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.1808 TMEM94 Zornitza Stark Tag for review tag was added to gene: TMEM94.
Prepair 1000+ v1.1808 MBTPS1 Zornitza Stark Tag for review tag was added to gene: MBTPS1.
Prepair 1000+ v1.1808 IGHM Zornitza Stark Tag for review tag was added to gene: IGHM.
Prepair 1000+ v1.1808 DYNC1I2 Zornitza Stark Tag for review tag was added to gene: DYNC1I2.
Prepair 1000+ v1.1808 B9D1 Zornitza Stark Tag for review tag was added to gene: B9D1.
Prepair 1000+ v1.1808 ADPRHL2 Zornitza Stark Tag for review tag was added to gene: ADPRHL2.
Prepair 1000+ v1.1808 ZNHIT3 Zornitza Stark Marked gene: ZNHIT3 as ready
Prepair 1000+ v1.1808 ZNHIT3 Zornitza Stark Gene: znhit3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1808 ZNHIT3 Zornitza Stark Phenotypes for gene: ZNHIT3 were changed from PEHO syndrome, 260565 (3), Autosomal recessive to PEHO syndrome MIM#260565
Prepair 1000+ v1.1807 ZNHIT3 Zornitza Stark Publications for gene: ZNHIT3 were set to
Prepair 1000+ v1.1806 ZNF335 Zornitza Stark Marked gene: ZNF335 as ready
Prepair 1000+ v1.1806 ZNF335 Zornitza Stark Gene: znf335 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1806 ZNF335 Zornitza Stark Phenotypes for gene: ZNF335 were changed from Microcephaly 10, primary, autosomal recessive to Microcephaly 10, primary, autosomal recessive, MIM# 615095
Prepair 1000+ v1.1805 ZNF335 Zornitza Stark Publications for gene: ZNF335 were set to
Prepair 1000+ v1.1804 ZIC3 Zornitza Stark Marked gene: ZIC3 as ready
Prepair 1000+ v1.1804 ZIC3 Zornitza Stark Gene: zic3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1804 ZIC3 Zornitza Stark Phenotypes for gene: ZIC3 were changed from Congenital heart defects, nonsyndromic, 1, X-linked, 306955 (3) to Congenital heart defects, nonsyndromic, 1, X-linked (MIM#306955); Heterotaxy, visceral, 1, X-linked (MIM#306955, MONDO:0010607); VACTERL association, X-linked, MIM# 314390, MONDO:0010752
Prepair 1000+ v1.1803 ZIC3 Zornitza Stark Publications for gene: ZIC3 were set to
Prepair 1000+ v1.1802 ZBTB24 Zornitza Stark Marked gene: ZBTB24 as ready
Prepair 1000+ v1.1802 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1802 ZBTB24 Zornitza Stark Phenotypes for gene: ZBTB24 were changed from Immunodeficiency-centromeric instability-facial anomalies syndrome-2, 614069 (3) to Immunodeficiency-centromeric instability-facial anomalies syndrome 2, MIM# 614069; MONDO:0013553
Prepair 1000+ v1.1801 ZBTB24 Zornitza Stark Publications for gene: ZBTB24 were set to
Prepair 1000+ v1.1800 WDR81 Zornitza Stark Marked gene: WDR81 as ready
Prepair 1000+ v1.1800 WDR81 Zornitza Stark Gene: wdr81 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1800 WDR81 Zornitza Stark Phenotypes for gene: WDR81 were changed from Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185 (3) to Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2 MIM#610185, MONDO:0012430; Hydrocephalus, congenital, 3, with brain anomalies MIM#617967, MONDO:0054794
Prepair 1000+ v1.1799 WDR81 Zornitza Stark Publications for gene: WDR81 were set to
Prepair 1000+ v1.1798 WDR73 Zornitza Stark Marked gene: WDR73 as ready
Prepair 1000+ v1.1798 WDR73 Zornitza Stark Gene: wdr73 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1798 WDR73 Zornitza Stark Phenotypes for gene: WDR73 were changed from Galloway-Mowat syndrome, 251300 (3) to Galloway-Mowat syndrome 1, MIM# 251300
Prepair 1000+ v1.1797 WDR73 Zornitza Stark Publications for gene: WDR73 were set to
Prepair 1000+ v1.1796 VPS45 Zornitza Stark Marked gene: VPS45 as ready
Prepair 1000+ v1.1796 VPS45 Zornitza Stark Gene: vps45 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1796 VPS45 Zornitza Stark Phenotypes for gene: VPS45 were changed from Neutropenia, severe congenital, 5, autosomal recessive, 615285 (3) to Neutropenia, severe congenital, 5, autosomal recessive, MIM#615285
Prepair 1000+ v1.1795 VPS45 Zornitza Stark Publications for gene: VPS45 were set to
Prepair 1000+ v1.1794 VPS13B Zornitza Stark Marked gene: VPS13B as ready
Prepair 1000+ v1.1794 VPS13B Zornitza Stark Gene: vps13b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1794 VPS13B Zornitza Stark Phenotypes for gene: VPS13B were changed from Cohen syndrome, 216550 (3) to Cohen syndrome, MIM# 216550
Prepair 1000+ v1.1793 VPS13B Zornitza Stark Publications for gene: VPS13B were set to
Prepair 1000+ v1.1792 VARS2 Zornitza Stark Marked gene: VARS2 as ready
Prepair 1000+ v1.1792 VARS2 Zornitza Stark Gene: vars2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1792 VARS2 Zornitza Stark Phenotypes for gene: VARS2 were changed from Combined oxidative phosphorylation deficiency 20, 615917 (3) to Combined oxidative phosphorylation deficiency 20 MIM#615917
Prepair 1000+ v1.1791 VARS2 Zornitza Stark Publications for gene: VARS2 were set to
Prepair 1000+ v1.1790 USH2A Zornitza Stark Marked gene: USH2A as ready
Prepair 1000+ v1.1790 USH2A Zornitza Stark Gene: ush2a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1790 USH2A Zornitza Stark Phenotypes for gene: USH2A were changed from Usher syndrome, type 2A, 276901 (3) to Usher syndrome, type 2A, MIM#276901
Prepair 1000+ v1.1789 USH2A Zornitza Stark Publications for gene: USH2A were set to
Prepair 1000+ v1.1788 UFM1 Zornitza Stark Marked gene: UFM1 as ready
Prepair 1000+ v1.1788 UFM1 Zornitza Stark Gene: ufm1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1788 UFM1 Zornitza Stark Phenotypes for gene: UFM1 were changed from Leukodystrophy, hypomyelinating, 14, 617899 (3), Autosomal recessive to Leukodystrophy, hypomyelinating, 14, MIM#617899
Prepair 1000+ v1.1787 UFM1 Zornitza Stark Publications for gene: UFM1 were set to
Prepair 1000+ v1.1786 TYMP Zornitza Stark Marked gene: TYMP as ready
Prepair 1000+ v1.1786 TYMP Zornitza Stark Gene: tymp has been classified as Green List (High Evidence).
Prepair 1000+ v1.1786 TYMP Zornitza Stark Phenotypes for gene: TYMP were changed from Mitochondrial DNA depletion syndrome 1 (MNGIE type), 603041 (3) to Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM#603041
Prepair 1000+ v1.1785 TYMP Zornitza Stark Publications for gene: TYMP were set to
Prepair 1000+ v1.1784 TTC7A Zornitza Stark Marked gene: TTC7A as ready
Prepair 1000+ v1.1784 TTC7A Zornitza Stark Gene: ttc7a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1784 TTC7A Zornitza Stark Phenotypes for gene: TTC7A were changed from Gastrointestinal defects and immunodeficiency syndrome, 243150 (3) to Gastrointestinal defects and immunodeficiency syndrome MIM#243150
Prepair 1000+ v1.1783 TTC7A Zornitza Stark Publications for gene: TTC7A were set to
Prepair 1000+ v1.1782 TTC37 Zornitza Stark Marked gene: TTC37 as ready
Prepair 1000+ v1.1782 TTC37 Zornitza Stark Gene: ttc37 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1782 TTC37 Zornitza Stark Phenotypes for gene: TTC37 were changed from Trichohepatoenteric syndrome 1, 222470 (3) to Trichohepatoenteric syndrome 1 MIM#222470
Prepair 1000+ v1.1781 TTC37 Zornitza Stark Publications for gene: TTC37 were set to
Prepair 1000+ v1.1780 TMEM237 Zornitza Stark Marked gene: TMEM237 as ready
Prepair 1000+ v1.1780 TMEM237 Zornitza Stark Gene: tmem237 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1780 TMEM237 Zornitza Stark Phenotypes for gene: TMEM237 were changed from Joubert syndrome 14, 614424 (3) to Joubert syndrome 14, MIM#614424
Prepair 1000+ v1.1779 TMEM237 Zornitza Stark Publications for gene: TMEM237 were set to
Prepair 1000+ v1.1778 TMEM231 Zornitza Stark Marked gene: TMEM231 as ready
Prepair 1000+ v1.1778 TMEM231 Zornitza Stark Gene: tmem231 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1778 TMEM231 Zornitza Stark Phenotypes for gene: TMEM231 were changed from Joubert syndrome 20, 614970 (3) to Joubert syndrome 20, MIM#614970; Meckel syndrome 11, MIM#615397
Prepair 1000+ v1.1777 TMEM231 Zornitza Stark Publications for gene: TMEM231 were set to
Prepair 1000+ v1.1776 TMEM165 Zornitza Stark Marked gene: TMEM165 as ready
Prepair 1000+ v1.1776 TMEM165 Zornitza Stark Gene: tmem165 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1776 TMEM165 Zornitza Stark Phenotypes for gene: TMEM165 were changed from Congenital disorder of glycosylation, type IIk, 614727 (3) to Congenital disorder of glycosylation, type IIk, MIM#614727
Prepair 1000+ v1.1775 TMEM165 Zornitza Stark Publications for gene: TMEM165 were set to
Prepair 1000+ v1.1774 TJP2 Zornitza Stark Marked gene: TJP2 as ready
Prepair 1000+ v1.1774 TJP2 Zornitza Stark Gene: tjp2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1774 TJP2 Zornitza Stark Phenotypes for gene: TJP2 were changed from Cholestasis, progressive familial intrahepatic 4, 615878 (3) to Cholestasis, progressive familial intrahepatic 4, MIM# 615878
Prepair 1000+ v1.1773 TJP2 Zornitza Stark Publications for gene: TJP2 were set to
Prepair 1000+ v1.1772 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Prepair 1000+ v1.1772 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1772 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from Transcobalamin II deficiency, 275350 (3) to Transcobalamin II deficiency MIM#275350
Prepair 1000+ v1.1771 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Prepair 1000+ v1.1770 TBX19 Zornitza Stark Marked gene: TBX19 as ready
Prepair 1000+ v1.1770 TBX19 Zornitza Stark Gene: tbx19 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1770 TBX19 Zornitza Stark Phenotypes for gene: TBX19 were changed from Adrenocorticotropic hormone deficiency, 201400 (3) to Adrenocorticotropic hormone deficiency, MIM# 201400
Prepair 1000+ v1.1769 TBX19 Zornitza Stark Publications for gene: TBX19 were set to
Prepair 1000+ v1.1768 TBCK Zornitza Stark Marked gene: TBCK as ready
Prepair 1000+ v1.1768 TBCK Zornitza Stark Gene: tbck has been classified as Green List (High Evidence).
Prepair 1000+ v1.1768 TBCK Zornitza Stark Phenotypes for gene: TBCK were changed from Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, 616900 (3), Autosomal recessive to Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900
Prepair 1000+ v1.1767 TBCK Zornitza Stark Publications for gene: TBCK were set to
Prepair 1000+ v1.1766 STRADA Zornitza Stark Marked gene: STRADA as ready
Prepair 1000+ v1.1766 STRADA Zornitza Stark Gene: strada has been classified as Green List (High Evidence).
Prepair 1000+ v1.1766 STRADA Zornitza Stark Phenotypes for gene: STRADA were changed from Polyhydramnios, megalencephaly, and symptomatic epilepsy, 611087 (3), Autosomal recessive to Polyhydramnios, megalencephaly, and symptomatic epilepsy MIM#611087
Prepair 1000+ v1.1765 STRADA Zornitza Stark Publications for gene: STRADA were set to
Prepair 1000+ v1.1764 STAT1 Zornitza Stark Marked gene: STAT1 as ready
Prepair 1000+ v1.1764 STAT1 Zornitza Stark Gene: stat1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1764 STAT1 Zornitza Stark Phenotypes for gene: STAT1 were changed from Immunodeficiency 31B, mycobacterial and viral infections, autosomal recessive, 613796 (3) to Immunodeficiency 31B, mycobacterial and viral infections, autosomal recessive MIM#613796; Immunodeficiency 31B MONDO:0013427
Prepair 1000+ v1.1763 STAT1 Zornitza Stark Publications for gene: STAT1 were set to
Prepair 1000+ v1.1762 ST3GAL5 Zornitza Stark Marked gene: ST3GAL5 as ready
Prepair 1000+ v1.1762 ST3GAL5 Zornitza Stark Gene: st3gal5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1762 ST3GAL5 Zornitza Stark Phenotypes for gene: ST3GAL5 were changed from Salt and pepper developmental regression syndrome, 609056 (3), Autosomal recessive to Salt and pepper developmental regression syndrome, MIM# 609056
Prepair 1000+ v1.1761 ST3GAL5 Zornitza Stark Publications for gene: ST3GAL5 were set to
Prepair 1000+ v1.1760 SSR4 Zornitza Stark Marked gene: SSR4 as ready
Prepair 1000+ v1.1760 SSR4 Zornitza Stark Gene: ssr4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1760 SSR4 Zornitza Stark Phenotypes for gene: SSR4 were changed from Congenital disorder of glycosylation, type Iy, 300934 (3), X-linked recessive to Congenital disorder of glycosylation, type Iy MIM#300934
Prepair 1000+ v1.1759 SSR4 Zornitza Stark Publications for gene: SSR4 were set to
Prepair 1000+ v1.1758 SPINT2 Zornitza Stark Marked gene: SPINT2 as ready
Prepair 1000+ v1.1758 SPINT2 Zornitza Stark Gene: spint2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1758 SPINT2 Zornitza Stark Phenotypes for gene: SPINT2 were changed from Diarrhea 3, secretory sodium, congenital, syndromic, 270420 (3) to Diarrhoea 3, secretory sodium, congenital, syndromic, MIM#270420
Prepair 1000+ v1.1757 SPINT2 Zornitza Stark Publications for gene: SPINT2 were set to
Prepair 1000+ v1.1756 SPATA5 Zornitza Stark Marked gene: SPATA5 as ready
Prepair 1000+ v1.1756 SPATA5 Zornitza Stark Gene: spata5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1756 SPATA5 Zornitza Stark Phenotypes for gene: SPATA5 were changed from Epilepsy, hearing loss, and mental retardation syndrome, 616577 (3), Autosomal recessive to Neurodevelopmental disorder with hearing loss, seizures, and brain abnormalities, MIM# 616577
Prepair 1000+ v1.1755 SPATA5 Zornitza Stark Publications for gene: SPATA5 were set to
Prepair 1000+ v1.1754 SMARCAL1 Zornitza Stark Marked gene: SMARCAL1 as ready
Prepair 1000+ v1.1754 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1754 SMARCAL1 Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from Schimke immunoosseous dysplasia, 242900 (3) to Schimke immunoosseous dysplasia, MIM# 242900
Prepair 1000+ v1.1753 SMARCAL1 Zornitza Stark Publications for gene: SMARCAL1 were set to
Prepair 1000+ v1.1752 SLC6A8 Zornitza Stark Marked gene: SLC6A8 as ready
Prepair 1000+ v1.1752 SLC6A8 Zornitza Stark Gene: slc6a8 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1752 SLC6A8 Zornitza Stark Phenotypes for gene: SLC6A8 were changed from Cerebral creatine deficiency syndrome 1, 300352 (3) to Cerebral creatine deficiency syndrome 1, MIM#300352
Prepair 1000+ v1.1751 SLC6A8 Zornitza Stark Publications for gene: SLC6A8 were set to
Prepair 1000+ v1.1750 SLC6A5 Zornitza Stark Marked gene: SLC6A5 as ready
Prepair 1000+ v1.1750 SLC6A5 Zornitza Stark Gene: slc6a5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1750 SLC6A5 Zornitza Stark Phenotypes for gene: SLC6A5 were changed from Hyperekplexia 3, 614618 (3) to Hyperekplexia 3 MIM#614618
Prepair 1000+ v1.1749 SLC6A5 Zornitza Stark Publications for gene: SLC6A5 were set to
Prepair 1000+ v1.1748 SLC52A3 Zornitza Stark Marked gene: SLC52A3 as ready
Prepair 1000+ v1.1748 SLC52A3 Zornitza Stark Gene: slc52a3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1748 SLC52A3 Zornitza Stark Phenotypes for gene: SLC52A3 were changed from Brown-Vialetto-Van Laere syndrome 1, 211530 (3) to Brown-Vialetto-Van Laere syndrome 1, MIM#211530
Prepair 1000+ v1.1747 SLC52A3 Zornitza Stark Publications for gene: SLC52A3 were set to
Prepair 1000+ v1.1746 SLC52A2 Zornitza Stark Marked gene: SLC52A2 as ready
Prepair 1000+ v1.1746 SLC52A2 Zornitza Stark Gene: slc52a2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1746 SLC52A2 Zornitza Stark Phenotypes for gene: SLC52A2 were changed from Brown-Vialetto-Van Laere syndrome 2, 614707 (3) to Brown-Vialetto-Van Laere syndrome 2, MIM# 614707
Prepair 1000+ v1.1745 SLC52A2 Zornitza Stark Publications for gene: SLC52A2 were set to
Prepair 1000+ v1.1744 SLC4A4 Zornitza Stark Marked gene: SLC4A4 as ready
Prepair 1000+ v1.1744 SLC4A4 Zornitza Stark Gene: slc4a4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1744 SLC4A4 Zornitza Stark Phenotypes for gene: SLC4A4 were changed from Renal tubular acidosis, proximal, with ocular abnormalities, 604278 (3) to Renal tubular acidosis, proximal, with ocular abnormalities, MIM#604278
Prepair 1000+ v1.1743 SLC4A4 Zornitza Stark Publications for gene: SLC4A4 were set to
Prepair 1000+ v1.1742 SLC4A1 Zornitza Stark Phenotypes for gene: SLC4A1 were changed from Distal renal tubular acidosis 4 with hemolytic anemia, MIM# 611590 to Distal renal tubular acidosis 4 with haemolytic anaemia, MIM# 611590
Prepair 1000+ v1.1741 SLC4A1 Zornitza Stark Marked gene: SLC4A1 as ready
Prepair 1000+ v1.1741 SLC4A1 Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1741 SLC4A1 Zornitza Stark Phenotypes for gene: SLC4A1 were changed from Renal tubular acidosis, distal, AR, 611590 (3) to Distal renal tubular acidosis 4 with hemolytic anemia, MIM# 611590
Prepair 1000+ v1.1740 SLC4A1 Zornitza Stark Publications for gene: SLC4A1 were set to
Prepair 1000+ v1.1739 SLC33A1 Zornitza Stark Marked gene: SLC33A1 as ready
Prepair 1000+ v1.1739 SLC33A1 Zornitza Stark Gene: slc33a1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1739 SLC33A1 Zornitza Stark Phenotypes for gene: SLC33A1 were changed from Congenital cataracts, hearing loss, and neurodegeneration, 614482 (3) to Congenital cataracts, hearing loss, and neurodegeneration, MIM#614482
Prepair 1000+ v1.1738 SLC33A1 Zornitza Stark Publications for gene: SLC33A1 were set to
Prepair 1000+ v1.1737 SLC26A3 Zornitza Stark Marked gene: SLC26A3 as ready
Prepair 1000+ v1.1737 SLC26A3 Zornitza Stark Gene: slc26a3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1737 SLC26A3 Zornitza Stark Phenotypes for gene: SLC26A3 were changed from Diarrhea 1, secretory chloride, congenital, 214700 (3) to Diarrhoea 1, secretory chloride, congenital MIM#214700
Prepair 1000+ v1.1736 SLC26A3 Zornitza Stark Publications for gene: SLC26A3 were set to
Prepair 1000+ v1.1735 SLC25A13 Zornitza Stark Marked gene: SLC25A13 as ready
Prepair 1000+ v1.1735 SLC25A13 Zornitza Stark Gene: slc25a13 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1735 SLC25A13 Zornitza Stark Publications for gene: SLC25A13 were set to
Regression v0.574 KLC4 Zornitza Stark Marked gene: KLC4 as ready
Regression v0.574 KLC4 Zornitza Stark Gene: klc4 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.1734 SKIV2L Zornitza Stark Marked gene: SKIV2L as ready
Prepair 1000+ v1.1734 SKIV2L Zornitza Stark Gene: skiv2l has been classified as Green List (High Evidence).
Prepair 1000+ v1.1734 SKIV2L Zornitza Stark Phenotypes for gene: SKIV2L were changed from Trichohepatoenteric syndrome 2, 614602 (3) to Trichohepatoenteric syndrome 2, MIM# 614602
Prepair 1000+ v1.1733 SKIV2L Zornitza Stark Publications for gene: SKIV2L were set to
Prepair 1000+ v1.1732 SIL1 Zornitza Stark Marked gene: SIL1 as ready
Prepair 1000+ v1.1732 SIL1 Zornitza Stark Gene: sil1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1732 SIL1 Zornitza Stark Phenotypes for gene: SIL1 were changed from Marinesco-Sjogren syndrome, 248800 (3) to Marinesco-Sjogren syndrome MIM#248800
Prepair 1000+ v1.1731 SIL1 Zornitza Stark Publications for gene: SIL1 were set to
Prepair 1000+ v1.1730 SERPINH1 Zornitza Stark Marked gene: SERPINH1 as ready
Prepair 1000+ v1.1730 SERPINH1 Zornitza Stark Gene: serpinh1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1730 SERPINH1 Zornitza Stark Phenotypes for gene: SERPINH1 were changed from Orofaciodigital syndrome VI, 277170 (3) to Osteogenesis imperfecta, type X, MIM# 613848; Osteogenesis imperfecta type 10, MONDO:0013459
Prepair 1000+ v1.1729 SERPINH1 Zornitza Stark Publications for gene: SERPINH1 were set to
Prepair 1000+ v1.1728 SEPSECS Zornitza Stark Marked gene: SEPSECS as ready
Prepair 1000+ v1.1728 SEPSECS Zornitza Stark Gene: sepsecs has been classified as Green List (High Evidence).
Prepair 1000+ v1.1728 SEPSECS Zornitza Stark Phenotypes for gene: SEPSECS were changed from Pontocerebellar hypoplasia type 2D, 613811 (3) to Pontocerebellar hypoplasia type 2D, MIM# 613811
Prepair 1000+ v1.1727 SEPSECS Zornitza Stark Publications for gene: SEPSECS were set to
Prepair 1000+ v1.1726 SELENON Zornitza Stark Marked gene: SELENON as ready
Prepair 1000+ v1.1726 SELENON Zornitza Stark Gene: selenon has been classified as Green List (High Evidence).
Prepair 1000+ v1.1726 SELENON Zornitza Stark Phenotypes for gene: SELENON were changed from Muscular dystrophy, rigid spine, 1, 602771 (3) to Congenital myopathy 3 with rigid spine, MIM# 602771
Prepair 1000+ v1.1725 SELENON Zornitza Stark Publications for gene: SELENON were set to
Prepair 1000+ v1.1724 SCNN1A Zornitza Stark Marked gene: SCNN1A as ready
Prepair 1000+ v1.1724 SCNN1A Zornitza Stark Gene: scnn1a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1724 SCNN1A Zornitza Stark Phenotypes for gene: SCNN1A were changed from Pseudohypoaldosteronism, type I, 264350 (3) to Pseudohypoaldosteronism, type IB1, autosomal recessive, MIM# 264350
Prepair 1000+ v1.1723 SCNN1A Zornitza Stark Publications for gene: SCNN1A were set to
Prepair 1000+ v1.1722 RSPH4A Zornitza Stark Marked gene: RSPH4A as ready
Prepair 1000+ v1.1722 RSPH4A Zornitza Stark Gene: rsph4a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1722 RSPH4A Zornitza Stark Phenotypes for gene: RSPH4A were changed from Ciliary dyskinesia, primary, 11, 612649 (3) to Ciliary dyskinesia, primary, 11, MIM# 612649
Prepair 1000+ v1.1721 RSPH4A Zornitza Stark Publications for gene: RSPH4A were set to
Prepair 1000+ v1.1720 PSPH Zornitza Stark Marked gene: PSPH as ready
Prepair 1000+ v1.1720 PSPH Zornitza Stark Gene: psph has been classified as Green List (High Evidence).
Prepair 1000+ v1.1720 PSPH Zornitza Stark Phenotypes for gene: PSPH were changed from Phosphoserine phosphatase deficiency, 614023 (3) to Phosphoserine phosphatase deficiency , MIM# 614023
Prepair 1000+ v1.1719 PSPH Zornitza Stark Publications for gene: PSPH were set to
Prepair 1000+ v1.1718 PPT1 Zornitza Stark Marked gene: PPT1 as ready
Prepair 1000+ v1.1718 PPT1 Zornitza Stark Gene: ppt1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1718 PPT1 Zornitza Stark Phenotypes for gene: PPT1 were changed from Ceroid lipofuscinosis, neuronal, 1, 256730 (3) to Ceroid lipofuscinosis, neuronal, 1, MIM# 256730
Prepair 1000+ v1.1717 PPT1 Zornitza Stark Publications for gene: PPT1 were set to
Prepair 1000+ v1.1716 POMK Zornitza Stark Marked gene: POMK as ready
Prepair 1000+ v1.1716 POMK Zornitza Stark Gene: pomk has been classified as Green List (High Evidence).
Prepair 1000+ v1.1716 POMK Zornitza Stark Phenotypes for gene: POMK were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, 615249 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, MIM#615249
Prepair 1000+ v1.1715 POMK Zornitza Stark Publications for gene: POMK were set to
Prepair 1000+ v1.1714 POLR3A Zornitza Stark Marked gene: POLR3A as ready
Prepair 1000+ v1.1714 POLR3A Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1714 POLR3A Zornitza Stark Phenotypes for gene: POLR3A were changed from Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, 607694 (3) to Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; Wiedemann-Rautenstrauch syndrome, MIM# 264090
Prepair 1000+ v1.1713 POLR3A Zornitza Stark Publications for gene: POLR3A were set to
Prepair 1000+ v1.1712 PLOD1 Zornitza Stark Marked gene: PLOD1 as ready
Prepair 1000+ v1.1712 PLOD1 Zornitza Stark Gene: plod1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1712 PLOD1 Zornitza Stark Phenotypes for gene: PLOD1 were changed from Ehlers-Danlos syndrome, type VI, 225400 (3) to Ehlers-Danlos syndrome, kyphoscoliotic type, 1, MIM# 225400
Prepair 1000+ v1.1711 PLOD1 Zornitza Stark Publications for gene: PLOD1 were set to
Prepair 1000+ v1.1710 PLEC Zornitza Stark Marked gene: PLEC as ready
Prepair 1000+ v1.1710 PLEC Zornitza Stark Gene: plec has been classified as Green List (High Evidence).
Prepair 1000+ v1.1710 PLEC Zornitza Stark Phenotypes for gene: PLEC were changed from Epidermolysis bullosa simplex with pyloric atresia, 612138 (3) to Epidermolysis bullosa simplex 5D, generalized intermediate, autosomal recessive, MIM# 616487; Epidermolysis bullosa simplex 5B, with muscular dystrophy, MIM# 226670; Epidermolysis bullosa simplex 5C, with pyloric atresia MIM# 612138; Muscular dystrophy, limb-girdle, autosomal recessive 17, MIM# 613723
Prepair 1000+ v1.1709 PLEC Zornitza Stark Publications for gene: PLEC were set to
Prepair 1000+ v1.1708 PFKM Zornitza Stark Marked gene: PFKM as ready
Prepair 1000+ v1.1708 PFKM Zornitza Stark Gene: pfkm has been classified as Green List (High Evidence).
Prepair 1000+ v1.1708 PFKM Zornitza Stark Phenotypes for gene: PFKM were changed from Glycogen storage disease VII, 232800 (3) to Glycogen storage disease VII MIM#232800
Prepair 1000+ v1.1707 PFKM Zornitza Stark Publications for gene: PFKM were set to
Prepair 1000+ v1.1706 PEX6 Zornitza Stark Marked gene: PEX6 as ready
Prepair 1000+ v1.1706 PEX6 Zornitza Stark Gene: pex6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1706 PEX6 Zornitza Stark Phenotypes for gene: PEX6 were changed from Peroxisome biogenesis disorder 4A (Zellweger), 614862 to Peroxisome biogenesis disorder 4A (Zellweger), MIM# 614862; Peroxisome biogenesis disorder-4B, MIM# 614863
Prepair 1000+ v1.1705 PEX6 Zornitza Stark Publications for gene: PEX6 were set to
Prepair 1000+ v1.1704 PEX13 Zornitza Stark Marked gene: PEX13 as ready
Prepair 1000+ v1.1704 PEX13 Zornitza Stark Gene: pex13 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1704 PEX13 Zornitza Stark Phenotypes for gene: PEX13 were changed from Peroxisome biogenesis disorder 11A (Zellweger), 614883 to Peroxisome biogenesis disorder 11A (Zellweger), MIM#614883; Peroxisome biogenesis disorder 11B, MIM#614885
Prepair 1000+ v1.1703 PEX12 Zornitza Stark Marked gene: PEX12 as ready
Prepair 1000+ v1.1703 PEX12 Zornitza Stark Gene: pex12 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1703 PEX12 Zornitza Stark Phenotypes for gene: PEX12 were changed from Peroxisome biogenesis disorder 3A (Zellweger), 614859 to Peroxisome biogenesis disorder 3A (Zellweger), MIM#614859; Peroxisome biogenesis disorder 3B, MIM#266510
Prepair 1000+ v1.1702 PEPD Zornitza Stark Marked gene: PEPD as ready
Prepair 1000+ v1.1702 PEPD Zornitza Stark Gene: pepd has been classified as Green List (High Evidence).
Prepair 1000+ v1.1702 PEPD Zornitza Stark Phenotypes for gene: PEPD were changed from Prolidase deficiency, 170100 (3) to Prolidase deficiency, MIM# 170100
Prepair 1000+ v1.1701 PEPD Zornitza Stark Publications for gene: PEPD were set to
Prepair 1000+ v1.1700 P3H1 Zornitza Stark Marked gene: P3H1 as ready
Prepair 1000+ v1.1700 P3H1 Zornitza Stark Gene: p3h1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1700 P3H1 Zornitza Stark Phenotypes for gene: P3H1 were changed from Osteogenesis imperfecta, type VIII, 610915 (3) to Osteogenesis imperfecta, type VIII, MIM#610915
Prepair 1000+ v1.1699 P3H1 Zornitza Stark Publications for gene: P3H1 were set to
Prepair 1000+ v1.1698 OTC Zornitza Stark Marked gene: OTC as ready
Prepair 1000+ v1.1698 OTC Zornitza Stark Gene: otc has been classified as Green List (High Evidence).
Prepair 1000+ v1.1698 OTC Zornitza Stark Phenotypes for gene: OTC were changed from Ornithine transcarbamylase deficiency, 311250 (3) to Ornithine transcarbamylase deficiency, MIM# 311250
Prepair 1000+ v1.1697 OTC Zornitza Stark Publications for gene: OTC were set to
Prepair 1000+ v1.1696 ORC6 Zornitza Stark Marked gene: ORC6 as ready
Prepair 1000+ v1.1696 ORC6 Zornitza Stark Gene: orc6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1696 ORC6 Zornitza Stark Phenotypes for gene: ORC6 were changed from Meier-Gorlin syndrome 3, 613803 (3) to Meier-Gorlin syndrome 3 MIM#613803
Prepair 1000+ v1.1695 ORC6 Zornitza Stark Publications for gene: ORC6 were set to
Prepair 1000+ v1.1694 ORAI1 Zornitza Stark Marked gene: ORAI1 as ready
Prepair 1000+ v1.1694 ORAI1 Zornitza Stark Gene: orai1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1694 ORAI1 Zornitza Stark Phenotypes for gene: ORAI1 were changed from Immunodeficiency 9, 612782 (3) to Immunodeficiency 9, MIM#612782; Myopathy, tubular aggregate, 2, MIM#615883
Prepair 1000+ v1.1693 ORAI1 Zornitza Stark Publications for gene: ORAI1 were set to
Prepair 1000+ v1.1692 OPHN1 Zornitza Stark Marked gene: OPHN1 as ready
Prepair 1000+ v1.1692 OPHN1 Zornitza Stark Gene: ophn1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1692 OPHN1 Zornitza Stark Phenotypes for gene: OPHN1 were changed from Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 (3) to Intellectual developmental disorder, X-linked syndromic, Billuart type MIM#300486; X-linked intellectual disability-cerebellar hypoplasia syndrome MONDO:0010337
Prepair 1000+ v1.1691 OPHN1 Zornitza Stark Publications for gene: OPHN1 were set to
Prepair 1000+ v1.1690 OFD1 Zornitza Stark Marked gene: OFD1 as ready
Prepair 1000+ v1.1690 OFD1 Zornitza Stark Gene: ofd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1690 OFD1 Zornitza Stark Phenotypes for gene: OFD1 were changed from Joubert syndrome 10, 300804 (3) to Joubert syndrome 10 MIM#300804; Simpson-Golabi-Behmel syndrome, type 2 MIM#300209
Prepair 1000+ v1.1689 OFD1 Zornitza Stark Publications for gene: OFD1 were set to
Prepair 1000+ v1.1688 NYX Zornitza Stark Marked gene: NYX as ready
Prepair 1000+ v1.1688 NYX Zornitza Stark Gene: nyx has been classified as Green List (High Evidence).
Prepair 1000+ v1.1688 NYX Zornitza Stark Phenotypes for gene: NYX were changed from Night blindness, congenital stationary (complete), 1A, X-linked, MIM #310500 to Night blindness, congenital stationary (complete), 1A, X-linked MIM310500
Prepair 1000+ v1.1687 NYX Zornitza Stark Publications for gene: NYX were set to
Prepair 1000+ v1.1686 NT5C2 Zornitza Stark Marked gene: NT5C2 as ready
Prepair 1000+ v1.1686 NT5C2 Zornitza Stark Gene: nt5c2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1686 NT5C2 Zornitza Stark Phenotypes for gene: NT5C2 were changed from Spastic paraplegia 45, 613162 (3) to Spastic paraplegia 45, autosomal recessive, MIM# 613162
Prepair 1000+ v1.1685 NT5C2 Zornitza Stark Publications for gene: NT5C2 were set to
Prepair 1000+ v1.1684 NSUN2 Zornitza Stark Marked gene: NSUN2 as ready
Prepair 1000+ v1.1684 NSUN2 Zornitza Stark Gene: nsun2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1684 NSUN2 Zornitza Stark Phenotypes for gene: NSUN2 were changed from Mental retardation, autosomal recessive 5, 611091 (3) to Intellectual developmental disorder, autosomal recessive 5, MIM# 611091
Prepair 1000+ v1.1683 NSUN2 Zornitza Stark Publications for gene: NSUN2 were set to
Prepair 1000+ v1.1682 NPHS2 Zornitza Stark Marked gene: NPHS2 as ready
Prepair 1000+ v1.1682 NPHS2 Zornitza Stark Gene: nphs2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1682 NPHS2 Zornitza Stark Phenotypes for gene: NPHS2 were changed from Nephrotic syndrome, type 2, 600995 (3) to Nephrotic syndrome, type 2 MIM#600995
Prepair 1000+ v1.1681 NPHS2 Zornitza Stark Publications for gene: NPHS2 were set to
Prepair 1000+ v1.1680 NIPAL4 Zornitza Stark Marked gene: NIPAL4 as ready
Prepair 1000+ v1.1680 NIPAL4 Zornitza Stark Gene: nipal4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1680 NIPAL4 Zornitza Stark Phenotypes for gene: NIPAL4 were changed from Ichthyosis, congenital, autosomal recessive 6, 612281 (3) to Ichthyosis, congenital, autosomal recessive 6 MIM#612281
Prepair 1000+ v1.1679 NIPAL4 Zornitza Stark Publications for gene: NIPAL4 were set to
Prepair 1000+ v1.1678 NHS Zornitza Stark Marked gene: NHS as ready
Prepair 1000+ v1.1678 NHS Zornitza Stark Gene: nhs has been classified as Green List (High Evidence).
Prepair 1000+ v1.1678 NHS Zornitza Stark Phenotypes for gene: NHS were changed from Cataract 40, X-linked, 302200 (3) to Nance-Horan syndrome MIM#302350
Prepair 1000+ v1.1677 NHS Zornitza Stark Publications for gene: NHS were set to
Prepair 1000+ v1.1676 NHS Zornitza Stark reviewed gene: NHS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Nance-Horan syndrome MIM#302350; Mode of inheritance: None
Prepair 1000+ v1.1676 NEK8 Zornitza Stark Marked gene: NEK8 as ready
Prepair 1000+ v1.1676 NEK8 Zornitza Stark Gene: nek8 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1676 NEK8 Zornitza Stark Phenotypes for gene: NEK8 were changed from Renal-hepatic-pancreatic dysplasia 2, 615415 (3), Autosomal recessive to Renal-hepatic-pancreatic dysplasia 2 MIM#615415
Prepair 1000+ v1.1675 NEK8 Zornitza Stark Publications for gene: NEK8 were set to
Prepair 1000+ v1.1674 NDUFS1 Zornitza Stark Marked gene: NDUFS1 as ready
Prepair 1000+ v1.1674 NDUFS1 Zornitza Stark Gene: ndufs1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1674 NDUFS1 Zornitza Stark Phenotypes for gene: NDUFS1 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 5, MIM#618226
Prepair 1000+ v1.1673 NDUFS1 Zornitza Stark Publications for gene: NDUFS1 were set to
Prepair 1000+ v1.1672 NAXE Zornitza Stark Marked gene: NAXE as ready
Prepair 1000+ v1.1672 NAXE Zornitza Stark Gene: naxe has been classified as Green List (High Evidence).
Prepair 1000+ v1.1672 NAXE Zornitza Stark Phenotypes for gene: NAXE were changed from Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 617186 (3), Autosomal recessive to Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, MIM #617186
Prepair 1000+ v1.1671 NAXE Zornitza Stark Publications for gene: NAXE were set to
Prepair 1000+ v1.1670 MPLKIP Zornitza Stark Marked gene: MPLKIP as ready
Prepair 1000+ v1.1670 MPLKIP Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence).
Prepair 1000+ v1.1670 MPLKIP Zornitza Stark Phenotypes for gene: MPLKIP were changed from Trichothiodystrophy 4, nonphotosensitive, 234050 (3) to Trichothiodystrophy 4, nonphotosensitive MIM#234050
Prepair 1000+ v1.1669 MPLKIP Zornitza Stark Publications for gene: MPLKIP were set to
Prepair 1000+ v1.1668 MMAB Zornitza Stark Marked gene: MMAB as ready
Prepair 1000+ v1.1668 MMAB Zornitza Stark Gene: mmab has been classified as Green List (High Evidence).
Prepair 1000+ v1.1668 MMAB Zornitza Stark Phenotypes for gene: MMAB were changed from Methylmalonic aciduria, vitamin B12-responsive, due to defect in synthesis of adenosylcobalamin, cblB complementation type, 251110 (3) to Methylmalonic aciduria, vitamin B12-responsive, cblB type MIM#251110
Prepair 1000+ v1.1667 MMAB Zornitza Stark Publications for gene: MMAB were set to
Prepair 1000+ v1.1666 MGAT2 Zornitza Stark Marked gene: MGAT2 as ready
Prepair 1000+ v1.1666 MGAT2 Zornitza Stark Gene: mgat2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1666 MGAT2 Zornitza Stark Phenotypes for gene: MGAT2 were changed from Congenital disorder of glycosylation, type IIa, 212066 (3) to Congenital disorder of glycosylation, type IIa MIM#212066
Prepair 1000+ v1.1665 MGAT2 Zornitza Stark Publications for gene: MGAT2 were set to
Prepair 1000+ v1.1664 MCFD2 Zornitza Stark Marked gene: MCFD2 as ready
Prepair 1000+ v1.1664 MCFD2 Zornitza Stark Gene: mcfd2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1664 MCFD2 Zornitza Stark Phenotypes for gene: MCFD2 were changed from Factor V and factor VIII, combined deficiency of, 613625 (3) to Factor V and factor VIII, combined deficiency of MIM#613625
Prepair 1000+ v1.1663 MCFD2 Zornitza Stark Publications for gene: MCFD2 were set to
Prepair 1000+ v1.1662 MCFD2 Zornitza Stark reviewed gene: MCFD2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Factor V and factor VIII, combined deficiency of MIM#613625; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1662 MALT1 Zornitza Stark Marked gene: MALT1 as ready
Prepair 1000+ v1.1662 MALT1 Zornitza Stark Gene: malt1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1662 MALT1 Zornitza Stark Phenotypes for gene: MALT1 were changed from Immunodeficiency 12, 615468 (3) to Immunodeficiency 12 MIM#615468
Prepair 1000+ v1.1661 MALT1 Zornitza Stark Publications for gene: MALT1 were set to
Prepair 1000+ v1.1660 LTBP4 Zornitza Stark Marked gene: LTBP4 as ready
Prepair 1000+ v1.1660 LTBP4 Zornitza Stark Gene: ltbp4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1660 LTBP4 Zornitza Stark Phenotypes for gene: LTBP4 were changed from Cutis laxa, autosomal recessive, type IC, 613177 (3) to Cutis laxa, autosomal recessive, type IC, #613177
Prepair 1000+ v1.1659 LTBP4 Zornitza Stark Publications for gene: LTBP4 were set to
Prepair 1000+ v1.1658 LTBP3 Zornitza Stark Marked gene: LTBP3 as ready
Prepair 1000+ v1.1658 LTBP3 Zornitza Stark Gene: ltbp3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1658 LTBP3 Zornitza Stark Phenotypes for gene: LTBP3 were changed from Tooth agenesis, selective, 6, 613097 (3) to Dental anomalies and short stature, MIM #601216
Prepair 1000+ v1.1657 LTBP3 Zornitza Stark Publications for gene: LTBP3 were set to
Prepair 1000+ v1.1656 LRP5 Zornitza Stark Marked gene: LRP5 as ready
Prepair 1000+ v1.1656 LRP5 Zornitza Stark Added comment: Comment when marking as ready: Prepair only screens for recessive conditions.
Prepair 1000+ v1.1656 LRP5 Zornitza Stark Gene: lrp5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1656 LRP5 Zornitza Stark Phenotypes for gene: LRP5 were changed from Osteoporosis-pseudoglioma syndrome, 259770 (3) to Exudative vitreoretinopathy 4 MIM#601813; Osteoporosis-pseudoglioma syndrome MIM#259770
Prepair 1000+ v1.1655 LRP5 Zornitza Stark Publications for gene: LRP5 were set to
Prepair 1000+ v1.1654 LRP2 Zornitza Stark Marked gene: LRP2 as ready
Prepair 1000+ v1.1654 LRP2 Zornitza Stark Gene: lrp2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1654 LRP2 Zornitza Stark Phenotypes for gene: LRP2 were changed from Donnai-Barrow syndrome, 222448 (3) to Donnai-Barrow syndrome, MIM #222448
Prepair 1000+ v1.1653 LRP2 Zornitza Stark Publications for gene: LRP2 were set to
Prepair 1000+ v1.1652 LRIG2 Zornitza Stark Marked gene: LRIG2 as ready
Prepair 1000+ v1.1652 LRIG2 Zornitza Stark Gene: lrig2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1652 LRIG2 Zornitza Stark Phenotypes for gene: LRIG2 were changed from Urofacial syndrome 2, 615112 (3) to Urofacial syndrome 2, MIM #615112
Prepair 1000+ v1.1651 LRIG2 Zornitza Stark Publications for gene: LRIG2 were set to
Prepair 1000+ v1.1650 LIPT1 Zornitza Stark Marked gene: LIPT1 as ready
Prepair 1000+ v1.1650 LIPT1 Zornitza Stark Gene: lipt1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1650 LIPT1 Zornitza Stark Phenotypes for gene: LIPT1 were changed from Lipoyltransferase 1 deficiency, 616299 (3) to Lipoyltransferase 1 deficiency, MIM#616299
Prepair 1000+ v1.1649 LIPT1 Zornitza Stark Publications for gene: LIPT1 were set to
Prepair 1000+ v1.1648 LIPT1 Zornitza Stark reviewed gene: LIPT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681092; Phenotypes: Lipoyltransferase 1 deficiency, MIM#616299; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1648 LAMB3 Zornitza Stark Marked gene: LAMB3 as ready
Prepair 1000+ v1.1648 LAMB3 Zornitza Stark Gene: lamb3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1648 LAMB3 Zornitza Stark Phenotypes for gene: LAMB3 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 1A, intermediate MIM#226650; Epidermolysis bullosa, junctional 1B, severe MIM#226700
Prepair 1000+ v1.1647 LAMB3 Zornitza Stark Publications for gene: LAMB3 were set to
Prepair 1000+ v1.1646 LAMA3 Zornitza Stark Marked gene: LAMA3 as ready
Prepair 1000+ v1.1646 LAMA3 Zornitza Stark Gene: lama3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1646 LAMA3 Zornitza Stark Phenotypes for gene: LAMA3 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 2B, severe (MIM#619784); 3. Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous (MIM#245660); Epidermolysis bullosa, junctional 2A, intermediate (MIM#619783)
Prepair 1000+ v1.1645 LAMA3 Zornitza Stark Publications for gene: LAMA3 were set to
Prepair 1000+ v1.1644 LAMA1 Zornitza Stark Marked gene: LAMA1 as ready
Prepair 1000+ v1.1644 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1644 LAMA1 Zornitza Stark Phenotypes for gene: LAMA1 were changed from Poretti-Boltshauser syndrome, 615960 (3) to Poretti-Boltshauser syndrome, MIM #615960
Prepair 1000+ v1.1643 LAMA1 Zornitza Stark Publications for gene: LAMA1 were set to
Prepair 1000+ v1.1642 KLHL40 Zornitza Stark Marked gene: KLHL40 as ready
Prepair 1000+ v1.1642 KLHL40 Zornitza Stark Gene: klhl40 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1642 KLHL40 Zornitza Stark Phenotypes for gene: KLHL40 were changed from Nemaline myopathy 8, autosomal recessive, 615348 (3) to Nemaline myopathy 8, autosomal recessive MIM#615348
Prepair 1000+ v1.1641 KLHL40 Zornitza Stark Publications for gene: KLHL40 were set to
Prepair 1000+ v1.1640 JAM3 Zornitza Stark Marked gene: JAM3 as ready
Prepair 1000+ v1.1640 JAM3 Zornitza Stark Gene: jam3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1640 JAM3 Zornitza Stark Phenotypes for gene: JAM3 were changed from Hemorrhagic destruction of the brain, subependymal calcification, and cataracts, 613730 (3) to Haemorrhagic destruction of the brain, subependymal calcification, and cataracts MIM#613730
Prepair 1000+ v1.1639 JAM3 Zornitza Stark Publications for gene: JAM3 were set to
Prepair 1000+ v1.1638 IVD Zornitza Stark Marked gene: IVD as ready
Prepair 1000+ v1.1638 IVD Zornitza Stark Gene: ivd has been classified as Green List (High Evidence).
Prepair 1000+ v1.1638 IVD Zornitza Stark Phenotypes for gene: IVD were changed from Isovaleric acidemia, 243500 (3) to Isovaleric acidemia, MIM #243500
Prepair 1000+ v1.1637 IVD Zornitza Stark Publications for gene: IVD were set to
Prepair 1000+ v1.1636 IQCB1 Zornitza Stark Marked gene: IQCB1 as ready
Prepair 1000+ v1.1636 IQCB1 Zornitza Stark Gene: iqcb1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1636 IQCB1 Zornitza Stark Phenotypes for gene: IQCB1 were changed from Senior-Loken syndrome 5, 609254 (3) to Senior-Loken syndrome 5 MIM#609254
Prepair 1000+ v1.1635 IQCB1 Zornitza Stark Publications for gene: IQCB1 were set to
Prepair 1000+ v1.1634 INSR Zornitza Stark Marked gene: INSR as ready
Prepair 1000+ v1.1634 INSR Zornitza Stark Gene: insr has been classified as Green List (High Evidence).
Prepair 1000+ v1.1634 INSR Zornitza Stark Phenotypes for gene: INSR were changed from Leprechaunism, 246200 (3) to Donohue syndrome MIM#246200; Rabson-Mendenhall syndrome MIM#262190
Prepair 1000+ v1.1633 INSR Zornitza Stark Publications for gene: INSR were set to
Prepair 1000+ v1.1632 IFNGR1 Zornitza Stark Marked gene: IFNGR1 as ready
Prepair 1000+ v1.1632 IFNGR1 Zornitza Stark Gene: ifngr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1632 IFNGR1 Zornitza Stark Phenotypes for gene: IFNGR1 were changed from Immunodeficiency 27A, mycobacteriosis, AR, 209950 (3) to Immunodeficiency 27A, mycobacteriosis, MIM#209950
Prepair 1000+ v1.1631 IFNGR1 Zornitza Stark Publications for gene: IFNGR1 were set to
Prepair 1000+ v1.1630 IER3IP1 Zornitza Stark Marked gene: IER3IP1 as ready
Prepair 1000+ v1.1630 IER3IP1 Zornitza Stark Gene: ier3ip1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1630 IER3IP1 Zornitza Stark Phenotypes for gene: IER3IP1 were changed from Microcephaly, epilepsy, and diabetes syndrome, 614231 (3) to Microcephaly, epilepsy, and diabetes syndrome, MIM# 614231
Prepair 1000+ v1.1629 HPD Zornitza Stark Marked gene: HPD as ready
Prepair 1000+ v1.1629 HPD Zornitza Stark Gene: hpd has been classified as Green List (High Evidence).
Prepair 1000+ v1.1629 HPD Zornitza Stark Phenotypes for gene: HPD were changed from Tyrosinemia, type III, 276710 (3) to Tyrosinemia, type III, MIM#276710
Prepair 1000+ v1.1628 HPD Zornitza Stark Publications for gene: HPD were set to
Prepair 1000+ v1.1627 HPD Zornitza Stark reviewed gene: HPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 29456978; Phenotypes: Tyrosinemia, type III, MIM#276710; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1627 HMGCL Zornitza Stark Marked gene: HMGCL as ready
Prepair 1000+ v1.1627 HMGCL Zornitza Stark Gene: hmgcl has been classified as Green List (High Evidence).
Prepair 1000+ v1.1627 HMGCL Zornitza Stark Phenotypes for gene: HMGCL were changed from HMG-CoA lyase deficiency, 246450 (3) to HMG-CoA lyase deficiency, MIM# 246450
Prepair 1000+ v1.1626 HBB Zornitza Stark Tag for review tag was added to gene: HBB.
Prepair 1000+ v1.1626 HADHA Zornitza Stark Marked gene: HADHA as ready
Prepair 1000+ v1.1626 HADHA Zornitza Stark Gene: hadha has been classified as Green List (High Evidence).
Prepair 1000+ v1.1626 HADHA Zornitza Stark Phenotypes for gene: HADHA were changed from Fatty liver, acute, of pregnancy, 609016 (3) to LCHAD deficiency MIM#609016; Mitochondrial trifunctional protein deficiency 1 MIM#609015
Prepair 1000+ v1.1625 GTPBP3 Zornitza Stark Marked gene: GTPBP3 as ready
Prepair 1000+ v1.1625 GTPBP3 Zornitza Stark Gene: gtpbp3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1625 GTPBP3 Zornitza Stark Phenotypes for gene: GTPBP3 were changed from Combined oxidative phosphorylation deficiency 23, 616198 (3) to Combined oxidative phosphorylation deficiency 23 MIM#616198
Prepair 1000+ v1.1624 GTPBP3 Zornitza Stark Publications for gene: GTPBP3 were set to
Prepair 1000+ v1.1623 GNPTG Zornitza Stark Marked gene: GNPTG as ready
Prepair 1000+ v1.1623 GNPTG Zornitza Stark Gene: gnptg has been classified as Green List (High Evidence).
Prepair 1000+ v1.1623 GNPTG Zornitza Stark Phenotypes for gene: GNPTG were changed from Mucolipidosis III gamma, 252605 (3) to Mucolipidosis III gamma, MIM# 252605
Prepair 1000+ v1.1622 GNPTG Zornitza Stark Publications for gene: GNPTG were set to
Prepair 1000+ v1.1621 GLE1 Zornitza Stark Marked gene: GLE1 as ready
Prepair 1000+ v1.1621 GLE1 Zornitza Stark Gene: gle1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1621 GLE1 Zornitza Stark Phenotypes for gene: GLE1 were changed from Arthrogryposis, lethal, with anterior horn cell disease, 611890 (3) to Congenital arthrogryposis with anterior horn cell disease, MIM #611890; Lethal congenital contracture syndrome 1, MIM #253310
Prepair 1000+ v1.1620 GLE1 Zornitza Stark Publications for gene: GLE1 were set to
Prepair 1000+ v1.1619 GDI1 Zornitza Stark Marked gene: GDI1 as ready
Prepair 1000+ v1.1619 GDI1 Zornitza Stark Gene: gdi1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1619 GDI1 Zornitza Stark Phenotypes for gene: GDI1 were changed from Mental retardation, X-linked 41, 300849 (3) to Intellectual developmental disorder, X-linked 41, MIM #300849
Prepair 1000+ v1.1618 GDI1 Zornitza Stark Publications for gene: GDI1 were set to
Prepair 1000+ v1.1617 GDF1 Zornitza Stark Marked gene: GDF1 as ready
Prepair 1000+ v1.1617 GDF1 Zornitza Stark Gene: gdf1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1617 GDF1 Zornitza Stark Publications for gene: GDF1 were set to
Prepair 1000+ v1.1616 GDF1 Zornitza Stark Phenotypes for gene: GDF1 were changed from Right atrial isomerism, 208530 (3) to Congenital heart defects, multiple types, 6 MIM#613854; Right atrial isomerism (Ivemark), MIM #208530
Prepair 1000+ v1.1615 GDAP1 Zornitza Stark Marked gene: GDAP1 as ready
Prepair 1000+ v1.1615 GDAP1 Zornitza Stark Gene: gdap1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1615 GDAP1 Zornitza Stark Phenotypes for gene: GDAP1 were changed from Charcot-Marie-Tooth disease, recessive intermediate, A, 608340 (3) to Charcot-Marie-Tooth disease, axonal, type 2K, MIM #607831; Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM #607706; Charcot-Marie-Tooth disease, recessive intermediate, A, MIM #608340; Charcot-Marie-Tooth disease, type 4A, MIM#214400
Prepair 1000+ v1.1614 GDAP1 Zornitza Stark Publications for gene: GDAP1 were set to
Prepair 1000+ v1.1613 GAS8 Zornitza Stark Marked gene: GAS8 as ready
Prepair 1000+ v1.1613 GAS8 Zornitza Stark Gene: gas8 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1613 GAS8 Zornitza Stark Phenotypes for gene: GAS8 were changed from Ciliary dyskinesia, primary, 33, 616726 (3), Autosomal recessive to Ciliary dyskinesia, primary, 33 MIM#616726
Prepair 1000+ v1.1612 GAS8 Zornitza Stark Publications for gene: GAS8 were set to
Regression v0.574 KLC4 Zornitza Stark gene: KLC4 was added
gene: KLC4 was added to Regression. Sources: Literature
Mode of inheritance for gene: KLC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KLC4 were set to 26423925
Phenotypes for gene: KLC4 were set to Neurodegeneration, early-childhood-onset, with retinitis pigmentosa, sensorineural hearing loss, and demyelinating peripheral neuropathy, MIM# 621129
Review for gene: KLC4 was set to RED
Added comment: Single family reported with three affected sibs, homozygous variant.
Sources: Literature
Mendeliome v1.2386 KLC4 Zornitza Stark edited their review of gene: KLC4: Changed phenotypes: Neurodegeneration, early-childhood-onset, with retinitis pigmentosa, sensorineural hearing loss, and demyelinating peripheral neuropathy, MIM# 621129
Syndromic Retinopathy v0.221 EXOSC2 Zornitza Stark Publications for gene: EXOSC2 were set to 26843489; 31628467
Syndromic Retinopathy v0.220 EXOSC2 Zornitza Stark Classified gene: EXOSC2 as Amber List (moderate evidence)
Syndromic Retinopathy v0.220 EXOSC2 Zornitza Stark Gene: exosc2 has been classified as Amber List (Moderate Evidence).
Syndromic Retinopathy v0.219 EXOSC2 Zornitza Stark edited their review of gene: EXOSC2: Added comment: LIMITED by ClinGen. Two additional patients reported but again, predominantly missense variants.; Changed publications: 26843489, 31628467, 36344539, 36069504
Intellectual disability syndromic and non-syndromic v1.86 EXOSC2 Zornitza Stark Publications for gene: EXOSC2 were set to 26843489; 31628467
Intellectual disability syndromic and non-syndromic v1.85 EXOSC2 Zornitza Stark edited their review of gene: EXOSC2: Added comment: LIMITED by ClinGen. Two additional patients reported but again, predominantly missense variants.; Changed rating: AMBER; Changed publications: 26843489, 31628467, 36344539, 36069504
Mendeliome v1.2386 EXOSC2 Zornitza Stark changed review comment from: LIMITED by ClinGen; to: LIMITED by ClinGen. Two additional patients reported but again, predominantly missense variants.
Mendeliome v1.2386 EXOSC2 Zornitza Stark edited their review of gene: EXOSC2: Changed publications: 26843489, 31628467, 36344539, 36069504
Mendeliome v1.2386 EXOSC2 Zornitza Stark commented on gene: EXOSC2: LIMITED by ClinGen
Renal Macrocystic Disease v0.82 COL4A5 Zornitza Stark Classified gene: COL4A5 as Amber List (moderate evidence)
Renal Macrocystic Disease v0.82 COL4A5 Zornitza Stark Gene: col4a5 has been classified as Amber List (Moderate Evidence).
Renal Macrocystic Disease v0.81 COL4A5 Zornitza Stark reviewed gene: COL4A5: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Renal Macrocystic Disease v0.81 COL4A4 Zornitza Stark Classified gene: COL4A4 as Amber List (moderate evidence)
Renal Macrocystic Disease v0.81 COL4A4 Zornitza Stark Gene: col4a4 has been classified as Amber List (Moderate Evidence).
Renal Macrocystic Disease v0.80 COL4A4 Zornitza Stark reviewed gene: COL4A4: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Renal Macrocystic Disease v0.80 COL4A3 Zornitza Stark Classified gene: COL4A3 as Amber List (moderate evidence)
Renal Macrocystic Disease v0.80 COL4A3 Zornitza Stark Gene: col4a3 has been classified as Amber List (Moderate Evidence).
Renal Macrocystic Disease v0.79 COL4A3 Zornitza Stark reviewed gene: COL4A3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Alport syndrome MONDO:0018965; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2386 LSM1 Zornitza Stark Phenotypes for gene: LSM1 were changed from intellectual disability; congenital abnormalities to neurodevelopmental disorder MONDO:0700092, LSM1-related
Mendeliome v1.2385 LSM1 Sangavi Sivagnanasundram reviewed gene: LSM1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO:0700092; Mode of inheritance: None
Prepair 1000+ v1.1611 TTC21B Kate Scarff changed review comment from: Short-rib thoracic dysplasia (SRTD) with or without polydactyly is a skeletal ciliopathy characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a 'trident' appearance of the acetabular roof. SRTD encompasses Ellis-van Creveld syndrome (EVC) and the disorders previously designated as Jeune syndrome or asphyxiating thoracic dystrophy (ATD), short rib-polydactyly syndrome (SRPS), and Mainzer-Saldino syndrome (MZSDS). Polydactyly is variably present. Nonskeletal involvement can include cleft lip/palate as well as anomalies of the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of SRTD are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life.
Homozygous null alleles in Ttc21b are embryonic lethal in mice and it is likely that biallelic truncating null variants are equally incompatible with survival in humans.

Nephronophthisis 12: End stage kidney disease seen in multiple unrelated children <10 years. Patients harboring one truncating or splice site mutation in addition to a missense variant exhibit JATD or early onset NPHP with extra-renal features, whereas patients carrying homozygous p.Pro209Leu variants display a primarily kidney phenotype with NPHP and often with glomerular involvement (FSGS). However, liver and skeletal involvement as well as high myopia have also been described in patients with biallelic missense variants, including homozygous p.Pro209Leu carriers.; to: Short-rib thoracic dysplasia (SRTD) with or without polydactyly is a skeletal ciliopathy characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a 'trident' appearance of the acetabular roof. SRTD encompasses Ellis-van Creveld syndrome (EVC) and the disorders previously designated as Jeune syndrome or asphyxiating thoracic dystrophy (ATD), short rib-polydactyly syndrome (SRPS), and Mainzer-Saldino syndrome (MZSDS). Polydactyly is variably present. Nonskeletal involvement can include cleft lip/palate as well as anomalies of the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of SRTD are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life.
Homozygous null alleles in Ttc21b are embryonic lethal in mice and it is likely that biallelic truncating null variants are equally incompatible with survival in humans.

Nephronophthisis 12: End stage kidney disease seen in multiple unrelated children <10 years. Patients harboring one truncating or splice site mutation in addition to a missense variant exhibit SRTD or early onset NPHP with extra-renal features, whereas patients carrying homozygous p.Pro209Leu variants display a primarily kidney phenotype with NPHP and often with glomerular involvement (FSGS). However, liver and skeletal involvement as well as high myopia have also been described in patients with biallelic missense variants, including homozygous p.Pro209Leu carriers.
Prepair 1000+ v1.1611 TTC21B Kate Scarff edited their review of gene: TTC21B: Changed phenotypes: Short-rib thoracic dysplasia 4 with or without polydactyly, MIM #613819, Nephronophthisis 12, MIM #613820
Prepair 1000+ v1.1611 TTC21B Kate Scarff changed review comment from: Short-rib thoracic dysplasia (SRTD) with or without polydactyly is a skeletal ciliopathy characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a 'trident' appearance of the acetabular roof. SRTD encompasses Ellis-van Creveld syndrome (EVC) and the disorders previously designated as Jeune syndrome or asphyxiating thoracic dystrophy (ATD), short rib-polydactyly syndrome (SRPS), and Mainzer-Saldino syndrome (MZSDS). Polydactyly is variably present. Nonskeletal involvement can include cleft lip/palate as well as anomalies of the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of SRTD are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life.
Homozygous null alleles in Ttc21b are embryonic lethal in mice and it is likely that biallelic truncating null variants are equally incompatible with survival in humans.; to: Short-rib thoracic dysplasia (SRTD) with or without polydactyly is a skeletal ciliopathy characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a 'trident' appearance of the acetabular roof. SRTD encompasses Ellis-van Creveld syndrome (EVC) and the disorders previously designated as Jeune syndrome or asphyxiating thoracic dystrophy (ATD), short rib-polydactyly syndrome (SRPS), and Mainzer-Saldino syndrome (MZSDS). Polydactyly is variably present. Nonskeletal involvement can include cleft lip/palate as well as anomalies of the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of SRTD are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life.
Homozygous null alleles in Ttc21b are embryonic lethal in mice and it is likely that biallelic truncating null variants are equally incompatible with survival in humans.

Nephronophthisis 12: End stage kidney disease seen in multiple unrelated children <10 years. Patients harboring one truncating or splice site mutation in addition to a missense variant exhibit JATD or early onset NPHP with extra-renal features, whereas patients carrying homozygous p.Pro209Leu variants display a primarily kidney phenotype with NPHP and often with glomerular involvement (FSGS). However, liver and skeletal involvement as well as high myopia have also been described in patients with biallelic missense variants, including homozygous p.Pro209Leu carriers.
Prepair 1000+ v1.1611 TRIP11 Kate Scarff edited their review of gene: TRIP11: Changed phenotypes: Achondrogenesis, type IA, MIM #200600, Odontochondrodysplasia 1, MIM #184260
Mendeliome v1.2385 RP9 Sangavi Sivagnanasundram reviewed gene: RP9: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008710; Phenotypes: retinitis pigmentosa 9 MONDO:0008378; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Prepair 1000+ v1.1611 DBR1 Lilian Downie Marked gene: DBR1 as ready
Prepair 1000+ v1.1611 DBR1 Lilian Downie Added comment: Comment when marking as ready: Green for the immune condition in OMIM Xerosis and growth failure with immune and pulmonary dysfunction syndrome MIM#620510 although evidence is from a single paper but includes 4 unrelated families, 2 papers regarding encephalopathy, again enough evidence for inclusion >3 unrelated families.

UPGRADE TO GREEN
Prepair 1000+ v1.1611 DBR1 Lilian Downie Gene: dbr1 has been removed from the panel.
Prepair 1000+ v1.1611 AMN Lilian Downie Marked gene: AMN as ready
Prepair 1000+ v1.1611 AMN Lilian Downie Added comment: Comment when marking as ready: Treatable disorder with good outcomes
Prepair 1000+ v1.1611 AMN Lilian Downie Gene: amn has been removed from the panel.
Prepair 1000+ v1.1611 AMN Lilian Downie Publications for gene: AMN were set to
Prepair 1000+ v1.1610 ERCC5 Lilian Downie Marked gene: ERCC5 as ready
Prepair 1000+ v1.1610 ERCC5 Lilian Downie Gene: ercc5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1610 ERCC5 Lilian Downie Phenotypes for gene: ERCC5 were changed from Xeroderma pigmentosum, group G, 278780 (3) to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216
Prepair 1000+ v1.1609 ERCC5 Lilian Downie Publications for gene: ERCC5 were set to
Prepair 1000+ v1.1608 FAH Lilian Downie Marked gene: FAH as ready
Prepair 1000+ v1.1608 FAH Lilian Downie Gene: fah has been classified as Green List (High Evidence).
Prepair 1000+ v1.1608 FAH Lilian Downie Publications for gene: FAH were set to
Prepair 1000+ v1.1607 FAM126A Lilian Downie Marked gene: FAM126A as ready
Prepair 1000+ v1.1607 FAM126A Lilian Downie Gene: fam126a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1607 FAM126A Lilian Downie Publications for gene: FAM126A were set to
Prepair 1000+ v1.1606 FANCA Lilian Downie Marked gene: FANCA as ready
Prepair 1000+ v1.1606 FANCA Lilian Downie Gene: fanca has been classified as Green List (High Evidence).
Prepair 1000+ v1.1606 FBP1 Lilian Downie Marked gene: FBP1 as ready
Prepair 1000+ v1.1606 FBP1 Lilian Downie Gene: fbp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1606 FBP1 Lilian Downie Publications for gene: FBP1 were set to
Prepair 1000+ v1.1605 FERMT3 Lilian Downie Marked gene: FERMT3 as ready
Prepair 1000+ v1.1605 FERMT3 Lilian Downie Gene: fermt3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1605 FERMT3 Lilian Downie Publications for gene: FERMT3 were set to
Prepair 1000+ v1.1604 WRAP53 Lilian Downie Marked gene: WRAP53 as ready
Prepair 1000+ v1.1604 WRAP53 Lilian Downie Gene: wrap53 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1604 WRAP53 Lilian Downie Publications for gene: WRAP53 were set to
Prepair 1000+ v1.1603 XPC Lilian Downie Marked gene: XPC as ready
Prepair 1000+ v1.1603 XPC Lilian Downie Gene: xpc has been classified as Green List (High Evidence).
Prepair 1000+ v1.1603 XPC Lilian Downie Publications for gene: XPC were set to
Prepair 1000+ v1.1602 ZNF469 Lilian Downie Marked gene: ZNF469 as ready
Prepair 1000+ v1.1602 ZNF469 Lilian Downie Added comment: Comment when marking as ready: Upgrade to green
Prepair 1000+ v1.1602 ZNF469 Lilian Downie Gene: znf469 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.1602 ZNF469 Lilian Downie Publications for gene: ZNF469 were set to
Prepair 1000+ v1.1601 DHCR24 Lilian Downie Marked gene: DHCR24 as ready