Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Severe Combined Immunodeficiency v0.46 PTPRC Zornitza Stark Gene: ptprc has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency v0.46 PTPRC Zornitza Stark Phenotypes for gene: PTPRC were changed from to Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971; Hepatitis C virus, susceptibility to MIM# 609532
Severe Combined Immunodeficiency v0.45 PTPRC Zornitza Stark Publications for gene: PTPRC were set to
Severe Combined Immunodeficiency v0.44 PTPRC Zornitza Stark Mode of inheritance for gene: PTPRC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.43 JAK3 Zornitza Stark Marked gene: JAK3 as ready
Severe Combined Immunodeficiency v0.43 JAK3 Zornitza Stark Gene: jak3 has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency v0.43 JAK3 Zornitza Stark Phenotypes for gene: JAK3 were changed from to SCID, autosomal recessive, T-negative/B-positive type MIM# 600802
Severe Combined Immunodeficiency v0.42 JAK3 Zornitza Stark Publications for gene: JAK3 were set to
Severe Combined Immunodeficiency v0.41 JAK3 Zornitza Stark Mode of inheritance for gene: JAK3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.40 IL7R Zornitza Stark Marked gene: IL7R as ready
Severe Combined Immunodeficiency v0.40 IL7R Zornitza Stark Gene: il7r has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency v0.40 IL7R Zornitza Stark Phenotypes for gene: IL7R were changed from to Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type MIM# 608971; low T-cell numbers; normal-high B and NK-cell numbers; fever; rash; failure to thrive; recurrent respiratory and gastric infections; Hepatomegaly; Splenomegaly; diarrhoea; lymphadenopathy; pneumonitis; Pancytopaenia; decreased immunoglobulins
Severe Combined Immunodeficiency v0.39 IL7R Zornitza Stark Publications for gene: IL7R were set to
Severe Combined Immunodeficiency v0.38 IL7R Zornitza Stark Mode of inheritance for gene: IL7R was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9282 CORO1A Zornitza Stark Marked gene: CORO1A as ready
Mendeliome v0.9282 CORO1A Zornitza Stark Gene: coro1a has been classified as Green List (High Evidence).
Mendeliome v0.9282 CORO1A Zornitza Stark Phenotypes for gene: CORO1A were changed from to Immunodeficiency 8, MIM# 615401
Mendeliome v0.9281 CORO1A Zornitza Stark Publications for gene: CORO1A were set to
Mendeliome v0.9280 CORO1A Zornitza Stark Mode of inheritance for gene: CORO1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.37 CORO1A Zornitza Stark Marked gene: CORO1A as ready
Severe Combined Immunodeficiency v0.37 CORO1A Zornitza Stark Gene: coro1a has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency v0.37 CORO1A Zornitza Stark Phenotypes for gene: CORO1A were changed from to Immunodeficiency 8, MIM# 615401
Severe Combined Immunodeficiency v0.36 CORO1A Zornitza Stark Publications for gene: CORO1A were set to
Severe Combined Immunodeficiency v0.35 CORO1A Zornitza Stark Mode of inheritance for gene: CORO1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9279 POU6F2 Zornitza Stark Marked gene: POU6F2 as ready
Mendeliome v0.9279 POU6F2 Zornitza Stark Added comment: Comment when marking as ready: No evidence for association with Mendelian disease.
Mendeliome v0.9279 POU6F2 Zornitza Stark Gene: pou6f2 has been classified as Red List (Low Evidence).
Mendeliome v0.9279 POU6F2 Zornitza Stark Classified gene: POU6F2 as Red List (low evidence)
Mendeliome v0.9279 POU6F2 Zornitza Stark Gene: pou6f2 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1245 TMTC3 Danielle Ariti gene: TMTC3 was added
gene: TMTC3 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for gene: TMTC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMTC3 were set to 27773428; 28973161; 32973946
Phenotypes for gene: TMTC3 were set to Lissencephaly 8 MIM#617255
Review for gene: TMTC3 was set to GREEN
Added comment: 14 individuals from 8 unrelated families reported with bi-allelic LoF (frameshift, deletion, insertion) and missense variants.

Lissencephaly-8 is a neurologic disorder characterised by delayed psychomotor development, ID with poor/absent speech, early-onset refractory seizures, hypotonia and appendicular spasticity.

Seizures are considered a prominent phenotype: 6/9 patients developed refractory generalised or myoclonic seizures in infancy (PMID: 27773428) and in a reported family all four affected siblings presented with nocturnal seizures and ID (PMID: 28973161).
Sources: Expert list
Genetic Epilepsy v0.1245 WDR26 Danielle Ariti gene: WDR26 was added
gene: WDR26 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for gene: WDR26 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR26 were set to 28686853; 33675273
Phenotypes for gene: WDR26 were set to Skraban-Deardorff syndrome MIM# 617616
Review for gene: WDR26 was set to GREEN
Added comment: 20 individuals have been reported (only 17 with a clinical description available).

All mono-allelic variants reported were de novo; most variants were LoF (frameshift, nonsense, splice site, deletion) but some were missense.

Skraban-Deardorff syndrome is a neurodevelopmental disorder characterised by a broad range of clinical signs, including ID/DD, febrile and/or non-febrile seizures, abnormal facial features, feeding difficulties, and minor skeletal anomalies (Spastic gait).

PMID: 28686853- Reported 15 individuals with pathogenic de novo WDR26 variants. 15/15 patients presented with both ID and seizures.
Sources: Expert list
Genetic Epilepsy v0.1245 ZMYND11 Danielle Ariti gene: ZMYND11 was added
gene: ZMYND11 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for gene: ZMYND11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZMYND11 were set to 32097528; 34216016
Phenotypes for gene: ZMYND11 were set to Mental retardation, autosomal dominant 30 MIM# 616083
Review for gene: ZMYND11 was set to GREEN
Added comment: ZMYND11 variants are associated with a neurodevelopmental disorder, MRD30 that is characterised by developmental delay, particularly affecting speech, mild‐moderate intellectual disability, significant behavioural abnormalities, seizures, and hypotonia.
* Most identified variants are likely to result in premature truncation and/or nonsense‐mediated decay.

PMID: 34216016- Study of individuals with pathogenic ZMYND11 variants, 20/47 individuals presented with epilepsy (idiopathic focal epilepsy, Rolandic epilepsy, generalised epilepsies, Atypical Benign Partial Epilepsy etc).

PMID: 32097528- Study of 16 patients with ZMYND11-related syndromic intellectual disability, 31% presented with epilepsy.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4154 CDH15 Zornitza Stark reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.9278 CDH15 Zornitza Stark Marked gene: CDH15 as ready
Mendeliome v0.9278 CDH15 Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence).
Mendeliome v0.9278 CDH15 Zornitza Stark Phenotypes for gene: CDH15 were changed from to Mental retardation, autosomal dominant 3, MIM#612580
Mendeliome v0.9277 CDH15 Zornitza Stark Publications for gene: CDH15 were set to
Mendeliome v0.9276 CDH15 Zornitza Stark Mode of inheritance for gene: CDH15 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9275 CDH15 Zornitza Stark Classified gene: CDH15 as Red List (low evidence)
Mendeliome v0.9275 CDH15 Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence).
Mendeliome v0.9274 CDH15 Zornitza Stark Tag disputed tag was added to gene: CDH15.
Mendeliome v0.9274 CDH15 Zornitza Stark commented on gene: CDH15: PMID: 19012874 - 4 unrelated patients with missense variants and mild-severe ID. Only two genes checked. All variants are common in gnomAD (>20 hets each) and classified as VUS or likely benign in ClinVar (paper is from 2008, pre-dates gnomAD). Functional studies were performed showing a LOF effect, where cell adhesion was reduced.
However NMD PTCs are present in gnomAD (many >=6 hets each)

PMID: 12052883 - null mouse model were viable, showed no gross developmental defects. In particular, the skeletal musculature appeared essentially normal. In the cerebellum of M-cadherin-lacking mutants, typical contactus adherens junctions were present and similar in size and numbers to the equivalent junctions in wild-type animals. However, the adhesion plaques in the cerebellum of these mutants appeared to contain elevated levels of N-cadherin compared to wild-type animals.

PMID: 28422132 - reviewed microdeletions spanning multiple genes including CDH15, suggests it may contribute to a more severe neurological phenotype, with particular regard to brain malformations.

PMID: 26506440 - speculates low penetrance for PTCs in this gene. Acknowledges variants in ExAC, describes them as benign

Note no P/LP variants in ClinVar
Mendeliome v0.9274 CDH15 Zornitza Stark reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: None; Publications: 19012874, 12052883, 28422132, 26506440; Phenotypes: Mental retardation, autosomal dominant 3, MIM#612580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4154 CDH15 Zornitza Stark Marked gene: CDH15 as ready
Intellectual disability syndromic and non-syndromic v0.4154 CDH15 Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4154 CDH15 Zornitza Stark Phenotypes for gene: CDH15 were changed from to Mental retardation, autosomal dominant 3 MIM#612580
Intellectual disability syndromic and non-syndromic v0.4153 CDH15 Zornitza Stark Publications for gene: CDH15 were set to
Severe Combined Immunodeficiency v0.34 PTPRC Danielle Ariti reviewed gene: PTPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: 11145714, 12073144, 22689986, 10700239; Phenotypes: Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971, Hepatitis C virus, susceptibility to MIM# 609532; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9274 JAK3 Danielle Ariti reviewed gene: JAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 14615376, 11668610; Phenotypes: SCID, autosomal recessive, T-negative/B-positive type MIM# 600802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.34 JAK3 Danielle Ariti reviewed gene: JAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 14615376, 11668610; Phenotypes: SCID, autosomal recessive, T-negative/B-positive type MIM# 600802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9274 CORO1A Danielle Ariti reviewed gene: CORO1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25073507, 2352248, 18836449; Phenotypes: Immunodeficiency 8 MIM# 615401; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.34 CORO1A Danielle Ariti reviewed gene: CORO1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25073507, 2352248, 18836449; Phenotypes: Immunodeficiency 8 MIM# 615401; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9274 POU6F2 Chloe Stutterd reviewed gene: POU6F2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Vascular Malformations SuperPanel v1.1 Bryony Thompson Panel status changed from internal to public
Intellectual disability syndromic and non-syndromic v0.4152 CDH15 Zornitza Stark Mode of inheritance for gene: CDH15 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4151 CDH15 Zornitza Stark Tag disputed tag was added to gene: CDH15.
Intellectual disability syndromic and non-syndromic v0.4151 CDH15 Zornitza Stark Classified gene: CDH15 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.4151 CDH15 Zornitza Stark Gene: cdh15 has been classified as Red List (Low Evidence).
Skeletal dysplasia v0.125 FGF8 Zornitza Stark Marked gene: FGF8 as ready
Skeletal dysplasia v0.125 FGF8 Zornitza Stark Gene: fgf8 has been classified as Amber List (Moderate Evidence).
Skeletal dysplasia v0.125 FGF8 Zornitza Stark Publications for gene: FGF8 were set to 24569166
Skeletal dysplasia v0.124 FGF8 Zornitza Stark Classified gene: FGF8 as Amber List (moderate evidence)
Skeletal dysplasia v0.124 FGF8 Zornitza Stark Gene: fgf8 has been classified as Amber List (Moderate Evidence).
Skeletal dysplasia v0.123 FGF8 Zornitza Stark Tag SV/CNV tag was added to gene: FGF8.
Skeletal dysplasia v0.123 FGF8 Zornitza Stark reviewed gene: FGF8: Rating: AMBER; Mode of pathogenicity: None; Publications: 34433009; Phenotypes: Hypoplastic femurs and pelvis, MIM#619545; Mode of inheritance: None
Mendeliome v0.9274 FGF8 Zornitza Stark Phenotypes for gene: FGF8 were changed from Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Femoral hypoplasia to Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Hypoplastic femurs and pelvis, MIM#619545
Mendeliome v0.9273 FGF8 Zornitza Stark edited their review of gene: FGF8: Changed phenotypes: Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702, Hypoplastic femurs and pelvis, MIM#619545
Intellectual disability syndromic and non-syndromic v0.4150 CDH15 Elena Savva reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: Other; Publications: PMID: 19012874, 12052883, 28422132, 26506440; Phenotypes: Mental retardation, autosomal dominant 3 MIM#612580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Vascular Malformations SuperPanel v1.0 Bryony Thompson Added Panel Vasculopathy SuperPanel
Set child panels to: Vascular Malformations_Somatic; Vascular Malformations_Germline; Lymphoedema_nonsyndromic; Lymphoedema_syndromic
Set panel types to: Royal Melbourne Hospital
Mendeliome v0.9273 ARL6IP6 Zornitza Stark Marked gene: ARL6IP6 as ready
Mendeliome v0.9273 ARL6IP6 Zornitza Stark Gene: arl6ip6 has been classified as Red List (Low Evidence).
Mendeliome v0.9273 ARL6IP6 Zornitza Stark gene: ARL6IP6 was added
gene: ARL6IP6 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ARL6IP6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARL6IP6 were set to 31142202
Phenotypes for gene: ARL6IP6 were set to Cutis marmorata telangiectatica congenita
Review for gene: ARL6IP6 was set to RED
Added comment: A single case reported from a consanguineous family with a homozygous nonsense variant (p.Trp64Ter).
Sources: Literature
Repeat Disorders v0.148 FRA7A Bryony Thompson edited their review of STR: FRA7A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 5-53 repeats, with a median of 13.; Changed publications: 25196122, 33510257
Repeat Disorders v0.148 FRA2A Bryony Thompson edited their review of STR: FRA2A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 1-64 repeats, with a median of 16.; Changed publications: 24763282, 33510257
Repeat Disorders v0.148 FRA12A Bryony Thompson edited their review of STR: FRA12A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 8-120 repeats, with a median of 8.; Changed publications: 17236128, 33510257
Vascular Malformations_Germline v1.4 ARL6IP6 Bryony Thompson Marked gene: ARL6IP6 as ready
Vascular Malformations_Germline v1.4 ARL6IP6 Bryony Thompson Gene: arl6ip6 has been classified as Red List (Low Evidence).
Vascular Malformations_Germline v1.4 ARL6IP6 Bryony Thompson gene: ARL6IP6 was added
gene: ARL6IP6 was added to Vascular Malformations_Germline. Sources: Other
Mode of inheritance for gene: ARL6IP6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARL6IP6 were set to 31142202
Phenotypes for gene: ARL6IP6 were set to Cutis marmorata telangiectatica congenita
Review for gene: ARL6IP6 was set to RED
Added comment: A single case reported from a consanguineous family with a homozygous nonsense variant (p.Trp64Ter).
Sources: Other
Differences of Sex Development v0.215 CPE Zornitza Stark Marked gene: CPE as ready
Differences of Sex Development v0.215 CPE Zornitza Stark Gene: cpe has been classified as Green List (High Evidence).
Differences of Sex Development v0.215 CPE Zornitza Stark Classified gene: CPE as Green List (high evidence)
Differences of Sex Development v0.215 CPE Zornitza Stark Gene: cpe has been classified as Green List (High Evidence).
Differences of Sex Development v0.214 CPE Zornitza Stark gene: CPE was added
gene: CPE was added to Differences of Sex Development. Sources: Literature
Mode of inheritance for gene: CPE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CPE were set to 26120850; 32936766; 34383079
Phenotypes for gene: CPE were set to Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326
Review for gene: CPE was set to GREEN
Added comment: 8 individuals from 5 unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4150 CPE Zornitza Stark Publications for gene: CPE were set to 26120850; 32936766
Intellectual disability syndromic and non-syndromic v0.4149 CPE Zornitza Stark Classified gene: CPE as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4149 CPE Zornitza Stark Gene: cpe has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4148 CPE Zornitza Stark edited their review of gene: CPE: Added comment: Bosch et al. 2021 (PMID: 34383079) reported on 4 individuals from 3 additional families harbouring 2 different homozygous truncating variants in this gene. Clinical presentation was prominent for obesity and intellectual disability. Hypogonadotropic hypogonadism was confirmed in one individual and was suspected but not tested for in another two subjects.; Changed rating: GREEN; Changed publications: 26120850, 32936766, 34383079; Changed phenotypes: Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326
Mendeliome v0.9272 CPE Zornitza Stark Publications for gene: CPE were set to 26120850; 32936766
Mendeliome v0.9271 CPE Zornitza Stark Classified gene: CPE as Green List (high evidence)
Mendeliome v0.9271 CPE Zornitza Stark Gene: cpe has been classified as Green List (High Evidence).
Mendeliome v0.9270 CPE Arina Puzriakova reviewed gene: CPE: Rating: GREEN; Mode of pathogenicity: None; Publications: 34383079; Phenotypes: Intellectual developmental disorder and hypogonadotropic hypogonadism, OMIM:619326; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.324 HCFC1 Zornitza Stark Marked gene: HCFC1 as ready
Callosome v0.324 HCFC1 Zornitza Stark Gene: hcfc1 has been classified as Red List (Low Evidence).
Callosome v0.324 HCFC1 Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541
Callosome v0.323 HCFC1 Zornitza Stark Publications for gene: HCFC1 were set to
Callosome v0.322 HCFC1 Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Callosome v0.321 HCFC1 Zornitza Stark Classified gene: HCFC1 as Red List (low evidence)
Callosome v0.321 HCFC1 Zornitza Stark Gene: hcfc1 has been classified as Red List (Low Evidence).
Callosome v0.320 HCFC1 Zornitza Stark reviewed gene: HCFC1: Rating: RED; Mode of pathogenicity: None; Publications: 34164576, 24011988, 31207118; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4148 HCFC1 Zornitza Stark Marked gene: HCFC1 as ready
Intellectual disability syndromic and non-syndromic v0.4148 HCFC1 Zornitza Stark Gene: hcfc1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4148 HCFC1 Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541
Intellectual disability syndromic and non-syndromic v0.4147 HCFC1 Zornitza Stark Publications for gene: HCFC1 were set to
Intellectual disability syndromic and non-syndromic v0.4146 HCFC1 Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4145 HCFC1 Zornitza Stark reviewed gene: HCFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34164576, 24011988; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Genetic Epilepsy v0.1245 HCFC1 Zornitza Stark Marked gene: HCFC1 as ready
Genetic Epilepsy v0.1245 HCFC1 Zornitza Stark Gene: hcfc1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1245 HCFC1 Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541
Genetic Epilepsy v0.1244 HCFC1 Zornitza Stark Publications for gene: HCFC1 were set to
Genetic Epilepsy v0.1243 HCFC1 Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Genetic Epilepsy v0.1243 HCFC1 Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Genetic Epilepsy v0.1242 EIF2S3 Zornitza Stark Marked gene: EIF2S3 as ready
Genetic Epilepsy v0.1242 EIF2S3 Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1242 EIF2S3 Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome MIM# 300148
Genetic Epilepsy v0.1241 EIF2S3 Zornitza Stark Publications for gene: EIF2S3 were set to
Genetic Epilepsy v0.1240 EIF2S3 Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Genetic Epilepsy v0.1239 HCFC1 Danielle Ariti changed review comment from: Well-established gene-disease association with >20 individuals reported

Variants in the HCFC1 gene are associated with cases of syndromic and non-syndromic intellectual disability. Individuals present with severely delayed psychomotor development apparent in infancy, and severe neurological defects including intractable epilepsy, facial dysmorphia, and intellectual disability.; to: Well-established gene-disease association with >20 individuals reported

Variants in the HCFC1 gene are associated with cases of syndromic and non-syndromic intellectual disability. Individuals present with severely delayed psychomotor development apparent in infancy, and severe neurological defects including intractable epilepsy, facial dysmorphia, and intellectual disability.
Seizures being a prominent feature in this phenotype.
Genetic Epilepsy v0.1239 HCFC1 Danielle Ariti reviewed gene: HCFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34164576, 24011988; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type) MIM# 309541; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Genetic Epilepsy v0.1239 EIF2S3 Danielle Ariti changed review comment from: 7 families reported males with hemizygous EIF2S3 variants; one mouse model.

EIF2S3 variants cause intellectual disability syndrome, MEHMO which is derived from the clinical hallmarks: mental retardation, epileptic seizures, hypogonadism and hypogenitalism, microcephaly, and obesity.
Seizures are prominent within this phenotype (more than 60% of patients).; to: 7 families reported males with hemizygous EIF2S3 variants; one mouse model.

EIF2S3 variants cause intellectual disability syndrome, MEHMO which is derived from the clinical hallmarks: mental retardation, epileptic seizures, hypogonadism and hypogenitalism, microcephaly, and obesity.
Seizures are prominent within this phenotype.
Genetic Epilepsy v0.1239 EIF2S3 Danielle Ariti reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 33714664, 32799315, 28055140; Phenotypes: MEHMO syndrome MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Regression v0.377 CSTB Zornitza Stark Marked gene: CSTB as ready
Regression v0.377 CSTB Zornitza Stark Gene: cstb has been classified as Green List (High Evidence).
Regression v0.377 CSTB Zornitza Stark Classified gene: CSTB as Green List (high evidence)
Regression v0.377 CSTB Zornitza Stark Gene: cstb has been classified as Green List (High Evidence).
Regression v0.376 CSTB Zornitza Stark Tag 5'UTR tag was added to gene: CSTB.
Tag STR tag was added to gene: CSTB.
Regression v0.376 CSTB Zornitza Stark gene: CSTB was added
gene: CSTB was added to Regression. Sources: Expert Review
Mode of inheritance for gene: CSTB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSTB were set to 9012407; 9054946
Phenotypes for gene: CSTB were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800
Review for gene: CSTB was set to GREEN
Added comment: Myoclonic epilepsy of Unverricht and Lundborg is an autosomal recessive disorder characterized by onset of neurodegeneration between 6 and 13 years of age. It is typically progressive in adolescence, with dramatic worsening of myoclonus and ataxia in the first 6 years after onset. The disease stabilises in early adulthood, and myoclonus and ataxia may even improve, and there is minimal to no cognitive decline.

Note the most common causative allele is a dodecamer repeat in the promoter region. Missense variants have been reported, most commonly compound het with the repeat, except for p.Gly4Arg which has been reported in the homozygous state also.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4145 CSTB Zornitza Stark Marked gene: CSTB as ready
Intellectual disability syndromic and non-syndromic v0.4145 CSTB Zornitza Stark Gene: cstb has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4145 CSTB Zornitza Stark Phenotypes for gene: CSTB were changed from to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800
Intellectual disability syndromic and non-syndromic v0.4144 CSTB Zornitza Stark Publications for gene: CSTB were set to
Intellectual disability syndromic and non-syndromic v0.4143 CSTB Zornitza Stark Mode of inheritance for gene: CSTB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4142 CSTB Zornitza Stark Classified gene: CSTB as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.4142 CSTB Zornitza Stark Gene: cstb has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4141 CSTB Zornitza Stark reviewed gene: CSTB: Rating: RED; Mode of pathogenicity: None; Publications: 9012407, 9054946; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9270 CSTB Zornitza Stark Marked gene: CSTB as ready
Mendeliome v0.9270 CSTB Zornitza Stark Gene: cstb has been classified as Green List (High Evidence).
Mendeliome v0.9270 CSTB Zornitza Stark Phenotypes for gene: CSTB were changed from to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800; Keratolytic winter erythema (MIM#148370)
Mendeliome v0.9269 CSTB Zornitza Stark Publications for gene: CSTB were set to
Mendeliome v0.9268 CSTB Zornitza Stark Mode of inheritance for gene: CSTB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9267 CSTB Zornitza Stark reviewed gene: CSTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 32920378, 18028412, 9012407, 9054946; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1239 CSTB Zornitza Stark Marked gene: CSTB as ready
Genetic Epilepsy v0.1239 CSTB Zornitza Stark Added comment: Comment when marking as ready: Note the most common causative allele is a dodecamer repeat in the promoter region. Missense variants have been reported, most commonly compound het with the repeat, except for p.Gly4Arg which has been reported in the homozygous state also.
Genetic Epilepsy v0.1239 CSTB Zornitza Stark Gene: cstb has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1239 CSTB Zornitza Stark Tag 5'UTR tag was added to gene: CSTB.
Tag STR tag was added to gene: CSTB.
Genetic Epilepsy v0.1239 CSTB Zornitza Stark Phenotypes for gene: CSTB were changed from Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800 to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800
Genetic Epilepsy v0.1238 CSTB Zornitza Stark Phenotypes for gene: CSTB were changed from to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800
Genetic Epilepsy v0.1237 CSTB Zornitza Stark Publications for gene: CSTB were set to
Genetic Epilepsy v0.1236 CSTB Zornitza Stark Mode of inheritance for gene: CSTB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9267 CD3E Zornitza Stark Marked gene: CD3E as ready
Mendeliome v0.9267 CD3E Zornitza Stark Gene: cd3e has been classified as Green List (High Evidence).
Mendeliome v0.9267 CD3E Zornitza Stark Phenotypes for gene: CD3E were changed from to Immunodeficiency 18 MIM# 615615
Mendeliome v0.9266 CD3E Zornitza Stark Publications for gene: CD3E were set to
Mendeliome v0.9265 CD3E Zornitza Stark Mode of inheritance for gene: CD3E was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.34 CD3E Zornitza Stark Marked gene: CD3E as ready
Severe Combined Immunodeficiency v0.34 CD3E Zornitza Stark Gene: cd3e has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency v0.34 CD3E Zornitza Stark Phenotypes for gene: CD3E were changed from to Immunodeficiency 18 MIM# 615615
Severe Combined Immunodeficiency v0.33 CD3E Zornitza Stark Publications for gene: CD3E were set to
Severe Combined Immunodeficiency v0.32 CD3E Zornitza Stark Mode of inheritance for gene: CD3E was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9264 CD3D Zornitza Stark Marked gene: CD3D as ready
Mendeliome v0.9264 CD3D Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence).
Mendeliome v0.9264 CD3D Zornitza Stark Phenotypes for gene: CD3D were changed from to Immunodeficiency 19 MIM# 615617
Mendeliome v0.9263 CD3D Zornitza Stark Publications for gene: CD3D were set to
Mendeliome v0.9262 CD3D Zornitza Stark Mode of inheritance for gene: CD3D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.31 CD3D Zornitza Stark Marked gene: CD3D as ready
Severe Combined Immunodeficiency v0.31 CD3D Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence).
Severe Combined Immunodeficiency v0.31 CD3D Zornitza Stark Phenotypes for gene: CD3D were changed from to Immunodeficiency 19 MIM# 615617
Severe Combined Immunodeficiency v0.30 CD3D Zornitza Stark Publications for gene: CD3D were set to
Severe Combined Immunodeficiency v0.29 CD3D Zornitza Stark Mode of inheritance for gene: CD3D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9261 ARHGAP26 Zornitza Stark Marked gene: ARHGAP26 as ready
Mendeliome v0.9261 ARHGAP26 Zornitza Stark Gene: arhgap26 has been classified as Red List (Low Evidence).
Mendeliome v0.9261 ARHGAP26 Zornitza Stark Classified gene: ARHGAP26 as Red List (low evidence)
Mendeliome v0.9261 ARHGAP26 Zornitza Stark Gene: arhgap26 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1235 CSTB Danielle Ariti reviewed gene: CSTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 32920378, 18028412; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.165 SCN8A Zornitza Stark Marked gene: SCN8A as ready
Cerebral Palsy v0.165 SCN8A Zornitza Stark Gene: scn8a has been classified as Green List (High Evidence).
Cerebral Palsy v0.165 SCN8A Zornitza Stark Phenotypes for gene: SCN8A were changed from to Cerebral Palsy; Epileptic encephalopathy 13 MIM# 614558; Cognitive impairment with or without cerebellar ataxia MIM# 614306
Cerebral Palsy v0.164 SCN8A Zornitza Stark Publications for gene: SCN8A were set to
Cerebral Palsy v0.163 SCN8A Zornitza Stark Mode of inheritance for gene: SCN8A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9260 LEFTY2 Zornitza Stark Marked gene: LEFTY2 as ready
Mendeliome v0.9260 LEFTY2 Zornitza Stark Added comment: Comment when marking as ready: No reports since 1999.
Mendeliome v0.9260 LEFTY2 Zornitza Stark Gene: lefty2 has been classified as Red List (Low Evidence).
Mendeliome v0.9260 LEFTY2 Zornitza Stark Phenotypes for gene: LEFTY2 were changed from to Heterotaxy
Mendeliome v0.9259 LEFTY2 Zornitza Stark Publications for gene: LEFTY2 were set to
Mendeliome v0.9258 LEFTY2 Zornitza Stark Mode of inheritance for gene: LEFTY2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9257 LEFTY2 Zornitza Stark Classified gene: LEFTY2 as Red List (low evidence)
Mendeliome v0.9257 LEFTY2 Zornitza Stark Gene: lefty2 has been classified as Red List (Low Evidence).
Mendeliome v0.9256 CD3E Danielle Ariti reviewed gene: CD3E: Rating: GREEN; Mode of pathogenicity: None; Publications: 5546002, 28597365, 8490660; Phenotypes: Immunodeficiency 18 MIM# 615615; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.28 CD3E Danielle Ariti reviewed gene: CD3E: Rating: GREEN; Mode of pathogenicity: None; Publications: 15546002, 28597365, 8490660; Phenotypes: Immunodeficiency 18 MIM# 615615; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9256 CD3D Danielle Ariti reviewed gene: CD3D: Rating: GREEN; Mode of pathogenicity: None; Publications: 14602880, 15546002, 21926461, 21883749; Phenotypes: Immunodeficiency 19 MIM# 615617; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.28 CD3D Danielle Ariti reviewed gene: CD3D: Rating: GREEN; Mode of pathogenicity: None; Publications: 14602880, 15546002, 21926461, 21883749; Phenotypes: Immunodeficiency 19 MIM# 615617; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9256 ARHGAP26 Dean Phelan reviewed gene: ARHGAP26: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown
Cerebral Palsy v0.162 SCN8A Danielle Ariti reviewed gene: SCN8A: Rating: GREEN; Mode of pathogenicity: Other; Publications: 33528536, 32989326, 31904124; Phenotypes: Cerebral Palsy, Epileptic encephalopathy 13 MIM# 614558, Cognitive impairment with or without cerebellar ataxia MIM# 614306; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9256 MPL Zornitza Stark Phenotypes for gene: MPL were changed from Myelofibrosis with myeloid metaplasia, somatic, MIM#2544503; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR to Myelofibrosis with myeloid metaplasia, somatic, MIM#254450; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR
Bone Marrow Failure v1.7 MPL Zornitza Stark Phenotypes for gene: MPL were changed from Myelofibrosis with myeloid metaplasia, somatic, MIM#2544503; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR to Myelofibrosis with myeloid metaplasia, somatic, MIM#254450; Thrombocythemia 2, MIM#601977, AD, SMu; Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR
Bone Marrow Failure v1.6 MPL Zornitza Stark edited their review of gene: MPL: Changed phenotypes: Myelofibrosis with myeloid metaplasia, somatic, MIM#254450, Thrombocythemia 2, MIM#601977, AD, SMu, Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR
Additional findings_Paediatric v0.257 PTPRC Zornitza Stark Phenotypes for gene: PTPRC were changed from Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 151460 to Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971
Mendeliome v0.9255 EPAS1 Zornitza Stark Phenotypes for gene: EPAS1 were changed from Familial erythrocytosis (MIM#4611783), AD to Familial erythrocytosis (MIM#611783), AD
Liver Failure_Paediatric v1.8 BCS1L Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#124000 to GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400
Liver Failure_Paediatric v1.7 BCS1L Zornitza Stark edited their review of gene: BCS1L: Changed phenotypes: GRACILE syndrome, MIM# 603358, Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400
Mendeliome v0.9254 BCS1L Zornitza Stark Phenotypes for gene: BCS1L were changed from Bjornstad syndrome MIM#262000; GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type MIM#1124000 to Bjornstad syndrome MIM#262000; GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type MIM#112400
Cholestasis v0.204 BCS1L Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#124000 to GRACILE syndrome, MIM# 603358; Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400
Cholestasis v0.203 BCS1L Zornitza Stark edited their review of gene: BCS1L: Changed phenotypes: GRACILE syndrome, MIM# 603358, Mitochondrial complex III deficiency, nuclear type 1 , MIM#112400
Cholestasis v0.203 BCS1L Zornitza Stark edited their review of gene: BCS1L: Changed phenotypes: GRACILE syndrome, MIM# 603358, Mitochondrial complex III deficiency, nuclear type 1 , MIM#12400
Mendeliome v0.9253 OPA1 Zornitza Stark Phenotypes for gene: OPA1 were changed from Mitochondrial DNA depletion syndrome 14 (encephalocardiomyopathic type)MIM# 6168963; Behr syndrome MIM#210000, AR; Optic atrophy 1, MIM#165500; Optic atrophy plus syndrome, MIM# 125250 to Mitochondrial DNA depletion syndrome 14 (encephalocardiomyopathic type)MIM# 616896; Behr syndrome MIM#210000, AR; Optic atrophy 1, MIM#165500; Optic atrophy plus syndrome, MIM# 125250
Cerebral Palsy v0.162 MECP2 Zornitza Stark Marked gene: MECP2 as ready
Cerebral Palsy v0.162 MECP2 Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.162 MECP2 Zornitza Stark Classified gene: MECP2 as Green List (high evidence)
Cerebral Palsy v0.162 MECP2 Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence).
Mendeliome v0.9252 MAOB Zornitza Stark Marked gene: MAOB as ready
Mendeliome v0.9252 MAOB Zornitza Stark Gene: maob has been classified as Red List (Low Evidence).
Mendeliome v0.9252 MAOB Zornitza Stark gene: MAOB was added
gene: MAOB was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: MAOB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAOB were set to 31700678
Phenotypes for gene: MAOB were set to Cerebral palsy
Review for gene: MAOB was set to RED
Added comment: Variants identified in 2 unrelated individuals with CP (with same variant also identified in unaffected monozygotic twin).
Sources: Expert Review
Cerebral Palsy v0.161 MFN2 Krithika Murali gene: MFN2 was added
gene: MFN2 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: MFN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MFN2 were set to 16437557; 21715711; 34114234; 33528536
Phenotypes for gene: MFN2 were set to Charcot-Marie-Tooth disease, axonal, type 2A2A - #609260; Charcot-Marie-Tooth disease, axonal, type 2A2B - #617087; Hereditary motor and sensory neuropathy VIA - 601152
Review for gene: MFN2 was set to RED
Added comment: Most common cause of axonal Charcot-Marie-Tooth disease (CMT2). Homozygous and compound heterozygous MFN2 mutations have been reported in early-onset CMT2, including patients diagnosed <12 months of age.

x1 het VUS reported in a prematurely born child with unilateral spastic CP (34114234)
x1 paternally inherited pathogenic variant in MFN2 reported in 1 patient in CP cohort (33528536)
Sources: Literature
Cerebral Palsy v0.161 MAOB Zornitza Stark Marked gene: MAOB as ready
Cerebral Palsy v0.161 MAOB Zornitza Stark Gene: maob has been classified as Red List (Low Evidence).
Cerebral Palsy v0.161 MAOB Zornitza Stark Phenotypes for gene: MAOB were changed from to Cerebral palsy
Cerebral Palsy v0.160 MAOB Zornitza Stark Classified gene: MAOB as Red List (low evidence)
Cerebral Palsy v0.160 MAOB Zornitza Stark Gene: maob has been classified as Red List (Low Evidence).
Cerebral Palsy v0.159 KMT2B Zornitza Stark Marked gene: KMT2B as ready
Cerebral Palsy v0.159 KMT2B Zornitza Stark Gene: kmt2b has been classified as Red List (Low Evidence).
Cerebral Palsy v0.159 KMT2B Zornitza Stark Classified gene: KMT2B as Red List (low evidence)
Cerebral Palsy v0.159 KMT2B Zornitza Stark Gene: kmt2b has been classified as Red List (Low Evidence).
Cerebral Palsy v0.158 KMT2A Zornitza Stark Marked gene: KMT2A as ready
Cerebral Palsy v0.158 KMT2A Zornitza Stark Gene: kmt2a has been classified as Green List (High Evidence).
Cerebral Palsy v0.158 KMT2A Zornitza Stark Classified gene: KMT2A as Green List (high evidence)
Cerebral Palsy v0.158 KMT2A Zornitza Stark Gene: kmt2a has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1235 KDM5C Zornitza Stark Marked gene: KDM5C as ready
Genetic Epilepsy v0.1235 KDM5C Zornitza Stark Gene: kdm5c has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1235 KDM5C Zornitza Stark Phenotypes for gene: KDM5C were changed from Epilepsy; Intellectual Disability; microcephaly; Spasticity; hypothyroidism to Epilepsy; Intellectual Disability; microcephaly; Spasticity; hypothyroidism; Mental retardation, X-linked, syndromic, Claes-Jensen type, MIM# 300534; MONDO:0010355
Genetic Epilepsy v0.1234 KDM5C Zornitza Stark Publications for gene: KDM5C were set to 23246292; 32279304; 26919706
Genetic Epilepsy v0.1233 KDM5C Zornitza Stark Classified gene: KDM5C as Green List (high evidence)
Genetic Epilepsy v0.1233 KDM5C Zornitza Stark Gene: kdm5c has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1232 KDM5C Zornitza Stark reviewed gene: KDM5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 15586325, 32279304; Phenotypes: Mental retardation, X-linked, syndromic, Claes-Jensen type, MIM# 300534, MONDO:0010355; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1232 ATP6V1B2 Zornitza Stark Marked gene: ATP6V1B2 as ready
Genetic Epilepsy v0.1232 ATP6V1B2 Zornitza Stark Gene: atp6v1b2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1232 ATP6V1B2 Zornitza Stark Classified gene: ATP6V1B2 as Green List (high evidence)
Genetic Epilepsy v0.1232 ATP6V1B2 Zornitza Stark Gene: atp6v1b2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1231 ATP6V1B2 Zornitza Stark reviewed gene: ATP6V1B2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32873933; Phenotypes: Epileptic encephalopathy, Intellectual Disability, Deafness, congenital, with onychodystrophy, autosomal dominant, MIM# 124480; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4141 ATP6V0C Zornitza Stark Marked gene: ATP6V0C as ready
Intellectual disability syndromic and non-syndromic v0.4141 ATP6V0C Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4141 ATP6V0C Zornitza Stark Classified gene: ATP6V0C as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4141 ATP6V0C Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4140 ATP6V0C Zornitza Stark gene: ATP6V0C was added
gene: ATP6V0C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: ATP6V0C.
Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V0C were set to 33190975; 33090716
Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly
Review for gene: ATP6V0C was set to AMBER
Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures.
Sources: Literature
Mendeliome v0.9251 ATP6V0C Zornitza Stark Marked gene: ATP6V0C as ready
Mendeliome v0.9251 ATP6V0C Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9251 ATP6V0C Zornitza Stark Classified gene: ATP6V0C as Amber List (moderate evidence)
Mendeliome v0.9251 ATP6V0C Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9250 ATP6V0C Zornitza Stark Tag SV/CNV tag was added to gene: ATP6V0C.
Mendeliome v0.9250 ATP6V0C Zornitza Stark gene: ATP6V0C was added
gene: ATP6V0C was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V0C were set to 33190975; 33090716
Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly
Review for gene: ATP6V0C was set to AMBER
Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures.
Sources: Literature
Genetic Epilepsy v0.1231 ATP6V0C Zornitza Stark Marked gene: ATP6V0C as ready
Genetic Epilepsy v0.1231 ATP6V0C Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1231 ATP6V0C Zornitza Stark Classified gene: ATP6V0C as Amber List (moderate evidence)
Genetic Epilepsy v0.1231 ATP6V0C Zornitza Stark Gene: atp6v0c has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1230 ATP6V0C Zornitza Stark Tag SV/CNV tag was added to gene: ATP6V0C.
Genetic Epilepsy v0.1230 ATP6V0C Zornitza Stark reviewed gene: ATP6V0C: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual disability, seizures; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.157 MECP2 Krithika Murali gene: MECP2 was added
gene: MECP2 was added to Cerebral Palsy. Sources: Expert list,Literature
Mode of inheritance for gene: MECP2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: MECP2 were set to 30542205; 33528536
Phenotypes for gene: MECP2 were set to Encephalopathy, neonatal severe - 300673; Intellectual developmental disorder, X-linked syndromic, Lubs type - 300260; Intellectual developmental disorder, X-linked, syndromic 13 - 300055; Rett syndrome - 312750
Review for gene: MECP2 was set to GREEN
Added comment: Pathogenic/likely pathogenic variants reported in 9 unrelated patients with CP
Sources: Expert list, Literature
Cerebral Palsy v0.157 MAOB Krithika Murali gene: MAOB was added
gene: MAOB was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: MAOB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAOB were set to 31700678
Review for gene: MAOB was set to RED
Added comment: Identified in 2 unrelated individuals with CP (with same variant also identified in unaffected monozygotic twin) in a gene not currently known to be associated disease.
Sources: Literature
Cerebral Palsy v0.157 KMT2B Krithika Murali gene: KMT2B was added
gene: KMT2B was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: KMT2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KMT2B were set to 29697234
Phenotypes for gene: KMT2B were set to Dystonia 28, childhood-onset - #617284
Review for gene: KMT2B was set to RED
Added comment: Progressive early-onset movement disorder (mean age 7 years). Variants not previously reported in patients with CP.
Sources: Literature
Cerebral Palsy v0.157 KMT2A Krithika Murali gene: KMT2A was added
gene: KMT2A was added to Cerebral Palsy. Sources: Expert list,Literature
Mode of inheritance for gene: KMT2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KMT2A were set to 33528536
Phenotypes for gene: KMT2A were set to Wiedemann-Steiner syndrome - #605130
Review for gene: KMT2A was set to GREEN
Added comment: Pathogenic/likely pathogenic variants identified in 5 unrelated patients with CP (Moreno-de-Luca et al 2021).
Sources: Expert list, Literature
Genetic Epilepsy v0.1230 KDM5C Kavitha Kothur gene: KDM5C was added
gene: KDM5C was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: KDM5C was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: KDM5C were set to 23246292; 32279304; 26919706
Phenotypes for gene: KDM5C were set to Epilepsy; Intellectual Disability; microcephaly; Spasticity; hypothyroidism
Genetic Epilepsy v0.1230 ATP6V1B2 Kavitha Kothur gene: ATP6V1B2 was added
gene: ATP6V1B2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ATP6V1B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V1B2 were set to 31655144; 32934366; 32597767
Phenotypes for gene: ATP6V1B2 were set to Epileptic encephalopathy; Intellectual Disability; microcephaly, DOORS syndrome
Review for gene: ATP6V1B2 was set to GREEN
Added comment: Sources: Literature
Genetic Epilepsy v0.1230 ATP6V0C Kavitha Kothur gene: ATP6V0C was added
gene: ATP6V0C was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V0C were set to 33190975; 33090716
Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly
Penetrance for gene: ATP6V0C were set to unknown
Review for gene: ATP6V0C was set to AMBER
Added comment: Sources: Literature
Cerebral Palsy v0.157 KIDINS220 Zornitza Stark Marked gene: KIDINS220 as ready
Cerebral Palsy v0.157 KIDINS220 Zornitza Stark Added comment: Comment when marking as ready: Phenotypic overlap with CP particularly for mono-allelic disease association.
Cerebral Palsy v0.157 KIDINS220 Zornitza Stark Gene: kidins220 has been classified as Green List (High Evidence).
Cerebral Palsy v0.157 KIDINS220 Zornitza Stark Classified gene: KIDINS220 as Green List (high evidence)
Cerebral Palsy v0.157 KIDINS220 Zornitza Stark Gene: kidins220 has been classified as Green List (High Evidence).
Cerebral Palsy v0.156 KIDINS220 Krithika Murali gene: KIDINS220 was added
gene: KIDINS220 was added to Cerebral Palsy. Sources: Expert list,Literature
Mode of inheritance for gene: KIDINS220 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIDINS220 were set to 30542205
Phenotypes for gene: KIDINS220 were set to Spastic paraplegia, intellectual disability, nystagmus, and obesity - #617296; Ventriculomegaly and arthrogryposis - #619501
Review for gene: KIDINS220 was set to GREEN
Added comment: Well-established association with AD spastic paraplegia and AR ventriculomegaly and arthrogryposis - phenotypic overlap noted with CP.

Also reported in 2 siblings with atypical CP likely due to parental germline mosaicism (PMID 30542205)

Alternative gene names: ARMS
Sources: Expert list, Literature
Mendeliome v0.9249 KDM7A Zornitza Stark Marked gene: KDM7A as ready
Mendeliome v0.9249 KDM7A Zornitza Stark Gene: kdm7a has been classified as Red List (Low Evidence).
Mendeliome v0.9249 KDM7A Zornitza Stark gene: KDM7A was added
gene: KDM7A was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: KDM7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KDM7A were set to 25666757
Phenotypes for gene: KDM7A were set to Cerebral palsy
Review for gene: KDM7A was set to RED
Added comment: Synonyms: JHDMID, KDM7, KIAA1718

De novo missense VUS identified in a WES CP cohort study, no other reports.
Sources: Literature
Cerebral Palsy v0.156 KDM7A Zornitza Stark Marked gene: KDM7A as ready
Cerebral Palsy v0.156 KDM7A Zornitza Stark Gene: kdm7a has been classified as Red List (Low Evidence).
Cerebral Palsy v0.156 KDM7A Zornitza Stark Phenotypes for gene: KDM7A were changed from to Cerebral palsy
Cerebral Palsy v0.155 KDM7A Zornitza Stark Classified gene: KDM7A as Red List (low evidence)
Cerebral Palsy v0.155 KDM7A Zornitza Stark Gene: kdm7a has been classified as Red List (Low Evidence).
Cerebral Palsy v0.154 KCNQ2 Zornitza Stark reviewed gene: KCNQ2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 7 - #613720; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.154 KCNQ2 Zornitza Stark Marked gene: KCNQ2 as ready
Cerebral Palsy v0.154 KCNQ2 Zornitza Stark Gene: kcnq2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.154 KCNQ2 Zornitza Stark Phenotypes for gene: KCNQ2 were changed from Developmental and epileptic encephalopathy 7 - #613720; Myokymia - #121200; Seizures, benign neonatal, 1 - #121200 to Developmental and epileptic encephalopathy 7 - #613720
Cerebral Palsy v0.153 KCNQ2 Zornitza Stark Classified gene: KCNQ2 as Green List (high evidence)
Cerebral Palsy v0.153 KCNQ2 Zornitza Stark Gene: kcnq2 has been classified as Green List (High Evidence).
Mendeliome v0.9248 ROBO1 Zornitza Stark Marked gene: ROBO1 as ready
Mendeliome v0.9248 ROBO1 Zornitza Stark Gene: robo1 has been classified as Green List (High Evidence).
Mendeliome v0.9248 ROBO1 Zornitza Stark Phenotypes for gene: ROBO1 were changed from to Congenital heart disease; Pituitary anomalies
Mendeliome v0.9247 ROBO1 Zornitza Stark Publications for gene: ROBO1 were set to
Mendeliome v0.9246 ROBO1 Zornitza Stark Mode of inheritance for gene: ROBO1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.9245 ROBO1 Zornitza Stark reviewed gene: ROBO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28592524, 30530901, 30692597, 33270637, 28402530; Phenotypes: Congenital heart disease, Pituitary anomalies; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Pituitary hormone deficiency v0.19 ROBO1 Zornitza Stark Marked gene: ROBO1 as ready
Pituitary hormone deficiency v0.19 ROBO1 Zornitza Stark Gene: robo1 has been classified as Green List (High Evidence).
Pituitary hormone deficiency v0.19 ROBO1 Zornitza Stark Classified gene: ROBO1 as Green List (high evidence)
Pituitary hormone deficiency v0.19 ROBO1 Zornitza Stark Gene: robo1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.152 KDM7A Krithika Murali changed review comment from: Synonyms: JHDMID, KDM7, KIAA1718

De novo missense VUS identified in a WES CP cohort study in a gene not known to be associated with disease.
Sources: Expert list, Literature; to: Synonyms: JHDMID, KDM7, KIAA1718

De novo missense VUS identified in a WES CP cohort study in a gene not known to be associated with disease.
Sources: Literature
Cerebral Palsy v0.152 KDM7A Krithika Murali gene: KDM7A was added
gene: KDM7A was added to Cerebral Palsy. Sources: Expert list,Literature
Mode of inheritance for gene: KDM7A was set to Unknown
Publications for gene: KDM7A were set to 25666757
Review for gene: KDM7A was set to RED
Added comment: Synonyms: JHDMID, KDM7, KIAA1718

De novo missense VUS identified in a WES CP cohort study in a gene not known to be associated with disease.
Sources: Expert list, Literature
Cerebral Palsy v0.152 KCNQ2 Krithika Murali gene: KCNQ2 was added
gene: KCNQ2 was added to Cerebral Palsy. Sources: Expert list,Literature
Mode of inheritance for gene: KCNQ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNQ2 were set to 33557955; 32585800; 22275249; 28655139
Phenotypes for gene: KCNQ2 were set to Developmental and epileptic encephalopathy 7 - #613720; Myokymia - #121200; Seizures, benign neonatal, 1 - #121200
Review for gene: KCNQ2 was set to AMBER
Added comment: Well-validated association with early-onset epileptic encephalopathy (ClinGen) and neonatal seizures.


In addition, KCNQ2 pathogenic variants reported in multiple individuals with intractable neonatal seizures and associated intellectual disability, developmental delay and motor impairment (axial hypotonia and/or spastic quadriplegia) - (PMID 22275249)

x2 case reports of associated CP - 6 year old M with neonatal seizures and a CP-like syndrome. KCNQ2 exon 7 partial duplication impairing gene function (ClinVar ID 617505) - (PMID 32585800 and 33557955) and 2 year old F with perinatal encephalopathy, severe tetraparesis and cerebral visual impairment (PMID 28655139). Neonatal epileptic encephalopathy primary presentation in both cases.

On Expert CP Gene List.
Sources: Expert list, Literature
Pituitary hormone deficiency v0.18 ROBO1 Natasha Brown gene: ROBO1 was added
gene: ROBO1 was added to Pituitary hormone deficiency. Sources: Literature
Mode of inheritance for gene: ROBO1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: ROBO1 were set to PMID: 30530901; 30692597; 33270637; 28402530
Phenotypes for gene: ROBO1 were set to pituitary stalk interruption syndrome; pituitary anomalies; pituitary hormone deficiency
Review for gene: ROBO1 was set to GREEN
Added comment: PMID: 30692597 novel hmz splice, single case; severe phenotype combined pituitary hormone deficiency, psychomotor developmental delay, severe intellectual disability, sensorineural hearing loss, strabismus, dysmorphism; parents reported to be unaffected.
PMID: 30530901 Two affected from one family with 343.7 kb deletion of 3p12.3 encompassing ROBO1
PMID: 33270637 Larger cohort study found four individiuals (2x LOF; 2x missense) all het variants however those with missense variants also had other variants in different genes, evidence for pathogenicity of missense variants less clear.
PMID: 28402530 In five unexplained cases of pit stalk interruption, found: p.Ala977Glnfs*40 in two affected sibs; p.Tyr1114Ter in a sporadic case, and p.Cys240Ser, affected child and paternal aunt. All heterozygous.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4139 ARFGEF1 Zornitza Stark Marked gene: ARFGEF1 as ready
Intellectual disability syndromic and non-syndromic v0.4139 ARFGEF1 Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4139 ARFGEF1 Zornitza Stark Classified gene: ARFGEF1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4139 ARFGEF1 Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4138 ARFGEF1 Zornitza Stark gene: ARFGEF1 was added
gene: ARFGEF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARFGEF1 were set to 34113008
Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy
Review for gene: ARFGEF1 was set to GREEN
Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families.
Sources: Literature
Genetic Epilepsy v0.1230 ARFGEF1 Zornitza Stark Marked gene: ARFGEF1 as ready
Genetic Epilepsy v0.1230 ARFGEF1 Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1230 ARFGEF1 Zornitza Stark Classified gene: ARFGEF1 as Green List (high evidence)
Genetic Epilepsy v0.1230 ARFGEF1 Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1229 ARFGEF1 Zornitza Stark gene: ARFGEF1 was added
gene: ARFGEF1 was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARFGEF1 were set to 34113008
Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy
Review for gene: ARFGEF1 was set to GREEN
Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families.
Sources: Expert Review
Mendeliome v0.9245 ARFGEF1 Zornitza Stark Marked gene: ARFGEF1 as ready
Mendeliome v0.9245 ARFGEF1 Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence).
Mendeliome v0.9245 ARFGEF1 Zornitza Stark Classified gene: ARFGEF1 as Green List (high evidence)
Mendeliome v0.9245 ARFGEF1 Zornitza Stark Gene: arfgef1 has been classified as Green List (High Evidence).
Mendeliome v0.9244 ARFGEF1 Zornitza Stark gene: ARFGEF1 was added
gene: ARFGEF1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARFGEF1 were set to 34113008
Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy
Review for gene: ARFGEF1 was set to GREEN
Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families.
Sources: Expert Review
Genetic Epilepsy v0.1228 AP4B1 Zornitza Stark Marked gene: AP4B1 as ready
Genetic Epilepsy v0.1228 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1228 AP4B1 Zornitza Stark Classified gene: AP4B1 as Green List (high evidence)
Genetic Epilepsy v0.1228 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1227 AP4B1 Zornitza Stark gene: AP4B1 was added
gene: AP4B1 was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: AP4B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP4B1 were set to 21620353; 22290197; 24700674; 24781758; 32166732
Phenotypes for gene: AP4B1 were set to Spastic paraplegia 47, autosomal recessive, MIM# 614066
Review for gene: AP4B1 was set to GREEN
Added comment: Autosomal recessive neurodegenerative disorder characterised by neonatal hypotonia that progresses to hypertonia and spasticity and severe ID with poor or absent speech development. Microcephaly is an early, presenting feature. Seizures reported in at least 3 families.

>5 unrelated families reported.
Sources: Expert Review
Mendeliome v0.9243 NPR3 Zornitza Stark Marked gene: NPR3 as ready
Mendeliome v0.9243 NPR3 Zornitza Stark Gene: npr3 has been classified as Green List (High Evidence).
Mendeliome v0.9243 NPR3 Zornitza Stark Phenotypes for gene: NPR3 were changed from to Boudin-Mortier syndrome, MIM#619543; Tall stature, skeletal abnormalities, aortic dilatation
Mendeliome v0.9242 NPR3 Zornitza Stark Publications for gene: NPR3 were set to
Mendeliome v0.9241 NPR3 Zornitza Stark Mode of inheritance for gene: NPR3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9240 NPR3 Zornitza Stark reviewed gene: NPR3: Rating: GREEN; Mode of pathogenicity: None; Publications: 30032985; Phenotypes: Boudin-Mortier syndrome, MIM#619543, Tall stature, skeletal abnormalities, aortic dilatation; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Aortopathy_Connective Tissue Disorders v1.55 NPR3 Zornitza Stark Phenotypes for gene: NPR3 were changed from Tall stature, skeletal abnormalities, aortic dilatation to Boudin-Mortier syndrome, MIM#619543; Tall stature, skeletal abnormalities, aortic dilatation
Aortopathy_Connective Tissue Disorders v1.54 NPR3 Zornitza Stark edited their review of gene: NPR3: Changed phenotypes: Boudin-Mortier syndrome, MIM#619543, Tall stature, skeletal abnormalities, aortic dilatation
Intellectual disability syndromic and non-syndromic v0.4137 PRR12 Zornitza Stark Phenotypes for gene: PRR12 were changed from intellectual disability; iris abnormalities to Neuroocular syndrome, MIM#619539; Intellectual disability; Iris abnormalities; Complex microphthalmia
Intellectual disability syndromic and non-syndromic v0.4136 PRR12 Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Intellectual disability, Iris abnormalities, Complex microphthalmia
Mendeliome v0.9240 PRR12 Zornitza Stark Phenotypes for gene: PRR12 were changed from Intellectual disability; Iris abnormalities; Complex microphthalmia to Neuroocular syndrome, MIM#619539; Intellectual disability; Iris abnormalities; Complex microphthalmia
Mendeliome v0.9239 PRR12 Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Intellectual disability, Iris abnormalities, Complex microphthalmia
Anophthalmia_Microphthalmia_Coloboma v1.8 PRR12 Zornitza Stark Phenotypes for gene: PRR12 were changed from Complex microphthalmia to Neuroocular syndrome, MIM#619539; Complex microphthalmia
Anophthalmia_Microphthalmia_Coloboma v1.7 PRR12 Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Complex microphthalmia
Mendeliome v0.9239 KCNC3 Zornitza Stark Marked gene: KCNC3 as ready
Mendeliome v0.9239 KCNC3 Zornitza Stark Gene: kcnc3 has been classified as Green List (High Evidence).
Mendeliome v0.9239 KCNC3 Zornitza Stark Phenotypes for gene: KCNC3 were changed from to Spinocerebellar ataxia 13, MIM# 605259
Mendeliome v0.9238 KCNC3 Zornitza Stark Publications for gene: KCNC3 were set to
Mendeliome v0.9237 KCNC3 Zornitza Stark Mode of inheritance for gene: KCNC3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9236 KCNC3 Zornitza Stark reviewed gene: KCNC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 16501573, 25497598, 25981959, 25981959; Phenotypes: Spinocerebellar ataxia 13, MIM# 605259; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.152 KCNC3 Zornitza Stark Marked gene: KCNC3 as ready
Cerebral Palsy v0.152 KCNC3 Zornitza Stark Gene: kcnc3 has been classified as Green List (High Evidence).
Cerebral Palsy v0.152 KCNC3 Zornitza Stark Classified gene: KCNC3 as Green List (high evidence)
Cerebral Palsy v0.152 KCNC3 Zornitza Stark Gene: kcnc3 has been classified as Green List (High Evidence).
Cerebral Palsy v0.151 KCNC3 Zornitza Stark gene: KCNC3 was added
gene: KCNC3 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: KCNC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNC3 were set to 16501573; 25497598; 25981959; 25981959
Phenotypes for gene: KCNC3 were set to Spinocerebellar ataxia 13, MIM# 605259
Review for gene: KCNC3 was set to GREEN
Added comment: ID and ataxia, variable age of onset, including in childhood. Reported in ataxic CP cohort.
Sources: Expert list
Cerebral Palsy v0.151 KCNC3 Zornitza Stark gene: KCNC3 was added
gene: KCNC3 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: KCNC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNC3 were set to 16501573; 25497598; 25981959; 25981959
Phenotypes for gene: KCNC3 were set to Spinocerebellar ataxia 13, MIM# 605259
Review for gene: KCNC3 was set to GREEN
Added comment: ID and ataxia, variable age of onset, including in childhood. Reported in ataxic CP cohort.
Sources: Expert list
Cerebral Palsy v0.150 ITPR1 Zornitza Stark Marked gene: ITPR1 as ready
Cerebral Palsy v0.150 ITPR1 Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.150 ITPR1 Zornitza Stark Classified gene: ITPR1 as Green List (high evidence)
Cerebral Palsy v0.150 ITPR1 Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.149 ITPR1 Zornitza Stark gene: ITPR1 was added
gene: ITPR1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: ITPR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ITPR1 were set to 28826917; 25981959; 22986007
Phenotypes for gene: ITPR1 were set to Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360
Review for gene: ITPR1 was set to GREEN
Added comment: Variants in this gene reported in individuals diagnosed with ataxic CP.
Sources: Expert list
Cerebral Palsy v0.148 IQSEC2 Zornitza Stark Marked gene: IQSEC2 as ready
Cerebral Palsy v0.148 IQSEC2 Zornitza Stark Gene: iqsec2 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.148 IQSEC2 Zornitza Stark gene: IQSEC2 was added
gene: IQSEC2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: IQSEC2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: IQSEC2 were set to 33368194; 20473311; 23674175
Phenotypes for gene: IQSEC2 were set to Mental retardation, X-linked 1/78, MIM# 309530, MONDO:0010656; Severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome MONDO:0018347
Review for gene: IQSEC2 was set to RED
Added comment: More than 20 unrelated families reported. Typical features are ID, microcephaly and hand stereotypies. Phenotypic overlap with Angelman-Rett-like syndromes rather than CP.
Sources: Expert list
Cerebral Palsy v0.147 HPCA Zornitza Stark Marked gene: HPCA as ready
Cerebral Palsy v0.147 HPCA Zornitza Stark Gene: hpca has been classified as Red List (Low Evidence).
Cerebral Palsy v0.147 HPCA Zornitza Stark changed review comment from: Isolated dystonia, variable age of onset, including in adolescence. Insufficient phenotypic overlap with CP.
Sources: Expert list; to: Four families reported. Isolated dystonia, variable age of onset, including in adolescence. Insufficient phenotypic overlap with CP.
Sources: Expert list
Cerebral Palsy v0.147 HPCA Zornitza Stark gene: HPCA was added
gene: HPCA was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: HPCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HPCA were set to 30145809; 25799108
Phenotypes for gene: HPCA were set to Dystonia 2, torsion, autosomal recessive, MIM#224500
Review for gene: HPCA was set to RED
Added comment: Isolated dystonia, variable age of onset, including in adolescence. Insufficient phenotypic overlap with CP.
Sources: Expert list
Microcephaly v1.53 MINPP1 Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527
Microcephaly v1.52 MINPP1 Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527
Mendeliome v0.9236 MINPP1 Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527
Mendeliome v0.9235 MINPP1 Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527
Cerebral Palsy v0.146 MINPP1 Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527
Cerebral Palsy v0.145 MINPP1 Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527
Cerebellar and Pontocerebellar Hypoplasia v1.17 MINPP1 Zornitza Stark Phenotypes for gene: MINPP1 were changed from Pontocerebellar hypoplasia to Pontocerebellar hypoplasia, type 16, MIM# 619527
Cerebellar and Pontocerebellar Hypoplasia v1.16 MINPP1 Zornitza Stark edited their review of gene: MINPP1: Changed phenotypes: Pontocerebellar hypoplasia, type 16, MIM# 619527
Arthrogryposis v0.298 ZC4H2 Zornitza Stark Publications for gene: ZC4H2 were set to 23623388; 31885220
Arthrogryposis v0.297 ZC4H2 Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Arthrogryposis v0.296 ZC4H2 Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9235 ZC4H2 Zornitza Stark Marked gene: ZC4H2 as ready
Mendeliome v0.9235 ZC4H2 Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4136 ZC4H2 Zornitza Stark Marked gene: ZC4H2 as ready
Intellectual disability syndromic and non-syndromic v0.4136 ZC4H2 Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4136 ZC4H2 Zornitza Stark Phenotypes for gene: ZC4H2 were changed from to Wieacker-Wolff syndrome, MIM# 314580
Intellectual disability syndromic and non-syndromic v0.4135 ZC4H2 Zornitza Stark Publications for gene: ZC4H2 were set to
Intellectual disability syndromic and non-syndromic v0.4134 ZC4H2 Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4133 ZC4H2 Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9235 ZC4H2 Zornitza Stark Phenotypes for gene: ZC4H2 were changed from to Wieacker-Wolff syndrome, MIM# 314580
Mendeliome v0.9234 ZC4H2 Zornitza Stark Publications for gene: ZC4H2 were set to
Mendeliome v0.9233 ZC4H2 Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Cerebral Palsy v0.145 ZC4H2 Zornitza Stark Publications for gene: ZC4H2 were set to 23623388
Cerebral Palsy v0.144 ZC4H2 Zornitza Stark changed review comment from: Intellectual disability and spasticity are key features. At least one family had a diagnosis of CP.; to: Intellectual disability and spasticity are key features, more than 40 families reported. At least one family had a diagnosis of CP.
Cerebral Palsy v0.144 ZC4H2 Zornitza Stark edited their review of gene: ZC4H2: Changed publications: 23623388, 34322088, 33949289, 31885220, 31206972
Mendeliome v0.9232 ZC4H2 Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Cerebral Palsy v0.144 ZC4H2 Zornitza Stark Marked gene: ZC4H2 as ready
Cerebral Palsy v0.144 ZC4H2 Zornitza Stark Gene: zc4h2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.144 ZC4H2 Zornitza Stark Phenotypes for gene: ZC4H2 were changed from to Wieacker-Wolff syndrome, MIM# 314580
Cerebral Palsy v0.143 ZC4H2 Zornitza Stark Publications for gene: ZC4H2 were set to
Cerebral Palsy v0.142 ZC4H2 Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Cerebral Palsy v0.141 ZC4H2 Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Cerebral Palsy v0.141 SPG11 Zornitza Stark Marked gene: SPG11 as ready
Cerebral Palsy v0.141 SPG11 Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence).
Cerebral Palsy v0.141 SPG11 Zornitza Stark Classified gene: SPG11 as Green List (high evidence)
Cerebral Palsy v0.141 SPG11 Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence).
Cerebral Palsy v0.140 SPG11 Zornitza Stark gene: SPG11 was added
gene: SPG11 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: SPG11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPG11 were set to 34183250; 33581793
Phenotypes for gene: SPG11 were set to Spastic paraplegia 11, autosomal recessive, MIM# 604360
Review for gene: SPG11 was set to GREEN
Added comment: Intellectual disability and spasticity, reported in CP cohort.

Recent review of >300 individuals with SPG11-related disease. Mean age at onset was 13.10 ± 3.65 years, with initial symptoms like gait disturbance (107/195, 54.87%) and intellectual disability (47/195, 24.10%). Cognitive decline (228/270, 84.44%) was the most common complex manifestation stepped by dysarthria (134/195, 68.72%), neuropathy (112/177, 63.28%), amyatrophy, sphincter disturbance (60/130, 46.15%) and ataxia (90/194, 46.39%).
Sources: Expert list
Cerebral Palsy v0.139 SMARCB1 Zornitza Stark Marked gene: SMARCB1 as ready
Cerebral Palsy v0.139 SMARCB1 Zornitza Stark Gene: smarcb1 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.139 SMARCB1 Zornitza Stark gene: SMARCB1 was added
gene: SMARCB1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: SMARCB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMARCB1 were set to Coffin-Siris syndrome 3, MIM# 614608
Review for gene: SMARCB1 was set to RED
Added comment: Intellectual disability and dysmorphic features, no strong phenotypic overlap with CP.
Sources: Expert list
Genetic Epilepsy v0.1226 ACOX1 Zornitza Stark Marked gene: ACOX1 as ready
Genetic Epilepsy v0.1226 ACOX1 Zornitza Stark Gene: acox1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1226 ACOX1 Zornitza Stark Phenotypes for gene: ACOX1 were changed from to Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960
Genetic Epilepsy v0.1225 ACOX1 Zornitza Stark Publications for gene: ACOX1 were set to
Genetic Epilepsy v0.1224 ACOX1 Zornitza Stark Mode of inheritance for gene: ACOX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1223 ACOX1 Zornitza Stark reviewed gene: ACOX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32169171, 17458872; Phenotypes: Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470, Mitchell syndrome, MIM# 618960; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1223 ALX4 Zornitza Stark Marked gene: ALX4 as ready
Genetic Epilepsy v0.1223 ALX4 Zornitza Stark Gene: alx4 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1223 ALX4 Zornitza Stark gene: ALX4 was added
gene: ALX4 was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: ALX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ALX4 were set to 33269135
Phenotypes for gene: ALX4 were set to Parietal foramina 2, MIM# 609597
Review for gene: ALX4 was set to RED
Added comment: Single case report of seizures in an individual with ALX4 variant and parietal foramina, unclear if related.
Sources: Expert Review
Genetic Epilepsy v0.1222 ADGRV1 Zornitza Stark Phenotypes for gene: ADGRV1 were changed from Myoclonic epilepsy; febrile seizures; epilepsy to Myoclonic epilepsy; febrile seizures; epilepsy; Rolandic epilepsy
Genetic Epilepsy v0.1221 ADGRV1 Zornitza Stark Publications for gene: ADGRV1 were set to 29266188; 29261713; 32962041
Genetic Epilepsy v0.1220 ADGRV1 Zornitza Stark Mode of inheritance for gene: ADGRV1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1219 ADGRV1 Zornitza Stark Classified gene: ADGRV1 as Amber List (moderate evidence)
Genetic Epilepsy v0.1219 ADGRV1 Zornitza Stark Gene: adgrv1 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1218 ADGRV1 Zornitza Stark edited their review of gene: ADGRV1: Added comment: Two families reported with bi-allelic variants and Rolandic epilepsy.; Changed rating: AMBER; Changed publications: 29266188, 29261713, 32962041, 34160719; Changed phenotypes: Myoclonic epilepsy, febrile seizures, epilepsy, Rolandic epilepsy; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Classified gene: ACTG1 as Green List (high evidence)
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Classified gene: ACTG1 as Green List (high evidence)
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Marked gene: ACTG1 as ready
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Classified gene: ACTG1 as Green List (high evidence)
Genetic Epilepsy v0.1218 ACTG1 Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1217 ACTG1 Zornitza Stark gene: ACTG1 was added
gene: ACTG1 was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: ACTG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ACTG1 were set to 22366783; 25052316
Phenotypes for gene: ACTG1 were set to Baraitser-Winter syndrome 2, MIM# 614583
Review for gene: ACTG1 was set to GREEN
Added comment: Well established gene-disease association. ID and seizures correlate with extent of brain anomalies.
Sources: Expert Review
Genetic Epilepsy v0.1216 AARS2 Zornitza Stark Publications for gene: AARS2 were set to 21549344; 25817015
Genetic Epilepsy v0.1215 AARS2 Zornitza Stark Classified gene: AARS2 as Amber List (moderate evidence)
Genetic Epilepsy v0.1215 AARS2 Zornitza Stark Gene: aars2 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1214 AARS2 Zornitza Stark changed review comment from: Seizures not a prominent feature of these conditions.; to: Seizures reported in some.
Genetic Epilepsy v0.1214 AARS2 Zornitza Stark edited their review of gene: AARS2: Changed rating: AMBER; Changed publications: 21549344, 25817015, 32571458, 24808023
Genetic Epilepsy v0.1214 TUBB3 Zornitza Stark Marked gene: TUBB3 as ready
Genetic Epilepsy v0.1214 TUBB3 Zornitza Stark Gene: tubb3 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1214 TUBB3 Zornitza Stark Phenotypes for gene: TUBB3 were changed from to Cortical dysplasia, complex, with other brain malformations 1, MIM# 614039
Genetic Epilepsy v0.1213 TUBB3 Zornitza Stark Publications for gene: TUBB3 were set to
Genetic Epilepsy v0.1212 TUBB3 Zornitza Stark Mode of inheritance for gene: TUBB3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.1211 TUBB3 Zornitza Stark reviewed gene: TUBB3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20829227, 25059107, 33318778; Phenotypes: Cortical dysplasia, complex, with other brain malformations 1, MIM# 614039; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.1211 SLC4A4 Zornitza Stark Marked gene: SLC4A4 as ready
Genetic Epilepsy v0.1211 SLC4A4 Zornitza Stark Gene: slc4a4 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1211 SLC4A4 Zornitza Stark gene: SLC4A4 was added
gene: SLC4A4 was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: SLC4A4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC4A4 were set to 33439394
Phenotypes for gene: SLC4A4 were set to Renal tubular acidosis, proximal, with ocular abnormalities, MIM# 604278
Review for gene: SLC4A4 was set to RED
Added comment: Bi-allelic variants in SLC4A4 cause a syndrome characterised by proximal renal tubular acidosis (pRTA), ID, dental and ocular abnormalities, and hemiplegic migraine.

Single family reported with 4 affected individuals, where seizures were a prominent feature, with adult onset. Two developed life-threatening status epilepticus.
Sources: Expert Review
Regression v0.375 SLC1A3 Zornitza Stark Marked gene: SLC1A3 as ready
Regression v0.375 SLC1A3 Zornitza Stark Gene: slc1a3 has been classified as Red List (Low Evidence).
Regression v0.375 SLC1A3 Zornitza Stark Phenotypes for gene: SLC1A3 were changed from to Episodic ataxia, type 6, MIM# 612656
Regression v0.374 SLC1A3 Zornitza Stark Publications for gene: SLC1A3 were set to
Regression v0.373 SLC1A3 Zornitza Stark Mode of inheritance for gene: SLC1A3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.1210 SLC1A3 Zornitza Stark Marked gene: SLC1A3 as ready
Genetic Epilepsy v0.1210 SLC1A3 Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence).
Regression v0.372 SLC1A3 Zornitza Stark Classified gene: SLC1A3 as Red List (low evidence)
Regression v0.372 SLC1A3 Zornitza Stark Gene: slc1a3 has been classified as Red List (Low Evidence).
Regression v0.371 SLC1A3 Zornitza Stark reviewed gene: SLC1A3: Rating: RED; Mode of pathogenicity: None; Publications: 19139306, 16116111, 29208948, 27829685, 32741053; Phenotypes: Episodic ataxia, type 6, MIM# 612656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.1210 SLC1A3 Zornitza Stark Classified gene: SLC1A3 as Green List (high evidence)
Genetic Epilepsy v0.1210 SLC1A3 Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1209 SLC1A3 Zornitza Stark gene: SLC1A3 was added
gene: SLC1A3 was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: SLC1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC1A3 were set to 19139306; 16116111; 29208948; 27829685; 32741053
Phenotypes for gene: SLC1A3 were set to Episodic ataxia, type 6, MIM# 612656
Review for gene: SLC1A3 was set to GREEN
Added comment: Seven families reported. Episodic ataxia type 6 (EA6) differs from other EA forms in long attack duration, epilepsy and absent myokymia, nystagmus, and tinnitus.
Sources: Expert Review
Genetic Epilepsy v0.1208 MAST1 Zornitza Stark Marked gene: MAST1 as ready
Genetic Epilepsy v0.1208 MAST1 Zornitza Stark Gene: mast1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1208 MAST1 Zornitza Stark Classified gene: MAST1 as Green List (high evidence)
Genetic Epilepsy v0.1208 MAST1 Zornitza Stark Gene: mast1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1207 MAST1 Zornitza Stark gene: MAST1 was added
gene: MAST1 was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: MAST1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAST1 were set to 31721002; 30449657; 32198973
Phenotypes for gene: MAST1 were set to Mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations; OMIM #618273
Review for gene: MAST1 was set to GREEN
Added comment: 7 unrelated patients with mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations (MCCCHCM) with de novo heterozygous mutations in MAST1 gene. Intellectual disability and seizures are clinical features, together with characteristic brain imaging abnormalities.

In vitro functional studies showed that 1 of the variants (lys276del) increased MAST1 binding to microtubules compared to controls. Mutant mice heterozygous for a Mast1 leu278del allele showed a thicker corpus callosum compared to wildtype, and an overall reduction in cortical volume and thickness and decreased cerebellar volume and number of granule and Purkinje cells due to increased apoptosis compared to controls.

1 Emirati patient with ID, microcephaly, and dysmorphic features, with missense variant in MAST1.
Sources: Expert Review
Genetic Epilepsy v0.1206 LAMA2 Zornitza Stark Classified gene: LAMA2 as Green List (high evidence)
Genetic Epilepsy v0.1206 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1205 LAMA2 Zornitza Stark Classified gene: LAMA2 as Green List (high evidence)
Genetic Epilepsy v0.1205 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1204 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Genetic Epilepsy v0.1204 LAMA2 Zornitza Stark Gene: lama2 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1204 LAMA2 Zornitza Stark gene: LAMA2 was added
gene: LAMA2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: LAMA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LAMA2 were set to 33333793; 34325301
Phenotypes for gene: LAMA2 were set to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23 , MIM#618138
Review for gene: LAMA2 was set to GREEN
Added comment: Epilepsy is a common, often severe, feature of LAMA2-related muscular dystrophy (LAMA2-RD) and could represent its onset and main manifestation, even in the absence of overt muscle involvement, reviewed in PMID 34325301.
Sources: Literature
Genetic Epilepsy v0.1203 CIC Zornitza Stark Marked gene: CIC as ready
Genetic Epilepsy v0.1203 CIC Zornitza Stark Gene: cic has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1203 CIC Zornitza Stark Phenotypes for gene: CIC were changed from to Mental retardation, autosomal dominant 45, MIM# 617600
Genetic Epilepsy v0.1202 CIC Zornitza Stark Publications for gene: CIC were set to
Genetic Epilepsy v0.1201 CIC Zornitza Stark Mode of inheritance for gene: CIC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.1200 CIC Zornitza Stark reviewed gene: CIC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28288114; Phenotypes: Mental retardation, autosomal dominant 45, MIM# 617600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.1200 BRAF Zornitza Stark Marked gene: BRAF as ready
Genetic Epilepsy v0.1200 BRAF Zornitza Stark Gene: braf has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1200 BRAF Zornitza Stark Phenotypes for gene: BRAF were changed from to Cardiofaciocutaneous syndrome, MIM# 115150
Genetic Epilepsy v0.1199 BRAF Zornitza Stark Publications for gene: BRAF were set to
Genetic Epilepsy v0.1198 BRAF Zornitza Stark Mode of inheritance for gene: BRAF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.1197 BRAF Zornitza Stark reviewed gene: BRAF: Rating: GREEN; Mode of pathogenicity: None; Publications: 34309696; Phenotypes: Cardiofaciocutaneous syndrome, MIM# 115150; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Congenital Disorders of Glycosylation v1.19 ALG10 Zornitza Stark Marked gene: ALG10 as ready
Congenital Disorders of Glycosylation v1.19 ALG10 Zornitza Stark Gene: alg10 has been classified as Red List (Low Evidence).
Congenital Disorders of Glycosylation v1.19 ALG10 Zornitza Stark gene: ALG10 was added
gene: ALG10 was added to Congenital Disorders of Glycosylation. Sources: Literature
Mode of inheritance for gene: ALG10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALG10 were set to 33798445
Phenotypes for gene: ALG10 were set to Progressive myoclonus epilepsy; CDG
Review for gene: ALG10 was set to RED
Added comment: Single individual with homozygous variant identified in a progressive myoclonus epilepsy cohort.
Sources: Literature
Genetic Epilepsy v0.1197 ALG10 Zornitza Stark Marked gene: ALG10 as ready
Genetic Epilepsy v0.1197 ALG10 Zornitza Stark Gene: alg10 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1197 ALG10 Zornitza Stark gene: ALG10 was added
gene: ALG10 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ALG10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALG10 were set to 33798445
Phenotypes for gene: ALG10 were set to Progressive myoclonus epilepsy; CDG
Review for gene: ALG10 was set to RED
Added comment: Single individual with homozygous variant identified in a progressive myoclonus epilepsy cohort.
Sources: Literature
Mendeliome v0.9232 ALG10 Zornitza Stark Marked gene: ALG10 as ready
Mendeliome v0.9232 ALG10 Zornitza Stark Gene: alg10 has been classified as Red List (Low Evidence).
Mendeliome v0.9232 ALG10 Zornitza Stark gene: ALG10 was added
gene: ALG10 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ALG10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALG10 were set to 33798445
Phenotypes for gene: ALG10 were set to Progressive myoclonus epilepsy; CDG
Review for gene: ALG10 was set to RED
Added comment: Single individual with homozygous variant identified in a progressive myoclonus epilepsy cohort.
Sources: Literature
Mendeliome v0.9231 LRRK1 Zornitza Stark Marked gene: LRRK1 as ready
Mendeliome v0.9231 LRRK1 Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence).
Mendeliome v0.9231 LRRK1 Zornitza Stark Classified gene: LRRK1 as Green List (high evidence)
Mendeliome v0.9231 LRRK1 Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence).
Mendeliome v0.9230 LRRK1 Zornitza Stark gene: LRRK1 was added
gene: LRRK1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: LRRK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LRRK1 were set to 27829680; 27055475; 31571209; 32119750
Phenotypes for gene: LRRK1 were set to Osteosclerotic metaphyseal dysplasia (OSMD) (OMIM: 615198)
Review for gene: LRRK1 was set to GREEN
Added comment: At least 4 unrelated families reported.
Sources: Expert Review
Skeletal dysplasia v0.123 LRRK1 Zornitza Stark Marked gene: LRRK1 as ready
Skeletal dysplasia v0.123 LRRK1 Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.123 LRRK1 Zornitza Stark Classified gene: LRRK1 as Green List (high evidence)
Skeletal dysplasia v0.123 LRRK1 Zornitza Stark Gene: lrrk1 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.122 LRRK1 Zornitza Stark gene: LRRK1 was added
gene: LRRK1 was added to Skeletal dysplasia. Sources: Expert Review
Mode of inheritance for gene: LRRK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LRRK1 were set to 27829680; 27055475; 31571209; 32119750
Phenotypes for gene: LRRK1 were set to Osteosclerotic metaphyseal dysplasia (OSMD) (OMIM: 615198)
Review for gene: LRRK1 was set to GREEN
Added comment: At least 4 unrelated families reported.
Sources: Expert Review
Genetic Epilepsy v0.1196 KIF4A Zornitza Stark gene: KIF4A was added
gene: KIF4A was added to Genetic Epilepsy. Sources: Expert Review
Mode of inheritance for gene: KIF4A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: KIF4A were set to 24812067; 34346154
Phenotypes for gene: KIF4A were set to Mental retardation, X-linked 100, MIM# 300923
Review for gene: KIF4A was set to AMBER
Added comment: 12 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several. At least 3 reported as having seizures, though variable severity (including febrile Sz in one).
Sources: Expert Review
Hydrocephalus_Ventriculomegaly v0.96 KIF4A Zornitza Stark Marked gene: KIF4A as ready
Hydrocephalus_Ventriculomegaly v0.96 KIF4A Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence).
Hydrocephalus_Ventriculomegaly v0.96 KIF4A Zornitza Stark Classified gene: KIF4A as Green List (high evidence)
Hydrocephalus_Ventriculomegaly v0.96 KIF4A Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence).
Hydrocephalus_Ventriculomegaly v0.95 KIF4A Zornitza Stark gene: KIF4A was added
gene: KIF4A was added to Hydrocephalus_Ventriculomegaly. Sources: Expert Review
Mode of inheritance for gene: KIF4A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: KIF4A were set to 24812067; 34346154; 30679815
Phenotypes for gene: KIF4A were set to Mental retardation, X-linked 100, MIM# 300923
Review for gene: KIF4A was set to GREEN
Added comment: 12 families reported. Severe hydrocephalus present in at least 3.
Sources: Expert Review
Mendeliome v0.9229 KIF4A Zornitza Stark Publications for gene: KIF4A were set to 24812067
Mendeliome v0.9228 KIF4A Zornitza Stark Classified gene: KIF4A as Green List (high evidence)
Mendeliome v0.9228 KIF4A Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4133 KIF4A Zornitza Stark Publications for gene: KIF4A were set to 24812067; 34346154
Intellectual disability syndromic and non-syndromic v0.4133 KIF4A Zornitza Stark Publications for gene: KIF4A were set to 24812067
Mendeliome v0.9227 KIF4A Zornitza Stark edited their review of gene: KIF4A: Added comment: Further 11 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several.; Changed rating: GREEN; Changed publications: 24812067, 34346154
Intellectual disability syndromic and non-syndromic v0.4132 KIF4A Zornitza Stark Classified gene: KIF4A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4132 KIF4A Zornitza Stark Gene: kif4a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4131 KIF4A Zornitza Stark edited their review of gene: KIF4A: Added comment: Further 11 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several.; Changed rating: GREEN; Changed publications: 24812067, 34346154
Mendeliome v0.9227 HNRNPH1 Zornitza Stark Marked gene: HNRNPH1 as ready
Mendeliome v0.9227 HNRNPH1 Zornitza Stark Gene: hnrnph1 has been classified as Green List (High Evidence).
Mendeliome v0.9227 HNRNPH1 Zornitza Stark Classified gene: HNRNPH1 as Green List (high evidence)
Mendeliome v0.9227 HNRNPH1 Zornitza Stark Gene: hnrnph1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.138 PAK3 Zornitza Stark Marked gene: PAK3 as ready
Cerebral Palsy v0.138 PAK3 Zornitza Stark Gene: pak3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.138 PAK3 Zornitza Stark Phenotypes for gene: PAK3 were changed from to Intellectual developmental disorder, X-linked 30, MIM# 300558
Cerebral Palsy v0.137 PAK3 Zornitza Stark Publications for gene: PAK3 were set to
Cerebral Palsy v0.136 PAK3 Zornitza Stark Mode of inheritance for gene: PAK3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Cerebral Palsy v0.135 PAK3 Zornitza Stark Classified gene: PAK3 as Red List (low evidence)
Cerebral Palsy v0.135 PAK3 Zornitza Stark Gene: pak3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.134 PAK3 Zornitza Stark reviewed gene: PAK3: Rating: RED; Mode of pathogenicity: None; Publications: 25666757; Phenotypes: Intellectual developmental disorder, X-linked 30, MIM# 300558; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Cerebral Palsy v0.134 SLC2A1 Zornitza Stark Marked gene: SLC2A1 as ready
Cerebral Palsy v0.134 SLC2A1 Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.134 SLC2A1 Zornitza Stark Classified gene: SLC2A1 as Green List (high evidence)
Cerebral Palsy v0.134 SLC2A1 Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.133 SLC2A1 Zornitza Stark gene: SLC2A1 was added
gene: SLC2A1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: SLC2A1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: SLC2A1 were set to 30799092; 18451999; 20129935; 10980529; 20221955; 31196579
Phenotypes for gene: SLC2A1 were set to GLUT1 deficiency syndrome 1, infantile onset, severe, 606777; GLUT1 deficiency syndrome 2, childhood onset, 612126; Disorders of glucose transport
Review for gene: SLC2A1 was set to GREEN
Added comment: Well established gene-disease association. Mixture of ID and movement disorders, reported in a CP cohort. Treatable.
Sources: Expert list
Mendeliome v0.9226 IRGM Zornitza Stark Marked gene: IRGM as ready
Mendeliome v0.9226 IRGM Zornitza Stark Gene: irgm has been classified as Red List (Low Evidence).
Mendeliome v0.9226 IRGM Zornitza Stark Phenotypes for gene: IRGM were changed from to {Inflammatory bowel disease (Crohn disease) 19} MIM#612278
Mendeliome v0.9225 IRGM Zornitza Stark Publications for gene: IRGM were set to
Mendeliome v0.9224 IRGM Zornitza Stark Classified gene: IRGM as Red List (low evidence)
Mendeliome v0.9224 IRGM Zornitza Stark Gene: irgm has been classified as Red List (Low Evidence).
Mendeliome v0.9223 UTP4 Zornitza Stark Marked gene: UTP4 as ready
Mendeliome v0.9223 UTP4 Zornitza Stark Gene: utp4 has been classified as Red List (Low Evidence).
Mendeliome v0.9223 UTP4 Zornitza Stark Phenotypes for gene: UTP4 were changed from to North American Indian childhood cirrhosis
Mendeliome v0.9222 UTP4 Zornitza Stark Publications for gene: UTP4 were set to
Mendeliome v0.9221 UTP4 Zornitza Stark Mode of inheritance for gene: UTP4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9220 UTP4 Zornitza Stark Classified gene: UTP4 as Red List (low evidence)
Mendeliome v0.9220 UTP4 Zornitza Stark Gene: utp4 has been classified as Red List (Low Evidence).
Mendeliome v0.9219 UTP4 Zornitza Stark Tag refuted tag was added to gene: UTP4.
Mendeliome v0.9219 UTP4 Zornitza Stark reviewed gene: UTP4: Rating: RED; Mode of pathogenicity: None; Publications: 12417987, 27535533; Phenotypes: North American Indian childhood cirrhosis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4131 FAM149B1 Zornitza Stark Marked gene: FAM149B1 as ready
Intellectual disability syndromic and non-syndromic v0.4131 FAM149B1 Zornitza Stark Gene: fam149b1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4131 FAM149B1 Zornitza Stark Classified gene: FAM149B1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4131 FAM149B1 Zornitza Stark Gene: fam149b1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.132 SCN1A Zornitza Stark Marked gene: SCN1A as ready
Cerebral Palsy v0.132 SCN1A Zornitza Stark Gene: scn1a has been classified as Green List (High Evidence).
Cerebral Palsy v0.132 SCN1A Zornitza Stark Classified gene: SCN1A as Green List (high evidence)
Cerebral Palsy v0.132 SCN1A Zornitza Stark Gene: scn1a has been classified as Green List (High Evidence).
Cerebral Palsy v0.131 PURA Zornitza Stark Marked gene: PURA as ready
Cerebral Palsy v0.131 PURA Zornitza Stark Gene: pura has been classified as Green List (High Evidence).
Cerebral Palsy v0.131 PURA Zornitza Stark Classified gene: PURA as Green List (high evidence)
Cerebral Palsy v0.131 PURA Zornitza Stark Gene: pura has been classified as Green List (High Evidence).
Cerebral Palsy v0.130 HECW2 Zornitza Stark Marked gene: HECW2 as ready
Cerebral Palsy v0.130 HECW2 Zornitza Stark Gene: hecw2 has been classified as Green List (High Evidence).
Mendeliome v0.9219 IRGM Paul De Fazio reviewed gene: IRGM: Rating: RED; Mode of pathogenicity: None; Publications: 17554261, 19299395, 18985712, 20106866, 21278745, 20360734; Phenotypes: {Inflammatory bowel disease (Crohn disease) 19} MIM#612278; Mode of inheritance: Unknown; Current diagnostic: yes
Cerebral Palsy v0.130 HECW2 Zornitza Stark Classified gene: HECW2 as Green List (high evidence)
Cerebral Palsy v0.130 HECW2 Zornitza Stark Gene: hecw2 has been classified as Green List (High Evidence).
Mendeliome v0.9219 UTP4 Michelle Torres reviewed gene: UTP4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4130 FAM149B1 Michelle Torres gene: FAM149B1 was added
gene: FAM149B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FAM149B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM149B1 were set to 30905400
Phenotypes for gene: FAM149B1 were set to Joubert; Ciliopathy
Review for gene: FAM149B1 was set to GREEN
gene: FAM149B1 was marked as current diagnostic
Added comment: Four unrelated, but consanguineous, families reported with 2 truncating variants. Developmental delay with hypotonia and intellectual disability are typical features, and many children have characteristic facies.
Sources: Literature
Cerebral Palsy v0.129 SCN1A Clare van Eyk gene: SCN1A was added
gene: SCN1A was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: SCN1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SCN1A were set to PMID: 33528536; PMID: 34364746; PMID: 34114234
Phenotypes for gene: SCN1A were set to Developmental and epileptic encephalopathy 6B, non-Dravet (OMIM 619317); Dravet syndrome (OMIM 607208)
Review for gene: SCN1A was set to GREEN
Added comment: Six cases described with missense (3 cases) or loss of function (3 cases) variants in SCN1A in individuals diagnosed with cerebral palsy. Mutations in SCN1A cause a spectrum of early-onset epileptic encephalopathies, with some cases reported to have movement disorders clinically overlapping with cerebral palsy.
Sources: Literature
Cerebral Palsy v0.129 PURA Clare van Eyk gene: PURA was added
gene: PURA was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: PURA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PURA were set to PMID: 34077496
Phenotypes for gene: PURA were set to Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158)
Review for gene: PURA was set to GREEN
Added comment: PURA loss of function and missense variants cause a clinically variable neurodevelopmental disorder with movement disorders including dystonia and limb spasticity described in some individuals. One case with a novel frameshift deletion described with dyskinetic cerebral palsy and intellectual disability. An additional 3 cases with de novo variants (1 nonsense, 2 missense) reported in a retrospective analysis of a Clinical Laboratory referral cohort with cerebral palsy.
Sources: Literature
Cerebral Palsy v0.129 HECW2 Danielle Ariti gene: HECW2 was added
gene: HECW2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: HECW2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HECW2 were set to 33528536; 33098801
Phenotypes for gene: HECW2 were set to Cerebral Palsy; Neurodevelopmental disorder with hypotonia, seizures, and absent language MIM# 617268
Review for gene: HECW2 was set to GREEN
Added comment: 3 individuals in CP cohort with mono-allelic (2x de novo & 1 unknown inheritance) HECW2 variants. All individuals were diagnosed with idiopathic dystonic CP.

HECW2 variants cause a neurodevelopmental disorder NDHSAL that presents with severe developmental delay, absent speech, epilepsy, encephalopathy, hypotonia, dystonia/dyskinesia, and macrocephaly.
Sources: Expert list
Repeat Disorders v0.148 FRA7A Bryony Thompson Classified STR: FRA7A as Amber List (moderate evidence)
Repeat Disorders v0.148 FRA7A Bryony Thompson Str: fra7a has been classified as Amber List (Moderate Evidence).
Limb and Digital Malformations SuperPanel v0.2 Bryony Thompson Changed child panels to: Radial Ray Abnormalities; Polydactyly; Hand and foot malformations
Cerebral Palsy v0.129 SHANK3 Zornitza Stark Marked gene: SHANK3 as ready
Cerebral Palsy v0.129 SHANK3 Zornitza Stark Gene: shank3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.129 SHANK3 Zornitza Stark gene: SHANK3 was added
gene: SHANK3 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: SHANK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHANK3 were set to 17173049
Phenotypes for gene: SHANK3 were set to Phelan-McDermid syndrome, MIM# 606232
Review for gene: SHANK3 was set to RED
Added comment: Note deletions are common. ID with severe speech impairment/autistic features but movement disorders are not prominent, so limited overlap clinically with CP.
Sources: Expert list
Cerebral Palsy v0.128 PIGN Zornitza Stark Marked gene: PIGN as ready
Cerebral Palsy v0.128 PIGN Zornitza Stark Gene: pign has been classified as Green List (High Evidence).
Cerebral Palsy v0.128 PIGN Zornitza Stark Classified gene: PIGN as Green List (high evidence)
Cerebral Palsy v0.128 PIGN Zornitza Stark Gene: pign has been classified as Green List (High Evidence).
Cerebral Palsy v0.127 PCDH19 Zornitza Stark Marked gene: PCDH19 as ready
Cerebral Palsy v0.127 PCDH19 Zornitza Stark Gene: pcdh19 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.127 PCDH19 Zornitza Stark Classified gene: PCDH19 as Red List (low evidence)
Cerebral Palsy v0.127 PCDH19 Zornitza Stark Gene: pcdh19 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.126 PCDH12 Zornitza Stark Marked gene: PCDH12 as ready
Cerebral Palsy v0.126 PCDH12 Zornitza Stark Gene: pcdh12 has been classified as Green List (High Evidence).
Cerebral Palsy v0.126 PCDH12 Zornitza Stark Classified gene: PCDH12 as Green List (high evidence)
Cerebral Palsy v0.126 PCDH12 Zornitza Stark Gene: pcdh12 has been classified as Green List (High Evidence).
Cerebral Palsy v0.125 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Cerebral Palsy v0.125 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Cerebral Palsy v0.125 GRIN2B Zornitza Stark Classified gene: GRIN2B as Green List (high evidence)
Cerebral Palsy v0.125 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Cerebral Palsy v0.124 GNAO1 Zornitza Stark Marked gene: GNAO1 as ready
Cerebral Palsy v0.124 GNAO1 Zornitza Stark Gene: gnao1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.124 GNAO1 Zornitza Stark Classified gene: GNAO1 as Green List (high evidence)
Cerebral Palsy v0.124 GNAO1 Zornitza Stark Gene: gnao1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.123 FOXG1 Zornitza Stark Marked gene: FOXG1 as ready
Cerebral Palsy v0.123 FOXG1 Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.123 FOXG1 Zornitza Stark Classified gene: FOXG1 as Green List (high evidence)
Cerebral Palsy v0.123 FOXG1 Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.122 GNB1 Zornitza Stark Marked gene: GNB1 as ready
Cerebral Palsy v0.122 GNB1 Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.122 GNB1 Zornitza Stark Classified gene: GNB1 as Green List (high evidence)
Cerebral Palsy v0.122 GNB1 Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence).
Limb and Digital Malformations SuperPanel v0.0 Bryony Thompson Added Panel Limb and Digital Malformations SuperPanel
Set child panels to: Polydactyly; Hand and foot malformations
Set panel types to: Superpanel; Royal Melbourne Hospital; Rare Disease
Hand and foot malformations v0.55 Bryony Thompson Panel name changed from Hand and foot malformation to Hand and foot malformations
Panel status changed from internal to public
Hand and foot malformations v0.54 WNT3 Bryony Thompson Marked gene: WNT3 as ready
Hand and foot malformations v0.54 WNT3 Bryony Thompson Gene: wnt3 has been classified as Red List (Low Evidence).
Hand and foot malformations v0.54 WNT3 Bryony Thompson Publications for gene: WNT3 were set to
Hand and foot malformations v0.53 TGDS Bryony Thompson Marked gene: TGDS as ready
Hand and foot malformations v0.53 TGDS Bryony Thompson Gene: tgds has been classified as Green List (High Evidence).
Hand and foot malformations v0.53 TGDS Bryony Thompson Publications for gene: TGDS were set to
Hand and foot malformations v0.52 TGDS Bryony Thompson Classified gene: TGDS as Green List (high evidence)
Hand and foot malformations v0.52 TGDS Bryony Thompson Gene: tgds has been classified as Green List (High Evidence).
Hand and foot malformations v0.51 TGDS Bryony Thompson reviewed gene: TGDS: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480037; Phenotypes: Catel-Manzke syndrome MIM#616145; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hand and foot malformations v0.51 SMARCE1 Bryony Thompson Marked gene: SMARCE1 as ready
Hand and foot malformations v0.51 SMARCE1 Bryony Thompson Gene: smarce1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.51 SMARCE1 Bryony Thompson Publications for gene: SMARCE1 were set to
Hand and foot malformations v0.50 SMARCE1 Bryony Thompson Classified gene: SMARCE1 as Green List (high evidence)
Hand and foot malformations v0.50 SMARCE1 Bryony Thompson Gene: smarce1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.49 SMARCE1 Bryony Thompson edited their review of gene: SMARCE1: Set current diagnostic: yes
Hand and foot malformations v0.49 SMARCE1 Bryony Thompson reviewed gene: SMARCE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 25169878, 34205270; Phenotypes: Coffin-Siris syndrome 5 MIM#616938; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.121 GRIN2B Danielle Ariti gene: GRIN2B was added
gene: GRIN2B was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: GRIN2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GRIN2B were set to 34531397; 33528536
Phenotypes for gene: GRIN2B were set to Cerebral Palsy; Developmental and epileptic encephalopathy 27 MIM# 616139; Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM# 613970
Review for gene: GRIN2B was set to GREEN
Added comment: 3 individuals in CP cohort with mono-allelic (2x de novo & 1 unknown inheritance) GRIN2B variants.

GRIN2B variants cause autosomal dominant neurodevelopmental disorders DEE27 and MRD6 that present with intellectual disability, seizures, hypotonia, movement disorders, and autistic features.
Sources: Expert list
Cerebral Palsy v0.121 GNB1 Danielle Ariti gene: GNB1 was added
gene: GNB1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: GNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GNB1 were set to 33528536; 32989326; 34531397; 30194818
Phenotypes for gene: GNB1 were set to Cerebral Palsy; Mental retardation, autosomal dominant 42 MIM# 616973
Review for gene: GNB1 was set to GREEN
Added comment: 4 individuals in CP cohort reported with mono-allelic (3x de novo & 1x unknown inheritance) GNB1 variants. All individuals presented with impaired movement (dystonia, spasticity) and ID; additional features were growth delay, ADHD and seizures.

Additionally, all individuals had substitution affecting the p.Ile80 residue in exon 6 (28% of MRD42 cases carry variants at this residue and tend to present with Dystonia and growth delay more frequently than other residue-variant cases)
Sources: Expert list
Hand and foot malformations v0.49 SMARCB1 Bryony Thompson Marked gene: SMARCB1 as ready
Hand and foot malformations v0.49 SMARCB1 Bryony Thompson Gene: smarcb1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.49 SMARCB1 Bryony Thompson Publications for gene: SMARCB1 were set to
Hand and foot malformations v0.48 SMARCB1 Bryony Thompson Classified gene: SMARCB1 as Green List (high evidence)
Hand and foot malformations v0.48 SMARCB1 Bryony Thompson Gene: smarcb1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.47 SMARCB1 Bryony Thompson reviewed gene: SMARCB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 25169878; Phenotypes: Coffin-Siris syndrome 3 MIM#614608; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Hand and foot malformations v0.47 SMARCA4 Bryony Thompson Marked gene: SMARCA4 as ready
Hand and foot malformations v0.47 SMARCA4 Bryony Thompson Gene: smarca4 has been classified as Green List (High Evidence).
Hand and foot malformations v0.47 SMARCA4 Bryony Thompson Publications for gene: SMARCA4 were set to
Hand and foot malformations v0.46 SMARCA4 Bryony Thompson Classified gene: SMARCA4 as Green List (high evidence)
Hand and foot malformations v0.46 SMARCA4 Bryony Thompson Gene: smarca4 has been classified as Green List (High Evidence).
Hand and foot malformations v0.45 SMARCA4 Bryony Thompson reviewed gene: SMARCA4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308; Phenotypes: Coffin-Siris syndrome 4 MIM#614609; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Hand and foot malformations v0.45 SMARCA2 Bryony Thompson Marked gene: SMARCA2 as ready
Hand and foot malformations v0.45 SMARCA2 Bryony Thompson Gene: smarca2 has been classified as Green List (High Evidence).
Hand and foot malformations v0.45 SMARCA2 Bryony Thompson Mode of pathogenicity for gene: SMARCA2 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Hand and foot malformations v0.44 SMARCA2 Bryony Thompson Publications for gene: SMARCA2 were set to
Hand and foot malformations v0.43 SMARCA2 Bryony Thompson Classified gene: SMARCA2 as Green List (high evidence)
Hand and foot malformations v0.43 SMARCA2 Bryony Thompson Gene: smarca2 has been classified as Green List (High Evidence).
Hand and foot malformations v0.42 RAD21 Bryony Thompson Marked gene: RAD21 as ready
Hand and foot malformations v0.42 RAD21 Bryony Thompson Gene: rad21 has been classified as Green List (High Evidence).
Hand and foot malformations v0.42 RAD21 Bryony Thompson Classified gene: RAD21 as Green List (high evidence)
Hand and foot malformations v0.42 RAD21 Bryony Thompson Gene: rad21 has been classified as Green List (High Evidence).
Hand and foot malformations v0.41 RAD21 Bryony Thompson Publications for gene: RAD21 were set to
Hand and foot malformations v0.40 PHF6 Bryony Thompson Marked gene: PHF6 as ready
Hand and foot malformations v0.40 PHF6 Bryony Thompson Gene: phf6 has been classified as Green List (High Evidence).
Hand and foot malformations v0.40 PHF6 Bryony Thompson Publications for gene: PHF6 were set to
Hand and foot malformations v0.39 PHF6 Bryony Thompson Mode of inheritance for gene: PHF6 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Hand and foot malformations v0.38 PHF6 Bryony Thompson Classified gene: PHF6 as Green List (high evidence)
Hand and foot malformations v0.38 PHF6 Bryony Thompson Gene: phf6 has been classified as Green List (High Evidence).
Hand and foot malformations v0.37 PHF6 Bryony Thompson edited their review of gene: PHF6: Changed rating: GREEN; Set current diagnostic: yes
Hand and foot malformations v0.37 PHF6 Bryony Thompson reviewed gene: PHF6: Rating: ; Mode of pathogenicity: None; Publications: 19161141, 24092917, 12415272; Phenotypes: Borjeson-Forssman-Lehmann syndrome MIM#301900; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Cerebral Palsy v0.121 GNAO1 Danielle Ariti gene: GNAO1 was added
gene: GNAO1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: GNAO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GNAO1 were set to 33528536; 34364746; 33098801
Phenotypes for gene: GNAO1 were set to Cerebral Palsy; Neurodevelopmental disorder with involuntary movements MIM# 617493
Review for gene: GNAO1 was set to GREEN
Added comment: >10 individuals in CP cohort reported with mono-allelic (de novo) GNAO1variants.
The majority of these individuals were diagnosed with Dyskinetic CP displaying progressive movement disorder (dystonia, athetosis and chorea), ID and often seizures.
Sources: Expert list
Hand and foot malformations v0.37 NXN Bryony Thompson Marked gene: NXN as ready
Hand and foot malformations v0.37 NXN Bryony Thompson Gene: nxn has been classified as Green List (High Evidence).
Hand and foot malformations v0.37 NXN Bryony Thompson Publications for gene: NXN were set to
Hand and foot malformations v0.36 NXN Bryony Thompson Classified gene: NXN as Green List (high evidence)
Hand and foot malformations v0.36 NXN Bryony Thompson Gene: nxn has been classified as Green List (High Evidence).
Hand and foot malformations v0.35 LTBP2 Bryony Thompson Marked gene: LTBP2 as ready
Hand and foot malformations v0.35 LTBP2 Bryony Thompson Gene: ltbp2 has been classified as Red List (Low Evidence).
Hand and foot malformations v0.35 LTBP2 Bryony Thompson Publications for gene: LTBP2 were set to
Hand and foot malformations v0.34 LTBP2 Bryony Thompson reviewed gene: LTBP2: Rating: RED; Mode of pathogenicity: None; Publications: 22539340; Phenotypes: Weill-Marchesani syndrome 3, recessive MIM#614819; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hand and foot malformations v0.34 KMT2A Bryony Thompson Marked gene: KMT2A as ready
Hand and foot malformations v0.34 KMT2A Bryony Thompson Gene: kmt2a has been classified as Green List (High Evidence).
Hand and foot malformations v0.34 KMT2A Bryony Thompson Publications for gene: KMT2A were set to
Hand and foot malformations v0.33 KMT2A Bryony Thompson Classified gene: KMT2A as Green List (high evidence)
Hand and foot malformations v0.33 KMT2A Bryony Thompson Gene: kmt2a has been classified as Green List (High Evidence).
Hand and foot malformations v0.32 KMT2A Bryony Thompson reviewed gene: KMT2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22795537, 24886118; Phenotypes: Wiedemann-Steiner syndrome MIM#605130; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Hand and foot malformations v0.32 KDM6A Bryony Thompson Marked gene: KDM6A as ready
Hand and foot malformations v0.32 KDM6A Bryony Thompson Gene: kdm6a has been classified as Green List (High Evidence).
Hand and foot malformations v0.32 KDM6A Bryony Thompson Publications for gene: KDM6A were set to
Hand and foot malformations v0.31 KDM6A Bryony Thompson Classified gene: KDM6A as Green List (high evidence)
Hand and foot malformations v0.31 KDM6A Bryony Thompson Gene: kdm6a has been classified as Green List (High Evidence).
Hand and foot malformations v0.30 KDM6A Bryony Thompson reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33674768; Phenotypes: Kabuki syndrome 2 MIM#300867, brachydactyly, clinodactyly; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Cerebral Palsy v0.121 FOXG1 Danielle Ariti gene: FOXG1 was added
gene: FOXG1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: FOXG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOXG1 were set to 34077496; 33528536
Phenotypes for gene: FOXG1 were set to Cerebral Palsy; Rett syndrome, congenital variant MIM# 613454
Review for gene: FOXG1 was set to GREEN
Added comment: 5 individuals in CP cohort reported with mono-allelic (de novo) FOXG1 variants.
All individuals presented with movement impairments (3 with Spastic quadriplegia), intellectual disability, and microcephaly (and 2 individuals with seizures).
Sources: Expert list
Mendeliome v0.9219 FMN1 Bryony Thompson Marked gene: FMN1 as ready
Mendeliome v0.9219 FMN1 Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence).
Hand and foot malformations v0.30 IFT57 Bryony Thompson Marked gene: IFT57 as ready
Hand and foot malformations v0.30 IFT57 Bryony Thompson Gene: ift57 has been classified as Red List (Low Evidence).
Hand and foot malformations v0.30 IFT57 Bryony Thompson Publications for gene: IFT57 were set to
Lymphoedema v0.11 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Hand and foot malformations v0.29 HDAC4 Bryony Thompson Tag SV/CNV tag was added to gene: HDAC4.
Hand and foot malformations v0.29 HDAC4 Bryony Thompson Publications for gene: HDAC4 were set to
Hand and foot malformations v0.28 HDAC4 Bryony Thompson Classified gene: HDAC4 as Amber List (moderate evidence)
Hand and foot malformations v0.28 HDAC4 Bryony Thompson Gene: hdac4 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9219 FMN1 Bryony Thompson Classified gene: FMN1 as Amber List (moderate evidence)
Mendeliome v0.9219 FMN1 Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9218 FMN1 Bryony Thompson gene: FMN1 was added
gene: FMN1 was added to Mendeliome. Sources: Literature
SV/CNV tags were added to gene: FMN1.
Mode of inheritance for gene: FMN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FMN1 were set to 20610440; 19383632; 15202026
Phenotypes for gene: FMN1 were set to oligosyndactyly; radioulnar synostosis; hearing loss; renal defects
Review for gene: FMN1 was set to AMBER
Added comment: A 263 Kb homozygous deletion of FMN1 has been identified in a single case with oligosyndactyly, radioulnar synostosis, hearing loss and renal defects. Also, a supporting null mouse model with oligosyndactyly. Also, a large duplication including GREM1 reported in association with Cenani–Lenz syndrome.
Sources: Literature
Hand and foot malformations v0.27 FMN1 Bryony Thompson Marked gene: FMN1 as ready
Hand and foot malformations v0.27 FMN1 Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence).
Hand and foot malformations v0.27 FMN1 Bryony Thompson Phenotypes for gene: FMN1 were changed from to oligosyndactyly; radioulnar synostosis; hearing loss; renal defects
Hand and foot malformations v0.26 FMN1 Bryony Thompson Publications for gene: FMN1 were set to
Hand and foot malformations v0.25 FMN1 Bryony Thompson Mode of inheritance for gene: FMN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Hand and foot malformations v0.24 FMN1 Bryony Thompson Classified gene: FMN1 as Amber List (moderate evidence)
Hand and foot malformations v0.24 FMN1 Bryony Thompson Gene: fmn1 has been classified as Amber List (Moderate Evidence).
Hand and foot malformations v0.23 FMN1 Bryony Thompson Tag SV/CNV tag was added to gene: FMN1.
Hand and foot malformations v0.23 FMN1 Bryony Thompson reviewed gene: FMN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 20610440, 19383632, 15202026; Phenotypes: oligosyndactyly, radioulnar synostosis, hearing loss, renal defects; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9217 LBX1 Zornitza Stark Marked gene: LBX1 as ready
Mendeliome v0.9217 LBX1 Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9217 LBX1 Zornitza Stark Classified gene: LBX1 as Amber List (moderate evidence)
Mendeliome v0.9217 LBX1 Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9216 LBX1 Zornitza Stark gene: LBX1 was added
gene: LBX1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: LBX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LBX1 were set to 30487221
Phenotypes for gene: LBX1 were set to Central hypoventilation syndrome, congenital, 3, MIM#619483
Review for gene: LBX1 was set to AMBER
Added comment: Two siblings reported with homozygous LoF variant in this gene, supportive mouse model.
Sources: Expert Review
Central Hypoventilation v1.3 LBX1 Zornitza Stark Marked gene: LBX1 as ready
Central Hypoventilation v1.3 LBX1 Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence).
Central Hypoventilation v1.3 LBX1 Zornitza Stark Classified gene: LBX1 as Amber List (moderate evidence)
Central Hypoventilation v1.3 LBX1 Zornitza Stark Gene: lbx1 has been classified as Amber List (Moderate Evidence).
Central Hypoventilation v1.2 LBX1 Zornitza Stark gene: LBX1 was added
gene: LBX1 was added to Central Hypoventilation. Sources: Expert Review
Mode of inheritance for gene: LBX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LBX1 were set to 30487221
Phenotypes for gene: LBX1 were set to Central hypoventilation syndrome, congenital, 3, MIM#619483
Review for gene: LBX1 was set to AMBER
Added comment: Two siblings reported with homozygous LoF variant in this gene, supportive mouse model.
Sources: Expert Review
Mendeliome v0.9215 FBXW4 Bryony Thompson Phenotypes for gene: FBXW4 were changed from to Split-hand/foot malformation 3 syndrome MIM#246560
Mendeliome v0.9214 B9D1 Bryony Thompson Publications for gene: B9D1 were set to 24886560; 21493627; 25920555
Mendeliome v0.9213 FBXW4 Bryony Thompson Publications for gene: FBXW4 were set to
Mendeliome v0.9212 FBXW4 Bryony Thompson Classified gene: FBXW4 as Red List (low evidence)
Mendeliome v0.9212 FBXW4 Bryony Thompson Gene: fbxw4 has been classified as Red List (Low Evidence).
Mendeliome v0.9211 FBXW4 Bryony Thompson reviewed gene: FBXW4: Rating: RED; Mode of pathogenicity: None; Publications: 12913067, 16235095, 27600068; Phenotypes: Split-hand/foot malformation 3 syndrome MIM#246560; Mode of inheritance: None
Hand and foot malformations v0.23 FBXW4 Bryony Thompson Marked gene: FBXW4 as ready
Hand and foot malformations v0.23 FBXW4 Bryony Thompson Gene: fbxw4 has been classified as Red List (Low Evidence).
Hand and foot malformations v0.23 FBXW4 Bryony Thompson Publications for gene: FBXW4 were set to
Hand and foot malformations v0.22 FBXW4 Bryony Thompson reviewed gene: FBXW4: Rating: RED; Mode of pathogenicity: None; Publications: 12913067, 16235095, 27600068; Phenotypes: Split-hand/foot malformation (SHFM); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hand and foot malformations v0.22 FBLN1 Bryony Thompson Publications for gene: FBLN1 were set to
Hand and foot malformations v0.21 FBLN1 Bryony Thompson Marked gene: FBLN1 as ready
Hand and foot malformations v0.21 FBLN1 Bryony Thompson Gene: fbln1 has been classified as Red List (Low Evidence).
Hand and foot malformations v0.21 FAT1 Bryony Thompson Marked gene: FAT1 as ready
Hand and foot malformations v0.21 FAT1 Bryony Thompson Gene: fat1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.21 FAT1 Bryony Thompson Phenotypes for gene: FAT1 were changed from to facial dysmorphism; colobomatous microphthalmia; ptosis; syndactyly with or without nephropathy
Hand and foot malformations v0.20 FAT1 Bryony Thompson Publications for gene: FAT1 were set to
Hand and foot malformations v0.19 FAT1 Bryony Thompson Mode of inheritance for gene: FAT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Hand and foot malformations v0.18 FAT1 Bryony Thompson Classified gene: FAT1 as Green List (high evidence)
Hand and foot malformations v0.18 FAT1 Bryony Thompson Gene: fat1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.17 EP300 Bryony Thompson Marked gene: EP300 as ready
Hand and foot malformations v0.17 EP300 Bryony Thompson Gene: ep300 has been classified as Green List (High Evidence).
Hand and foot malformations v0.17 EP300 Bryony Thompson Classified gene: EP300 as Green List (high evidence)
Hand and foot malformations v0.17 EP300 Bryony Thompson Added comment: Comment on list classification: Limb anomalies are a feature of Rubinstein-Taybi syndrome
Hand and foot malformations v0.17 EP300 Bryony Thompson Gene: ep300 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.192 IMPDH2 Arina Puzriakova reviewed gene: IMPDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34305140; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Cerebral Palsy v0.121 PIGN Clare van Eyk changed review comment from: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype.An additional case with a homozygous missense variant in PIGN was described to have atypical cerebral palsy with multiple other anomalies.; to: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype. An additional case with a homozygous missense variant in PIGN was described to have atypical cerebral palsy with multiple other anomalies.
Cerebral Palsy v0.121 PIGN Clare van Eyk Deleted their comment
Cerebral Palsy v0.121 PIGN Clare van Eyk edited their review of gene: PIGN: Added comment: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype.An additional case with a homozygous missense variant in PIGN was described to have atypical cerebral palsy with multiple other anomalies.; Changed rating: GREEN; Changed publications: PMID: 33528536, PMID: 34540776
Cerebral Palsy v0.121 PIGN Clare van Eyk gene: PIGN was added
gene: PIGN was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: PIGN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGN were set to PMID: 33528536
Phenotypes for gene: PIGN were set to Multiple congenital anomalies-hypotonia-seizures syndrome 1 (OMIM 614080)
Review for gene: PIGN was set to AMBER
Added comment: Two cases with compound heterozygous missense variants in PIGN were identified in a retrospective reanalysis of a large Clinical Laboratory referral cohort with cerebral palsy. Limb hypertonia and spasticity have been described in some children with Multiple congenital anomalies-hypotonia-seizures syndrome 1. Most children with Multiple congenital anomalies-hypotonia-seizures syndrome 1 die before 3 years of age, however missense variants have been reported to cause a less severe clinical phenotype.
Sources: Literature
Cerebral Palsy v0.121 PCDH19 Clare van Eyk changed review comment from: Variants in PCDH19 cause an X-linked disorder which affects heterozygous females, with hemizygous males largely unaffected. One male with spastic diplegic cerebral palsy described with a hemizygous predicted pathogenic variant.
Sources: Literature; to: Variants in PCDH19 cause an X-linked disorder which affects heterozygous females, with hemizygous males largely unaffected. One male with spastic diplegic cerebral palsy described with a hemizygous predicted pathogenic variant.
Sources: Literature
Cerebral Palsy v0.121 PCDH19 Clare van Eyk gene: PCDH19 was added
gene: PCDH19 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: PCDH19 was set to Other
Publications for gene: PCDH19 were set to PMID: 34321325
Phenotypes for gene: PCDH19 were set to Developmental and epileptic encephalopathy 9 (OMIM 300088)
Review for gene: PCDH19 was set to RED
Added comment: Variants in PCDH19 cause an X-linked disorder which affects heterozygous females, with hemizygous males largely unaffected. One male with spastic diplegic cerebral palsy described with a hemizygous predicted pathogenic variant.
Sources: Literature
Cerebral Palsy v0.121 PCDH12 Clare van Eyk gene: PCDH12 was added
gene: PCDH12 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: PCDH12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCDH12 were set to PMID: 34321325; PMID: 29556033
Phenotypes for gene: PCDH12 were set to Diencephalic-mesencephalic junction dysplasia syndrome 1 (OMIM 251280)
Review for gene: PCDH12 was set to GREEN
Added comment: One case with homozygous nonsense variant reported with dysmorphic features, dystonic cerebral palsy and comorbidities including intellectual disability. Second individual with compound heterozygous truncating PCDH12 variants diagnosed as dyskinetic cerebral palsy with epilepsy and severe intellectual disability. Biallelic PCDH12 mutations cause a syndromic neurodevelopmental disorder with spasticity or dystonia.
Sources: Literature
Imprinting disorders v0.8 ZFP57 Zornitza Stark Marked gene: ZFP57 as ready
Imprinting disorders v0.8 ZFP57 Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence).
Imprinting disorders v0.8 ZFP57 Zornitza Stark Publications for gene: ZFP57 were set to 18622393; 23150280; 25848000
Imprinting disorders v0.7 MKRN3 Zornitza Stark reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Imprinting disorders v0.7 MKRN3 Zornitza Stark Tag SV/CNV tag was added to gene: MKRN3.
Tag 5'UTR tag was added to gene: MKRN3.
Imprinting disorders v0.7 MKRN3 Zornitza Stark Marked gene: MKRN3 as ready
Imprinting disorders v0.7 MKRN3 Zornitza Stark Gene: mkrn3 has been classified as Green List (High Evidence).
Imprinting disorders v0.7 MKRN3 Zornitza Stark Publications for gene: MKRN3 were set to PMID: 23738509; http://igc.otago.ac.nz/home.html; 30794780
Imprinting disorders v0.6 KCNK9 Zornitza Stark Marked gene: KCNK9 as ready
Imprinting disorders v0.6 KCNK9 Zornitza Stark Gene: kcnk9 has been classified as Green List (High Evidence).
Imprinting disorders v0.6 KCNK9 Zornitza Stark Phenotypes for gene: KCNK9 were changed from Phenotype resulting from under expression: mental retardation, hypotonia, dysmprophism; Affected tissue: brain; Birk-Barel syndrome to Phenotype resulting from under expression: mental retardation, hypotonia, dysmprophism; Affected tissue: brain; Birk-Barel syndrome, MIM# 612292; MONDO:0012856
Imprinting disorders v0.5 KCNK9 Zornitza Stark Publications for gene: KCNK9 were set to http://igc.otago.ac.nz/home.html; PMID: 24667089; 18678320; 30794780
Imprinting disorders v0.4 KCNK9 Zornitza Stark reviewed gene: KCNK9: Rating: GREEN; Mode of pathogenicity: None; Publications: 28333430, 27151206, 24980697, 18678320; Phenotypes: Birk-Barel syndrome, MIM# 612292, MONDO:0012856; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Mendeliome v0.9211 RAF1 Zornitza Stark Marked gene: RAF1 as ready
Mendeliome v0.9211 RAF1 Zornitza Stark Gene: raf1 has been classified as Green List (High Evidence).
Mendeliome v0.9211 RAF1 Zornitza Stark Phenotypes for gene: RAF1 were changed from to Noonan syndrome 5, MIM# 611553; Cardiomyopathy, dilated, 1NN, MIM# 615916
Mendeliome v0.9210 RAF1 Zornitza Stark Publications for gene: RAF1 were set to
Mendeliome v0.9209 RAF1 Zornitza Stark Mode of pathogenicity for gene: RAF1 was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Mendeliome v0.9208 RAF1 Zornitza Stark Mode of inheritance for gene: RAF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9207 RAF1 Zornitza Stark reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 17603483, 17603482, 31145547, 31030682, 29271604, 24777450; Phenotypes: Noonan syndrome 5, MIM# 611553, Cardiomyopathy, dilated, 1NN, MIM# 615916; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cardiomyopathy_Paediatric v0.108 RAF1 Zornitza Stark Marked gene: RAF1 as ready
Cardiomyopathy_Paediatric v0.108 RAF1 Zornitza Stark Gene: raf1 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.108 RAF1 Zornitza Stark Phenotypes for gene: RAF1 were changed from Noonan syndrome 5; Noonan syndrome 5 611553; LEOPARD syndrome 2 611554; syndromic HCM; LEOPARD syndrome 2; LEOPARD syndrome; Noonan syndrome to Cardiomyopathy, dilated, 1NN, MIM# 615916; Noonan syndrome 5, MIM# 611553
Cardiomyopathy_Paediatric v0.107 RAF1 Zornitza Stark Publications for gene: RAF1 were set to 17603482; 17603483
Cardiomyopathy_Paediatric v0.106 RAF1 Zornitza Stark reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24777450; Phenotypes: Cardiomyopathy, dilated, 1NN, MIM# 615916, Noonan syndrome 5, MIM# 611553; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Differences of Sex Development v0.213 CDKN1C Zornitza Stark Marked gene: CDKN1C as ready
Differences of Sex Development v0.213 CDKN1C Zornitza Stark Gene: cdkn1c has been classified as Green List (High Evidence).
Differences of Sex Development v0.213 CDKN1C Zornitza Stark Phenotypes for gene: CDKN1C were changed from to IMAGe syndrome, MIM# 614732
Differences of Sex Development v0.212 CDKN1C Zornitza Stark Publications for gene: CDKN1C were set to
Differences of Sex Development v0.211 CDKN1C Zornitza Stark Mode of pathogenicity for gene: CDKN1C was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Differences of Sex Development v0.210 CDKN1C Zornitza Stark Mode of inheritance for gene: CDKN1C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Differences of Sex Development v0.209 CDKN1C Zornitza Stark reviewed gene: CDKN1C: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 22634751, 33076988, 31976094, 31497289; Phenotypes: IMAGe syndrome, MIM# 614732; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Mendeliome v0.9207 CDKN1C Zornitza Stark Marked gene: CDKN1C as ready
Mendeliome v0.9207 CDKN1C Zornitza Stark Gene: cdkn1c has been classified as Green List (High Evidence).
Mendeliome v0.9207 CDKN1C Zornitza Stark Phenotypes for gene: CDKN1C were changed from to Beckwith-Wiedemann syndrome, MIM# 130650; IMAGe syndrome, MIM# 614732; Silver-Russell syndrome
Mendeliome v0.9206 CDKN1C Zornitza Stark Publications for gene: CDKN1C were set to
Mendeliome v0.9205 CDKN1C Zornitza Stark Mode of inheritance for gene: CDKN1C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Mendeliome v0.9204 CDKN1C Zornitza Stark reviewed gene: CDKN1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 10424811, 8841187, 22205991, 20503313, 19843502, 15372379, 23511928, 30794780, 33076988, 31976094, 31497289; Phenotypes: Beckwith-Wiedemann syndrome, MIM# 130650, IMAGe syndrome, MIM# 614732, Silver-Russell syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Imprinting disorders v0.4 CDKN1C Zornitza Stark Marked gene: CDKN1C as ready
Imprinting disorders v0.4 CDKN1C Zornitza Stark Gene: cdkn1c has been classified as Green List (High Evidence).
Imprinting disorders v0.4 CDKN1C Zornitza Stark Publications for gene: CDKN1C were set to 10424811; PMID: 8841187; 22205991]; 20503313; 19843502; http://igc.otago.ac.nz/home.html; [15372379; 23511928; 30794780
Imprinting disorders v0.3 CDKN1C Zornitza Stark reviewed gene: CDKN1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 10424811, 8841187, 22205991, 20503313, 19843502, 15372379, 23511928, 30794780, 33076988, 31976094, 31497289; Phenotypes: Beckwith-Wiedemann syndrome, MIM# 130650, IMAGe syndrome, MIM# 614732, Silver-Russell syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Hand and foot malformations v0.16 DYNC1I1 Bryony Thompson Marked gene: DYNC1I1 as ready
Hand and foot malformations v0.16 DYNC1I1 Bryony Thompson Gene: dync1i1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.16 DYNC1I1 Bryony Thompson Phenotypes for gene: DYNC1I1 were changed from to Split-hand/split-foot malformation (SHFM)
Hand and foot malformations v0.15 DYNC1I1 Bryony Thompson Publications for gene: DYNC1I1 were set to
Hand and foot malformations v0.14 DYNC1I1 Bryony Thompson Mode of inheritance for gene: DYNC1I1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hand and foot malformations v0.13 DYNC1I1 Bryony Thompson Tag SV/CNV tag was added to gene: DYNC1I1.
Hand and foot malformations v0.13 DYNC1I1 Bryony Thompson Classified gene: DYNC1I1 as Green List (high evidence)
Hand and foot malformations v0.13 DYNC1I1 Bryony Thompson Gene: dync1i1 has been classified as Green List (High Evidence).
Hand and foot malformations v0.12 DYNC1I1 Bryony Thompson reviewed gene: DYNC1I1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22914741, 25231166, 32219838; Phenotypes: Split-hand/split-foot malformation (SHFM); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hand and foot malformations v0.12 DPF2 Bryony Thompson Marked gene: DPF2 as ready
Hand and foot malformations v0.12 DPF2 Bryony Thompson Gene: dpf2 has been classified as Green List (High Evidence).
Hand and foot malformations v0.12 DPF2 Bryony Thompson Classified gene: DPF2 as Green List (high evidence)
Hand and foot malformations v0.12 DPF2 Bryony Thompson Gene: dpf2 has been classified as Green List (High Evidence).
Hand and foot malformations v0.11 DPF2 Bryony Thompson reviewed gene: DPF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29429572; Phenotypes: Coffin-Siris syndrome 7 MIM#618027; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Hand and foot malformations v0.11 DLX6 Bryony Thompson Marked gene: DLX6 as ready
Hand and foot malformations v0.11 DLX6 Bryony Thompson Gene: dlx6 has been classified as Red List (Low Evidence).
Hand and foot malformations v0.11 DLX6 Bryony Thompson Phenotypes for gene: DLX6 were changed from Split-hand/foot malformation 1 183600; Split-hand/foot malformation 1 with sensorineural hearing loss 220600 to Split-hand/foot malformation 1 183600
Hand and foot malformations v0.10 DLX6 Bryony Thompson Publications for gene: DLX6 were set to
Hand and foot malformations v0.9 DLX6 Bryony Thompson Mode of inheritance for gene: DLX6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hand and foot malformations v0.8 DLX6 Bryony Thompson reviewed gene: DLX6: Rating: RED; Mode of pathogenicity: None; Publications: 28611547; Phenotypes: Split-hand and foot malformation (SHFM, MIM 183600); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hand and foot malformations v0.8 CHUK Bryony Thompson Marked gene: CHUK as ready
Hand and foot malformations v0.8 CHUK Bryony Thompson Gene: chuk has been classified as Amber List (Moderate Evidence).
Hand and foot malformations v0.8 CHUK Bryony Thompson Publications for gene: CHUK were set to
Hand and foot malformations v0.7 CHUK Bryony Thompson Mode of inheritance for gene: CHUK was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Hand and foot malformations v0.6 CHUK Bryony Thompson Classified gene: CHUK as Amber List (moderate evidence)
Hand and foot malformations v0.6 CHUK Bryony Thompson Gene: chuk has been classified as Amber List (Moderate Evidence).
Hand and foot malformations v0.5 ARHGAP31 Bryony Thompson Marked gene: ARHGAP31 as ready
Hand and foot malformations v0.5 ARHGAP31 Bryony Thompson Gene: arhgap31 has been classified as Green List (High Evidence).
Hand and foot malformations v0.5 ARHGAP31 Bryony Thompson Publications for gene: ARHGAP31 were set to
Hand and foot malformations v0.4 ARHGAP31 Bryony Thompson reviewed gene: ARHGAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 21565291, 24668619, 29924900; Phenotypes: Adams-Oliver syndrome 1 MIM#100300; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9204 B9D1 Bryony Thompson Classified gene: B9D1 as Green List (high evidence)
Mendeliome v0.9204 B9D1 Bryony Thompson Gene: b9d1 has been classified as Green List (High Evidence).
Mendeliome v0.9203 B9D1 Bryony Thompson changed review comment from: hNow N
PMID: 34338422 - compound het missense and frameshift variant in a proband with anal atresia with vestibular fistula, ventricular septal defect, and right renal agenesis (VACTERL cohort)
PMID: 21763481 - B9d1 -/- mouse displayed polydactyly, kidney cysts, ductal plate malformations, and abnormal patterning of the neural tube, concomitant with compromised ciliogenesis, ciliary protein localization, and Hedgehog (Hh) signal transduction.; to: 3 unrelated cases with a syndromic phenotype and a supporting null mouse model
PMID: 34338422 - compound het missense and frameshift variant in a proband with anal atresia with vestibular fistula, ventricular septal defect, and right renal agenesis (VACTERL cohort)
PMID: 24886560 - 2 Joubert syndrome cases
PMID: 21763481 - B9d1 -/- mouse displayed polydactyly, kidney cysts, ductal plate malformations, and abnormal patterning of the neural tube, concomitant with compromised ciliogenesis, ciliary protein localization, and Hedgehog (Hh) signal transduction.
Mendeliome v0.9203 B9D1 Bryony Thompson reviewed gene: B9D1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21763481, 24886560, 34338422; Phenotypes: Meckel syndrome, Joubert syndrome, VACTERL; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9203 LEFTY2 Elena Savva reviewed gene: LEFTY2: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 10518210, 10053005; Phenotypes: Heterotaxy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Hand and foot malformations v0.4 Bryony Thompson removed gene:B9D1 from the panel
Hand and foot malformations v0.1 Bryony Thompson Panel types changed to Royal Melbourne Hospital; Rare Disease
Hand and foot malformations v0.0 WNT5A Bryony Thompson gene: WNT5A was added
gene: WNT5A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WNT5A were set to Robinow syndrome, autosomal dominant 1 180700
Hand and foot malformations v0.0 WNT3 Bryony Thompson gene: WNT3 was added
gene: WNT3 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT3 were set to Tetra-amelia syndrome 273395
Hand and foot malformations v0.0 WNT10B Bryony Thompson gene: WNT10B was added
gene: WNT10B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: WNT10B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT10B were set to Split-hand/foot malformation 6 225300
Hand and foot malformations v0.0 TRPV4 Bryony Thompson gene: TRPV4 was added
gene: TRPV4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: TRPV4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TRPV4 were set to Parastremmatic dwarfism 168400; Metatropic dysplasia 156530; Spinal muscular atrophy, distal, congenital nonprogressive 600175; Scapuloperoneal spinal muscular atrophy 181405; SED, Maroteaux type 184095; Spondylometaphyseal dysplasia, Kozlowski type 184252; Hereditary motor and sensory neuropathy, type IIc 606071; Brachyolmia type 3 113500; Digital arthropathy-brachydactyly, familial 606835
Hand and foot malformations v0.0 TRPS1 Bryony Thompson gene: TRPS1 was added
gene: TRPS1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: TRPS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TRPS1 were set to Trichorhinophalangeal syndrome, type III 190351; Trichorhinophalangeal syndrome, type I 190350
Hand and foot malformations v0.0 TP63 Bryony Thompson gene: TP63 was added
gene: TP63 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: TP63 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TP63 were set to Hay-Wells syndrome 106260; Rapp-Hodgkin syndrome 129400; Limb-mammary syndrome 603543; Split-hand/foot malformation 4 605289; Orofacial cleft 8 129400; ULT syndrome 103285; Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome 3 604292
Hand and foot malformations v0.0 TGDS Bryony Thompson gene: TGDS was added
gene: TGDS was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: TGDS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TGDS were set to Catel-Manzke syndrome 616145
Hand and foot malformations v0.0 TBX15 Bryony Thompson gene: TBX15 was added
gene: TBX15 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: TBX15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TBX15 were set to Cousin syndrome 260660
Hand and foot malformations v0.0 SOX9 Bryony Thompson gene: SOX9 was added
gene: SOX9 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SOX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOX9 were set to Campomelic dysplasia with autosomal sex reversal 114290
Hand and foot malformations v0.0 SOST Bryony Thompson gene: SOST was added
gene: SOST was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SOST was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: SOST were set to Van Buchem disease 239100; Sclerosteosis 1 269500; Craniodiaphyseal dysplasia, autosomal dominant 122860
Hand and foot malformations v0.0 SMC3 Bryony Thompson gene: SMC3 was added
gene: SMC3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SMC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMC3 were set to Cornelia de Lange syndrome 3 610759
Hand and foot malformations v0.0 SMC1A Bryony Thompson gene: SMC1A was added
gene: SMC1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SMC1A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: SMC1A were set to Cornelia de Lange syndrome 2 300590
Hand and foot malformations v0.0 SMARCE1 Bryony Thompson gene: SMARCE1 was added
gene: SMARCE1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: SMARCE1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMARCE1 were set to Coffin-Siris syndrome 5 MIM#616938
Hand and foot malformations v0.0 SMARCB1 Bryony Thompson gene: SMARCB1 was added
gene: SMARCB1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: SMARCB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMARCB1 were set to Coffin-Siris syndrome 3 MIM#614608
Hand and foot malformations v0.0 SMARCA4 Bryony Thompson gene: SMARCA4 was added
gene: SMARCA4 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: SMARCA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMARCA4 were set to Coffin-Siris syndrome 4 MIM#614609
Hand and foot malformations v0.0 SMARCA2 Bryony Thompson gene: SMARCA2 was added
gene: SMARCA2 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: SMARCA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMARCA2 were set to Nicolaides-Baraitser syndrome MIM#601358
Hand and foot malformations v0.0 SMAD4 Bryony Thompson gene: SMAD4 was added
gene: SMAD4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SMAD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD4 were set to Myhre syndrome 139210
Hand and foot malformations v0.0 SF3B4 Bryony Thompson gene: SF3B4 was added
gene: SF3B4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SF3B4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SF3B4 were set to Acrofacial dysostosis 1, Nager type 154400
Hand and foot malformations v0.0 ROR2 Bryony Thompson gene: ROR2 was added
gene: ROR2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ROR2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: ROR2 were set to Robinow syndrome, autosomal recessive 268310; Brachydactyly, type B1 113000
Hand and foot malformations v0.0 RECQL4 Bryony Thompson gene: RECQL4 was added
gene: RECQL4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RECQL4 were set to Rothmund-Thomson syndrome 268400; RAPILINO syndrome 266280; Baller-Gerold syndrome 218600
Hand and foot malformations v0.0 RBPJ Bryony Thompson gene: RBPJ was added
gene: RBPJ was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: RBPJ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RBPJ were set to Adams-Oliver syndrome 3, 614814
Hand and foot malformations v0.0 RBM8A Bryony Thompson gene: RBM8A was added
gene: RBM8A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RBM8A were set to Thrombocytopenia-absent radius syndrome 274000
Hand and foot malformations v0.0 RAD21 Bryony Thompson gene: RAD21 was added
gene: RAD21 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: RAD21 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAD21 were set to Cornelia de Lange syndrome 4 614701
Hand and foot malformations v0.0 PTHLH Bryony Thompson gene: PTHLH was added
gene: PTHLH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PTHLH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTHLH were set to Brachydactyly, type E2 613382
Hand and foot malformations v0.0 PTDSS1 Bryony Thompson gene: PTDSS1 was added
gene: PTDSS1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PTDSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTDSS1 were set to Lenz-Majewski hyperostotic dwarfism 151050
Hand and foot malformations v0.0 PRMT7 Bryony Thompson gene: PRMT7 was added
gene: PRMT7 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PRMT7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRMT7 were set to Short stature, brachydactyly, intellectual developmental disability, and seizures 617157
Hand and foot malformations v0.0 PRKAR1A Bryony Thompson gene: PRKAR1A was added
gene: PRKAR1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PRKAR1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: PRKAR1A were set to Myxoma, intracardiac 255960; Acrodysostosis 1, with or without hormone resistance 101800; Pigmented nodular adrenocortical disease, primary, 1 610489
Hand and foot malformations v0.0 POLR1A Bryony Thompson gene: POLR1A was added
gene: POLR1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: POLR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: POLR1A were set to Acrofacial dysostosis, Cincinnati type 616462
Hand and foot malformations v0.0 PIGV Bryony Thompson gene: PIGV was added
gene: PIGV was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PIGV was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PIGV were set to Hyperphosphatasia with mental retardation syndrome 1 239300
Hand and foot malformations v0.0 PHF6 Bryony Thompson gene: PHF6 was added
gene: PHF6 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: PHF6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHF6 were set to Borjeson-Forssman-Lehmann syndrome MIM#301900
Hand and foot malformations v0.0 PGM3 Bryony Thompson gene: PGM3 was added
gene: PGM3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PGM3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PGM3 were set to Immunodeficiency 23 615816
Hand and foot malformations v0.0 PDE4D Bryony Thompson gene: PDE4D was added
gene: PDE4D was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PDE4D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDE4D were set to Acrodysostosis 2, with or without hormone resistance 614613
Hand and foot malformations v0.0 PDE3A Bryony Thompson gene: PDE3A was added
gene: PDE3A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: PDE3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDE3A were set to Hypertension and brachydactyly syndrome, 112410
Hand and foot malformations v0.0 NXN Bryony Thompson gene: NXN was added
gene: NXN was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: NXN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NXN were set to Robinow syndrome, autosomal recessive 2 MIM#618529
Hand and foot malformations v0.0 NSDHL Bryony Thompson gene: NSDHL was added
gene: NSDHL was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: NSDHL were set to CK syndrome 300831; Congenital hemidysplasia, ichthyosis, limb defects (CHILD) syndrome 308050
Hand and foot malformations v0.0 NOTCH1 Bryony Thompson gene: NOTCH1 was added
gene: NOTCH1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: NOTCH1 were set to Limb, scalp and skull defects; AOS; Adams-Oliver syndrome 5, 616028; Combination of aplasia cutis congenita of the scalp vertex and terminal transverse limb defects (e.g., amputations, syndactyly, brachydactyly, or oligodactyly)
Hand and foot malformations v0.0 NOG Bryony Thompson gene: NOG was added
gene: NOG was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: NOG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOG were set to Stapes ankylosis with broad thumb and toes 184460; Symphalangism, proximal, 1A 185800; Multiple synostoses syndrome 1 186500; Tarsal-carpal coalition syndrome 186570; Brachydactyly, type B2 611377
Hand and foot malformations v0.0 NIPBL Bryony Thompson gene: NIPBL was added
gene: NIPBL was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome 1 122470
Hand and foot malformations v0.0 NECTIN4 Bryony Thompson gene: NECTIN4 was added
gene: NECTIN4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: NECTIN4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NECTIN4 were set to Ectodermal dysplasia-syndactyly syndrome 1 MIM#613573
Hand and foot malformations v0.0 NECTIN1 Bryony Thompson gene: NECTIN1 was added
gene: NECTIN1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: NECTIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NECTIN1 were set to Cleft lip/palate-ectodermal dysplasia syndrome MIM#225060
Hand and foot malformations v0.0 MYCN Bryony Thompson gene: MYCN was added
gene: MYCN was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYCN were set to Feingold syndrome (Microcephaly-oculo-digito-esophageal-duodenal) 164280
Hand and foot malformations v0.0 MGP Bryony Thompson gene: MGP was added
gene: MGP was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: MGP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MGP were set to Keutel syndrome 245150
Hand and foot malformations v0.0 LTBP3 Bryony Thompson gene: LTBP3 was added
gene: LTBP3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: LTBP3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: LTBP3 were set to Geleophysic dysplasia 3 617809; Dental anomalies and short stature 610216
Hand and foot malformations v0.0 LTBP2 Bryony Thompson gene: LTBP2 was added
gene: LTBP2 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: LTBP2 was set to Unknown
Phenotypes for gene: LTBP2 were set to Weill-Marchesani
Hand and foot malformations v0.0 LRP4 Bryony Thompson gene: LRP4 was added
gene: LRP4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: LRP4 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: LRP4 were set to Sclerosteosis 2 614305; Cenani-Lenz syndactyly syndrome 212780
Hand and foot malformations v0.0 KMT2D Bryony Thompson gene: KMT2D was added
gene: KMT2D was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: KMT2D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: KMT2D were set to Kabuki syndrome 1 - 147920
Hand and foot malformations v0.0 KMT2A Bryony Thompson gene: KMT2A was added
gene: KMT2A was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: KMT2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KMT2A were set to Wiedemann-Steiner syndrome MIM#605130
Hand and foot malformations v0.0 KDM6A Bryony Thompson gene: KDM6A was added
gene: KDM6A was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: KDM6A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: KDM6A were set to Kabuki syndrome 2 MIM#300867
Hand and foot malformations v0.0 IHH Bryony Thompson gene: IHH was added
gene: IHH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: IHH was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: IHH were set to Brachydactyly, type A1 112500; Acrocapitofemoral dysplasia 607778
Hand and foot malformations v0.0 IFT57 Bryony Thompson gene: IFT57 was added
gene: IFT57 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT57 were set to ?Orofaciodigital syndrome XVIII MIM#617927
Hand and foot malformations v0.0 HDAC8 Bryony Thompson gene: HDAC8 was added
gene: HDAC8 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: HDAC8 were set to Wilson-Turner syndrome 309585; Cornelia de Lange syndrome 5 300882
Hand and foot malformations v0.0 HDAC4 Bryony Thompson gene: HDAC4 was added
gene: HDAC4 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: HDAC4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HDAC4 were set to Albright hereditary osteodystrophy-like syndrome; Brachydactyly-intellectual disability
Hand and foot malformations v0.0 GSC Bryony Thompson gene: GSC was added
gene: GSC was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: GSC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GSC were set to Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471
Hand and foot malformations v0.0 GNAS Bryony Thompson gene: GNAS was added
gene: GNAS was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: GNAS was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Phenotypes for gene: GNAS were set to McCune-Albright syndrome, somatic, mosaic 174800; ACTH-independent macronodular adrenal hyperplasia 219080 IC; Osseous heteroplasia, progressive 166350; Pseudohypoparathyroidism Ic 612462; Pseudopseudohypoparathyroidism 612463; Pseudohypoparathyroidism Ia 103580; Pseudohypoparathyroidism Ib 603233
Hand and foot malformations v0.0 GJA1 Bryony Thompson gene: GJA1 was added
gene: GJA1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: GJA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: GJA1 were set to Hypoplastic left heart syndrome 1 241550; Syndactyly, type III 186100; Oculodentodigital dysplasia 164200; Palmoplantar keratoderma with congenital alopecia 104100; Craniometaphyseal dysplasia, autosomal recessive 218400; Erythrokeratodermia variabilis et progressiva 133200; Oculodentodigital dysplasia, autosomal recessive 257850
Hand and foot malformations v0.0 GDF6 Bryony Thompson gene: GDF6 was added
gene: GDF6 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: GDF6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GDF6 were set to Multiple synostoses syndrome type 4 - 617898.; Klippel-Feil syndrome 1, autosomal dominant 118100
Hand and foot malformations v0.0 FZD2 Bryony Thompson gene: FZD2 was added
gene: FZD2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FZD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FZD2 were set to Autosomal dominant omodysplasia 164745; Autosomal dominant omodysplasia type 2 164745
Hand and foot malformations v0.0 FMN1 Bryony Thompson gene: FMN1 was added
gene: FMN1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: FMN1 was set to Unknown
Hand and foot malformations v0.0 FLNA Bryony Thompson gene: FLNA was added
gene: FLNA was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FLNA was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: FLNA were set to Osteodysplasty Melnick Needles 309350 XLD; Otopalatodigital syndrome, type II 304120 XLD; Frontometaphyseal dysplasia 305620; Terminal osseous dysplasia 300244; Otopalatodigital syndrome, type I -311300
Hand and foot malformations v0.0 FIG4 Bryony Thompson gene: FIG4 was added
gene: FIG4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FIG4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FIG4 were set to Yunis-Varon syndrome 216340; Amyotrophic lateral sclerosis 11 612577
Hand and foot malformations v0.0 FGF9 Bryony Thompson gene: FGF9 was added
gene: FGF9 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FGF9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FGF9 were set to Multiple synostoses syndrome type 3 612961
Hand and foot malformations v0.0 FBXW4 Bryony Thompson gene: FBXW4 was added
gene: FBXW4 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: FBXW4 was set to Unknown
Phenotypes for gene: FBXW4 were set to Split-hand/foot malformation 3 syndrome 246560
Hand and foot malformations v0.0 FBN1 Bryony Thompson gene: FBN1 was added
gene: FBN1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FBN1 were set to Marfan syndrome 154700; Weill-Marchesani syndrome 2, dominant 608328; Stiff skin syndrome 184900; Acromicric dysplasia 102370; Geleophysic dysplasia 2 614185
Hand and foot malformations v0.0 FBLN1 Bryony Thompson gene: FBLN1 was added
gene: FBLN1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: FBLN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: FBLN1 were set to Synpolydactyly, 3/3'4, associated with metacarpal and metatarsal synostoses 608180
Hand and foot malformations v0.0 FAT1 Bryony Thompson gene: FAT1 was added
gene: FAT1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: FAT1 was set to Unknown
Hand and foot malformations v0.0 ESCO2 Bryony Thompson gene: ESCO2 was added
gene: ESCO2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ESCO2 were set to SC phocomelia syndrome 269000; Roberts syndrome 268300
Hand and foot malformations v0.0 EP300 Bryony Thompson gene: EP300 was added
gene: EP300 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: EP300 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EP300 were set to Rubinstein-Taybi syndrome 180849
Hand and foot malformations v0.0 EOGT Bryony Thompson gene: EOGT was added
gene: EOGT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: EOGT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EOGT were set to Adams Oliver syndrome 4
Hand and foot malformations v0.0 DYNC1I1 Bryony Thompson gene: DYNC1I1 was added
gene: DYNC1I1 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: DYNC1I1 was set to Unknown
Hand and foot malformations v0.0 DVL3 Bryony Thompson gene: DVL3 was added
gene: DVL3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DVL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DVL3 were set to Robinow syndrome, autosomal dominant 3, 616894
Hand and foot malformations v0.0 DVL1 Bryony Thompson gene: DVL1 was added
gene: DVL1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DVL1 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Phenotypes for gene: DVL1 were set to Robinow syndrome, autosomal dominant 2, MIM# 616331
Hand and foot malformations v0.0 DPF2 Bryony Thompson gene: DPF2 was added
gene: DPF2 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: DPF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DPF2 were set to Coffin-Siris syndrome 7 MIM#618027
Hand and foot malformations v0.0 DOCK6 Bryony Thompson gene: DOCK6 was added
gene: DOCK6 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DOCK6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DOCK6 were set to Adams-Oliver syndrome 2 614219
Hand and foot malformations v0.0 DLX6 Bryony Thompson gene: DLX6 was added
gene: DLX6 was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: DLX6 was set to Unknown
Phenotypes for gene: DLX6 were set to Split-hand/foot malformation 1 183600; Split-hand/foot malformation 1 with sensorineural hearing loss 220600
Hand and foot malformations v0.0 DLX5 Bryony Thompson gene: DLX5 was added
gene: DLX5 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DLX5 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: DLX5 were set to Split-hand/foot malformation 1 with sensorineural hearing loss 220600
Hand and foot malformations v0.0 DLL4 Bryony Thompson gene: DLL4 was added
gene: DLL4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DLL4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DLL4 were set to Adams-Oliver syndrome 6, 616589
Hand and foot malformations v0.0 DHODH Bryony Thompson gene: DHODH was added
gene: DHODH was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DHODH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHODH were set to Miller syndrome (postaxial acrofacial dysostosis) 263750
Hand and foot malformations v0.0 DHCR7 Bryony Thompson gene: DHCR7 was added
gene: DHCR7 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome 270400
Hand and foot malformations v0.0 CREBBP Bryony Thompson gene: CREBBP was added
gene: CREBBP was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CREBBP were set to Rubinstein-Taybi syndrome 180849
Hand and foot malformations v0.0 CHUK Bryony Thompson gene: CHUK was added
gene: CHUK was added to Hand and foot malformation. Sources: Expert list
Mode of inheritance for gene: CHUK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHUK were set to ?Popliteal pterygium syndrome, Bartsocas-Papas type 2 MIM#619339; Cocoon syndrome MIM#613630
Hand and foot malformations v0.0 CHSY1 Bryony Thompson gene: CHSY1 was added
gene: CHSY1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome 605282
Hand and foot malformations v0.0 CDH3 Bryony Thompson gene: CDH3 was added
gene: CDH3 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CDH3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDH3 were set to Ectodermal dysplasia, ectrodactyly, and macular dystrophy 225280
Hand and foot malformations v0.0 FAM58A Bryony Thompson gene: FAM58A was added
gene: FAM58A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: FAM58A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: FAM58A were set to STAR syndrome 300707
Hand and foot malformations v0.0 CACNA1C Bryony Thompson gene: CACNA1C was added
gene: CACNA1C was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: CACNA1C was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: CACNA1C were set to Timothy syndrome MIM#601005
Hand and foot malformations v0.0 BMPR1B Bryony Thompson gene: BMPR1B was added
gene: BMPR1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: BMPR1B was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: BMPR1B were set to Acromesomelic dysplasia, Demirhan type 609441; Brachydactyly, type A1, D 616849; Brachydactyly, type A2 112600
Hand and foot malformations v0.0 BMP2 Bryony Thompson gene: BMP2 was added
gene: BMP2 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: BMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BMP2 were set to Brachydactyly, type A2 112600; short stature, facial dysmorphism and skeletal anomalies with or without cardiac aomalies 617877.
Hand and foot malformations v0.0 B9D1 Bryony Thompson gene: B9D1 was added
gene: B9D1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: B9D1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B9D1 were set to Meckel syndrome 9 614209
Hand and foot malformations v0.0 B3GLCT Bryony Thompson gene: B3GLCT was added
gene: B3GLCT was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B3GLCT were set to O-fucose-specific beta-1,3-N-glucosyltransferase deficiency (Disorders of protein O-glycosylation, O-mannosylglycan synthesis deficiencies); Peters-plus syndrome 261540
Hand and foot malformations v0.0 ARID1B Bryony Thompson gene: ARID1B was added
gene: ARID1B was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome type 1 - 135900
Hand and foot malformations v0.0 ARID1A Bryony Thompson gene: ARID1A was added
gene: ARID1A was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARID1A were set to Coffin-Siris
Hand and foot malformations v0.0 ARHGAP31 Bryony Thompson gene: ARHGAP31 was added
gene: ARHGAP31 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARHGAP31 were set to Adams-Oliver syndrome 1 100300
Hand and foot malformations v0.0 ANKRD11 Bryony Thompson gene: ANKRD11 was added
gene: ANKRD11 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ANKRD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKRD11 were set to KBG syndrome 148050
Hand and foot malformations v0.0 AFF4 Bryony Thompson gene: AFF4 was added
gene: AFF4 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368
Hand and foot malformations v0.0 ADAMTS17 Bryony Thompson gene: ADAMTS17 was added
gene: ADAMTS17 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ADAMTS17 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTS17 were set to Weill-Marchesani syndrome type 4
Hand and foot malformations v0.0 ADAMTS10 Bryony Thompson gene: ADAMTS10 was added
gene: ADAMTS10 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ADAMTS10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTS10 were set to Weill-Marchesani syndrome 1, recessive, 277600
Hand and foot malformations v0.0 ACVR1 Bryony Thompson gene: ACVR1 was added
gene: ACVR1 was added to Hand and foot malformation. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: ACVR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACVR1 were set to Fibrodysplasia ossificans progressiva 135100
Hand and foot malformations v0.0 Bryony Thompson Added panel Hand and foot malformation
Polydactyly v0.240 TMEM107 Bryony Thompson Classified gene: TMEM107 as Green List (high evidence)
Polydactyly v0.240 TMEM107 Bryony Thompson Gene: tmem107 has been classified as Green List (High Evidence).
Polydactyly v0.239 TMEM107 Bryony Thompson gene: TMEM107 was added
gene: TMEM107 was added to Polydactyly. Sources: Expert list
Mode of inheritance for gene: TMEM107 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM107 were set to 22698544; 26123494; 26518474
Phenotypes for gene: TMEM107 were set to Meckel syndrome 13 MIM#617562; Orofaciodigital syndrome XVI MIM#617563
Review for gene: TMEM107 was set to GREEN
gene: TMEM107 was marked as current diagnostic
Added comment: At least four unrelated families with polydactyly as a feature of the condition and a supporting null mouse model.
Sources: Expert list
Polydactyly v0.238 MAP3K20 Bryony Thompson Marked gene: MAP3K20 as ready
Polydactyly v0.238 MAP3K20 Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence).
Polydactyly v0.238 MAP3K20 Bryony Thompson Classified gene: MAP3K20 as Green List (high evidence)
Polydactyly v0.238 MAP3K20 Bryony Thompson Gene: map3k20 has been classified as Green List (High Evidence).
Polydactyly v0.237 MAP3K20 Bryony Thompson gene: MAP3K20 was added
gene: MAP3K20 was added to Polydactyly. Sources: Expert list
Mode of inheritance for gene: MAP3K20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAP3K20 were set to 26755636; 32266845
Phenotypes for gene: MAP3K20 were set to Split-foot malformation with mesoaxial polydactyly MIM#616890
Review for gene: MAP3K20 was set to GREEN
Added comment: PMID: 26755636 - Polydactyly is a feature of the condition in two consanguineous families with homozygous variants. A mouse model recapitulates the phenotype.
PMID: 32266845 - A heterozygous missense was identified in a case with split hand/foot malformation (SHFM), but also large deletion including SHFM-causing genes is also present
Sources: Expert list
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Marked gene: ECHS1 as ready
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Classified gene: ECHS1 as Green List (high evidence)
Cerebral Palsy v0.118 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.117 EARS2 Zornitza Stark Marked gene: EARS2 as ready
Cerebral Palsy v0.117 EARS2 Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.117 EARS2 Zornitza Stark Classified gene: EARS2 as Green List (high evidence)
Cerebral Palsy v0.117 EARS2 Zornitza Stark Gene: ears2 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.121 ARID1B Bryony Thompson Marked gene: ARID1B as ready
Skeletal dysplasia v0.121 ARID1B Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence).
Skeletal dysplasia v0.121 ARID1B Bryony Thompson Publications for gene: ARID1B were set to
Skeletal dysplasia v0.120 ARID1B Bryony Thompson Mode of inheritance for gene: ARID1B was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Skeletal dysplasia v0.119 ARID1B Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported, at least one case identified in a skeletal dysplasia cohort.
Skeletal dysplasia v0.119 ARID1B Bryony Thompson Classified gene: ARID1B as Green List (high evidence)
Skeletal dysplasia v0.119 ARID1B Bryony Thompson Gene: arid1b has been classified as Green List (High Evidence).
Skeletal dysplasia v0.118 ARID1B Bryony Thompson changed review comment from: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. > cases reported.; to: Skeletal limb anomalies, spinal anomalies, and short stature have been reported as a feature of the condition. >3 cases reported.
Skeletal dysplasia v0.118 ARID1B Bryony Thompson reviewed gene: ARID1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 34122524; Phenotypes: Coffin-Siris syndrome 1 MIM#135900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Skeletal dysplasia v0.118 ARID1A Bryony Thompson Marked gene: ARID1A as ready
Skeletal dysplasia v0.118 ARID1A Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence).
Skeletal dysplasia v0.118 ARID1A Bryony Thompson Publications for gene: ARID1A were set to
Skeletal dysplasia v0.117 ARID1A Bryony Thompson Mode of inheritance for gene: ARID1A was changed from to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Skeletal dysplasia v0.116 ARID1A Bryony Thompson Classified gene: ARID1A as Green List (high evidence)
Skeletal dysplasia v0.116 ARID1A Bryony Thompson Gene: arid1a has been classified as Green List (High Evidence).
Skeletal dysplasia v0.115 ARID1A Bryony Thompson changed review comment from: At least 5 cases have been reported with skeletal anomalies as a feature of the condition. Mosaicism is very common for the gene.; to: At least 5 cases have been reported with skeletal anomalies (brachydactyly and polydactyly) as a feature of the condition. Mosaicism is very common for the gene.
Skeletal dysplasia v0.115 ARID1A Bryony Thompson reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23929686, 32888375; Phenotypes: Coffin-Siris syndrome 2 MM#614607; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Cerebral Palsy v0.116 ECHS1 Danielle Ariti gene: ECHS1 was added
gene: ECHS1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: ECHS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ECHS1 were set to 33528536; 34364746; 32858208
Phenotypes for gene: ECHS1 were set to Cerebral Palsy; Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277
Review for gene: ECHS1 was set to GREEN
Added comment: Two cases in CP cohort reported with compound heterozygous ECHS1variants.
One of the individuals presented with delayed motor skills with coordination problems, dystonia (at age 11), and spasticity in upper and lower limbs.

ECHS1 variants cause an inborn error of metabolism disorder characterised by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Some of these cases display paroxysmal and non-paroxysmal dystonia.
Sources: Expert list
Cerebral Palsy v0.116 EARS2 Danielle Ariti gene: EARS2 was added
gene: EARS2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: EARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EARS2 were set to 33528536; 34364746
Phenotypes for gene: EARS2 were set to Cerebral Palsy; Combined oxidative phosphorylation deficiency 12 MIM# 614924
Review for gene: EARS2 was set to GREEN
Added comment: Two individuals in CP cohort reported with bi-allelic EARS2 variants.
One of the individuals presented with severe ID, ASD and seizures on top of impaired motor symptoms.

Overlapping CP phenotype with COXPD12- mitochondrial neurologic disorder characterised by onset in infancy of hypotonia and delayed psychomotor development, or early developmental regression. Severe cases can present with Dystonia, Spastic tetraparesis and/or lack of speech.
Sources: Expert list
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Marked gene: SPEN as ready
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence)
Genetic Epilepsy v0.1195 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Congenital Heart Defect v0.130 SPEN Zornitza Stark Marked gene: SPEN as ready
Congenital Heart Defect v0.130 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Congenital Heart Defect v0.130 SPEN Zornitza Stark Classified gene: SPEN as Green List (high evidence)
Congenital Heart Defect v0.130 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Autism v0.168 SPEN Zornitza Stark Marked gene: SPEN as ready
Autism v0.168 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Autism v0.168 SPEN Zornitza Stark Classified gene: SPEN as Green List (high evidence)
Autism v0.168 SPEN Zornitza Stark Gene: spen has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Marked gene: SPEN as ready
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Classified gene: SPEN as Amber List (moderate evidence)
Deafness_IsolatedAndComplex v1.93 SPEN Zornitza Stark Gene: spen has been classified as Amber List (Moderate Evidence).
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Marked gene: AFF4 as ready
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Classified gene: AFF4 as Green List (high evidence)
Skeletal dysplasia v0.115 AFF4 Bryony Thompson Gene: aff4 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.114 AFF4 Bryony Thompson gene: AFF4 was added
gene: AFF4 was added to Skeletal dysplasia. Sources: Other
Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AFF4 were set to 25730767; 31058441
Phenotypes for gene: AFF4 were set to CHOPS syndrome MIM#616368
Mode of pathogenicity for gene: AFF4 was set to Other
Review for gene: AFF4 was set to GREEN
gene: AFF4 was marked as current diagnostic
Added comment: CHOPS syndrome: C for Cognitive impairment and Coarse facies, H for Heart defects, O for Obesity, P for Pulmonary involvement and S for Short stature and Skeletal dysplasia. 8 out of 11 cases had skeletal dysplasia as a feature of the condition. Gain-of-function is the mechanism of disease.
Sources: Other
Cerebral Palsy v0.116 DDX3X Zornitza Stark Marked gene: DDX3X as ready
Cerebral Palsy v0.116 DDX3X Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence).
Cerebral Palsy v0.116 DDX3X Zornitza Stark Classified gene: DDX3X as Green List (high evidence)
Cerebral Palsy v0.116 DDX3X Zornitza Stark Gene: ddx3x has been classified as Green List (High Evidence).
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Marked gene: DDHD2 as ready
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Classified gene: DDHD2 as Green List (high evidence)
Cerebral Palsy v0.115 DDHD2 Zornitza Stark Gene: ddhd2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.114 DDX3X Danielle Ariti gene: DDX3X was added
gene: DDX3X was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: DDX3X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: DDX3X were set to 33528536
Phenotypes for gene: DDX3X were set to Cerebral Palsy; Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958
Review for gene: DDX3X was set to GREEN
Added comment: 6 individuals in CP cohort reported with de novo DDX3X variants.
Sources: Expert list
Cerebral Palsy v0.114 DDHD2 Danielle Ariti gene: DDHD2 was added
gene: DDHD2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: DDHD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDHD2 were set to 30705080; 34077496; 34321325
Phenotypes for gene: DDHD2 were set to Cerebral Palsy; Spastic paraplegia 54, autosomal recessive MIM# 615033
Review for gene: DDHD2 was set to GREEN
Added comment: Two individuals reported in CP cohort. Phenotype-Spastic diplegia, and ID.

Multiple reports of CP-mimic patients with global developmental delay and non-progressive spastic gait.

SPG54 individuals display CP-like phenotype such as intellectual disability, early-onset spasticity of the lower limbs and delayed psychomotor development.
Sources: Expert list
Cerebral Palsy v0.114 DDC Zornitza Stark Marked gene: DDC as ready
Cerebral Palsy v0.114 DDC Zornitza Stark Added comment: Comment when marking as ready: Phenotypic overlap with CP: ID and movement disorders
Cerebral Palsy v0.114 DDC Zornitza Stark Gene: ddc has been classified as Green List (High Evidence).
Cerebral Palsy v0.114 DDC Zornitza Stark Classified gene: DDC as Green List (high evidence)
Cerebral Palsy v0.114 DDC Zornitza Stark Gene: ddc has been classified as Green List (High Evidence).
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Marked gene: CYP2U1 as ready
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Classified gene: CYP2U1 as Green List (high evidence)
Cerebral Palsy v0.113 CYP2U1 Zornitza Stark Gene: cyp2u1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Marked gene: COL4A2 as ready
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Classified gene: COL4A2 as Green List (high evidence)
Cerebral Palsy v0.112 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.111 DDC Danielle Ariti gene: DDC was added
gene: DDC was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: DDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDC were set to 33528536; 30799092; 33996177
Phenotypes for gene: DDC were set to Aromatic L-amino acid decarboxylase deficiency MIM# 608643
Review for gene: DDC was set to AMBER
Added comment: Single case reported in CP cohort with Dystonic cerebral palsy.

Multiple AADCD cases reported as CP- mimics due to phenotype overlap: dystonia and developmental delay.

AADCD being is an inborn error in neurotransmitter metabolism disorder that leads to combined serotonin and catecholamine deficiency. Clinically characterised by vegetative symptoms, oculogyric crises, dystonia, and severe neurologic dysfunction (infancy/ early childhood); displays CP-like features.
Sources: Expert list
Genetic Epilepsy v0.1194 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to AMBER
gene: SPEN was marked as current diagnostic
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.

Seizures were observed in only 3/32 (~9%) of patients
Sources: Literature
Autism v0.167 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Autism. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to GREEN
gene: SPEN was marked as current diagnostic
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.
Sources: Literature
Congenital Heart Defect v0.129 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to GREEN
gene: SPEN was marked as current diagnostic
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.
Sources: Literature
Deafness_IsolatedAndComplex v1.92 SPEN Elena Savva gene: SPEN was added
gene: SPEN was added to Deafness_IsolatedAndComplex. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPEN were set to PMID: 33596411
Phenotypes for gene: SPEN were set to Radio-Tartaglia syndrome MIM#619312
Review for gene: SPEN was set to AMBER
Added comment: PMID: 33596411
- 34 individuals with truncating variants in SPEN reported, most are de novo variants.
- Clinical profile includes developmental delay/intellectual disability, autism spectrum disorder, anxiety, aggressive behavior, attention deficit disorder, hypotonia, brain and spine anomalies, congenital heart defects, high/narrow palate, facial dysmorphisms, and obesity/increased BMI, especially in females.
- Authors showed haploinsufficiency of SPEN is associated with a distinctive DNA methylation episignature of the X chromosome in affected females.

Hearing loss reported in ~10% of patients, uncommon phenotype
Sources: Literature
Cerebral Palsy v0.111 CYP2U1 Danielle Ariti changed review comment from: Single case reported in CP cohort (bi-allelic c.A947T variant).

SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia.
Sources: Expert list; to: Single case reported in CP cohort (bi-allelic p.D316V variant).

SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia.
Sources: Expert list
Cerebral Palsy v0.111 CYP2U1 Danielle Ariti gene: CYP2U1 was added
gene: CYP2U1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: CYP2U1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CYP2U1 were set to 33528536; 29761117; 23176821
Phenotypes for gene: CYP2U1 were set to Cerebral Palsy; Spastic paraplegia 56, autosomal recessive MIM# 615030
Review for gene: CYP2U1 was set to GREEN
Added comment: Single case reported in CP cohort (bi-allelic c.A947T variant).

SPG56 is an autosomal recessive neurodegenerative disorder characterised by early-onset progressive lower-limb spasticity. 4 reported SPG56 cases display CP-like phenotype: ID and spastic diplegia.
Sources: Expert list
Imprinting disorders v0.3 NLRP5 Anna Le Fevre reviewed gene: NLRP5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26323243, 31829238, 29574422, 30877238, 32222962, 34440388; Phenotypes: Miscarriage, Beckwith-Wiedemann syndrome, Multi locus imprinting disturbance in offspring; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Cerebral Palsy v0.111 COL4A2 Danielle Ariti gene: COL4A2 was added
gene: COL4A2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: COL4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COL4A2 were set to 33528536; 33912663
Phenotypes for gene: COL4A2 were set to Cerebral Palsy; Brain small vessel disease 2 MIM# 614483
Review for gene: COL4A2 was set to GREEN
Added comment: 7 individuals in CP cohort have been reported with mono-allelic COL4A2 variants. Phenotypic overlap: Spastic Triplegia, ID (no language), porencephaly and seizures.

2 siblings reported with bi-allelic variants; Spastic Cerebral Palsy with ID and Epilepsy.
Sources: Expert list
Cerebral Palsy v0.111 ATL1 Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ) to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 )
Cerebral Palsy v0.111 ATL1 Zornitza Stark Phenotypes for gene: ATL1 were changed from Cerebral palsy to Cerebral palsy; Spastic paraplegia 3A, autosomal dominant (OMIM 182600 )
Cerebral Palsy v0.110 ATL1 Zornitza Stark Publications for gene: ATL1 were set to PMID: 32989326
Cerebral Palsy v0.109 ATL1 Zornitza Stark Classified gene: ATL1 as Green List (high evidence)
Cerebral Palsy v0.109 ATL1 Zornitza Stark Gene: atl1 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 ZNF445 Anna Le Fevre gene: ZNF445 was added
gene: ZNF445 was added to Imprinting disorders. Sources: Literature
Mode of inheritance for gene: ZNF445 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF445 were set to PMID: 34039421; 30602440; 30846001
Phenotypes for gene: ZNF445 were set to Temple syndrome; Multi locus imprinting disturbance (MLID)
Penetrance for gene: ZNF445 were set to unknown
Review for gene: ZNF445 was set to AMBER
Added comment: Suggested rating: AMBER

Single report (Kagami 2021) of a child with Temple syndrome and MLID found to have a novel homozygous truncating variant in ZNF445. ZNF445 has been shown to play a critical role in the maintenance of postfertilisation methylation imprints (Takahashi 2019). Mechanism and parent of origin effects remain uncertain.
Sources: Literature
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Marked gene: NGLY1 as ready
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Classified gene: NGLY1 as Green List (high evidence)
Cerebral Palsy v0.107 NGLY1 Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Marked gene: NEXMIF as ready
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence).
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Classified gene: NEXMIF as Red List (low evidence)
Cerebral Palsy v0.106 NEXMIF Zornitza Stark Gene: nexmif has been classified as Red List (Low Evidence).
Cerebral Palsy v0.105 PANK2 Zornitza Stark Marked gene: PANK2 as ready
Cerebral Palsy v0.105 PANK2 Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.105 PANK2 Zornitza Stark Classified gene: PANK2 as Amber List (moderate evidence)
Cerebral Palsy v0.105 PANK2 Zornitza Stark Gene: pank2 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.104 NDUFAF2 Zornitza Stark Marked gene: NDUFAF2 as ready
Cerebral Palsy v0.104 NDUFAF2 Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.104 NDUFAF2 Zornitza Stark Phenotypes for gene: NDUFAF2 were changed from Cerebral palsy to Cerebral palsy; Mitochondrial complex I deficiency nuclear type 10 (OMIM 618233)
Cerebral Palsy v0.103 NDUFAF2 Zornitza Stark Classified gene: NDUFAF2 as Green List (high evidence)
Cerebral Palsy v0.103 NDUFAF2 Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Marked gene: NDUFA12 as ready
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Classified gene: NDUFA12 as Amber List (moderate evidence)
Cerebral Palsy v0.102 NDUFA12 Zornitza Stark Gene: ndufa12 has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.101 NALCN Zornitza Stark Marked gene: NALCN as ready
Cerebral Palsy v0.101 NALCN Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.101 NALCN Zornitza Stark Phenotypes for gene: NALCN were changed from Cerebral palsy to Cerebral palsy; Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266)
Cerebral Palsy v0.100 NALCN Zornitza Stark Classified gene: NALCN as Amber List (moderate evidence)
Cerebral Palsy v0.100 NALCN Zornitza Stark Gene: nalcn has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.99 ATL1 Clare van Eyk reviewed gene: ATL1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33528536, PMID: 34321325; Phenotypes: Spastic paraplegia 3A, autosomal dominant (OMIM 182600 ); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.99 NALCN Clare van Eyk edited their review of gene: NALCN: Changed phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay (OMIM 616266)
Cerebral Palsy v0.99 NDUFA12 Clare van Eyk Deleted their comment
Cerebral Palsy v0.99 NDUFA12 Clare van Eyk edited their review of gene: NDUFA12: Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort.; Changed phenotypes: Mitochondrial complex I deficiency, nuclear type 23 (OMIM 618244)
Cerebral Palsy v0.99 NEXMIF Clare van Eyk Deleted their comment
Cerebral Palsy v0.99 NEXMIF Clare van Eyk edited their review of gene: NEXMIF: Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date.; Changed phenotypes: X-linked intellectual disability 98 (OMIM:300912)
Cerebral Palsy v0.99 PANK2 Clare van Eyk gene: PANK2 was added
gene: PANK2 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: PANK2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PANK2 were set to PMID: 33098801
Phenotypes for gene: PANK2 were set to HARP syndrome ( OMIM 607236); Neurodegeneration with brain iron accumulation 1 (OMIM 234200)
Review for gene: PANK2 was set to AMBER
Added comment: One case reported with dystonic cerebral palsy. Dystonia and spasticity are reported in cases with variants in PANK2.
Sources: Literature
Cerebral Palsy v0.99 NGLY1 Clare van Eyk gene: NGLY1 was added
gene: NGLY1 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NGLY1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NGLY1 were set to PMID:33528536
Phenotypes for gene: NGLY1 were set to Congenital disorder of deglycosylation (OMIM 615273)
Review for gene: NGLY1 was set to GREEN
Added comment: Three cases with biallelic P/LP variants reported in Clinical Laboratory Referral Cohort retrospectively analysed for genetic determinants of cerebral palsy. Autosomal recessive, multisystem disorder with some overlapping clinical features with cerebral palsy, but this is a progressive condition.
Sources: Literature
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk reviewed gene: NDUFAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: mitochondrial complex I deficiency nuclear type 10 (OMIM 618233); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk Deleted their review
Cerebral Palsy v0.99 NEXMIF Clare van Eyk changed review comment from: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date.
Sources: Expert list; to: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any published reports in CP cohorts to date.
Sources: Expert list
Cerebral Palsy v0.99 NEXMIF Clare van Eyk gene: NEXMIF was added
gene: NEXMIF was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: NEXMIF was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: NEXMIF were set to X-linked Intellectual disability; epilepsy; autism
Penetrance for gene: NEXMIF were set to Incomplete
Review for gene: NEXMIF was set to RED
Added comment: Variants cause X-linked intellectual disability 98 (OMIM:300912). Developmental and epileptic encephalopathy with some affected individuals having movement phenotypes which could be considered CP-like, but did not find any reports in CP cohorts to date.
Sources: Expert list
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype.
Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Overlapping clinical phenotype.
Sources: Literature
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk changed review comment from: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233).
Sources: Literature; to: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233). Most variants are LOF. Overlapping clinical phenotype.
Sources: Literature
Cerebral Palsy v0.99 NDUFAF2 Clare van Eyk gene: NDUFAF2 was added
gene: NDUFAF2 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NDUFAF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFAF2 were set to PMID:33528536; PMID:34364746
Phenotypes for gene: NDUFAF2 were set to Cerebral palsy
Review for gene: NDUFAF2 was set to GREEN
Added comment: Two homozygous pathogenic deletions reported in cerebral palsy cohorts. Biallelic loss of function variants cause mitochondrial complex I deficiency nuclear type 10 (OMIM 618233).
Sources: Literature
Cerebral Palsy v0.99 NDUFA12 Clare van Eyk gene: NDUFA12 was added
gene: NDUFA12 was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NDUFA12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA12 were set to PMID:34364746
Phenotypes for gene: NDUFA12 were set to Spastic tetraparesis; intellectual disability; encephalopathy
Review for gene: NDUFA12 was set to AMBER
Added comment: Mitochondrial disorder causing motor dysfunction with learning difficulties (OMIM 618244). One case in cerebral palsy cohort.
Sources: Literature
Cerebral Palsy v0.99 NALCN Clare van Eyk reviewed gene: NALCN: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:33528536, PMID:34364746; Phenotypes: Cerebral palsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.99 NALCN Clare van Eyk Deleted their review
Cerebral Palsy v0.99 NALCN Clare van Eyk gene: NALCN was added
gene: NALCN was added to Cerebral Palsy. Sources: Literature
Mode of inheritance for gene: NALCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NALCN were set to PMID:33528536; 34364746
Phenotypes for gene: NALCN were set to Cerebral palsy
Review for gene: NALCN was set to AMBER
Added comment: One case with pathogenic variant from clinical laboratory referral cohort. One additional VUS from tertiary care setting. NALCN variants cause a congenital disorder with contractures of the limbs, abnormal facial features, hypotonia, and developmental delay (OMIM: 611549). Cerebral palsy has not been described previously.
Sources: Literature
Mendeliome v0.9203 CARMIL2 Zornitza Stark Marked gene: CARMIL2 as ready
Mendeliome v0.9203 CARMIL2 Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence).
Mendeliome v0.9203 CARMIL2 Zornitza Stark Phenotypes for gene: CARMIL2 were changed from to Immunodeficiency 58, MIM# 618131; Early onset paediatric inflammatory bowel disease
Mendeliome v0.9202 CARMIL2 Zornitza Stark Publications for gene: CARMIL2 were set to
Mendeliome v0.9201 CARMIL2 Zornitza Stark Mode of inheritance for gene: CARMIL2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9200 CARMIL2 Zornitza Stark reviewed gene: CARMIL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29479355, 28112205, 27896283, 33723309; Phenotypes: Immunodeficiency 58, MIM# 618131, Early onset paediatric inflammatory bowel disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Marked gene: CARMIL2 as ready
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Classified gene: CARMIL2 as Green List (high evidence)
Inflammatory bowel disease v0.61 CARMIL2 Zornitza Stark Gene: carmil2 has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.60 CARMIL2 Zornitza Stark gene: CARMIL2 was added
gene: CARMIL2 was added to Inflammatory bowel disease. Sources: Expert Review
Mode of inheritance for gene: CARMIL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CARMIL2 were set to 33723309
Phenotypes for gene: CARMIL2 were set to Early onset paediatric inflammatory bowel disease
Review for gene: CARMIL2 was set to GREEN
Added comment: Bi-allelic variants in this gene are associated with immunodeficiency. Four individuals from three families reported with early onset IBD. None manifested overt clinical signs of immunodeficiency before their diagnosis.
Sources: Expert Review
Cerebral vascular malformations v0.23 SETD5 Bryony Thompson Classified gene: SETD5 as Amber List (moderate evidence)
Cerebral vascular malformations v0.23 SETD5 Bryony Thompson Gene: setd5 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v0.22 CHD4 Bryony Thompson Classified gene: CHD4 as Amber List (moderate evidence)
Cerebral vascular malformations v0.22 CHD4 Bryony Thompson Gene: chd4 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v0.21 ABCC6 Bryony Thompson Marked gene: ABCC6 as ready
Cerebral vascular malformations v0.21 ABCC6 Bryony Thompson Gene: abcc6 has been classified as Red List (Low Evidence).
Cerebral vascular malformations v0.21 ABCC6 Bryony Thompson reviewed gene: ABCC6: Rating: RED; Mode of pathogenicity: None; Publications: 16086762; Phenotypes: Moya moya disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9200 PNLDC1 Zornitza Stark Marked gene: PNLDC1 as ready
Mendeliome v0.9200 PNLDC1 Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence).
Mendeliome v0.9200 PNLDC1 Zornitza Stark Classified gene: PNLDC1 as Green List (high evidence)
Mendeliome v0.9200 PNLDC1 Zornitza Stark Gene: pnldc1 has been classified as Green List (High Evidence).
Mendeliome v0.9199 PNLDC1 Zornitza Stark gene: PNLDC1 was added
gene: PNLDC1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: PNLDC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PNLDC1 were set to 34347949
Phenotypes for gene: PNLDC1 were set to Spermatogenic failure 57, MIM# 619528
Review for gene: PNLDC1 was set to GREEN
Added comment: Four unrelated individuals reported.
Sources: Expert Review
Mendeliome v0.9198 FOXP1 Zornitza Stark Marked gene: FOXP1 as ready
Mendeliome v0.9198 FOXP1 Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence).
Mendeliome v0.9198 FOXP1 Zornitza Stark Phenotypes for gene: FOXP1 were changed from to Mental retardation with language impairment and with or without autistic features, MIM# 613670
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Marked gene: FOXP1 as ready
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Classified gene: FOXP1 as Green List (high evidence)
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.88 FOXP1 Zornitza Stark Gene: foxp1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.87 FOXP1 Zornitza Stark gene: FOXP1 was added
gene: FOXP1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review
Mode of inheritance for gene: FOXP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOXP1 were set to 27657687
Phenotypes for gene: FOXP1 were set to Mental retardation with language impairment and with or without autistic features, MIM# 613670
Review for gene: FOXP1 was set to GREEN
Added comment: Well established association with syndromic ID. Multiple individuals reported with congenital anomalies of the kidneys and urinary tract in PMID 27657687.
Sources: Expert Review
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Marked gene: ZMYM2 as ready
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Classified gene: ZMYM2 as Green List (high evidence)
Congenital Heart Defect v0.129 ZMYM2 Zornitza Stark Gene: zmym2 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.128 ZMYM2 Zornitza Stark gene: ZMYM2 was added
gene: ZMYM2 was added to Congenital Heart Defect. Sources: Expert Review
Mode of inheritance for gene: ZMYM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZMYM2 were set to 32891193
Phenotypes for gene: ZMYM2 were set to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Review for gene: ZMYM2 was set to GREEN
Added comment: Connaughton et al (2020 - PMID: 32891193) report on 19 individuals (from 15 unrelated families) with heterozygous pathogenic ZMYM2 variants.

Affected individuals from 7 families presented with CAKUT while all of them displayed extra-renal features. Neurological manifestations were reported in 16 individuals from 14 families (data not available for 1 fam), among others hypotonia (3/14 fam), speech delay (4/14 fam), global DD (9/14 fam), ID (4/14 fam), microcephaly (4/14 fam). ASD was reported in 4 fam (4 indiv). Seizures were reported in 2 fam (2 indiv). Variable other features included cardiac defects, facial dysmorphisms, small hands and feet with dys-/hypo-plastic nails and clinodactyly.

14 pLoF variants were identified, in most cases as de novo events (8 fam). In 2 families the variant was inherited from an affected parent. Germline mosaicism occurred in 1 family.

The human disease features were recapitulated in a X. tropicalis morpholino knockdown, with expression of truncating variants failing to rescue renal and craniofacial defects. Heterozygous Zmym2-deficient mice also recapitulated the features of CAKUT.

ZMYM2 (previously ZNF198) encodes a nuclear zinc finger protein localizing to the nucleus (and PML nuclear body).

It has previously been identified as transcriptional corepressor interacting with nuclear receptors and the LSD1-CoREST-HDAC1 complex. It has also been shown to interact with FOXP transcription factors.

The authors provide evidence for loss of interaction of the truncated ZMYM2 with FOXP1 (mutations in the latter having recently been reported in syndromic CAKUT).
Sources: Expert Review
Mendeliome v0.9197 ZMYM2 Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.86 ZMYM2 Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 ZMYM2 Zornitza Stark reviewed gene: ZMYM2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4130 ZMYM2 Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Intellectual disability syndromic and non-syndromic v0.4129 ZMYM2 Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522
Mendeliome v0.9197 HCN2 Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders
Mendeliome v0.9196 HCN2 Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders
Genetic Epilepsy v0.1194 HCN2 Zornitza Stark Phenotypes for gene: HCN2 were changed from Genetic epilepsy with febrile seizures plus; Other seizure disorders to Febrile seizures, familial, 2, MIM# 602477; Genetic epilepsy with febrile seizures plus; Other seizure disorders
Genetic Epilepsy v0.1193 HCN2 Zornitza Stark edited their review of gene: HCN2: Changed phenotypes: Febrile seizures, familial, 2, MIM# 602477, Genetic epilepsy with febrile seizures plus, Other seizure disorders
Mendeliome v0.9196 HSCB Zornitza Stark Marked gene: HSCB as ready
Mendeliome v0.9196 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9196 HSCB Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence)
Mendeliome v0.9196 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9195 HSCB Zornitza Stark gene: HSCB was added
gene: HSCB was added to Mendeliome. Sources: Expert list
Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSCB were set to 32634119
Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5, MIM# 619523
Review for gene: HSCB was set to AMBER
Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model.
Sources: Expert list
Red cell disorders v1.2 HSCB Zornitza Stark Marked gene: HSCB as ready
Red cell disorders v1.2 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Red cell disorders v1.2 HSCB Zornitza Stark Classified gene: HSCB as Amber List (moderate evidence)
Red cell disorders v1.2 HSCB Zornitza Stark Gene: hscb has been classified as Amber List (Moderate Evidence).
Red cell disorders v1.1 HSCB Zornitza Stark gene: HSCB was added
gene: HSCB was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: HSCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSCB were set to 32634119
Phenotypes for gene: HSCB were set to Anaemia, sideroblastic, 5 619523
Review for gene: HSCB was set to AMBER
Added comment: Single individual reported with compound heterozygous variants in this gene. Good functional data including animal model.
Sources: Expert list
Mendeliome v0.9194 FAM57B Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy
Mendeliome v0.9193 FAM57B Zornitza Stark edited their review of gene: FAM57B: Changed phenotypes: Cone-rod dystrophy 22, MIM# 619531, Maculopathy
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Marked gene: FAM57B as ready
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence).
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Classified gene: FAM57B as Green List (high evidence)
Cone-rod Dystrophy v0.31 FAM57B Zornitza Stark Gene: fam57b has been classified as Green List (High Evidence).
Cone-rod Dystrophy v0.30 FAM57B Zornitza Stark gene: FAM57B was added
gene: FAM57B was added to Cone-rod Dystrophy. Sources: Expert Review
new gene name tags were added to gene: FAM57B.
Mode of inheritance for gene: FAM57B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM57B were set to 33077892
Phenotypes for gene: FAM57B were set to Cone-rod dystrophy 22, MIM# 619531; Maculopathy
Review for gene: FAM57B was set to GREEN
Added comment: 4 patients with cone-rod dystrophy or maculopathy from 3 families, with LOF pathogenic variants in TLCD3B (ceramide synthase gene). Ceramide is a proapoptotic lipid as high levels of ceramides can lead to apoptosis of neuronal cells, including photoreceptors. Variants segregated with disease. TLCD3B showed high expression in the adult retina with higher expression in the macular than in the peripheral region. Tlcd3bKO/KO mice exhibited a significant reduction of the cone photoreceptor light responses, thinning of the outer nuclear layer, and loss of cone photoreceptors across the retina.
Sources: Expert Review
Retinitis pigmentosa v0.101 FAM57B Zornitza Stark Phenotypes for gene: FAM57B were changed from Cone–rod dystrophy; Maculopathy to Cone-rod dystrophy 22, MIM# 619531; Maculopathy
Retinitis pigmentosa v0.100 FAM57B Zornitza Stark reviewed gene: FAM57B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cone-rod dystrophy 22, MIM# 619531; Mode of inheritance: None
Mendeliome v0.9193 CADM3 Zornitza Stark Phenotypes for gene: CADM3 were changed from Charcot-Marie-Tooth disease to Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519
Mendeliome v0.9192 CADM3 Zornitza Stark reviewed gene: CADM3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark changed review comment from: Combination of ID with ataxia overlaps with CP.
Sources: Expert list; to: Combination of ID with ataxia overlaps with CP. At least 3 families reported, intragenic deletions.
Sources: Expert list
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Marked gene: CAMTA1 as ready
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Tag SV/CNV tag was added to gene: CAMTA1.
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Classified gene: CAMTA1 as Green List (high evidence)
Cerebral Palsy v0.99 CAMTA1 Zornitza Stark Gene: camta1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.98 CAMTA1 Zornitza Stark gene: CAMTA1 was added
gene: CAMTA1 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: CAMTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CAMTA1 were set to 22693284; 24738973
Phenotypes for gene: CAMTA1 were set to Cerebellar ataxia, nonprogressive, with mental retardation, MIM# 614756
Review for gene: CAMTA1 was set to GREEN
Added comment: Combination of ID with ataxia overlaps with CP.
Sources: Expert list
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Marked gene: CACNA1A as ready
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Classified gene: CACNA1A as Amber List (moderate evidence)
Cerebral Palsy v0.97 CACNA1A Zornitza Stark Gene: cacna1a has been classified as Amber List (Moderate Evidence).
Cerebral Palsy v0.96 CACNA1A Zornitza Stark gene: CACNA1A was added
gene: CACNA1A was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: CACNA1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1A were set to 29761117
Phenotypes for gene: CACNA1A were set to Developemental and epileptic encephalopathy 42, MIM# 617106; Episodic ataxia, type 2, MIM# 108500; Migraine, familial hemiplegic, 1, MIM# 141500; Migraine, familial hemiplegic, 1, with progressive cerebellar ataxia 141500; Spinocerebellar ataxia 6, MIM# 183086
Review for gene: CACNA1A was set to AMBER
Added comment: Variants in this gene cause a range of phenotypes, including hemiplegia, although this tends to be episodic. Reported in a CP cohort.
Sources: Expert Review
Cerebral Palsy v0.95 BCL11A Zornitza Stark Marked gene: BCL11A as ready
Cerebral Palsy v0.95 BCL11A Zornitza Stark Gene: bcl11a has been classified as Red List (Low Evidence).
Cerebral Palsy v0.95 BCL11A Zornitza Stark gene: BCL11A was added
gene: BCL11A was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: BCL11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BCL11A were set to Dias-Logan syndrome, MIM# 617101
Review for gene: BCL11A was set to RED
Added comment: Intellectual disability, microcephaly, dysmorphic features and persistence of fetal haemoglobin but no specific overlap with CP.
Sources: Expert Review
Mackenzie's Mission_Reproductive Carrier Screening v0.103 BCAP31 Zornitza Stark gene: BCAP31 was added
gene: BCAP31 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: BCAP31 were set to 24011989; 31330203; 33603160
Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Review for gene: BCAP31 was set to GREEN
Added comment: More than 20 unrelated families reported. Clinical features include severe intellectual disability (ID), dystonia, deafness, and central hypomyelination. Female carriers are mostly asymptomatic but may present with deafness.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4129 BCAP31 Zornitza Stark Marked gene: BCAP31 as ready
Intellectual disability syndromic and non-syndromic v0.4129 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4129 BCAP31 Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Intellectual disability syndromic and non-syndromic v0.4128 BCAP31 Zornitza Stark Publications for gene: BCAP31 were set to
Intellectual disability syndromic and non-syndromic v0.4127 BCAP31 Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4126 BCAP31 Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9192 BCAP31 Zornitza Stark Marked gene: BCAP31 as ready
Mendeliome v0.9192 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Mendeliome v0.9192 BCAP31 Zornitza Stark Phenotypes for gene: BCAP31 were changed from to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Mendeliome v0.9191 BCAP31 Zornitza Stark Publications for gene: BCAP31 were set to
Mendeliome v0.9190 BCAP31 Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9189 BCAP31 Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Marked gene: BCAP31 as ready
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Classified gene: BCAP31 as Green List (high evidence)
Cerebral Palsy v0.94 BCAP31 Zornitza Stark Gene: bcap31 has been classified as Green List (High Evidence).
Cerebral Palsy v0.93 BCAP31 Zornitza Stark gene: BCAP31 was added
gene: BCAP31 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: BCAP31 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: BCAP31 were set to 24011989; 31330203
Phenotypes for gene: BCAP31 were set to Deafness, dystonia, and cerebral hypomyelination, MIM# 300475
Review for gene: BCAP31 was set to GREEN
Added comment: Phenotypic overlap with CP due to combination of almost no psychomotor development with dystonia and pyramidal signs. At least one patient reported who specifically had a CP diagnosis.
Sources: Expert Review
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Marked gene: AUTS2 as ready
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Classified gene: AUTS2 as Green List (high evidence)
Cerebral Palsy v0.91 AUTS2 Zornitza Stark Gene: auts2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.90 AUTS2 Zornitza Stark gene: AUTS2 was added
gene: AUTS2 was added to Cerebral Palsy. Sources: Expert list
SV/CNV tags were added to gene: AUTS2.
Mode of inheritance for gene: AUTS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AUTS2 were set to 23332918; 27075013
Phenotypes for gene: AUTS2 were set to Mental retardation, autosomal dominant 26, MIM# 615834
Review for gene: AUTS2 was set to GREEN
Added comment: Multiple individuals reported with ID/autism, but 'cerebral palsy' was the original clinical diagnosis in some.

Predominantly deletions reported, so may not be tractable by all NGS assays.
Sources: Expert list
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Marked gene: AFF4 as ready
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Classified gene: AFF4 as Green List (high evidence)
Pulmonary Fibrosis_Interstitial Lung Disease v0.33 AFF4 Zornitza Stark Gene: aff4 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.32 AFF4 Zornitza Stark gene: AFF4 was added
gene: AFF4 was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Expert Review
Mode of inheritance for gene: AFF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AFF4 were set to 31058441; 25730767
Phenotypes for gene: AFF4 were set to CHOPS syndrome, MIM# 616368
Review for gene: AFF4 was set to GREEN
Added comment: Chronic interstitial lung disease is a feature of this condition. More than 15 unrelated individuals reported.
Sources: Expert Review
Cerebral Palsy v0.89 ATRX Zornitza Stark Marked gene: ATRX as ready
Cerebral Palsy v0.89 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Cerebral Palsy v0.89 ATRX Zornitza Stark Classified gene: ATRX as Green List (high evidence)
Cerebral Palsy v0.89 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Cerebral Palsy v0.88 ATRX Zornitza Stark gene: ATRX was added
gene: ATRX was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ATRX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ATRX were set to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580
Review for gene: ATRX was set to GREEN
Added comment: ID and hypotonia/hypertonia/spasticity: phenotypic overlap with CP. Well established gene-disease association.
Sources: Expert Review
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Marked gene: ATP1A3 as ready
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark edited their review of gene: ATP1A3: Changed rating: RED
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Classified gene: ATP1A3 as Red List (low evidence)
Cerebral Palsy v0.87 ATP1A3 Zornitza Stark Gene: atp1a3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.86 ATP1A3 Zornitza Stark gene: ATP1A3 was added
gene: ATP1A3 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ATP1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ATP1A3 were set to Alternating hemiplegia of childhood 2, MIM# 614820; CAPOS syndrome, MIM# 601338; Dystonia-12, MIM# 128235
Review for gene: ATP1A3 was set to GREEN
Added comment: The disorders associated with variants in this gene tend to have episodic symptoms, insufficient overlap with CP.
Sources: Expert Review
Cerebral Palsy v0.85 ASXL3 Zornitza Stark Marked gene: ASXL3 as ready
Cerebral Palsy v0.85 ASXL3 Zornitza Stark Gene: asxl3 has been classified as Red List (Low Evidence).
Cerebral Palsy v0.85 ASXL3 Zornitza Stark gene: ASXL3 was added
gene: ASXL3 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ASXL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ASXL3 were set to Bainbridge-Ropers syndrome, MIM# 615485
Review for gene: ASXL3 was set to RED
Added comment: Severe neurodevelopmental disorder but no strong overlap with CP.
Sources: Expert Review
Cerebral Palsy v0.84 ARX Zornitza Stark Marked gene: ARX as ready
Cerebral Palsy v0.84 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Cerebral Palsy v0.84 ARX Zornitza Stark Classified gene: ARX as Green List (high evidence)
Cerebral Palsy v0.84 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Cerebral Palsy v0.83 ARX Zornitza Stark gene: ARX was added
gene: ARX was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ARX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ARX were set to Developmental and epileptic encephalopathy 1, MIM# 308350; Lissencephaly, X-linked 2, MIM# 300215; Proud syndrome, MIM# 300004
Review for gene: ARX was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap: ID/seizures/abnormal tone.
Sources: Expert Review
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Classified gene: AMPD2 as Green List (high evidence)
Cerebral Palsy v0.82 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4126 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Intellectual disability syndromic and non-syndromic v0.4126 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4126 AMPD2 Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809
Intellectual disability syndromic and non-syndromic v0.4125 AMPD2 Zornitza Stark Publications for gene: AMPD2 were set to
Intellectual disability syndromic and non-syndromic v0.4124 AMPD2 Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4123 AMPD2 Zornitza Stark reviewed gene: AMPD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23911318, 27066553; Phenotypes: Pontocerebellar hypoplasia, type 9, MIM#615809; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9189 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Mendeliome v0.9189 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Mendeliome v0.9189 AMPD2 Zornitza Stark Phenotypes for gene: AMPD2 were changed from to Pontocerebellar hypoplasia, type 9, MIM#615809
Mendeliome v0.9188 AMPD2 Zornitza Stark Publications for gene: AMPD2 were set to
Mendeliome v0.9187 AMPD2 Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9186 AMPD2 Zornitza Stark Deleted their comment
Mendeliome v0.9186 AMPD2 Zornitza Stark edited their review of gene: AMPD2: Added comment: Well established gene-disease association. Clinical features include severely delayed psychomotor development, progressive microcephaly, spasticity, seizures, and brain abnormalities, including brain atrophy, thin corpus callosum, and delayed myelination.; Changed rating: GREEN; Changed publications: 23911318, 27066553
Cerebral Palsy v0.81 AMPD2 Zornitza Stark gene: AMPD2 was added
gene: AMPD2 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: AMPD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AMPD2 were set to 23911318; 27066553; 29761117
Phenotypes for gene: AMPD2 were set to Pontocerebellar hypoplasia, type 9, MIM# 615809
Review for gene: AMPD2 was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap: ID and spastic paraplegia. Reported in CP cohort.
Sources: Expert Review
Incidentalome v0.79 Zornitza Stark removed gene:ALS2 from the panel
Mendeliome v0.9186 ALS2 Zornitza Stark Marked gene: ALS2 as ready
Mendeliome v0.9186 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Mendeliome v0.9186 ALS2 Zornitza Stark Classified gene: ALS2 as Green List (high evidence)
Mendeliome v0.9186 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.80 ALS2 Zornitza Stark Marked gene: ALS2 as ready
Cerebral Palsy v0.80 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.80 ALS2 Zornitza Stark Classified gene: ALS2 as Green List (high evidence)
Cerebral Palsy v0.80 ALS2 Zornitza Stark Gene: als2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.79 ALS2 Zornitza Stark gene: ALS2 was added
gene: ALS2 was added to Cerebral Palsy. Sources: Expert Review
Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALS2 were set to 12145748; 33409823; 30128655
Phenotypes for gene: ALS2 were set to Spastic paralysis, infantile onset ascending, MIM# 607225
Review for gene: ALS2 was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap with CP.
Sources: Expert Review
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Marked gene: ALDH3A2 as ready
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Classified gene: ALDH3A2 as Green List (high evidence)
Cerebral Palsy v0.78 ALDH3A2 Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.77 ALDH3A2 Zornitza Stark gene: ALDH3A2 was added
gene: ALDH3A2 was added to Cerebral Palsy. Sources: Expert list
Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALDH3A2 were set to 9027499; 9829906; 28543186
Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome, MIM# 270200
Review for gene: ALDH3A2 was set to GREEN
Added comment: Well established gene-disease association. Phenotypic overlap with CP: ID and spastic paraplegia.
Sources: Expert list
Red cell disorders v1.0 Zornitza Stark promoted panel to version 1.0
Red cell disorders v0.222 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Mendeliome v0.9185 HBG2 Zornitza Stark Marked gene: HBG2 as ready
Mendeliome v0.9185 HBG2 Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence).
Mendeliome v0.9185 HBG2 Zornitza Stark Phenotypes for gene: HBG2 were changed from to Fetal hemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977
Mendeliome v0.9184 HBG2 Zornitza Stark Publications for gene: HBG2 were set to
Mendeliome v0.9183 HBG2 Zornitza Stark Mode of inheritance for gene: HBG2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9182 HBG2 Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26500940; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.221 HBG2 Zornitza Stark Marked gene: HBG2 as ready
Red cell disorders v0.221 HBG2 Zornitza Stark Gene: hbg2 has been classified as Green List (High Evidence).
Red cell disorders v0.221 HBG2 Zornitza Stark Phenotypes for gene: HBG2 were changed from Cyanosis, transient neonatal, 613977; 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1,141749 to Fetal haemoglobin quantitative trait locus 1, MIM# 141749; Cyanosis, transient neonatal, MIM# 613977
Red cell disorders v0.220 HBG2 Zornitza Stark Mode of inheritance for gene: HBG2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.219 HBG2 Zornitza Stark reviewed gene: HBG2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal hemoglobin quantitative trait locus 1, MIM# 141749, Cyanosis, transient neonatal, MIM# 613977; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9182 HBG1 Zornitza Stark Marked gene: HBG1 as ready
Mendeliome v0.9182 HBG1 Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence).
Mendeliome v0.9182 HBG1 Zornitza Stark Classified gene: HBG1 as Green List (high evidence)
Mendeliome v0.9182 HBG1 Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence).
Mendeliome v0.9181 HBG1 Zornitza Stark gene: HBG1 was added
gene: HBG1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: HBG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HBG1 were set to 26500940
Phenotypes for gene: HBG1 were set to Fetal haemoglobin quantitative trait locus 1, 141749
Review for gene: HBG1 was set to GREEN
Added comment: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations.
Sources: Expert Review
Red cell disorders v0.219 HBG1 Zornitza Stark Marked gene: HBG1 as ready
Red cell disorders v0.219 HBG1 Zornitza Stark Gene: hbg1 has been classified as Green List (High Evidence).
Red cell disorders v0.219 HBG1 Zornitza Stark Phenotypes for gene: HBG1 were changed from 141749 Globin Disorder; Globin Disorder; Fetal hemoglobin quantitative trait locus 1; 141749 Hereditary persistance of fetal haemoglobin; Fetal hemoglobin quantitative trait locus 1, 141749 to Fetal haemoglobin quantitative trait locus 1, 141749
Red cell disorders v0.218 HBG1 Zornitza Stark changed review comment from: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or hematologic manifestations.; to: Classic hereditary persistence of fetal hemoglobin (HPFH) is characterized by a substantial elevation of fetal hemoglobin (HbF) in adult red blood cells. There are no other phenotypic or haematologic manifestations.
Red cell disorders v0.218 HBG1 Zornitza Stark reviewed gene: HBG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fetal haemoglobin quantitative trait locus 1 141749; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.218 RPS24 Zornitza Stark Marked gene: RPS24 as ready
Red cell disorders v0.218 RPS24 Zornitza Stark Gene: rps24 has been classified as Green List (High Evidence).
Red cell disorders v0.218 RPS24 Zornitza Stark Phenotypes for gene: RPS24 were changed from Inherited Bone Marrow Failure Syndromes; Diamond-blackfan anemia 3, 610629; Diamond-Blackfan Anemia 3; Diamond Blackfan anemia; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 3; Diamond_Blackfan Anemia 3; 610629 Diamond_Blackfan Anemia 3; 610629 Diamond-blackfan anemia 3 to Diamond-Blackfan anaemia 3, MIM# 610629
Red cell disorders v0.217 RPS24 Zornitza Stark Publications for gene: RPS24 were set to 17186470; 23812780
Red cell disorders v0.216 RPS19 Zornitza Stark Marked gene: RPS19 as ready
Red cell disorders v0.216 RPS19 Zornitza Stark Gene: rps19 has been classified as Green List (High Evidence).
Red cell disorders v0.216 RPS19 Zornitza Stark Phenotypes for gene: RPS19 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 105650 Diamond-Blackfan anemia 1; 105650 Diamond_Blackfan Anemia 1; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 1; Diamond-Blackfan anemia 1, 105650; Diamond_Blackfan Anemia to Diamond-Blackfan anaemia 1, MIM# 105650; MONDO:0007110
Red cell disorders v0.215 RPS19 Zornitza Stark Publications for gene: RPS19 were set to 9988267
Red cell disorders v0.214 RPS17 Zornitza Stark Marked gene: RPS17 as ready
Red cell disorders v0.214 RPS17 Zornitza Stark Gene: rps17 has been classified as Green List (High Evidence).
Red cell disorders v0.214 RPS17 Zornitza Stark Phenotypes for gene: RPS17 were changed from Diamond-Blackfan anemia 4, 612527; 612527 Diamond-Blackfan anemia 4 to Diamond-Blackfan anaemia 4, MIM# 612527
Red cell disorders v0.213 RPS10 Zornitza Stark Marked gene: RPS10 as ready
Red cell disorders v0.213 RPS10 Zornitza Stark Gene: rps10 has been classified as Green List (High Evidence).
Red cell disorders v0.213 RPS10 Zornitza Stark Phenotypes for gene: RPS10 were changed from 613308 Diamond-Blackfan anemia 9; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; DIAMOND-BLACKFAN ANEMIA 9; Diamond-Blackfan Anemia 9; Diamond-Blackfan Anemia; Diamond-Blackfan anemia 9, 613308; 613308 Diamond_Blackfan Anemia 9; Diamond_Blackfan Anemia 9 to Diamond-Blackfan anaemia 9, MIM# 613308
Red cell disorders v0.212 RPS10 Zornitza Stark Publications for gene: RPS10 were set to 20116044
Red cell disorders v0.211 RPL9 Zornitza Stark Marked gene: RPL9 as ready
Red cell disorders v0.211 RPL9 Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.211 RPL9 Zornitza Stark Phenotypes for gene: RPL9 were changed from Diamond-Blackfan anemia; N/A Diamond-Blackfan anemia; ?Diamond-Blackfan anaemia to Diamond Blackfan anaemia
Red cell disorders v0.210 RPL9 Zornitza Stark Publications for gene: RPL9 were set to 29114930
Red cell disorders v0.209 RPL9 Zornitza Stark Classified gene: RPL9 as Amber List (moderate evidence)
Red cell disorders v0.209 RPL9 Zornitza Stark Gene: rpl9 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9180 WNT9B Zornitza Stark Marked gene: WNT9B as ready
Mendeliome v0.9180 WNT9B Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9180 WNT9B Zornitza Stark Phenotypes for gene: WNT9B were changed from to Renal agenesis/hypoplasia/dysplasia
Mendeliome v0.9179 WNT9B Zornitza Stark Publications for gene: WNT9B were set to
Mendeliome v0.9178 WNT9B Zornitza Stark Mode of inheritance for gene: WNT9B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9177 WNT9B Zornitza Stark Classified gene: WNT9B as Amber List (moderate evidence)
Mendeliome v0.9177 WNT9B Zornitza Stark Gene: wnt9b has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9176 WNT9B Zornitza Stark reviewed gene: WNT9B: Rating: AMBER; Mode of pathogenicity: None; Publications: 34145744; Phenotypes: Renal agenesis/hypoplasia/dysplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9176 DDX23 Zornitza Stark Marked gene: DDX23 as ready
Mendeliome v0.9176 DDX23 Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence).
Mendeliome v0.9176 DDX23 Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder
Mendeliome v0.9175 DDX23 Zornitza Stark Publications for gene: DDX23 were set to 33057194
Mendeliome v0.9174 DDX23 Zornitza Stark Classified gene: DDX23 as Green List (high evidence)
Mendeliome v0.9174 DDX23 Zornitza Stark Gene: ddx23 has been classified as Green List (High Evidence).
Mendeliome v0.9173 DDX23 Zornitza Stark reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: 34050707; Phenotypes: DDX23-associated neurodevelopmental disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4123 DDX23 Zornitza Stark Phenotypes for gene: DDX23 were changed from Developmental disorder to DDX23-associated neurodevelopmental disorder
Intellectual disability syndromic and non-syndromic v0.4122 DDX23 Zornitza Stark Publications for gene: DDX23 were set to 33057194
Pituitary hormone deficiency v0.17 CHD7 Belinda Chong edited their review of gene: CHD7: Changed publications: PMID: 29152903, PMID: 30733481
Pituitary hormone deficiency v0.17 CHD7 Belinda Chong reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29152903, 30733481; Phenotypes: CHARGE syndrome MIM# 214800, Hypogonadotropic hypogonadism 5 with or without anosmia MIM# 612370; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9173 TAF2 Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204; 24084144
Mendeliome v0.9172 TAF2 Zornitza Stark Classified gene: TAF2 as Green List (high evidence)
Mendeliome v0.9172 TAF2 Zornitza Stark Gene: taf2 has been classified as Green List (High Evidence).
Mendeliome v0.9171 TAF2 Zornitza Stark edited their review of gene: TAF2: Added comment: New report of 4 individuals from 2 unrelated families, with severe intellectual disability, global developmental delay, postnatal microcephaly, feet deformities and thin corpus callosum. They had homozygous TAF2 missense variants detected by Exome Sequencing.; Changed rating: GREEN; Changed publications: 21937992, 22633631, 26350204, 24084144, 34474177
Microcephaly v1.52 TAF2 Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204
Intellectual disability syndromic and non-syndromic v0.4121 TAF2 Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204
Mendeliome v0.9171 ERGIC1 Zornitza Stark Marked gene: ERGIC1 as ready
Mendeliome v0.9171 ERGIC1 Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9171 ERGIC1 Zornitza Stark Classified gene: ERGIC1 as Amber List (moderate evidence)
Mendeliome v0.9171 ERGIC1 Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9170 ERGIC1 Zornitza Stark gene: ERGIC1 was added
gene: ERGIC1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERGIC1 were set to 28317099; 34037256
Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100
Review for gene: ERGIC1 was set to AMBER
Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi.

Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents.
Sources: Literature
Arthrogryposis v0.296 ERGIC1 Zornitza Stark Marked gene: ERGIC1 as ready
Arthrogryposis v0.296 ERGIC1 Zornitza Stark Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9169 HMGB1 Zornitza Stark Phenotypes for gene: HMGB1 were changed from Mirror image foot polydactyly to Mirror image foot polydactyly; Developmental delay and microcephaly, no OMIM #
Mendeliome v0.9168 HMGB1 Zornitza Stark Publications for gene: HMGB1 were set to 34159400
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 Zornitza Stark Marked gene: HMGB1 as ready
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence).
Microcephaly v1.51 HMGB1 Zornitza Stark Marked gene: HMGB1 as ready
Microcephaly v1.51 HMGB1 Zornitza Stark Gene: hmgb1 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 SGCE Anna Le Fevre reviewed gene: SGCE: Rating: GREEN; Mode of pathogenicity: None; Publications: 11528394, 12325078, 17200151, 16227522, 20301587, 33200041; Phenotypes: myoclonus, dystonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9167 HMGB1 Chirag Patel reviewed gene: HMGB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34164801; Phenotypes: Developmental delay and microcephaly, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9167 HMGB1 Chirag Patel Classified gene: HMGB1 as Green List (high evidence)
Mendeliome v0.9167 HMGB1 Chirag Patel Gene: hmgb1 has been classified as Green List (High Evidence).
Microcephaly v1.51 HMGB1 Chirag Patel Phenotypes for gene: HMGB1 were changed from Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM #
Microcephaly v1.51 HMGB1 Chirag Patel Phenotypes for gene: HMGB1 were changed from 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM # to Developmental delay and microcephaly, no OMIM #
Microcephaly v1.50 HMGB1 Chirag Patel edited their review of gene: HMGB1: Changed phenotypes: Developmental delay and microcephaly, no OMIM #
Microcephaly v1.50 HMGB1 Chirag Patel Classified gene: HMGB1 as Green List (high evidence)
Microcephaly v1.50 HMGB1 Chirag Patel Gene: hmgb1 has been classified as Green List (High Evidence).
Microcephaly v1.49 HMGB1 Chirag Patel gene: HMGB1 was added
gene: HMGB1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HMGB1 were set to PMID: 34164801
Phenotypes for gene: HMGB1 were set to 0 ALDH5A1 1 ALDH7A1 0 ALG1 0 ALG11 1 ALG12 1 ALG13 1 ALG14 1 ALG3 1 ALG6 1 ALG8 1 ALG9 1 ALKBH8 1 ALMS1 0 AMER1 0 AMPD2 0 AMT 0 ANK2 2 ANKRD11 0 ANKRD17 2 AP1B1 1 AP1G1 1 AP1S1 0 AP1S2 0 AP2M1 1 AP3B1 0 AP3B2 1 AP4B1 1 AP4E1 1 AP4M1 1 AP4S1 1 APC2 1 APOPT1 1 ARCN1 1 ARF1 1 ARFGEF2 0 ARG1 0 ARHGEF9 1 ARID1A 1 ARID1B 1 ARID2 2 ARL13B 1 ARL6 1 ARMC9 1 ARSA 0 ARSB 1 ARSE 1 ARV1 0 ARX 0 ASAH1 0 ASH1L 1 ASL 1 ASNS 1 ASPA 0 ASPM 1 ASS1 0 ASTN1 1 ASXL1 0 ASXL2 0 ASXL3 1 ATAD1 1 ATAD3A 1 ATG7 1 ATIC 1 ATM 0 ATN1 1 ATP13A2 0 ATP1A1 1 ATP1A2 1 ATP1A3 2 ATP6AP1 1 ATP6AP2 0 ATP6V0A2 0 ATP6V1A 1 ATP6V1B2 0 ATP7A 0 ATP8A2 1 ATR 0 ATRX 0 AUH 0 AUTS2 1 B3GALNT2 1 B3GLCT 0 B4GALNT1 0 B4GALT1 1 B4GALT7 1 B9D2 1 BAZ2B 1 BBS1 0 BBS10 0 BBS12 0 BBS2 0 BBS4 1 BBS5 1 BBS7 1 BBS9 1 BCAP31 0 BCAS3 1 BCKDHA 0 BCKDHB 0 BCKDK 0 BCL11A 0 BCL11B 1 BCOR 1 BCORL1 1 BCS1L 0 BICRA 3 BLM 0 BMP4 0 BOLA3 0 BPTF 1 BRAF 0 BRAT1 1 BRD4 2 BRF1 1 BRIP1 1 BRPF1 1 BRSK2 1 BRWD3 0 BSCL2 0 BSND 1 BTD 0 BUB1B 0 C12orf4 0 C12orf57 0 C12orf65 0 C2CD3 1 C2orf69 1 C5orf42 1 CA2 1 CA8 1 CACNA1A 0 CACNA1B 1 CACNA1C 0 CACNA1D 1 CACNA1E 1 CACNA1G 2 CACNA1I 1 CACNA2D2 1 CAD 1 CAMK2A 0 CAMK2B 1 CAMK4 1 CAMTA1 2 CAPN15 1 CARS 1 CARS2 1 CASK 0 CBL 0 CBS 0 CBY1 1 CC2D1A 1 CC2D2A 0 CCBE1 1 CCDC22 0 CCDC47 1 CCDC88A 1 CCDC88C 2 CCND2 0 CDC42 0 CDC42BPB 1 CDH11 2 CDH15 0 CDH2 1 CDK10 0 CDK13 1 CDK19 1 CDK5RAP2 1 CDK8 1 CDKL5 0 CDON 0 CELF2 1 CENPF 0 CENPJ 0 CEP104 1 CEP120 1 CEP135 1 CEP152 1 CEP164 1 CEP290 0 CEP41 0 CEP55 1 CEP57 1 CEP83 1 CEP85L 1 CHAMP1 0 CHD1 1 CHD2 0 CHD3 1 CHD4 1 CHD5 1 CHD7 0 CHD8 0 CHKB 0 CHMP1A 1 CIC 0 CIT 0 CKAP2L 0 CLCN3 1 CLCN4 1 CLCN6 1 CLCNKB 1 CLN3 0 CLN5 1 CLN6 0 CLN8 0 CLP1 1 CLPB 1 CLTC 1 CNKSR2 0 CNNM2 0 CNOT1 3 CNOT2 1 CNOT3 2 CNPY3 1 CNTNAP1 1 CNTNAP2 0 COASY 1 COG1 0 COG4 1 COG5 1 COG6 1 COG7 0 COG8 1 COL4A1 0 COL4A2 0 COL4A3BP 0 COLEC11 0 COPB2 2 COQ4 0 COQ8A 0 COX10 1 COX15 0 CPS1 0 CRADD 1 CRB2 0 CREBBP 1 CSDE1 1 CSNK1G1 2 CSNK2A1 0 CSNK2B 0 CSPP1 1 CSTB 0 CTBP1 1 CTCF 1 CTDP1 0 CTNNA2 1 CTNNB1 0 CTSA 0 CTSD 0 CTU2 1 CUL3 2 CUL4B 0 CUX1 1 CUX2 1 CWC27 0 CWF19L1 1 CXorf56 1 CYB5R3 0 CYC1 0 CYFIP2 1 D2HGDH 0 DAG1 0 DARS 1 DARS2 0 DBT 0 DCAF17 0 DCHS1 0 DCPS 1 DCX 0 DDB1 2 DDC 0 DDHD2 0 DDX11 1 DDX23 2 DDX3X 0 DDX59 1 DDX6 1 DEAF1 1 DEGS1 1 DENND5A 1 DEPDC5 0 DHCR24 0 DHCR7 0 DHDDS 1 DHFR 1 DHPS 1 DHTKD1 0 DHX30 1 DHX37 2 DIAPH1 0 DIS3L2 0 DKC1 0 DLD 0 DLG3 1 DLG4 2 DLL1 1 DMD 0 DMXL2 1 DNAJC12 1 DNAJC19 0 DNM1 1 DNM1L 1 DNMT3A 1 DNMT3B 0 DOCK3 1 DOCK6 1 DOCK7 1 DOCK8 0 DOLK 1 DPAGT1 1 DPF2 0 DPH1 1 DPM1 0 DPM2 1 DPYD 1 DPYS 1 DPYSL5 1 DYM 1 DYNC1H1 0 DYNC1I2 1 DYRK1A 1 EARS2 1 EBF3 1 EBP 1 EDEM3 2 EED 1 EEF1A2 1 EEF2 1 EFTUD2 1 EHMT1 1 EIF2AK2 2 EIF2AK3 0 EIF2S3 1 EIF3F 1 EIF4A3 1 EIF5A 1 ELAC2 0 ELOVL4 0 ELP2 0 EMC1 1 EMC10 2 EML1 1 EP300 0 EPG5 1 ERCC1 1 ERCC2 0 ERCC3 0 ERCC5 1 ERCC6 0 ERCC6L2 0 ERCC8 0 ERLIN2 1 ESCO2 0 ETFA 1 ETFB 1 ETFDH 1 ETHE1 0 EXOC7 1 EXOSC3 0 EXOSC8 1 EXT2 1 EXTL3 1 EZH2 1 FAM111A 0 FAM126A 0 FAM20C 0 FAM50A 1 FAR1 1 FARS2 1 FARSA 1 FARSB 1 FAT4 0 FBRSL1 1 FBXL3 2 FBXL4 0 FBXO11 1 FBXO28 1 FBXO31 2 FBXW11 2 FBXW7 1 FDFT1 1 FGD1 1 FGF12 0 FGF13 1 FGF14 1 FGFR1 1 FGFR3 1 FH 0 FIG4 0 FITM2 1 FKRP 0 FKTN 0 FLNA 0 FLVCR2 0 FMN2 0 FMR1 0 FOLR1 1 FOXG1 0 FOXP1 2 FOXP2 1 FOXRED1 0 FRAS1 1 FRMPD4 1 FRRS1L 1 FTCD 1 FTSJ1 0 FUCA1 0 FUT8 1 GABBR2 1 GABRA1 1 GABRA2 1 GABRA5 1 GABRB2 0 GABRB3 1 GABRG2 1 GAD1 1 GALC 0 GALE 0 GALNT2 1 GALT 1 GAMT 0 GATA6 1 GATAD2B 1 GATM 1 GCDH 0 GCH1 0 GDI1 0 GEMIN5 1 GFAP 0 GFER 1 GFM1 0 GJC2 0 GK 0 GLB1 0 GLDC 0 GLI2 0 GLI3 0 GLIS3 1 GLS 1 GLUL 0 GLYCTK 0 GM2A 0 GMPPA 0 GMPPB 0 GNAI1 2 GNAO1 1 GNAS 1 GNB1 1 GNB2 3 GNB5 1 GNE 1 GNPAT 0 GNPTAB 0 GNPTG 1 GNS 0 GOLGA2 2 GOT2 1 GPAA1 1 GPC3 0 GPC4 1 GPT2 1 GRIA1 1 GRIA2 2 GRIA3 1 GRIA4 0 GRID2 0 GRIK2 1 GRIN1 1 GRIN2A 1 GRIN2B 1 GRIN2D 1 GRM1 0 GRM7 1 GSS 1 GTF2H5 0 GTF3C3 1 GTPBP2 1 GTPBP3 0 GUSB 1 H3F3A 1 H3F3B 1 HACE1 1 HADHA 0 HADHB 1 HCCS 0 HCFC1 0 HCN1 0 HDAC4 2 HDAC8 1 HECW2 2 HEPACAM 0 HERC1 0 HERC2 2 HESX1 0 HEXA 0 HEXB 0 HGSNAT 1 HIBCH 0 HID1 1 HIRA 1 HIST1H1E 1 HIST1H4C 2 HIVEP2 1 HK1 2 HLCS 0 HMGB1 1 HMGCL 0 HNMT 1 HNRNPH1 1 HNRNPH2 0 HNRNPK 0 HNRNPR 1 HNRNPU 1 HOXA1 0 HPD 0 HPDL 2 HPRT1 0 HRAS 1 HS2ST1 3 HSD17B10 0 HSD17B4 1 HSPD1 0 HSPG2 1 HTRA2 0 HUWE1 1 IARS 1 IBA57 1 IDH2 0 IDS 0 IDUA 0 IER3IP1 1 IFIH1 0 IFT172 0 IFT27 1 IFT74 1 IGF1 1 IGF1R 1 IKBKG 0 IL1RAPL1 0 IMPDH2 2 INPP5E 1 INPP5K 0 INTS1 1 IQSEC1 1 IQSEC2 1 IREB2 1 IRF2BPL 1 ISCA1 1 ISCA2 1 ISPD 0 ITPA 0 ITPR1 0 IVD 0 JAM3 1 JARID2 1 JMJD1C 2 KANSL1 1 KARS 1 KAT5 2 KAT6A 0 KAT6B 0 KAT8 1 KATNB1 1 KCNA2 1 KCNB1 1 KCNC1 0 KCNH1 1 KCNJ10 0 KCNJ11 0 KCNJ6 1 KCNK4 1 KCNK9 1 KCNMA1 1 KCNN2 1 KCNN3 1 KCNQ2 0 KCNQ3 1 KCNQ5 1 KCNT1 0 KCNT2 1 KCTD3 0 KCTD7 0 KDM1A 1 KDM3B 2 KDM4B 2 KDM5B 1 KDM5C 1 KDM6A 0 KDM6B 1 KIAA0586 0 KIAA1109 0 KIDINS220 1 KIF11 2 KIF14 1 KIF1A 2 KIF1BP 1 KIF21B 1 KIF2A 1 KIF5A 0 KIF5C 1 KIF7 0 KLF7 1 KLHL7 0 KMT2A 1 KMT2B 1 KMT2C 1 KMT2D 2 KMT2E 1 KMT5B 1 KNL1 1 KPTN 1 KRAS 0 L1CAM 0 L2HGDH 0 LAMA1 0 LAMA2 1 LAMB1 1 LAMB2 1 LAMC3 0 LAMP2 0 LARGE1 0 LARP7 1 LARS 2 LARS2 0 LIAS 1 LIG4 0 LINGO4 1 LINS1 0 LIPT1 1 LMBRD1 1 LMBRD2 2 LMNB1 2 LMNB2 2 LONP1 0 LRP2 0 LRPPRC 0 LSS 1 LTBP1 1 LYRM7 1 LZTFL1 1 LZTR1 1 MAB21L1 2 MAB21L2 1 MACF1 1 MADD 3 MAF 0 MAGEL2 1 MAN1B1 1 MAN2B1 1 MANBA 1 MAOA 1 MAP1B 1 MAP2K1 0 MAP2K2 0 MAPK1 2 MAPK8IP3 2 MAPKAPK5 1 MAPRE2 1 MASP1 1 MAST1 1 MAST3 1 MAT1A 0 MBD5 1 MBOAT7 0 MBTPS2 0 MCCC1 0 MCCC2 0 MCM3AP 1 MCOLN1 1 MCPH1 1 MDH2 0 MECP2 1 MED12 0 MED12L 1 MED13 1 MED13L 0 MED17 1 MED23 0 MED25 1 MED27 2 MEF2C 1 MEGF8 2 MEIS2 0 METTL23 2 METTL5 1 MFF 0 MFSD2A 1 MFSD8 1 MGAT2 1 MICU1 1 MID1 0 MIR17HG 2 MKKS 0 MKS1 0 MLC1 0 MLYCD 1 MMAA 0 MMAB 0 MMACHC 0 MMADHC 0 MN1 2 MOCS1 1 MOCS2 0 MOGS 1 MORC2 2 MPDU1 1 MPDZ 1 MPLKIP 1 MPP5 1 MPV17 1 MRPS22 0 MRPS34 1 MSL3 1 MSMO1 1 MTFMT 0 MTHFR 0 MTHFS 1 MTO1 1 MTOR 0 MTR 1 MTRR 1 MUT 0 MVK 0 MYCN 0 MYO5A 0 MYT1L 2 NAA10 0 NAA15 1 NACC1 0 NAGA 0 NAGLU 0 NALCN 0 NANS 0 NARS 2 NBEA 1 NCAPD2 2 NCAPG2 1 NCDN 2 NCKAP1 1 NDE1 1 NDP 0 NDST1 0 NDUFA1 0 NDUFA2 1 NDUFAF1 1 NDUFS1 1 NDUFS4 1 NDUFS7 0 NDUFS8 0 NDUFV1 0 NEDD4L 1 NEMF 2 NEU1 0 NEUROD2 1 NEXMIF 1 NF1 0 NFASC 1 NFIA 0 NFIB 1 NFIX 0 NFU1 1 NGLY1 0 NHS 0 NIPBL 1 NKAP 1 NKX2-1 0 NLGN3 0 NONO 0 NOVA2 1 NPC1 0 NPC2 0 NPHP1 0 NPHP3 1 NR2F1 1 NR4A2 2 NRAS 0 NRROS 1 NRXN1 0 NSD1 0 NSD2 1 NSDHL 1 NSUN2 0 NT5C2 1 NTNG2 1 NTRK1 0 NTRK2 1 NUBPL 0 NUDT2 1 NUP188 1 NUP214 2 NUS1 1 OCLN 0 OCRL 0 ODC1 1 OFD1 0 OGT 1 OPA3 0 OPHN1 0 OSGEP 1 OTC 0 OTUD5 2 OTUD6B 0 OTX2 0 OXR1 1 P4HTM 1 PACS1 1 PACS2 1 PAFAH1B1 1 PAH 0 PAK1 1 PAK3 1 PAM16 1 PARN 0 PARP6 1 PAX6 0 PAX8 0 PBX1 0 PC 0 PCCA 0 PCCB 0 PCDH12 1 PCDH19 0 PCDHGC4 1 PCGF2 1 PCNT 0 PCYT2 1 PDE10A 1 PDE4D 0 PDE6D 1 PDGFRB 0 PDHA1 0 PDHB 1 PDHX 0 PDP1 1 PDSS1 1 PDSS2 0 PEPD 0 PET100 1 PEX1 0 PEX10 0 PEX11B 0 PEX12 0 PEX13 0 PEX14 0 PEX16 0 PEX19 0 PEX2 0 PEX26 0 PEX3 0 PEX5 0 PEX6 0 PEX7 0 PGAP1 0 PGAP2 1 PGAP3 1 PGK1 1 PGM2L1 1 PGM3 1 PHACTR1 1 PHF21A 2 PHF6 0 PHF8 1 PHGDH 0 PHIP 1 PI4KA 1 PIBF1 2 PIDD1 1 PIGA 1 PIGB 2 PIGC 1 PIGG 1 PIGH 1 PIGK 1 PIGL 1 PIGN 1 PIGO 1 PIGP 2 PIGQ 1 PIGS 1 PIGT 1 PIGU 1 PIGV 1 PIGW 0 PIK3C2A 1 PIK3CA 0 PIK3R2 1 PISD 1 PITRM1 1 PLA2G6 0 PLAA 0 PLCB1 1 PLK4 1 PLP1 0 PLPBP 1 PMM2 0 PMPCA 1 PMPCB 1 PNKP 1 PNPLA6 0 PNPT1 1 POGZ 1 POLA1 1 POLG 0 POLR1C 1 POLR2A 1 POLR3A 0 POLR3B 0 POLRMT 1 POMGNT1 0 POMGNT2 0 POMK 1 POMT1 0 POMT2 0 PORCN 0 POU3F3 1 PPIL1 1 PPM1D 1 PPP1CB 1 PPP1R12A 1 PPP1R15B 0 PPP1R21 1 PPP2CA 1 PPP2R1A 1 PPP2R5D 1 PPP3CA 0 PPT1 0 PQBP1 1 PRICKLE2 1 PRKAR1A 1 PRKAR1B 1 PRMT7 0 PRODH 0 PRPS1 0 PRR12 1 PRSS12 0 PRUNE1 1 PSAP 1 PSMD12 0 PSPH 0 PTCH1 0 PTCHD1 0 PTDSS1 0 PTEN 0 PTF1A 0 PTPN11 0 PTPN23 1 PTPN4 1 PTRHD1 1 PTS 0 PUF60 1 PUM1 1 PURA 1 PUS1 0 PUS3 1 PUS7 1 PYCR1 0 PYCR2 0 QARS 1 QDPR 0 QRICH1 1 RAB11B 1 RAB18 0 RAB23 0 RAB39B 0 RAB3GAP1 1 RAB3GAP2 0 RAC1 1 RAC3 1 RAD21 1 RAF1 0 RAI1 1 RALA 1 RALGAPA1 1 RAP1B 2 RARB 1 RARS 1 RARS2 0 RBBP8 0 RBM10 1 RELN 0 RERE 1 RFT1 1 RFX3 1 RFX4 1 RFX7 1 RHEB 1 RHOBTB2 1 RIT1 0 RLIM 1 RMND1 0 RNASEH2A 0 RNASEH2B 0 RNASEH2C 0 RNASET2 0 RNF125 0 RNF13 1 RNF220 1 RNU4ATAC 1 RNU7-1 2 ROGDI 1 ROR2 0 RORA 1 RPGRIP1L 0 RPIA 1 RPL10 1 RPS6KA3 0 RRM2B 0 RSRC1 1 RTEL1 0 RTN4IP1 1 RTTN 1 SAMD9 0 SAMHD1 0 SARS2 1 SATB1 2 SATB2 1 SBF1 1 SC5D 0 SCAF4 1 SCAMP5 2 SCAPER 1 SCN1A 1 SCN1B 1 SCN2A 0 SCN3A 1 SCN8A 0 SCO2 0 SDCCAG8 1 SDHA 0 SDHAF1 1 SEPSECS 1 SERAC1 0 SET 0 SETBP1 0 SETD1A 1 SETD1B 1 SETD2 1 SETD5 1 SFXN4 1 SGPL1 0 SGSH 1 SHANK2 0 SHANK3 1 SHH 0 SHMT2 2 SHOC2 1 SIAH1 1 SIK1 0 SIL1 1 SIN3A 0 SIN3B 1 SIX3 0 SKI 0 SLC12A2 3 SLC12A5 0 SLC12A6 0 SLC13A5 1 SLC16A2 1 SLC17A5 0 SLC18A2 1 SLC19A3 0 SLC1A1 1 SLC1A2 1 SLC1A4 1 SLC25A1 0 SLC25A12 0 SLC25A15 0 SLC25A22 0 SLC2A1 0 SLC33A1 0 SLC35A1 0 SLC35A2 0 SLC35C1 0 SLC39A14 0 SLC39A8 1 SLC46A1 1 SLC4A4 0 SLC5A6 1 SLC6A1 1 SLC6A17 0 SLC6A19 0 SLC6A3 0 SLC6A8 0 SLC6A9 1 SLC9A6 1 SLX4 0 SMAD4 0 SMARCA2 1 SMARCA4 0 SMARCA5 1 SMARCB1 0 SMARCC2 1 SMARCD1 1 SMARCE1 0 SMC1A 0 SMC3 0 SMG8 2 SMG9 1 SMOC1 1 SMPD1 1 SMPD4 1 SMS 0 SNAP25 1 SNAP29 0 SNRPB 1 SNX14 0 SNX27 1 SON 1 SOS1 1 SOS2 1 SOX10 0 SOX11 0 SOX2 1 SOX4 1 SOX5 1 SOX6 2 SOX9 0 SPART 1 SPATA5 1 SPECC1L 0 SPEN 2 SPG11 1 SPOP 1 SPR 0 SPRED1 1 SPTAN1 1 SPTBN1 1 SPTBN2 0 SPTBN4 2 SRCAP 2 SRD5A3 0 SSR4 0 ST3GAL3 0 ST3GAL5 2 STAG1 0 STAG2 1 STAMBP 1 STIL 1 STRA6 0 STRADA 1 STT3A 2 STX1B 0 STXBP1 0 SUCLA2 1 SUCLG1 0 SUFU 1 SUMF1 1 SUOX 0 SUPT16H 1 SURF1 0 SUZ12 2 SVBP 2 SYN1 0 SYNCRIP 2 SYNGAP1 1 SYNJ1 0 SYP 0 SYT1 2 SZT2 0 TAF1 1 TAF2 2 TAF6 1 TANC2 2 TANGO2 0 TAOK1 1 TASP1 1 TAT 0 TAZ 0 TBC1D20 1 TBC1D23 0 TBC1D24 0 TBCD 1 TBCE 0 TBCK 0 TBL1XR1 0 TBR1 1 TBX1 1 TCF20 1 TCF4 0 TCF7L2 2 TCN2 1 TCTN2 0 TCTN3 1 TDP2 1 TECPR2 1 TELO2 1 TENM3 1 TERT 2 TET3 1 TFE3 2 TGIF1 1 TH 0 THOC2 1 THOC6 0 THRA 0 TIMM50 1 TINF2 1 TLK2 1 TMCO1 0 TMEM106B 1 TMEM165 1 TMEM216 0 TMEM222 2 TMEM237 1 TMEM240 0 TMEM5 0 TMEM67 1 TMEM70 0 TMEM94 1 TMTC3 1 TMX2 1 TNPO2 1 TNR 1 TNRC6B 2 TOE1 1 TOGARAM1 1 TP73 1 TPP1 1 TPP2 1 TRAF7 1 TRAIP 1 TRAK1 1 TRAPPC11 1 TRAPPC12 1 TRAPPC4 1 TRAPPC6B 1 TRAPPC9 2 TREX1 0 TRIM8 1 TRIO 1 TRIP12 1 TRIT1 1 TRMT1 1 TRMT10A 1 TRNT1 1 TRPM3 1 TRRAP 1 TSC1 0 TSC2 0 TSEN15 1 TSEN2 0 TSEN54 0 TSFM 0 TSHB 0 TSPAN7 0 TSPOAP1 1 TTC19 0 TTC37 0 TTC5 2 TTC8 1 TTI2 1 TUBA1A 0 TUBB 1 TUBB2A 1 TUBB2B 0 TUBB3 0 TUBB4A 0 TUBG1 0 TUBGCP2 1 TUBGCP6 1 TUSC3 1 TWIST1 0 UBA5 0 UBE2A 1 UBE3A 0 UBE3B 1 UBE4A 1 UBR1 1 UBR7 1 UBTF 1 UFC1 1 UFM1 1 UFSP2 2 UGDH 1 UGP2 1 UMPS 1 UNC80 1 UPB1 2 UPF3B 2 USP18 1 USP7 2 USP9X 1 VAMP2 2 VARS 1 VARS2 1 VIPAS39 1 VLDLR 0 VPS11 1 VPS13B 0 VPS33B 1 VPS41 1 VPS4A 3 VPS53 0 VRK1 0 WAC 1 WARS2 1 WASF1 2 WASHC4 3 WDFY3 1 WDPCP 1 WDR11 2 WDR26 1 WDR37 1 WDR4 2 WDR45 0 WDR45B 1 WDR62 1 WDR73 0 WDR81 1 WNT1 1 WNT5A 2 WWOX 0 XPA 2 XRCC4 0 XYLT1 2 YARS 1 YIF1B 2 YWHAG 1 YY1 0 ZBTB18 0 ZBTB20 0 ZBTB24 1 ZC4H2 0 ZDHHC9 0 ZEB2 1 ZFHX4 1 ZFYVE26 0 ZIC1 1 ZIC2 0 ZMIZ1 2 ZMYM2 2 ZMYND11 1 ZNF142 1 ZNF148 1 ZNF292 2 ZNF335 1 ZNF462 2 ZNF526 1 ZNF699 1 ZNF711 1 ZSWIM6 1 AASS 1 ACADSB 1 ACAT1 1 ADAM22 1 AKAP6 1 ALDOA 1 ALX1 1 ALX3 1 ALX4 1 AP2S1 1 ARF3 2 ARHGAP31 1 ARHGAP35 1 ARNT2 1 ATP6V0A1 1 ATP9A 1 ATXN2L 1 B3GALT6 1 B9D1 1 BBIP1 1 C16orf62 1 C8orf37 1 CACNB4 1 CAPZA2 1 CCDC174 1 CCDC78 1 CD96 1 CDK16 1 CDK6 1 CDKN1C 1 CEP63 1 CEP89 1 CHRM1 1 CHST14 1 CLCN2 1 CNKSR1 1 COPB1 1 COQ2 1 COQ9 1 COX14 1 COX20 1 COX7B 1 CPE 1 CRBN 1 CTC1 1 CTNND1 1 CTNND2 1 DDOST 1 DHX32 1 DLAT 1 DPH2 1 DPP6 2 DSCAM 1 EEF1B2 1 EEF1D 1 EIF2A 1 EMG1 1 EMX2 1 EPHA7 1 ERGIC3 2 EXOC2 2 EXOSC2 1 FANCB 1 FANCD2 1 FANCG 1 FASTKD2 1 FEM1B 1 FGFR2 1 FIBP 1 FOXP4 1 FRMD4A 1 FRY 1 FTO 1 FUK 1 GBA 1 GEMIN4 1 GIGYF1 1 GMNN 1 GNAI2 1 GNAQ 1 GORAB 1 GPHN 1 GSX2 1 GTF2E2 2 HARS 2 HAX1 1 HEATR5B 1 HIST1H4J 1 HNRNPD 1 HSPA9 1 HTT 1 HYLS1 1 ICE1 1 IMPA1 1 INPP4A 1 IQSEC3 2 ITCH 1 ITFG2 2 ITGA7 1 JAKMIP1 1 KCNJ1 1 KLHL15 1 LAS1L 1 LINGO1 1 LIPT2 1 LMAN2L 1 LNPK 1 LRRC32 1 LYST 1 MAGT1 1 MMGT1 1 MRPL3 2 MSL2 1 NBN 1 NDUFA10 1 NDUFA11 1 NDUFA9 1 NDUFAF2 1 NDUFAF3 1 NDUFAF4 1 NDUFAF5 1 NDUFAF6 1 NDUFB3 1 NDUFB9 1 NDUFS2 1 NDUFS3 1 NDUFS6 1 NDUFV2 1 NECAP1 1 NHP2 1 NMNAT1 1 NR2F2 1 NSF 1 PAX1 1 PDCD6IP 1 PDE2A 1 PHC1 1 PIEZO2 1 PIGY 1 PJA1 1 PLCH1 1 PLEKHG2 1 PLOD3 1 PLXNA2 1 PPP2R5C 1 PRKACB 2 PRKD1 2 PRRT2 1 PSAT1 1 PSMB1 1 PSMC3 1 PSMC5 1 PTRH2 1 RAB11A 1 RAB14 1 RAP1GDS1 1 RIC1 1 RMRP 1 RNF113A 1 RNF2 1 RPS23 1 RSPRY1 1 RUSC2 1 SACS 1 SEC31A 1 SEMA3E 1 SEMA5A 1 SHROOM4 1 SLC2A2 1 SLC35A3 2 SLC45A1 1 SLC5A5 1 SLC9A7 1 SMARCD2 1 SNORD118 1 SNRPN 1 SOX3 2 SRRM2 1 STN1 1 TACO1 1 TAF13 1 TAF1C 1 TARS 1 TBC1D2B 2 TBC1D7 1 TGFB1 1 THRB 1 TKFC 1 TKT 2 TMEM231 1 TMLHE 1 TNIK 1 TOP2B 1 TRAPPC2L 1 TRIP13 1 TTI1 2 TUBGCP4 1 TUFM 1 U2AF2 1 UPF1 1 UQCC2 1 USP27X 1 VPS37A 1 VPS50 1 VPS51 1 WFS1 2 YAP1 1 ZBTB11 1 ZBTB16 1 ZC3H14 4 ZFHX3 2 ZNF407 2 ZNF668 1 ABCC6 2 ABCG5 1 ACOX2 1 ACTA1 1 ADA2 1 ADAMTSL2 1 ADCY5 1 ADGRB3 1 ADGRG6 2 ADRA2B 1 AFG3L2 1 AGGF1 1 AGK 1 AGL 1 AGO3 1 AGPS 1 AGT 1 AGTR2 1 AKR1C2 1 ALDOB 1 ALG2 1 ALS2 1 ANK3 1 ANKH 1 APTX 1 AR 1 ARHGEF6 1 ASMT 1 ATL1 1 ATP10A 1 ATP2A2 1 ATP2B3 1 ATP2C2 1 ATXN10 1 AVP 1 AVPR1A 1 AVPR2 1 B3GAT3 1 BDNF 1 BICD2 1 BIN1 1 BMPER 1 C19orf12 1 C3orf58 1 CA5A 1 CACNG2 1 CANT1 1 CCDC8 1 CDC6 1 CDK5R1 1 CDT1 1 CFH 1 CFHR1 1 CFHR3 1 CHRNA4 1 CISD2 1 CLCNKA 1 CLIC2 1 CLIP2 1 CLPP 1 CMAS 1 CNTN3 1 CNTN4 1 CNTN6 1 CNTNAP5 1 COA3 1 COL18A1 1 COL1A2 1 COLEC10 1 COQ5 1 CORO1A 1 COX4I2 1 COX6B1 1 CP 1 CPA6 1 CRKL 1 CRLF1 1 CRTAP 1 CTSF 1 CUBN 1 CYFIP1 1 CYP27A1 1 CYP2U1 1 DDR2 1 DISP1 1 DLGAP2 1 DLK1 2 DNAJA1 1 DNAJC3 1 DNAJC6 1 DOCK4 1 DOK7 1 DPM3 1 DPP10 1 DSCR3 1 DSE 1 DTYMK 1 DUOXA2 1 DYNC2H1 1 EDC3 1 EDNRB 1 EFNB1 1 EFNB2 1 EIF2AK1 1 EIF2B1 1 EIF2B2 1 EIF2B3 1 EIF2B4 1 EIF2B5 1 ELMOD1 1 EOGT 1 EOMES 1 EPB41L1 1 EPM2A 1 ERCC4 1 ERF 1 ERMARD 1 ETS1 1 EVC 1 EVC2 1 FA2H 1 FAAH2 1 FAM160B1 1 FBLN5 1 FBN1 1 FDXR 1 FGF3 1 FLNB 1 FLVCR1 1 FTL 1 FZD3 1 G6PC3 1 GABRG1 1 GAN 1 GATA1 1 GBA2 1 GBE1 1 GCK 1 GCSH 1 GHR 1 GJA1 1 GJB1 1 GLRA1 1 GLUD1 1 GNA14 1 GOSR2 1 GPSM2 1 GRPR 1 GSPT2 1 GTF2I 1 GTF2IRD1 1 GYS2 1 H19 1 HADH 1 HAL 1 HARS2 1 HOXD10 1 IFT140 1 IGBP1 1 IGF2 1 IMMP2L 1 INS 1 INSR 1 INTS8 1 IRX5 1 IYD 1 JAG1 1 JPH3 1 KANK1 1 KATNAL2 1 KCNC3 1 KCND3 1 KCTD13 1 KIF16B 1 KIF1B 1 KIF21A 1 KIF4A 1 KIRREL3 1 KLF8 1 KLLN 1 KYNU 1 LBR 1 LGI4 1 LHX3 1 LMNA 1 LRP5 1 LSM1 1 LSM11 2 MACROD2 1 MAP4K4 2 MARS2 2 MCM4 1 MEPCE 1 MET 1 METAP1 1 MFN2 1 MGME1 1 MGP 1 MID2 1 MLH1 1 MNX1 1 MPI 1 MPZ 1 MRAP 1 MRPS16 1 MSH6 1 MTM1 1 MTMR2 1 MTPAP 1 MYH3 1 MYMK 1 MYO7A 1 MYT1 1 NAGS 1 NDN 1 NEGR1 1 NGF 1 NHEJ1 1 NHLRC1 1 NIN 1 NLGN1 1 NLGN4X 1 NOP10 1 NOTCH3 1 NRXN2 1 NTNG1 1 NUP62 1 ORC1 1 ORC4 1 ORC6 1 OTUD7A 2 PANK2 1 PAX2 1 PAX3 1 PAX7 1 PCBD1 1 PCDH10 1 PCDH15 1 PCDH9 1 PCLO 1 PDE11A 1 PDGFB 1 PHKA2 1 PHKG2 1 PIGF 2 PIK3R1 1 PINK1 1 PIP5K1B 1 PNP 1 POC1A 1 POLD1 1 POLD2 1 PON3 1 POP1 1 POU1F1 1 PPM1K 1 PPOX 1 PRDM8 1 PREPL 1 PRF1 1 PRICKLE1 1 PRKDC 1 PRKN 1 PRKRA 1 PRRX1 1 PRX 1 PYGL 1 RAB27A 1 RAB40AL 1 RALGAPB 1 RANBP2 1 RAPSN 1 RASA1 2 RAX 1 RBFOX1 1 RBL2 1 RBM28 1 RBM8A 1 RBPJ 1 RECQL4 1 RET 1 RFX6 1 RIMS1 1 RIN2 1 RING1 1 RNF135 2 RPL11 1 RPS19 1 RPS28 1 RUBCN 1 SALL1 1 SAMD9L 1 SBDS 1 SCN11A 1 SCN9A 1 SCO1 1 SECISBP2 1 SELENOI 1 SELENON 1 SF3B4 1 SGCA 1 SH3TC2 1 SHANK1 1 SLC12A1 1 SLC19A2 1 SLC1A3 1 SLC20A2 1 SLC22A5 1 SLC25A13 1 SLC25A19 1 SLC25A20 1 SLC25A24 1 SLC25A4 2 SLC29A3 1 SLC2A10 1 SLC39A4 1 SLC44A1 2 SLC5A2 1 SLC6A4 1 SLC7A7 1 SLC9A9 1 SMCHD1 1 SMG6 1 SNIP1 1 SNRPA 1 SNRPE 2 SOBP 1 SOST 1 SP7 1 SPAST 1 SPEG 1 SPG7 2 SPINK5 1 SPRTN 1 SPTLC1 1 SRPX2 1 ST7 1 STAC3 1 STAT5B 1 STK3 1 STT3B 1 STX11 1 SYT14 1 TAF8 1 TDGF1 2 TECR 1 TFAP2A 1 TFAP2B 1 TFG 1 TG 1 TGFBR1 1 TGFBR2 1 THAP1 1 TIMM8A 1 TMEM260 1 TP63 1 TPH2 1 TPK1 1 TRAPPC6A 1 TREM2 1 TRHR 1 TRIM32 1 TRIM37 1 TSEN34 1 TSHR 1 TTC21B 1 TTR 1 TUBA8 1 TWNK 1 TXNL4A 1 UBE2U 1 UBR4 2 UCHL1 1 UGT1A1 1 UNC13A 1 UNC13D 1 UQCRB 1 UQCRC2 1 UQCRQ 1 UROC1 1 VAMP1 1 VANGL1 1 VPS45 1 WASHC5 1 WDR13 1 WDR19 1 WDR34 1 WIPI2 1 WRAP53 1 XIST 1 XPNPEP3 1 ZCCHC12 1 ZDHHC15 1 ZFP57 1 ZMYM3 1 ZNF41 1 ZNF423 1 ZNF507 1 ZNF674 1 ZNF804A 1 ZNF81 2 ZNHIT6 1 DIP2B 2 DMPK 2 Add a gene STRs in panel DM1 1 FRAXE 1 FRA12A 1 Add a STR Regions in panel Add a Region Intellectual disability syndromic and non-syndromic Gene: HMGB1 Green List (high evidence) You reviewed HMGB1 (high mobility group box 1) EnsemblGeneIds (GRCh38): ENSG00000189403 EnsemblGeneIds (GRCh37): ENSG00000189403 OMIM: 163905, Gene2Phenotype HMGB1 is in 3 panels Reviews (1) Details History Review feedback Review gene Rating: Rating Mode of Inheritance: Mode of Inheritance Mode of pathogenicity: Mode of pathogenicity Publications (PMID: 1234; 4321): Publications (PMID: 1234; 4321) Phenotypes (separate using a semi-colon -; ): Phenotypes (separate using a semi-colon -; ) Current diagnostic: Current diagnostic Comments: Comments 1 review Your review Chirag Patel (Genetic Health Queensland) Green List (high evidence) 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature Created: 17 Sep 2021, 4:56 a.m. Mode of inheritance MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes Developmental delay and microcephaly, no OMIM #
Review for gene: HMGB1 was set to GREEN
Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 Chirag Patel Classified gene: HMGB1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4120 HMGB1 Chirag Patel Gene: hmgb1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4119 HMGB1 Chirag Patel gene: HMGB1 was added
gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HMGB1 were set to PMID: 34164801
Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM #
Review for gene: HMGB1 was set to GREEN
Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome.
Sources: Literature
Arthrogryposis v0.296 ERGIC1 Chirag Patel Classified gene: ERGIC1 as Amber List (moderate evidence)
Arthrogryposis v0.296 ERGIC1 Chirag Patel Gene: ergic1 has been classified as Amber List (Moderate Evidence).
Arthrogryposis v0.295 ERGIC1 Chirag Patel gene: ERGIC1 was added
gene: ERGIC1 was added to Arthrogryposis. Sources: Literature
Mode of inheritance for gene: ERGIC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERGIC1 were set to PMID: 28317099, 34037256
Phenotypes for gene: ERGIC1 were set to Arthrogryposis multiplex congenita 2, neurogenic type; OMIM # 208100
Review for gene: ERGIC1 was set to AMBER
Added comment: Reinstein et al. (2018) used WES in a large consanguineous Israeli Arab kindred consisting of 16 patients affected with the neurogenic type of arthrogryposis multiplex congenita. They identified a homozygous missense (V98E) mutation in ERGIC1 gene, which segregated with the disorder in the kindred, and was not found in the ExAC database or in 212 ethnically matched controls. Functional studies of the variant and studies of patient cells were not performed. ERGIC1 encodes a cycling membrane protein which has a possible role in transport between endoplasmic reticulum and Golgi.

Marconi et al (2021) used genome sequencing in a consanguineous family with 2 affected siblings presenting congenital arthrogryposis and some facial dysmorphism. They identified a homozygous 22.6 Kb deletion encompassing the promoter and first exon of ERGIC1. mRNA quantification showed the complete absence of ERGIC1 expression in the two affected siblings and a decrease in heterozygous parents.
Sources: Literature
Imprinting disorders v0.3 UBE3A Anna Le Fevre reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 8988171, 16470747; Phenotypes: Angelman syndrome OMIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Microcephaly v1.48 TAF2 Chirag Patel Classified gene: TAF2 as Green List (high evidence)
Microcephaly v1.48 TAF2 Chirag Patel Gene: taf2 has been classified as Green List (High Evidence).
Microcephaly v1.47 TAF2 Chirag Patel Classified gene: TAF2 as Green List (high evidence)
Microcephaly v1.47 TAF2 Chirag Patel Gene: taf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4118 TAF2 Chirag Patel Classified gene: TAF2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4118 TAF2 Chirag Patel Gene: taf2 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 ZFP57 Anna Le Fevre reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393, 27075368, 23150280, 30315371, 31399135, 33053156; Phenotypes: Transient Neonatal Diabetes Mellitus Type 1, Multi Locus Imprinting Disturbance, IUGR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v1.46 TAF2 Chirag Patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4117 TAF2 Chirag Patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 Chirag Patel Classified gene: DDX23 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 Chirag Patel Gene: ddx23 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 Chirag Patel Classified gene: DDX23 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4117 DDX23 Chirag Patel Gene: ddx23 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4116 DDX23 Chirag Patel reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34050707; Phenotypes: Neurodevelopmental disorder, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.208 RPL5 Zornitza Stark Marked gene: RPL5 as ready
Red cell disorders v0.208 RPL5 Zornitza Stark Gene: rpl5 has been classified as Green List (High Evidence).
Red cell disorders v0.208 RPL5 Zornitza Stark Phenotypes for gene: RPL5 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; 612561 Diamond-Blackfan anemia 6; Diamond-Blackfan anemia 6, 612561; Diamond-Blackfan Anemia 6; 612561 Diamond_Blackfan Anemia 6; Diamond-Blackfan Anemia; DIAMOND-BLACKFAN ANEMIA 6; Diamond_Blackfan Anemia 6 to Diamond-Blackfan anemia 6, MIM# 612561; MONDO:0012937
Red cell disorders v0.207 RPL35A Zornitza Stark Marked gene: RPL35A as ready
Red cell disorders v0.207 RPL35A Zornitza Stark Gene: rpl35a has been classified as Green List (High Evidence).
Red cell disorders v0.207 RPL35A Zornitza Stark Phenotypes for gene: RPL35A were changed from Inherited Bone Marrow Failure Syndromes; DIAMOND-BLACKFAN ANEMIA 5; Diamond-Blackfan anemia 5, 612528; 612528 Diamond-Blackfan anemia 5; Diamond Blackfan anemia; Diamond-Blackfan Anemia; Diamond-Blackfan Anemia 5; 612528 Diamond_Blackfan Anemia 5; Diamond_Blackfan Anemia 5 to Diamond-Blackfan anaemia 5, MIM# 612528
Red cell disorders v0.206 RPL35A Zornitza Stark Publications for gene: RPL35A were set to 18535205
Red cell disorders v0.205 RPL35A Zornitza Stark Tag SV/CNV tag was added to gene: RPL35A.
Red cell disorders v0.205 RPL31 Zornitza Stark Marked gene: RPL31 as ready
Red cell disorders v0.205 RPL31 Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.205 RPL31 Zornitza Stark Phenotypes for gene: RPL31 were changed from N/A ? Diamond-Blackfan Anaemia to Diamond Blackfan anaemia
Red cell disorders v0.204 RPL31 Zornitza Stark Classified gene: RPL31 as Amber List (moderate evidence)
Red cell disorders v0.204 RPL31 Zornitza Stark Gene: rpl31 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.203 RPL27 Zornitza Stark Marked gene: RPL27 as ready
Red cell disorders v0.203 RPL27 Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence).
Red cell disorders v0.203 RPL27 Zornitza Stark Phenotypes for gene: RPL27 were changed from Diamond-Blackfan anemia; Diamond-Blackfan anemia 16, 617408 to Diamond-Blackfan anemia 16, MIM# 617408
Red cell disorders v0.202 RPL27 Zornitza Stark Classified gene: RPL27 as Red List (low evidence)
Red cell disorders v0.202 RPL27 Zornitza Stark Gene: rpl27 has been classified as Red List (Low Evidence).
Mendeliome v0.9166 FCGR2B Zornitza Stark Marked gene: FCGR2B as ready
Mendeliome v0.9166 FCGR2B Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence).
Mendeliome v0.9166 FCGR2B Zornitza Stark Phenotypes for gene: FCGR2B were changed from to {Systemic lupus erythematosus, susceptibility to} MIM#152700
Mendeliome v0.9165 FCGR2B Zornitza Stark Publications for gene: FCGR2B were set to
Mendeliome v0.9164 FCGR2B Zornitza Stark Mode of inheritance for gene: FCGR2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9163 FCGR2B Zornitza Stark Classified gene: FCGR2B as Red List (low evidence)
Mendeliome v0.9163 FCGR2B Zornitza Stark Gene: fcgr2b has been classified as Red List (Low Evidence).
Red cell disorders v0.201 RPS26 Zornitza Stark Marked gene: RPS26 as ready
Red cell disorders v0.201 RPS26 Zornitza Stark Gene: rps26 has been classified as Green List (High Evidence).
Red cell disorders v0.201 RPS26 Zornitza Stark Phenotypes for gene: RPS26 were changed from Diamond-Blackfan anemia 10, 613309; Inherited Bone Marrow Failure Syndromes; Diamond-Blackfan anemia 10; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 613309 Diamond_Blackfan Anemia 10; Diamond_Blackfan Anemia 10; 613309 Diamond-Blackfan anemia 10 to Diamond-Blackfan anemia 10, MIM# 613309; MONDO:0013217
Red cell disorders v0.200 RPS27 Zornitza Stark Marked gene: RPS27 as ready
Red cell disorders v0.200 RPS27 Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence).
Red cell disorders v0.200 RPS27 Zornitza Stark Phenotypes for gene: RPS27 were changed from Diamond-Blackfan anemia; ?Diamond-Blackfan anemia 17, 617409; 617409 ?Diamond-Blackfan anemia 17, to Diamond-Blackfan anemia 17, MIM# 617409
Red cell disorders v0.199 RPS27 Zornitza Stark Publications for gene: RPS27 were set to 25424902; 23718193
Red cell disorders v0.198 RPS27 Zornitza Stark Classified gene: RPS27 as Red List (low evidence)
Red cell disorders v0.198 RPS27 Zornitza Stark Gene: rps27 has been classified as Red List (Low Evidence).
Red cell disorders v0.197 RPS29 Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, MIM# 615909 to Diamond-Blackfan anaemia 13, MIM# 615909
Red cell disorders v0.196 RPS29 Zornitza Stark Marked gene: RPS29 as ready
Red cell disorders v0.196 RPS29 Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.196 RPS29 Zornitza Stark Phenotypes for gene: RPS29 were changed from Diamond-Blackfan anemia 13, 615909; 615909 Diamond-Blackfan anemia 13 to Diamond-Blackfan anemia 13, MIM# 615909
Red cell disorders v0.195 RPS29 Zornitza Stark Classified gene: RPS29 as Amber List (moderate evidence)
Red cell disorders v0.195 RPS29 Zornitza Stark Gene: rps29 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.194 RPS7 Zornitza Stark Marked gene: RPS7 as ready
Red cell disorders v0.194 RPS7 Zornitza Stark Gene: rps7 has been classified as Green List (High Evidence).
Red cell disorders v0.194 RPS7 Zornitza Stark Phenotypes for gene: RPS7 were changed from Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan anemia 8, 612563; 612563 Diamond_Blackfan Anemia 8; DIAMOND-BLACKFAN ANEMIA 8; Diamond-Blackfan Anemia; 612563 Diamond-Blackfan anemia 8; Diamond_Blackfan Anemia 8 to Diamond-Blackfan anaemia 8, MIM# 612563; MONDO:0012939
Red cell disorders v0.193 RPS7 Zornitza Stark Publications for gene: RPS7 were set to 19061985; 27882484; 23718193
Red cell disorders v0.192 SBDS Zornitza Stark Marked gene: SBDS as ready
Red cell disorders v0.192 SBDS Zornitza Stark Gene: sbds has been classified as Green List (High Evidence).
Red cell disorders v0.192 SBDS Zornitza Stark Phenotypes for gene: SBDS were changed from 260400 Shwachman-Diamond syndrome; Shwachman-Diamond syndrome to Shwachman-Diamond syndrome, MIM# 260400
Red cell disorders v0.191 SEC23B Zornitza Stark Marked gene: SEC23B as ready
Red cell disorders v0.191 SEC23B Zornitza Stark Gene: sec23b has been classified as Green List (High Evidence).
Red cell disorders v0.191 SEC23B Zornitza Stark Phenotypes for gene: SEC23B were changed from Congenital Dyserythropoietic Anemia; ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; 224100 ANEMIA, DYSERYTHROPOIETIC CONGENITAL, TYPE II; Anemia, dyserythropoieticcongenital, type II, 224100; Congenital dyserythropoietic anemia type II; 224100 Congenital dyserythropoietic anaemia type 2 to Dyserythropoietic anaemia, congenital, type II , MIM#224100
Red cell disorders v0.190 SEC23B Zornitza Stark Publications for gene: SEC23B were set to 19561605
Red cell disorders v0.189 SLC19A2 Zornitza Stark Marked gene: SLC19A2 as ready
Red cell disorders v0.189 SLC19A2 Zornitza Stark Gene: slc19a2 has been classified as Green List (High Evidence).
Red cell disorders v0.189 SLC19A2 Zornitza Stark Phenotypes for gene: SLC19A2 were changed from 249270 Thiamine-Responsive Megaloblastic Anemia syndrome; Thiamine-Responsive Megaloblastic Anemia syndrome, 249270; 249270 Thiamine-responsive megaloblastic anemia syndrome to Thiamine-responsive megaloblastic anaemia syndrome, MIM# 249270
Red cell disorders v0.188 SLC25A38 Zornitza Stark Marked gene: SLC25A38 as ready
Red cell disorders v0.188 SLC25A38 Zornitza Stark Gene: slc25a38 has been classified as Green List (High Evidence).
Red cell disorders v0.188 SLC25A38 Zornitza Stark Phenotypes for gene: SLC25A38 were changed from Anemia, sideroblastic, 2, pyridoxine-refractory, 205950; 205950 Pyridoxine refractory sideroblastic anaemia 2; 205950 Anemia, sideroblastic, 2, pyridoxine-refractory to Anaemia, sideroblastic, 2, pyridoxine-refractory, MIM# 205950
Red cell disorders v0.187 XK Zornitza Stark Marked gene: XK as ready
Red cell disorders v0.187 XK Zornitza Stark Gene: xk has been classified as Green List (High Evidence).
Red cell disorders v0.187 XK Zornitza Stark Phenotypes for gene: XK were changed from 300842 McLeod syndrome to McLeod syndrome with or without chronic granulomatous disease MIM# 300842; absence of red blood cell Kx antigen; weak expression of Kell red blood cell antigens; neuroacanthocytosis (peripheral and central nervous systems); cardiovascular abnormalities; myopathy
Red cell disorders v0.186 XK Zornitza Stark Publications for gene: XK were set to 17683354; 11761473
Red cell disorders v0.185 NHP2 Zornitza Stark Marked gene: NHP2 as ready
Red cell disorders v0.185 NHP2 Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence).
Red cell disorders v0.185 NHP2 Zornitza Stark Phenotypes for gene: NHP2 were changed from 613987 Dyskeratosis congenita, autosomal recessive 2 to Dyskeratosis congenita, autosomal recessive 2, MIM# 613987
Red cell disorders v0.184 NHP2 Zornitza Stark Publications for gene: NHP2 were set to
Red cell disorders v0.183 NHP2 Zornitza Stark Classified gene: NHP2 as Red List (low evidence)
Red cell disorders v0.183 NHP2 Zornitza Stark Gene: nhp2 has been classified as Red List (Low Evidence).
Red cell disorders v0.182 NHP2 Zornitza Stark changed review comment from: Dyskeratosis congenita is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features. Three unrelated families reported.; to: Pancytopaenia.
Red cell disorders v0.182 NHP2 Zornitza Stark edited their review of gene: NHP2: Changed rating: RED
Red cell disorders v0.182 RPL18 Zornitza Stark Marked gene: RPL18 as ready
Red cell disorders v0.182 RPL18 Zornitza Stark Gene: rpl18 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.182 RPL18 Zornitza Stark Phenotypes for gene: RPL18 were changed from Diamond-Blackfan anaemia to Diamond-Blackfan anemia 18, MIM# 618310
Red cell disorders v0.181 RPL18 Zornitza Stark Publications for gene: RPL18 were set to 28280134
Red cell disorders v0.180 RPS28 Zornitza Stark Marked gene: RPS28 as ready
Red cell disorders v0.180 RPS28 Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.180 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 to Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164
Red cell disorders v0.179 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from 606164 Diamond Blackfan anemia 15 with mandibulofacial dysostosis; Diamond Blackfan anemia 15 with mandibulofacial dysostosis, 606164 to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164
Red cell disorders v0.178 TSR2 Zornitza Stark Marked gene: TSR2 as ready
Red cell disorders v0.178 TSR2 Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence).
Red cell disorders v0.178 TSR2 Zornitza Stark Phenotypes for gene: TSR2 were changed from 300946 ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis; ?Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, 300946 to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946
Red cell disorders v0.177 TSR2 Zornitza Stark Classified gene: TSR2 as Red List (low evidence)
Red cell disorders v0.177 TSR2 Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence).
Red cell disorders v0.176 ATRX Zornitza Stark Marked gene: ATRX as ready
Red cell disorders v0.176 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Red cell disorders v0.176 ATRX Zornitza Stark Phenotypes for gene: ATRX were changed from 301040 Alpha-thalassemia/mental retardation syndrome to Alpha-thalassaemia/mental retardation syndrome, MIM# 301040
Red cell disorders v0.175 ATRX Zornitza Stark Publications for gene: ATRX were set to 19444090; 17579672; 11449489
Red cell disorders v0.174 ATRX Zornitza Stark Mode of inheritance for gene: ATRX was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Red cell disorders v0.173 ATRX Zornitza Stark Classified gene: ATRX as Green List (high evidence)
Red cell disorders v0.173 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Red cell disorders v0.172 ATRX Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 7697714; Phenotypes: Alpha-thalassaemia/mental retardation syndrome, MIM# 301040; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Red cell disorders v0.172 DKC1 Zornitza Stark Marked gene: DKC1 as ready
Red cell disorders v0.172 DKC1 Zornitza Stark Gene: dkc1 has been classified as Red List (Low Evidence).
Red cell disorders v0.172 DKC1 Zornitza Stark Phenotypes for gene: DKC1 were changed from 305000 Dyskeratosis congenita, X-linked to Dyskeratosis congenita, X-linked 305000; Hoyeraal-Hreidarsson Syndrome
Red cell disorders v0.171 DKC1 Zornitza Stark Publications for gene: DKC1 were set to
Red cell disorders v0.170 DKC1 Zornitza Stark changed review comment from: Dyskeratosis congenita is classically defined by the triad of abnormal skin pigmentation, nail dystrophy, and leukoplakia of the oral mucosa. It is characterized by short telomeres. Progressive bone marrow failure occurs in over 80% of cases and is the main cause of early mortality. The phenotype is highly variable, and affected individuals may have multiple additional features, including pulmonary fibrosis, liver cirrhosis, premature hair loss and/or graying, osteoporosis, atresia of the lacrimal ducts, and learning difficulties. Males may have testicular atrophy. Predisposition to malignancy is an important feature.

Hoyeraal-Hreidarsson syndrome (HHS) refers to a clinically severe variant of DKC that is characterized by multisystem involvement and early onset in utero. Patients with HHS show intrauterine growth retardation, microcephaly, delayed development, and bone marrow failure resulting in immunodeficiency, cerebellar hypoplasia, and sometimes enteropathy. Death often occurs in childhood.

PMID: 25940403, at least 13 of the variants associated with dyskeratosis congenita were also reported to cause HHS: P10L, I38T, T66A, T67I, H68Q, H68Y, S121G, R158W, K314R, A353V, R378Q, A386T and IVS12+1, so NOT only variants in exon 11. Two mutations were only found in HH, T49M and S304N.; to: Pancytopaenia rather than a red cell disorder.
Red cell disorders v0.170 DKC1 Zornitza Stark edited their review of gene: DKC1: Changed rating: RED
Red cell disorders v0.170 Zornitza Stark removed gene:HBE1 from the panel
Red cell disorders v0.169 SF3B1 Zornitza Stark Marked gene: SF3B1 as ready
Red cell disorders v0.169 SF3B1 Zornitza Stark Gene: sf3b1 has been classified as Red List (Low Evidence).
Red cell disorders v0.169 SF3B1 Zornitza Stark Phenotypes for gene: SF3B1 were changed from 605590 Refractory anaemia with ring sideroblasts to Myelodysplastic syndrome, somatic MIM# 614286
Red cell disorders v0.168 SF3B1 Zornitza Stark Mode of inheritance for gene: SF3B1 was changed from Unknown to Other
Red cell disorders v0.167 SF3B1 Zornitza Stark Tag somatic tag was added to gene: SF3B1.
Mendeliome v0.9162 FCGR2B Paul De Fazio reviewed gene: FCGR2B: Rating: RED; Mode of pathogenicity: None; Publications: 12115230, 15153543, 20385827; Phenotypes: {Systemic lupus erythematosus, susceptibility to} MIM#152700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v0.9162 GPX1 Zornitza Stark Marked gene: GPX1 as ready
Mendeliome v0.9162 GPX1 Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence).
Mendeliome v0.9162 GPX1 Zornitza Stark gene: GPX1 was added
gene: GPX1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: GPX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GPX1 were set to 1131421; 476008; 5766310; 2492138
Phenotypes for gene: GPX1 were set to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164
Review for gene: GPX1 was set to RED
Added comment: No individuals reported with GPX1 variants identified as the cause of Haemolytic anaemia due to glutathione peroxidase deficiency. Multiple papers report a number of cases of Haemolytic anaemia due to glutathione peroxidase deficiency, however there is no defined link or variant to GPX1 (PMID: 5766310. PMID: 1131421, PMID: 2492138, PMID: 476008)

Overall, lowered glutathione peroxidase activity has been observed in a number of individuals with haemolytic anaemia however the evidence for a cause-and-effect relationship between the enzyme deficiency and the presenting anaemia is not evident.
Sources: Expert Review
Red cell disorders v0.167 GPX1 Zornitza Stark Marked gene: GPX1 as ready
Red cell disorders v0.167 GPX1 Zornitza Stark Gene: gpx1 has been classified as Red List (Low Evidence).
Red cell disorders v0.167 GPX1 Zornitza Stark Phenotypes for gene: GPX1 were changed from 614164 Hemolytic anemia due to glutathione peroxidase deficiency to Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164
Red cell disorders v0.166 GPX1 Zornitza Stark Publications for gene: GPX1 were set to 1131421
Mendeliome v0.9161 CYP51A1 Bryony Thompson Mode of inheritance for gene: CYP51A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9160 CYP51A1 Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cataract v0.289 CYP51A1 Bryony Thompson Phenotypes for gene: CYP51A1 were changed from to Congenital cataract; infantile liver disease
Cataract v0.288 CYP51A1 Bryony Thompson Publications for gene: CYP51A1 were set to
Cataract v0.287 CYP51A1 Bryony Thompson Marked gene: CYP51A1 as ready
Cataract v0.287 CYP51A1 Bryony Thompson Gene: cyp51a1 has been classified as Green List (High Evidence).
Cataract v0.287 CYP51A1 Bryony Thompson reviewed gene: CYP51A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22935719, 26622071, 27878435, 25148791; Phenotypes: Congenital cataract, infantile liver disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9160 CYB5A Zornitza Stark Marked gene: CYB5A as ready
Mendeliome v0.9160 CYB5A Zornitza Stark Gene: cyb5a has been classified as Green List (High Evidence).
Mendeliome v0.9160 CYB5A Zornitza Stark Phenotypes for gene: CYB5A were changed from to Methemoglobinaemia and ambiguous genitalia, MIM# 250790
Mendeliome v0.9159 CYB5A Zornitza Stark Publications for gene: CYB5A were set to
Mendeliome v0.9158 CYB5A Zornitza Stark Mode of inheritance for gene: CYB5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9157 CYB5A Zornitza Stark reviewed gene: CYB5A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22170710, 32051920; Phenotypes: Methemoglobinemia and ambiguous genitalia 250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.165 CYB5A Zornitza Stark Marked gene: CYB5A as ready
Red cell disorders v0.165 CYB5A Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.165 CYB5A Zornitza Stark Phenotypes for gene: CYB5A were changed from 250790 Methemoglobinemia and ambiguous genitalia to Methemoglobinaemia and ambiguous genitalia MIM#250790
Red cell disorders v0.164 CYB5A Zornitza Stark Publications for gene: CYB5A were set to 8168836; 20080843
Red cell disorders v0.163 CYB5A Zornitza Stark Classified gene: CYB5A as Amber List (moderate evidence)
Red cell disorders v0.163 CYB5A Zornitza Stark Gene: cyb5a has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.162 FTCD Zornitza Stark Marked gene: FTCD as ready
Red cell disorders v0.162 FTCD Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.162 FTCD Zornitza Stark Phenotypes for gene: FTCD were changed from 229100 Glutamate formiminotransferase deficiency to Glutamate formiminotransferase deficiency MIM# 229100
Red cell disorders v0.161 FTCD Zornitza Stark Publications for gene: FTCD were set to 12815595
Red cell disorders v0.160 FTCD Zornitza Stark Classified gene: FTCD as Amber List (moderate evidence)
Red cell disorders v0.160 FTCD Zornitza Stark Gene: ftcd has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.159 GPX1 Danielle Ariti reviewed gene: GPX1: Rating: RED; Mode of pathogenicity: None; Publications: 1131421, 476008, 5766310, 2492138; Phenotypes: Haemolytic anaemia due to glutathione peroxidase deficiency MIM#614164; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.159 SH2B3 Zornitza Stark Marked gene: SH2B3 as ready
Red cell disorders v0.159 SH2B3 Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.159 SH2B3 Zornitza Stark Classified gene: SH2B3 as Amber List (moderate evidence)
Red cell disorders v0.159 SH2B3 Zornitza Stark Gene: sh2b3 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.158 SH2B3 Zornitza Stark gene: SH2B3 was added
gene: SH2B3 was added to Red cell disorders. Sources: Expert Review
somatic tags were added to gene: SH2B3.
Mode of inheritance for gene: SH2B3 was set to Other
Publications for gene: SH2B3 were set to 34349782; 23812944; 20843259
Phenotypes for gene: SH2B3 were set to Erythrocytosis, somatic, MIM# 133100
Mode of pathogenicity for gene: SH2B3 was set to Other
Review for gene: SH2B3 was set to AMBER
Added comment: Limited reports, variants appear to be somatic.
Sources: Expert Review
Red cell disorders v0.157 JAK2 Zornitza Stark Marked gene: JAK2 as ready
Red cell disorders v0.157 JAK2 Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.157 JAK2 Zornitza Stark Classified gene: JAK2 as Amber List (moderate evidence)
Red cell disorders v0.157 JAK2 Zornitza Stark Gene: jak2 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.156 JAK2 Zornitza Stark gene: JAK2 was added
gene: JAK2 was added to Red cell disorders. Sources: Expert Review
somatic tags were added to gene: JAK2.
Mode of inheritance for gene: JAK2 was set to Other
Publications for gene: JAK2 were set to 27389715
Phenotypes for gene: JAK2 were set to Erythrocytosis, somatic, 133100
Mode of pathogenicity for gene: JAK2 was set to Other
Review for gene: JAK2 was set to AMBER
Added comment: There is limited evidence to support an association of JAK2 variants with hereditary/congenital erythrocytosis. Typically, variants are somatic/acquired; and to date, only one report has described a patient with germline compound het variants (p.E846D and p.R1063H) in JAK2, who exhibited polyclonal erythrocytosis and megakaryocytic atypia but normal platelet number (PMID:27389715).

GoF somatic variants in this gene are also associated with polycythaemia vera (PV), particularly p.V617F, but also with reports of some familial clustering due to inheritance of the JAK2 46/1 predisposition haplotype.

Amber rating due to the somatic nature of variants.
Sources: Expert Review
Red cell disorders v0.155 VHL Zornitza Stark Marked gene: VHL as ready
Red cell disorders v0.155 VHL Zornitza Stark Gene: vhl has been classified as Green List (High Evidence).
Red cell disorders v0.155 VHL Zornitza Stark Classified gene: VHL as Green List (high evidence)
Red cell disorders v0.155 VHL Zornitza Stark Gene: vhl has been classified as Green List (High Evidence).
Red cell disorders v0.154 VHL Zornitza Stark gene: VHL was added
gene: VHL was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: VHL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VHL were set to 12844285; 21454469; 24729484; 23403324
Phenotypes for gene: VHL were set to Erythrocytosis, familial, 2, MIM# 263400
Mode of pathogenicity for gene: VHL was set to Other
Review for gene: VHL was set to GREEN
Added comment: Well established gene-disease association. Bi-allelic missense variants, postulated to be hypomorphic.

Note mono-allelic variants associated with Von Hippel Lindau syndrome.
Sources: Expert list
Red cell disorders v0.153 SF3B1 Danielle Ariti reviewed gene: SF3B1: Rating: RED; Mode of pathogenicity: Other; Publications: 21995386, 21909114; Phenotypes: Myelodysplastic syndrome, somatic MIM# 614286; Mode of inheritance: Other
Red cell disorders v0.153 CYB5A Danielle Ariti reviewed gene: CYB5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 22170710, 20080843, 32051920, 3951505; Phenotypes: Methemoglobinaemia and ambiguous genitalia MIM#250790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.153 EPOR Zornitza Stark Marked gene: EPOR as ready
Red cell disorders v0.153 EPOR Zornitza Stark Gene: epor has been classified as Green List (High Evidence).
Red cell disorders v0.153 EPOR Zornitza Stark Classified gene: EPOR as Green List (high evidence)
Red cell disorders v0.153 EPOR Zornitza Stark Gene: epor has been classified as Green List (High Evidence).
Red cell disorders v0.152 EPOR Zornitza Stark gene: EPOR was added
gene: EPOR was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EPOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPOR were set to 8506290; 9292543; 30507031; 33061762
Phenotypes for gene: EPOR were set to [Erythrocytosis, familial, 1], MIM# 133100
Review for gene: EPOR was set to GREEN
Added comment: Well established gene-disease association.
Sources: Expert list
Red cell disorders v0.151 FTCD Danielle Ariti reviewed gene: FTCD: Rating: AMBER; Mode of pathogenicity: None; Publications: 29178637, 30740726, 5301410; Phenotypes: Glutamate formiminotransferase deficiency MIM# 229100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 ALOX12B Zornitza Stark Marked gene: ALOX12B as ready
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 ALOX12B Zornitza Stark Gene: alox12b has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.107 ALOX12B Zornitza Stark Phenotypes for gene: ALOX12B were changed from to Ichthyosis, congenital, autosomal recessive 2, MIM# 242100
Palmoplantar Keratoderma and Erythrokeratoderma v0.106 ALOX12B Zornitza Stark Mode of inheritance for gene: ALOX12B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 ALOX12B Zornitza Stark reviewed gene: ALOX12B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, congenital, autosomal recessive 2, MIM# 242100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9157 COL14A1 Zornitza Stark Marked gene: COL14A1 as ready
Mendeliome v0.9157 COL14A1 Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence).
Mendeliome v0.9157 COL14A1 Zornitza Stark gene: COL14A1 was added
gene: COL14A1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL14A1 were set to 22972947
Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B
Review for gene: COL14A1 was set to RED
Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species.
Sources: Expert Review
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 COL14A1 Zornitza Stark Marked gene: COL14A1 as ready
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 COL14A1 Zornitza Stark Gene: col14a1 has been classified as Red List (Low Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.105 SMARCAD1 Zornitza Stark Phenotypes for gene: SMARCAD1 were changed from Basan syndrome (MIM#129200) to Basan syndrome, MIM#129200; Huriez syndrome, OMIM #181600
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 NLRP1 Zornitza Stark Marked gene: NLRP1 as ready
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 NLRP1 Zornitza Stark Gene: nlrp1 has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.104 Chirag Patel Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Royal Melbourne Hospital; Rare Disease
Palmoplantar Keratoderma and Erythrokeratoderma v0.103 NLRP1 Chirag Patel Classified gene: NLRP1 as Green List (high evidence)
Palmoplantar Keratoderma and Erythrokeratoderma v0.103 NLRP1 Chirag Patel Gene: nlrp1 has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.102 NLRP1 Chirag Patel gene: NLRP1 was added
gene: NLRP1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature
Mode of inheritance for gene: NLRP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NLRP1 were set to PMID: 27662089
Phenotypes for gene: NLRP1 were set to Palmoplantar carcinoma, multiple self-healing, OMIM # 615225
Review for gene: NLRP1 was set to GREEN
Added comment: Multiple self-healing palmoplantar carcinoma (MSPC) is characterised by recurrent keratoacanthomas in palmoplantar skin and conjunctival and corneal epithelia. Patients experience a high susceptibility to malignant squamous cell carcinoma.

Zhong et al. (2016) reported 3 families with variants in NLRP1
a) Affected mother and son with MSPC from a Caucasian French family. Whole exome sequencing (+ Sanger sequencing) identified a heterozygous missense mutation in NLRP1 gene (M77T), that appeared de novo in the mother and segregated with disease in the family. The variant was not found in 672 controls or 61 exome-sequenced subjects' DNA.
b) Large 5-generation Tunisian family segregating autosomal dominant MSPC. Whole exome sequencing identified a heterozygous missense mutation in exon 1 of NLRP1 gene (A54T), that segregated with disease in 16 family members.
c) 4-generation kindred with MSPC. Sanger sequencing of NLRP1 exon 1 identified heterozygosity for a missense mutation (A66V, that segregated with disease in the family.
d) 2 sibs in a consanguineous family with features of MSPC, with homozygous in-frame deletion in NLRP1 gene.
Functional analysis demonstrated that all 3 MSPC-associated missense mutations are gain-of-function variants that cause increased inflammasome activation.
Sources: Literature
Palmoplantar Keratoderma and Erythrokeratoderma v0.101 SMARCAD1 Chirag Patel Classified gene: SMARCAD1 as Green List (high evidence)
Palmoplantar Keratoderma and Erythrokeratoderma v0.101 SMARCAD1 Chirag Patel Gene: smarcad1 has been classified as Green List (High Evidence).
Palmoplantar Keratoderma and Erythrokeratoderma v0.100 SMARCAD1 Chirag Patel reviewed gene: SMARCAD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29409814; Phenotypes: Huriez syndrome, OMIM #181600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Palmoplantar Keratoderma and Erythrokeratoderma v0.100 COL14A1 Chirag Patel gene: COL14A1 was added
gene: COL14A1 was added to Palmoplantar Keratoderma and Erythrokeratoderma. Sources: Literature
Mode of inheritance for gene: COL14A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL14A1 were set to PMID: 22972947
Phenotypes for gene: COL14A1 were set to Punctate palmoplantar keratoderma type 1B
Review for gene: COL14A1 was set to RED
Added comment: 4 affected individuals and 2 unaffected controls from one Chinese PPPK family where disease locus was mapped at 8q24.13-8q24.21 by previous linkage analysis. Exome sequencing analysis identified a heterozygous variant in COL14A1 gene (c.4505C>T (p.Pro1502Leu)). The variant was shared by 4 affected individuals, but not 2 controls of the family. Sanger sequencing confirmed this variant in another four cases from this family. Variant was absent in the normal controls of this family as well as 676 unrelated normal controls and 781 patients with other disease. The missense substitution occurs at a highly conserved amino acid residue across multiple species.
Sources: Literature
Red cell disorders v0.151 EPO Zornitza Stark Marked gene: EPO as ready
Red cell disorders v0.151 EPO Zornitza Stark Gene: epo has been classified as Green List (High Evidence).
Red cell disorders v0.151 EPO Zornitza Stark Classified gene: EPO as Green List (high evidence)
Red cell disorders v0.151 EPO Zornitza Stark Gene: epo has been classified as Green List (High Evidence).
Red cell disorders v0.150 EPO Zornitza Stark gene: EPO was added
gene: EPO was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPO were set to 27651169; 29514032; 32130275; 20700488; 30507031; 28283061
Phenotypes for gene: EPO were set to Erythrocytosis, familial, 5, MIM# 617907; Diamond-Blackfan anaemia-like, MIM# 617911
Review for gene: EPO was set to GREEN
Added comment: More than 5 unrelated families reported, though note one paper has been retracted.

Single family with bi-allelic variants and a DBA phenotype.
Sources: Expert list
Red cell disorders v0.149 EPAS1 Zornitza Stark Marked gene: EPAS1 as ready
Red cell disorders v0.149 EPAS1 Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence).
Red cell disorders v0.149 EPAS1 Zornitza Stark Classified gene: EPAS1 as Green List (high evidence)
Red cell disorders v0.149 EPAS1 Zornitza Stark Gene: epas1 has been classified as Green List (High Evidence).
Red cell disorders v0.148 EPAS1 Zornitza Stark gene: EPAS1 was added
gene: EPAS1 was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EPAS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPAS1 were set to 18184961; 18378852; 22367913; 18650473
Phenotypes for gene: EPAS1 were set to Erythrocytosis, familial, 4, MIM# 611783
Mode of pathogenicity for gene: EPAS1 was set to Other
Review for gene: EPAS1 was set to GREEN
Added comment: Most mutations are gain-of-function missense variants in exon 12, but variants in exon 9 have also been described, in association with paraganglioma.
Sources: Expert list
Mendeliome v0.9156 EGLN1 Zornitza Stark Marked gene: EGLN1 as ready
Mendeliome v0.9156 EGLN1 Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence).
Mendeliome v0.9156 EGLN1 Zornitza Stark Phenotypes for gene: EGLN1 were changed from to Erythrocytosis, familial, 3, MIM# 609820
Mendeliome v0.9155 EGLN1 Zornitza Stark Publications for gene: EGLN1 were set to
Mendeliome v0.9154 EGLN1 Zornitza Stark Mode of inheritance for gene: EGLN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9153 EGLN1 Zornitza Stark reviewed gene: EGLN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19092153, 16407130, 17579185; Phenotypes: Erythrocytosis, familial, 3, MIM# 609820; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.147 EGLN1 Zornitza Stark Marked gene: EGLN1 as ready
Red cell disorders v0.147 EGLN1 Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence).
Red cell disorders v0.147 EGLN1 Zornitza Stark Classified gene: EGLN1 as Green List (high evidence)
Red cell disorders v0.147 EGLN1 Zornitza Stark Gene: egln1 has been classified as Green List (High Evidence).
Red cell disorders v0.146 EGLN1 Zornitza Stark gene: EGLN1 was added
gene: EGLN1 was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: EGLN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EGLN1 were set to 19092153; 16407130; 17579185
Phenotypes for gene: EGLN1 were set to Erythrocytosis, familial, 3, MIM# 609820
Review for gene: EGLN1 was set to GREEN
Added comment: At least 3 unrelated families reported.
Sources: Expert list
Red cell disorders v0.145 BPGM Zornitza Stark Marked gene: BPGM as ready
Red cell disorders v0.145 BPGM Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.145 BPGM Zornitza Stark Classified gene: BPGM as Amber List (moderate evidence)
Red cell disorders v0.145 BPGM Zornitza Stark Gene: bpgm has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.144 BPGM Zornitza Stark gene: BPGM was added
gene: BPGM was added to Red cell disorders. Sources: Expert list
Mode of inheritance for gene: BPGM was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: BPGM were set to 1421379; 27651169; 25015942
Phenotypes for gene: BPGM were set to Erythrocytosis, familial, 8, MIM# 222800
Review for gene: BPGM was set to AMBER
Added comment: Mixture of mono-allelic and bi-allelic variants reported, MOI uncertain.
Sources: Expert list
Holoprosencephaly and septo-optic dysplasia v1.2 RAD21 Zornitza Stark Publications for gene: RAD21 were set to 31334757
Holoprosencephaly and septo-optic dysplasia v1.1 RAD21 Arina Puzriakova reviewed gene: RAD21: Rating: ; Mode of pathogenicity: None; Publications: 32696056; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.9153 FGFR2 Zornitza Stark Marked gene: FGFR2 as ready
Mendeliome v0.9153 FGFR2 Zornitza Stark Gene: fgfr2 has been classified as Green List (High Evidence).
Mendeliome v0.9153 FGFR2 Zornitza Stark Phenotypes for gene: FGFR2 were changed from to Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis,MIM# 207410; Apert syndrome, MIM# 101200; Beare-Stevenson cutis gyrata syndrome, MIM# 123790; Bent bone dysplasia syndrome, MIM# 614592; Craniofacial-skeletal-dermatologic dysplasia, MIM# 101600; Craniosynostosis, nonspecific; Crouzon syndrome , MIM#123500; Jackson-Weiss syndrome,MIM# 123150; LADD syndrome, MIM# 149730; Pfeiffer syndrome,MIM# 101600; Saethre-Chotzen syndrome 101400
Mendeliome v0.9152 FGFR2 Zornitza Stark Publications for gene: FGFR2 were set to
Mendeliome v0.9151 FGFR2 Zornitza Stark Mode of inheritance for gene: FGFR2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9150 SLC4A1 Zornitza Stark Marked gene: SLC4A1 as ready
Mendeliome v0.9150 SLC4A1 Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence).
Mendeliome v0.9150 SLC4A1 Zornitza Stark Phenotypes for gene: SLC4A1 were changed from to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653; Distal renal tubular acidosis 1 MIM# 179800
Mendeliome v0.9149 SLC4A1 Zornitza Stark Publications for gene: SLC4A1 were set to
Mendeliome v0.9148 SLC4A1 Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9147 FGFR2 Chern Lim reviewed gene: FGFR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29848297, 32879300, 27323706; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Mendeliome v0.9147 SLC4A1 Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 7949112, 8640229, 16227998, 8640229, 16227998, 33881640, 32632909; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653, Distal renal tubular acidosis 1 MIM# 179800; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.143 TRNT1 Zornitza Stark Marked gene: TRNT1 as ready
Red cell disorders v0.143 TRNT1 Zornitza Stark Gene: trnt1 has been classified as Green List (High Evidence).
Red cell disorders v0.143 TRNT1 Zornitza Stark Phenotypes for gene: TRNT1 were changed from sideroblastic anaemia; 616084 Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay to Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084
Red cell disorders v0.142 TRNT1 Zornitza Stark Publications for gene: TRNT1 were set to
Red cell disorders v0.141 TRNT1 Zornitza Stark reviewed gene: TRNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25193871, 23553769, 29170023, 27389523; Phenotypes: Sideroblastic anaemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.27 STEAP3 Zornitza Stark Marked gene: STEAP3 as ready
Metal Metabolism Disorders v0.27 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Metal Metabolism Disorders v0.27 STEAP3 Zornitza Stark Phenotypes for gene: STEAP3 were changed from 615234 ?Anemia, hypochromic microcytic, with iron overload 2 to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234
Metal Metabolism Disorders v0.26 STEAP3 Zornitza Stark Publications for gene: STEAP3 were set to 22031863
Metal Metabolism Disorders v0.25 STEAP3 Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Metal Metabolism Disorders v0.24 STEAP3 Zornitza Stark Classified gene: STEAP3 as Red List (low evidence)
Metal Metabolism Disorders v0.24 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Metal Metabolism Disorders v0.23 STEAP3 Zornitza Stark reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9147 STEAP3 Zornitza Stark Phenotypes for gene: STEAP3 were changed from Anemia, hypochromic microcytic, with iron overload 2, MIM# 615234 to Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234
Mendeliome v0.9146 STEAP3 Zornitza Stark Publications for gene: STEAP3 were set to 22031863; 25515317
Mendeliome v0.9145 STEAP3 Zornitza Stark Classified gene: STEAP3 as Red List (low evidence)
Mendeliome v0.9145 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Mendeliome v0.9144 STEAP3 Zornitza Stark changed review comment from: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence.; to: Single family reported. Three affected sibs, variant inherited from unaffected father. Some supportive functional evidence.

Conflicting evidence (PMID 26675350): Large Chinese study (of normal and α-thalassemia subjects) investigated the prevalence of STEAP3 mutations in humans and their physiologic consequences. Discovered a relatively high prevalence of potentially harmful recessive alleles. However, whilst the identified STEAP3 mutations exhibited impaired ferrireductase activity in vitro, they had little or no effect on erythrocyte phenotypes
Mendeliome v0.9144 STEAP3 Zornitza Stark edited their review of gene: STEAP3: Changed rating: RED; Changed publications: 22031863, 25515317, 26675350; Changed phenotypes: Anaemia, hypochromic microcytic, with iron overload 2, MIM# 615234
Red cell disorders v0.141 STEAP3 Zornitza Stark Marked gene: STEAP3 as ready
Red cell disorders v0.141 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Red cell disorders v0.141 STEAP3 Zornitza Stark Phenotypes for gene: STEAP3 were changed from hypochromic anaemia to Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234
Red cell disorders v0.140 STEAP3 Zornitza Stark Publications for gene: STEAP3 were set to
Red cell disorders v0.139 STEAP3 Zornitza Stark Mode of inheritance for gene: STEAP3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.138 STEAP3 Zornitza Stark Classified gene: STEAP3 as Red List (low evidence)
Red cell disorders v0.138 STEAP3 Zornitza Stark Gene: steap3 has been classified as Red List (Low Evidence).
Red cell disorders v0.137 PGK1 Zornitza Stark Marked gene: PGK1 as ready
Red cell disorders v0.137 PGK1 Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence).
Red cell disorders v0.137 PGK1 Zornitza Stark Phenotypes for gene: PGK1 were changed from 300653 Phosphoglycerate kinase 1 deficiency to Phosphoglycerate kinase 1 deficiency MIM# 300653
Red cell disorders v0.136 PGK1 Zornitza Stark Publications for gene: PGK1 were set to 16740138; 6412025
Red cell disorders v0.135 PGK1 Zornitza Stark Classified gene: PGK1 as Green List (high evidence)
Red cell disorders v0.135 PGK1 Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence).
Red cell disorders v0.134 LARS2 Zornitza Stark Marked gene: LARS2 as ready
Red cell disorders v0.134 LARS2 Zornitza Stark Gene: lars2 has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.134 LARS2 Zornitza Stark Phenotypes for gene: LARS2 were changed from hydrops/sideroblastic anaemia to Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021
Red cell disorders v0.133 LARS2 Zornitza Stark Publications for gene: LARS2 were set to
Red cell disorders v0.132 LARS2 Zornitza Stark Mode of inheritance for gene: LARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.131 SLC4A1 Zornitza Stark Marked gene: SLC4A1 as ready
Red cell disorders v0.131 SLC4A1 Zornitza Stark Gene: slc4a1 has been classified as Green List (High Evidence).
Red cell disorders v0.131 SLC4A1 Zornitza Stark Phenotypes for gene: SLC4A1 were changed from 166900 Ovalocytosis, SA type, 185020 Cryohydrocytosis; RBC membrane abnormality; 166900 Ovalocytosis, SA type; Haemolytic Anemia; Cryohydrocytosis,185020; 612653 Spherocytosis, type 4; Ovalocytosis, SA type, 166900; Spherocytosis, type 4, 612653 to Cryohydrocytosis MIM# 185020; Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590; Ovalocytosis, SA type MIM# 166900; Spherocytosis, type 4 MIM# 612653
Red cell disorders v0.130 SLC4A1 Zornitza Stark Publications for gene: SLC4A1 were set to 1722314
Red cell disorders v0.129 SLC4A1 Zornitza Stark Mode of inheritance for gene: SLC4A1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.128 STEAP3 Danielle Ariti reviewed gene: STEAP3: Rating: RED; Mode of pathogenicity: None; Publications: 22031863, 25515317, 26675350; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 2 MIM# 615234; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.128 PGK1 Danielle Ariti reviewed gene: PGK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28580215, 20151463; Phenotypes: Phosphoglycerate kinase 1 deficiency MIM# 300653; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.128 LARS2 Danielle Ariti reviewed gene: LARS2: Rating: AMBER; Mode of pathogenicity: None; Publications: 26537577, 32442335; Phenotypes: Hydrops, lactic acidosis, and sideroblastic anaemia MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.128 SLC4A1 Danielle Ariti reviewed gene: SLC4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16227998, 15211439, 10926824, 7949112, 16392641, 8640229, 16227998, 8640229, 16227998; Phenotypes: Cryohydrocytosis MIM# 185020, Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590, Ovalocytosis, SA type MIM# 166900, Spherocytosis, type 4 MIM# 612653; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.128 RPL26 Zornitza Stark Marked gene: RPL26 as ready
Red cell disorders v0.128 RPL26 Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence).
Red cell disorders v0.128 RPL26 Zornitza Stark Phenotypes for gene: RPL26 were changed from Diamond-Blackfan anemia 11, MIM# 614900 to Diamond-Blackfan anaemia 11, MIM# 614900
Red cell disorders v0.127 RPL26 Zornitza Stark Phenotypes for gene: RPL26 were changed from ?Diamond-Blackfan anemia 11, 614900; 614900 ?Diamond-Blackfan anemia 11 to Diamond-Blackfan anemia 11, MIM# 614900
Red cell disorders v0.126 RPL26 Zornitza Stark Classified gene: RPL26 as Red List (low evidence)
Red cell disorders v0.126 RPL26 Zornitza Stark Gene: rpl26 has been classified as Red List (Low Evidence).
Red cell disorders v0.125 RPL15 Zornitza Stark Marked gene: RPL15 as ready
Red cell disorders v0.125 RPL15 Zornitza Stark Gene: rpl15 has been classified as Green List (High Evidence).
Red cell disorders v0.125 RPL15 Zornitza Stark Phenotypes for gene: RPL15 were changed from Diamond-Blackfan anemia 12, MIM# 615550 to Diamond-Blackfan anaemia 12, MIM# 615550
Red cell disorders v0.124 RPL15 Zornitza Stark Phenotypes for gene: RPL15 were changed from 615550 ?Diamond-Blackfan anaemia 12; ?Diamond-Blackfan anemia 12, 615550; 615550 ?Diamond-Blackfan anemia 1 to Diamond-Blackfan anemia 12, MIM# 615550
Red cell disorders v0.123 RPL15 Zornitza Stark Publications for gene: RPL15 were set to 23812780
Red cell disorders v0.122 RPL15 Zornitza Stark Mode of inheritance for gene: RPL15 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.121 RPL11 Zornitza Stark Marked gene: RPL11 as ready
Red cell disorders v0.121 RPL11 Zornitza Stark Gene: rpl11 has been classified as Green List (High Evidence).
Red cell disorders v0.121 RPL11 Zornitza Stark Phenotypes for gene: RPL11 were changed from Diamond_Blackfan Anemia 7; Inherited Bone Marrow Failure Syndromes; Diamond Blackfan anemia; Diamond-Blackfan Anemia; 612562 Diamond-Blackfan anemia 7; Diamond-Blackfan Anemia 7; 612562 Diamond_Blackfan Anemia 7; DIAMOND-BLACKFAN ANEMIA 7; Diamond-Blackfan anemia 7, 612562 to Diamond-Blackfan anemia 7, MIM# 612562; MONDO:0012938
Red cell disorders v0.120 PKLR Zornitza Stark Marked gene: PKLR as ready
Red cell disorders v0.120 PKLR Zornitza Stark Gene: pklr has been classified as Green List (High Evidence).
Red cell disorders v0.120 PKLR Zornitza Stark Phenotypes for gene: PKLR were changed from 266200 PYRUVATE KINASE DEFICIENCY; Enzyme Disorder; PYRUVATE KINASE DEFICIENCY; 266200 Pyruvate kinase deficiency; Pyruvate kinase deficiency, 266200; Pyruvate kinase deficiency to Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900; Pyruvate kinase deficiency, MIM# 266200
Red cell disorders v0.119 PKLR Zornitza Stark Mode of inheritance for gene: PKLR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.118 PKLR Zornitza Stark reviewed gene: PKLR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900, Pyruvate kinase deficiency, MIM# 266200; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.118 PIEZO1 Zornitza Stark Marked gene: PIEZO1 as ready
Red cell disorders v0.118 PIEZO1 Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence).
Red cell disorders v0.118 PIEZO1 Zornitza Stark Phenotypes for gene: PIEZO1 were changed from Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema, 194380; 194380 Stomatocytosis; Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Stomatocytosis; Dehydrated hereditary stomatocytosis; 616843 Lymphatic malformation 6; 194380 Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema; Hereditary xerocytosis to Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380
Red cell disorders v0.117 PIEZO1 Zornitza Stark Publications for gene: PIEZO1 were set to 22529292; 23695678
Red cell disorders v0.116 PIEZO1 Zornitza Stark Mode of inheritance for gene: PIEZO1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.115 PIEZO1 Zornitza Stark reviewed gene: PIEZO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21944700, 23695678, 23479567; Phenotypes: Dehydrated hereditary stomatocytosis with or without pseudohyperkalaemia and/or perinatal oedema, MIM# 194380; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.115 PFKM Zornitza Stark Marked gene: PFKM as ready
Red cell disorders v0.115 PFKM Zornitza Stark Gene: pfkm has been classified as Green List (High Evidence).
Red cell disorders v0.115 PFKM Zornitza Stark Phenotypes for gene: PFKM were changed from Glycogen storage disease VII, 232800; 232800 Glycogen storage disease VII to Glycogen storage disease VII, MIM# 232800
Red cell disorders v0.114 PFKM Zornitza Stark Publications for gene: PFKM were set to 7513946; 2140573
Red cell disorders v0.113 PFKM Zornitza Stark reviewed gene: PFKM: Rating: GREEN; Mode of pathogenicity: None; Publications: 24427140, 27066546, 30792690; Phenotypes: Glycogen storage disease VII, MIM# 232800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9144 NT5C3A Zornitza Stark Marked gene: NT5C3A as ready
Mendeliome v0.9144 NT5C3A Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence).
Mendeliome v0.9144 NT5C3A Zornitza Stark Phenotypes for gene: NT5C3A were changed from to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120
Mendeliome v0.9143 NT5C3A Zornitza Stark Publications for gene: NT5C3A were set to
Mendeliome v0.9142 NT5C3A Zornitza Stark Mode of inheritance for gene: NT5C3A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9141 NT5C3A Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.113 NT5C3A Zornitza Stark Marked gene: NT5C3A as ready
Red cell disorders v0.113 NT5C3A Zornitza Stark Gene: nt5c3a has been classified as Green List (High Evidence).
Red cell disorders v0.113 NT5C3A Zornitza Stark Phenotypes for gene: NT5C3A were changed from Anemia, hemolytic, due to UMPH1 deficiency, 266120; 266120 Anemia, hemolytic, due to UMPH1 deficiency to Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120
Red cell disorders v0.112 NT5C3A Zornitza Stark Publications for gene: NT5C3A were set to 11369620; 12714505
Red cell disorders v0.111 NT5C3A Zornitza Stark reviewed gene: NT5C3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11369620, 12714505, 30951028, 25153905; Phenotypes: Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Oligodontia v0.6 WNT10B Zornitza Stark Marked gene: WNT10B as ready
Oligodontia v0.6 WNT10B Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence).
Oligodontia v0.6 WNT10B Zornitza Stark Classified gene: WNT10B as Green List (high evidence)
Oligodontia v0.6 WNT10B Zornitza Stark Gene: wnt10b has been classified as Green List (High Evidence).
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Marked gene: RHOBTB2 as ready
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence).
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Classified gene: RHOBTB2 as Green List (high evidence)
Alternating Hemiplegia and Hemiplegic Migraine v0.51 RHOBTB2 Zornitza Stark Gene: rhobtb2 has been classified as Green List (High Evidence).
Alternating Hemiplegia and Hemiplegic Migraine v0.50 RHOBTB2 Zornitza Stark gene: RHOBTB2 was added
gene: RHOBTB2 was added to Alternating Hemiplegia and Hemiplegic Migraine. Sources: Literature
Mode of inheritance for gene: RHOBTB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RHOBTB2 were set to 33504645
Phenotypes for gene: RHOBTB2 were set to Developmental and epileptic encephalopathy 64 618004; Alternating hemiplegia
Review for gene: RHOBTB2 was set to GREEN
Added comment: Eleven affected patients were identified. All had heterozygous missense variants involving exon 9 of RHOBTB2, confirmed as de novo in 9 cases. All had a complex motor phenotype, including at least 2 different kinds of movement disorder, e.g., ataxia and dystonia. Many patients demonstrated several features fulfilling the criteria for AHC: 10 patients had a movement disorder including paroxysmal elements, and 8 experienced hemiplegic episodes. In contrast to classic AHC, commonly caused by mutations in ATP1A3, these events were reported later only in RHOBTB2 mutation-positive patients from 20 months of age.

All had ID, and many had seizures, so this represents an expansion of the phenotype rather than a distinct disorder.
Sources: Literature
Microcephaly v1.46 COPB2 Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence)
Microcephaly v1.46 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 COPB2 Zornitza Stark edited their review of gene: COPB2: Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported.
All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data.

Note one of the individuals with heterozygous variant had significant microcephaly in addition to the two sibs with bi-allelic variants.; Changed rating: AMBER; Changed publications: 29036432, 34450031; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Marked gene: COPB2 as ready
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Classified gene: COPB2 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.65 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.64 COPB2 Zornitza Stark gene: COPB2 was added
gene: COPB2 was added to Osteogenesis Imperfecta. Sources: Literature
Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COPB2 were set to 34450031
Phenotypes for gene: COPB2 were set to Osteoporosis, recurrent fractures and developmental delay
Review for gene: COPB2 was set to GREEN
Added comment: Loss-of-function variants in COPB2, a component of the COPI coatomer complex, in six individuals from five unrelated families. 4 are heterozygous and one family with two sibs with homozygous variant, previously reported.
All presenting with a clinical spectrum of osteoporosis or osteopaenia, many with recurrent fractures, and developmental delay of variable severity. Functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4116 COPB2 Zornitza Stark Classified gene: COPB2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4116 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4115 COPB2 Zornitza Stark reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Oligodontia v0.5 WNT10B Ain Roesley gene: WNT10B was added
gene: WNT10B was added to Oligodontia. Sources: Literature
Mode of inheritance for gene: WNT10B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: WNT10B were set to 27321946; 29364501; 21554266; 31050392
Phenotypes for gene: WNT10B were set to Tooth agenesis, selective, 8 MIM#617073
Penetrance for gene: WNT10B were set to unknown
Review for gene: WNT10B was set to GREEN
Added comment: PMID: 27321946; 4 unrelated families (including 1 with 3 affecteds). 3x missense and 1x truncating. Luciferase assays demonstrated LoF compared to WT.


PMID: 29364501; 7 unrelated families all missense. Arg159Pro identified in 4 families and family#5 also had variants in WNT10A.
Re-evaluation of a previously reported family #8 - 1 heterozygote who only had tooth agenesis while 6 other relatives who were homozygotes also had split hand-foot malformation

NOTE: No genotype phenotype correlation between AD tooth agenesis and AR split hand-foot malformation - missense have also been reported in SHFM (PMID: 31050392). While it's noted that most reports of SHFM did not investigate oligodontia in their patients or carrier parents, PMID: 21554266 noted their carrier parents were healthy and clinically distinguishable
Sources: Literature
Congenital Disorders of Glycosylation v1.18 SLC37A4 Zornitza Stark Phenotypes for gene: SLC37A4 were changed from Congenital disorder of glycosylation type II to Congenital disorder of glycosylation, type IIw, MIM# 619525
Congenital Disorders of Glycosylation v1.17 SLC37A4 Zornitza Stark edited their review of gene: SLC37A4: Changed phenotypes: Congenital disorder of glycosylation, type IIw 619525
Mendeliome v0.9141 IMPG1 Zornitza Stark Phenotypes for gene: IMPG1 were changed from Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200 to Macular dystrophy, vitelliform, 4, OMIM:616151; Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870
Mendeliome v0.9140 IMPG1 Zornitza Stark reviewed gene: IMPG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 91, MIM# 153870; Mode of inheritance: None
Retinitis pigmentosa v0.100 IMPG1 Zornitza Stark Phenotypes for gene: IMPG1 were changed from Retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa, MONDO:0019200; Retinitis pigmentosa 91, MIM# 153870
Retinitis pigmentosa v0.99 IMPG1 Zornitza Stark edited their review of gene: IMPG1: Changed phenotypes: Retinitis pigmentosa, MONDO:0019200, Retinitis pigmentosa 91, MIM# 153870
Mendeliome v0.9140 ABCC11 Zornitza Stark Marked gene: ABCC11 as ready
Mendeliome v0.9140 ABCC11 Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence).
Mendeliome v0.9140 ABCC11 Zornitza Stark Phenotypes for gene: ABCC11 were changed from to [Axillary odor, variation in] 117800; [Colostrum secretion, variation in] 117800; [Earwax, wet/dry] 117800
Mendeliome v0.9139 ABCC11 Zornitza Stark Classified gene: ABCC11 as Red List (low evidence)
Mendeliome v0.9139 ABCC11 Zornitza Stark Gene: abcc11 has been classified as Red List (Low Evidence).
Mendeliome v0.9138 ABCC11 Zornitza Stark reviewed gene: ABCC11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: [Axillary odor, variation in] 117800, [Colostrum secretion, variation in] 117800, [Earwax, wet/dry] 117800; Mode of inheritance: None
Red cell disorders v0.111 PUS1 Zornitza Stark Marked gene: PUS1 as ready
Red cell disorders v0.111 PUS1 Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence).
Red cell disorders v0.111 PUS1 Zornitza Stark Phenotypes for gene: PUS1 were changed from 600462 Myopathy, lactic acidosis, and sideroblastic anemia 1; Myopathy, Lactic Acidosis, and Sideroblastic Anemia, 600462; 600462 Myopathy, Lactic Acidosis, and Sideroblastic Anemia to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Red cell disorders v0.110 PUS1 Zornitza Stark Publications for gene: PUS1 were set to 15108122; 15772074
Red cell disorders v0.109 PUS1 Zornitza Stark edited their review of gene: PUS1: Changed phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Red cell disorders v0.109 HSPA9 Zornitza Stark Marked gene: HSPA9 as ready
Red cell disorders v0.109 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence).
Red cell disorders v0.109 HSPA9 Zornitza Stark Phenotypes for gene: HSPA9 were changed from sideroblastic anaemia; 182170 Sideroblastic anaemia 4; 182170 sideroblastic anaemia type 4; Sideroblastic anaemia type 4, 182170 to Anaemia, sideroblastic, 4, MIM# 182170
Red cell disorders v0.108 HSPA9 Zornitza Stark reviewed gene: HSPA9: Rating: GREEN; Mode of pathogenicity: None; Publications: 26491070; Phenotypes: Anaemia, sideroblastic, 4, MIM# 182170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9138 KCNN4 Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26198474; 26178367
Mendeliome v0.9137 KCNN4 Zornitza Stark changed review comment from: At least three families reported.
Sources: Expert list; to: Well established gene-disease association, more than 10 families and functional data.
Mendeliome v0.9137 KCNN4 Zornitza Stark edited their review of gene: KCNN4: Changed publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Changed phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689
Red cell disorders v0.108 KCNN4 Zornitza Stark Marked gene: KCNN4 as ready
Red cell disorders v0.108 KCNN4 Zornitza Stark Gene: kcnn4 has been classified as Green List (High Evidence).
Red cell disorders v0.108 KCNN4 Zornitza Stark Phenotypes for gene: KCNN4 were changed from Hereditary Xerocytosis; 616689 Dehydrated hereditary stomatocytosis 2 to Dehydrated hereditary stomatocytosis 2, MIM# 616689
Red cell disorders v0.107 KCNN4 Zornitza Stark Publications for gene: KCNN4 were set to 26148990; 26178367
Red cell disorders v0.106 KCNN4 Zornitza Stark Mode of inheritance for gene: KCNN4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.105 KCNN4 Zornitza Stark reviewed gene: KCNN4: Rating: GREEN; Mode of pathogenicity: None; Publications: 26148990, 26198474, 26178367, 33519508, 31091145, 28619848; Phenotypes: Dehydrated hereditary stomatocytosis 2, MIM# 616689; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.105 KLF1 Zornitza Stark Marked gene: KLF1 as ready
Red cell disorders v0.105 KLF1 Zornitza Stark Gene: klf1 has been classified as Green List (High Evidence).
Red cell disorders v0.105 KLF1 Zornitza Stark Phenotypes for gene: KLF1 were changed from 613673 Congenital dyserythropoietic anaemia type 4; Congenital Dyserythropoietic Anemia; 613673 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type IV, 613673; Dyserythropoietic anemia, congenital, type IV to Dyserythropoietic anaemia, congenital, type IV, MIM# 613673; MONDO:0013355
Red cell disorders v0.104 KLF1 Zornitza Stark Publications for gene: KLF1 were set to 21055716; 29200155
Red cell disorders v0.103 HK1 Zornitza Stark Marked gene: HK1 as ready
Red cell disorders v0.103 HK1 Zornitza Stark Gene: hk1 has been classified as Green List (High Evidence).
Red cell disorders v0.103 HK1 Zornitza Stark Phenotypes for gene: HK1 were changed from 235700 Enzyme Disorder; Hemolytic anemia due to hexokinase deficiency, 235700; 235700 Hemolytic anemia due to hexokinase deficiency; Hemolytic anemia due to hexokinase deficiency; Enzyme Disorder to Haemolytic anaemia due to hexokinase deficiency, MIM# 235700
Red cell disorders v0.102 HK1 Zornitza Stark Publications for gene: HK1 were set to 7655856; 12393545
Red cell disorders v0.101 HK1 Zornitza Stark reviewed gene: HK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7655856, 12393545, 33361148, 31119733, 27282571; Phenotypes: Haemolytic anaemia due to hexokinase deficiency, MIM# 235700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1193 HCN4 Zornitza Stark Marked gene: HCN4 as ready
Genetic Epilepsy v0.1193 HCN4 Zornitza Stark Gene: hcn4 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.1193 HCN4 Zornitza Stark gene: HCN4 was added
gene: HCN4 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for gene: HCN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HCN4 were set to 30127718; 29588962
Phenotypes for gene: HCN4 were set to {Epilepsy, idiopathic generalized, susceptibility to, 18}, MIM# 619521
Review for gene: HCN4 was set to RED
Added comment: Two families reported. Variant did not segregate with disease in one (PMID 29588962), and was present in two affected sibs from another family reported in PMID 30127718, some functional data to support impact of variant on protein function.
Sources: Expert list
Red cell disorders v0.101 KIF23 Zornitza Stark Marked gene: KIF23 as ready
Red cell disorders v0.101 KIF23 Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence).
Red cell disorders v0.101 KIF23 Zornitza Stark Phenotypes for gene: KIF23 were changed from Enzyme Disorder; Anaemia, dyserythropoietic congenital, type III; Congenital dyserythropoietic anemia (CDA); Congenital dyserythropoietic anemia type III; 605064 Congenital dyserythropoietic anaemia type 3; CDA III to Congenital dyserythropoietic anemia type III
Red cell disorders v0.100 KIF23 Zornitza Stark Classified gene: KIF23 as Red List (low evidence)
Red cell disorders v0.100 KIF23 Zornitza Stark Gene: kif23 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4115 MTRR Zornitza Stark Marked gene: MTRR as ready
Intellectual disability syndromic and non-syndromic v0.4115 MTRR Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4115 MTRR Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270
Intellectual disability syndromic and non-syndromic v0.4114 MTRR Zornitza Stark Publications for gene: MTRR were set to
Intellectual disability syndromic and non-syndromic v0.4113 MTRR Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4112 MTRR Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9137 MTRR Zornitza Stark Marked gene: MTRR as ready
Mendeliome v0.9137 MTRR Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence).
Mendeliome v0.9137 MTRR Zornitza Stark Phenotypes for gene: MTRR were changed from to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270
Mendeliome v0.9136 MTRR Zornitza Stark Publications for gene: MTRR were set to
Mendeliome v0.9135 MTRR Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9134 MTRR Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.99 MTRR Zornitza Stark Marked gene: MTRR as ready
Red cell disorders v0.99 MTRR Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence).
Red cell disorders v0.99 MTRR Zornitza Stark Phenotypes for gene: MTRR were changed from Homocystinuria-megaloblastic anemia, cbl E type, 236270; 236270 Homocystinuria-megaloblastic anemia, cbl E type to Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270
Red cell disorders v0.98 MTRR Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4112 MTR Zornitza Stark Marked gene: MTR as ready
Intellectual disability syndromic and non-syndromic v0.4112 MTR Zornitza Stark Gene: mtr has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4112 MTR Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940
Intellectual disability syndromic and non-syndromic v0.4111 MTR Zornitza Stark Publications for gene: MTR were set to
Intellectual disability syndromic and non-syndromic v0.4110 MTR Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4109 MTR Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9134 MTR Zornitza Stark Marked gene: MTR as ready
Mendeliome v0.9134 MTR Zornitza Stark Gene: mtr has been classified as Green List (High Evidence).
Mendeliome v0.9134 MTR Zornitza Stark Phenotypes for gene: MTR were changed from to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940
Mendeliome v0.9133 MTR Zornitza Stark Publications for gene: MTR were set to
Mendeliome v0.9132 MTR Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9131 MTR Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.98 MTR Zornitza Stark Marked gene: MTR as ready
Red cell disorders v0.98 MTR Zornitza Stark Gene: mtr has been classified as Green List (High Evidence).
Red cell disorders v0.98 MTR Zornitza Stark Phenotypes for gene: MTR were changed from Homocystinuria-megaloblastic anemia, cblG complementation type, 250940; 250940 Homocystinuria-megaloblastic anemia, cblG complementation type to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940
Red cell disorders v0.97 MTR Zornitza Stark Publications for gene: MTR were set to 9683607; 12068375
Red cell disorders v0.96 MTR Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Autoinflammatory Disorders v0.121 LPIN2 Zornitza Stark Marked gene: LPIN2 as ready
Autoinflammatory Disorders v0.121 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Autoinflammatory Disorders v0.121 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Autoinflammatory Disorders v0.120 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to
Autoinflammatory Disorders v0.119 LPIN2 Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Autoinflammatory Disorders v0.118 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9131 LPIN2 Zornitza Stark Marked gene: LPIN2 as ready
Mendeliome v0.9131 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Mendeliome v0.9131 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Mendeliome v0.9130 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to
Mendeliome v0.9129 LPIN2 Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9128 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.96 LPIN2 Zornitza Stark Marked gene: LPIN2 as ready
Red cell disorders v0.96 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Red cell disorders v0.96 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from Congenital dyserythropoietic anemia; Microcytic anemia; Majeed syndrome, 609628; 609628 Microcytic anemia; CDA; Majeed syndrome; 609628 Majeed syndrome to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Red cell disorders v0.95 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to 17330256; 15994876
Red cell disorders v0.94 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark Marked gene: KCNQ1 as ready
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark Gene: kcnq1 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark gene: KCNQ1 was added
gene: KCNQ1 was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: KCNQ1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNQ1 were set to 27539165
Phenotypes for gene: KCNQ1 were set to Long QT syndrome 1, 192500
Review for gene: KCNQ1 was set to RED
Added comment: Can present antenatally with bradycardia, but no specific mention of hydrops.
Sources: Expert Review
Hydrops fetalis v0.205 KCNH2 Zornitza Stark Marked gene: KCNH2 as ready
Hydrops fetalis v0.205 KCNH2 Zornitza Stark Gene: kcnh2 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.205 KCNH2 Zornitza Stark gene: KCNH2 was added
gene: KCNH2 was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNH2 were set to 27492745
Phenotypes for gene: KCNH2 were set to long QT syndrome
Review for gene: KCNH2 was set to RED
Added comment: Single case report identified of presentation with hydrops.
Sources: Expert Review
Hydrops fetalis v0.204 SCN5A Zornitza Stark Marked gene: SCN5A as ready
Hydrops fetalis v0.204 SCN5A Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence).
Hydrops fetalis v0.204 SCN5A Zornitza Stark Classified gene: SCN5A as Green List (high evidence)
Hydrops fetalis v0.204 SCN5A Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence).
Hydrops fetalis v0.203 SCN5A Zornitza Stark gene: SCN5A was added
gene: SCN5A was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SCN5A were set to 22064211; 15184283; 19419784
Phenotypes for gene: SCN5A were set to Long QT syndrome 3 (MIM#603830)
Review for gene: SCN5A was set to GREEN
Added comment: Three families reported with severe perinatal presentation, including hydrops.
Sources: Expert Review
Repeat Disorders v0.147 OPDM1 Zornitza Stark Tag adult-onset tag was added to STR: OPDM1.
Repeat Disorders v0.147 NIID Zornitza Stark Tag adult-onset tag was added to STR: NIID.
Repeat Disorders v0.147 Zornitza Stark Panel types changed to Australian Genomics; Royal Melbourne Hospital; Rare Disease
Repeat Disorders v0.146 VACTERLX Zornitza Stark Tag paediatric-onset tag was added to STR: VACTERLX.
Repeat Disorders v0.146 OPML1 Zornitza Stark Tag adult-onset tag was added to STR: OPML1.
Repeat Disorders v0.146 NIPA1 Zornitza Stark Marked STR: NIPA1 as ready
Repeat Disorders v0.146 NIPA1 Zornitza Stark Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 NIPA1 Zornitza Stark Tag adult-onset tag was added to STR: NIPA1.
Repeat Disorders v0.146 FRAXF Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXF.
Repeat Disorders v0.146 FRA7A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA7A.
Repeat Disorders v0.146 FRA11B Zornitza Stark Marked STR: FRA11B as ready
Repeat Disorders v0.146 FRA11B Zornitza Stark Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 FRA11B Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11B.
Repeat Disorders v0.146 FRA11A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11A.
Repeat Disorders v0.146 FAME7 Zornitza Stark Tag adult-onset tag was added to STR: FAME7.
Repeat Disorders v0.146 FAME6 Zornitza Stark Tag adult-onset tag was added to STR: FAME6.
Repeat Disorders v0.146 FAME4 Zornitza Stark Tag adult-onset tag was added to STR: FAME4.
Repeat Disorders v0.146 DMD Zornitza Stark Tag adult-onset tag was added to STR: DMD.
Tag paediatric-onset tag was added to STR: DMD.
Repeat Disorders v0.146 FRA2A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA2A.
Repeat Disorders v0.146 FRA12A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA12A.
Repeat Disorders v0.146 CCD Zornitza Stark Marked STR: CCD as ready
Repeat Disorders v0.146 CCD Zornitza Stark Str: ccd has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CCD Zornitza Stark Tag paediatric-onset tag was added to STR: CCD.
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Marked STR: CANVAS_ACAGG as ready
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Tag adult-onset tag was added to STR: CANVAS_ACAGG.
Repeat Disorders v0.146 XDP Zornitza Stark Tag adult-onset tag was added to STR: XDP.
Repeat Disorders v0.146 TOF Zornitza Stark Tag paediatric-onset tag was added to STR: TOF.
Repeat Disorders v0.146 SPD1 Zornitza Stark Tag paediatric-onset tag was added to STR: SPD1.
Repeat Disorders v0.146 SCA8 Zornitza Stark Tag adult-onset tag was added to STR: SCA8.
Repeat Disorders v0.146 SCA7 Zornitza Stark Tag adult-onset tag was added to STR: SCA7.
Repeat Disorders v0.146 SCA6 Zornitza Stark Tag adult-onset tag was added to STR: SCA6.
Repeat Disorders v0.146 SCA37 Zornitza Stark Tag adult-onset tag was added to STR: SCA37.
Repeat Disorders v0.146 SCA36 Zornitza Stark Tag adult-onset tag was added to STR: SCA36.
Repeat Disorders v0.146 SCA31 Zornitza Stark Tag adult-onset tag was added to STR: SCA31.
Repeat Disorders v0.146 SCA3 Zornitza Stark Tag adult-onset tag was added to STR: SCA3.
Tag paediatric-onset tag was added to STR: SCA3.
Repeat Disorders v0.146 SCA2 Zornitza Stark Tag adult-onset tag was added to STR: SCA2.
Tag paediatric-onset tag was added to STR: SCA2.
Repeat Disorders v0.146 SCA17 Zornitza Stark Tag adult-onset tag was added to STR: SCA17.
Tag paediatric-onset tag was added to STR: SCA17.
Repeat Disorders v0.146 SCA12 Zornitza Stark Tag adult-onset tag was added to STR: SCA12.
Tag paediatric-onset tag was added to STR: SCA12.
Repeat Disorders v0.146 SCA10 Zornitza Stark Tag adult-onset tag was added to STR: SCA10.
Mendeliome v0.9128 FOXE3 Zornitza Stark Marked gene: FOXE3 as ready
Mendeliome v0.9128 FOXE3 Zornitza Stark Gene: foxe3 has been classified as Green List (High Evidence).
Mendeliome v0.9128 FOXE3 Zornitza Stark Phenotypes for gene: FOXE3 were changed from to Anterior segment dysgenesis 2, multiple subtypes, MIM#610256; Cataract 34, multiple types, MIM#612968; Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349
Mendeliome v0.9127 FOXE3 Zornitza Stark Publications for gene: FOXE3 were set to
Mendeliome v0.9126 FOXE3 Zornitza Stark Mode of inheritance for gene: FOXE3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.9125 FOXE3 Eleanor Williams reviewed gene: FOXE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 26854927, 27218149, 16826526, 19708017, 20140963, 20664696, 20361012, 24019743, 27669367, 29878917, 32436650, 34046667, 11159941, 19708017, 20806047, 21150893, 11980846, 34046667; Phenotypes: Anterior segment dysgenesis 2, multiple subtypes, MIM#610256, Cataract 34, multiple types, MIM#612968, Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.9125 SLC26A1 Zornitza Stark Phenotypes for gene: SLC26A1 were changed from to Nephrolithiasis, calcium oxalate, MIM#167030
Mendeliome v0.9124 SLC26A1 Zornitza Stark Publications for gene: SLC26A1 were set to
Mendeliome v0.9123 SLC26A1 Zornitza Stark Mode of inheritance for gene: SLC26A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9122 SLC26A1 Zornitza Stark Classified gene: SLC26A1 as Amber List (moderate evidence)
Mendeliome v0.9122 SLC26A1 Zornitza Stark Gene: slc26a1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9121 SLC26A1 Zornitza Stark reviewed gene: SLC26A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27210743, 20160351, 30383413, 27125215; Phenotypes: Nephrolithiasis, calcium oxalate, MIM#167030; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9121 RHAG Zornitza Stark Marked gene: RHAG as ready
Mendeliome v0.9121 RHAG Zornitza Stark Gene: rhag has been classified as Green List (High Evidence).
Mendeliome v0.9121 RHAG Zornitza Stark Phenotypes for gene: RHAG were changed from to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000
Mendeliome v0.9120 RHAG Zornitza Stark Publications for gene: RHAG were set to
Mendeliome v0.9119 RHAG Zornitza Stark Mode of inheritance for gene: RHAG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9118 SPTA1 Zornitza Stark Marked gene: SPTA1 as ready
Mendeliome v0.9118 SPTA1 Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence).
Mendeliome v0.9118 SPTA1 Zornitza Stark Phenotypes for gene: SPTA1 were changed from to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970
Mendeliome v0.9117 SPTA1 Zornitza Stark Publications for gene: SPTA1 were set to
Mendeliome v0.9116 SPTA1 Zornitza Stark Mode of inheritance for gene: SPTA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9115 SPTA1 Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.94 RHAG Zornitza Stark Marked gene: RHAG as ready
Red cell disorders v0.94 RHAG Zornitza Stark Gene: rhag has been classified as Green List (High Evidence).
Red cell disorders v0.94 RHAG Zornitza Stark Phenotypes for gene: RHAG were changed from Stomatocytosis; Anemia, hemolytic, Rh-null, regulator type (BIALLELIC, autosomal or pseudoautosomal), 268150; 185000 Overhydrated hereditary stomatocytosis; Overhydrated hereditary stomatocytosis (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 185000; 268150 Anemia, hemolytic, Rh-null, regulator type to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000
Red cell disorders v0.93 RHAG Zornitza Stark Publications for gene: RHAG were set to 18931342
Red cell disorders v0.92 SLC11A2 Zornitza Stark Marked gene: SLC11A2 as ready
Red cell disorders v0.92 SLC11A2 Zornitza Stark Gene: slc11a2 has been classified as Green List (High Evidence).
Red cell disorders v0.92 SLC11A2 Zornitza Stark Phenotypes for gene: SLC11A2 were changed from 206100 Anemia, hypochromic microcytic, with iron overload 1; Anemia, hypochromic microcytic, with iron overload 1, 206100 to Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100
Red cell disorders v0.91 SLC11A2 Zornitza Stark Publications for gene: SLC11A2 were set to 16160008; 16439678; 15459009
Red cell disorders v0.90 SLC2A1 Zornitza Stark Marked gene: SLC2A1 as ready
Red cell disorders v0.90 SLC2A1 Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence).
Red cell disorders v0.90 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from Stomatocytosis; 612126 GLUT1 deficiency without epilepsy and/or hemolytic anemia; 608885 Stomatin-deficient cryohydrocytosis with neurologic defects; Pyridoxine-refractory sideroblastic anemia to Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885; delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia; haemolytic anaemia
Red cell disorders v0.89 SLC2A1 Zornitza Stark Publications for gene: SLC2A1 were set to 22492876; 21791420
Mendeliome v0.9115 SPTB Zornitza Stark Marked gene: SPTB as ready
Mendeliome v0.9115 SPTB Zornitza Stark Gene: sptb has been classified as Green List (High Evidence).
Red cell disorders v0.88 SPTA1 Zornitza Stark Marked gene: SPTA1 as ready
Red cell disorders v0.88 SPTA1 Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence).
Red cell disorders v0.88 SPTA1 Zornitza Stark Phenotypes for gene: SPTA1 were changed from 270970 Spherocytosis, type 3; 266140 Pyropoikilocytosis; RBC membrane abnormality; Pyropoikilocytosis (BIALLELIC, autosomal or pseudoautosomal), 266140; 266140 Pyropoikilocytosis, 270970 Spherocytosis, type 3; Spherocytosis, type 3 (BIALLELIC, autosomal or pseudoautosomal), 270970; 130600 Elliptocytosis-2; Elliptocytosis-2 (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 130600 to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970
Red cell disorders v0.87 SPTA1 Zornitza Stark Publications for gene: SPTA1 were set to 1679439; 3940543; 4077050
Mendeliome v0.9115 SPTB Zornitza Stark Phenotypes for gene: SPTB were changed from to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948
Mendeliome v0.9114 SPTB Zornitza Stark Publications for gene: SPTB were set to
Mendeliome v0.9113 SPTB Zornitza Stark Mode of inheritance for gene: SPTB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.86 SPTB Zornitza Stark Marked gene: SPTB as ready
Red cell disorders v0.86 SPTB Zornitza Stark Gene: sptb has been classified as Green List (High Evidence).
Red cell disorders v0.86 SPTB Zornitza Stark Phenotypes for gene: SPTB were changed from 617948 Elliptocytosis-3; Spherocytosis,616649; Anemia, neonatal hemolytic, fatal and near-fatal; RBC membrane abnormality; 616649 Spherocytosis, type 2; 616649 Anemia, neonatal hemolytic, fatal and near-fatal; Elliptocytosis to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948
Red cell disorders v0.85 SPTB Zornitza Stark Publications for gene: SPTB were set to 8226774; 3276733
Red cell disorders v0.84 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Red cell disorders v0.84 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Red cell disorders v0.84 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from megaloblastic bone marrow; neutropenia; thrombocytopenia; 275350 Transcobalamin II deficiency; Agammaglobulinemia; pancytopenia; neutropenic colitis; failure to thrive; Transcobalamin II deficiency; can have a presentation similar to severe combined immunodeficiency; hypotonia, myoclonic like movements, pallor, purpura, anaemia, thrombocytopenia, megaloblastosis, aplastic bone marrow to Transcobalamin II deficiency MIM# 275350; Decreased Ig levels; Megaloblastic anaemia; pancytopaenia; Reticulocytopaenia; failure to thrive; diarrhoea; hypogammaglobulinaemia; pallor; hypotonia; respiratory infection; if untreated (B12) for prolonged periods results in intellectual disability
Red cell disorders v0.83 TCN2 Zornitza Stark Publications for gene: TCN2 were set to 10518276; 7849710
Mendeliome v0.9112 TF Zornitza Stark Marked gene: TF as ready
Mendeliome v0.9112 TF Zornitza Stark Gene: tf has been classified as Green List (High Evidence).
Mendeliome v0.9112 TF Zornitza Stark Phenotypes for gene: TF were changed from to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure
Mendeliome v0.9111 TF Zornitza Stark Publications for gene: TF were set to
Mendeliome v0.9110 TF Zornitza Stark Mode of inheritance for gene: TF was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.82 TF Zornitza Stark Marked gene: TF as ready
Red cell disorders v0.82 TF Zornitza Stark Gene: tf has been classified as Green List (High Evidence).
Red cell disorders v0.82 TF Zornitza Stark Phenotypes for gene: TF were changed from Congenital hypotransferrinemia; Atransferrinemia, 209300; 209300 Congenital hypotransferrinemia to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure
Mendeliome v0.9109 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9109 RHAG Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9109 SPTB Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9109 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.81 RHAG Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.81 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.81 SLC2A1 Danielle Ariti reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27353637; Phenotypes: Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885, delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia, haemolytic anaemia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.81 HBD Zornitza Stark Marked gene: HBD as ready
Red cell disorders v0.81 HBD Zornitza Stark Gene: hbd has been classified as Green List (High Evidence).
Red cell disorders v0.81 HBD Zornitza Stark Phenotypes for gene: HBD were changed from Thalassemia due to Hb Lepore; Thalassemia,delta; Thalassemiadue to HbLepore; 141749 Delta-beta thalassaemia, thalassaemia due to Hb Lepore; Thalassemia, delta to Thalassaemia, delta-; Thalassaemia due to Hb Lepore
Red cell disorders v0.80 HBD Zornitza Stark reviewed gene: HBD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassaemia, delta-, Thalassaemia due to Hb Lepore; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.80 HBB Zornitza Stark Marked gene: HBB as ready
Red cell disorders v0.80 HBB Zornitza Stark Gene: hbb has been classified as Green List (High Evidence).
Red cell disorders v0.80 HBB Zornitza Stark Phenotypes for gene: HBB were changed from Sickle cell anemia (BIALLELIC, autosomal or pseudoautosomal),603903; 613985 Thalassemia, beta; Erythremias, beta-; 603902 Thalassemia-beta, dominant inclusion-body; Thalassemias, beta-,(BIALLELIC, autosomal or pseudoautosomal), 613985; Hereditary persistence of fetal hemoglobin,(MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown),141749; 603902 Dominand inclusion body beta thalassaemia; 603903 Sickle cell disease; 141749 Delta-beta thalassaemia; Heinz body anemias, beta- (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 140700; Globin Disorder; Thalassemia-beta, dominant inclusion-body, 603902; Delta-beta thalassemia (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 141749; 613985 Beta thalassaemia; Methemoglobinemias, beta- to Thalassemia, beta, MIM# 613985; Sickle cell anaemia, MIM# 603903; Methaemoglobinaemia, beta type, MIM# 617971; Hereditary persistence of fetal haemoglobin, MIM# 141749; Heinz body anaemia, MIM# 140700; Erythrocytosis 6, MIM# 617980
Red cell disorders v0.79 HBB Zornitza Stark reviewed gene: HBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, beta, MIM# 613985, Sickle cell anaemia, MIM# 603903, Methaemoglobinaemia, beta type, MIM# 617971, Hereditary persistence of fetal haemoglobin, MIM# 141749, Heinz body anaemia, MIM# 140700, Erythrocytosis 6, MIM# 617980; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.79 HBA2 Zornitza Stark Marked gene: HBA2 as ready
Red cell disorders v0.79 HBA2 Zornitza Stark Gene: hba2 has been classified as Green List (High Evidence).
Red cell disorders v0.79 HBA2 Zornitza Stark Phenotypes for gene: HBA2 were changed from Hypochromic microcytic anemia; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Erythrocytosis; 60413 Thalassemia, alpha; Heinz body anemia,140700; Thalassemia, alpha-, 604131 to Thalassemia, alpha-, MIM# 604131; Heinz body anaemia, MIM# 140700; Erythrocytosis 7, MIM# 617981
Red cell disorders v0.78 HBA2 Zornitza Stark reviewed gene: HBA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, alpha-, MIM# 604131, Heinz body anaemia, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.78 HBA1 Zornitza Stark Marked gene: HBA1 as ready
Red cell disorders v0.78 HBA1 Zornitza Stark Gene: hba1 has been classified as Green List (High Evidence).
Red cell disorders v0.78 HBA1 Zornitza Stark Phenotypes for gene: HBA1 were changed from Thalassemias, alpha-, 604131; 604131 Thalassemias, alpha; Erythremias, alpha-; Heinz body anemias, alpha-, 140700; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Methemoglobinemias, alpha- to Thalassemias, alpha-, MIM# 604131; Heinz body anemias, alpha-, MIM# 140700; Erythrocytosis 7, MIM# 617981
Red cell disorders v0.77 HBA1 Zornitza Stark reviewed gene: HBA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemias, alpha-, MIM# 604131, Heinz body anemias, alpha-, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.77 GSS Zornitza Stark Marked gene: GSS as ready
Red cell disorders v0.77 GSS Zornitza Stark Gene: gss has been classified as Green List (High Evidence).
Red cell disorders v0.77 GSS Zornitza Stark Phenotypes for gene: GSS were changed from 231900 Enzyme Disorder; Hemolytic anemia due to glutathione synthetase deficiency, 231900; 266130 Glutathione synthetase deficiency; Enzyme Disorder; Glutathione synthetase deficiency, 266130; Hemolytic anemia due to glutathione synthetase deficiency to Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900
Red cell disorders v0.76 GSS Zornitza Stark Publications for gene: GSS were set to 8896573
Red cell disorders v0.75 GSS Zornitza Stark reviewed gene: GSS: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896573, 31198081, 29395598, 29340523, 28267090; Phenotypes: Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.195 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; deafness; ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; deafness; ovarian insufficiency
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.194 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Deafness_IsolatedAndComplex v1.92 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Deafness_IsolatedAndComplex v1.91 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Muscular dystrophy and myopathy_Paediatric v0.93 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Muscular dystrophy and myopathy_Paediatric v0.92 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Mendeliome v0.9109 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Mendeliome v0.9108 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Red cell disorders v0.75 SPTA1 Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.75 SPTB Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.75 TCN2 Danielle Ariti reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency MIM# 275350, Decreased Ig levels, Megaloblastic anaemia, pancytopaenia, Reticulocytopaenia, failure to thrive, diarrhoea, hypogammaglobulinaemia, pallor, hypotonia, respiratory infection, if untreated (B12) for prolonged periods results in intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.75 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.146 SCA1 Zornitza Stark Tag adult-onset tag was added to STR: SCA1.
Repeat Disorders v0.146 SBMA Zornitza Stark Tag adult-onset tag was added to STR: SBMA.
Repeat Disorders v0.146 RCPS Zornitza Stark Tag paediatric-onset tag was added to STR: RCPS.
Repeat Disorders v0.146 CCHS Zornitza Stark Marked STR: CCHS as ready
Repeat Disorders v0.146 CCHS Zornitza Stark Str: cchs has been classified as Green List (High Evidence).
Mendeliome v0.9108 GSR Zornitza Stark Marked gene: GSR as ready
Mendeliome v0.9108 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9108 GSR Zornitza Stark Phenotypes for gene: GSR were changed from to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660
Mendeliome v0.9107 GSR Zornitza Stark Publications for gene: GSR were set to
Mendeliome v0.9106 GSR Zornitza Stark Mode of inheritance for gene: GSR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9105 GSR Zornitza Stark Classified gene: GSR as Amber List (moderate evidence)
Mendeliome v0.9105 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9104 GSR Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.75 GSR Zornitza Stark Marked gene: GSR as ready
Red cell disorders v0.75 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.75 GSR Zornitza Stark Phenotypes for gene: GSR were changed from Hemolytic anemia due to glutathione reductase deficiency; Enzyme Disorder; NA Enzyme Disorder to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660
Red cell disorders v0.74 GSR Zornitza Stark Publications for gene: GSR were set to 8533822
Red cell disorders v0.73 GSR Zornitza Stark Classified gene: GSR as Amber List (moderate evidence)
Red cell disorders v0.73 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.72 GSR Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.146 Bryony Thompson Panel status changed from internal to public
Arthrogryposis v0.294 MAGEL2 Zornitza Stark Publications for gene: MAGEL2 were set to 24076603; 27195816; 26365340
Arthrogryposis v0.293 MAGEL2 Zornitza Stark Mode of inheritance for gene: MAGEL2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9104 MKRN3 Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405 33214675 31041429 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Imprinting disorders v0.3 MKRN3 Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405, 33214675, 31041429, 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9104 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33820833, 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Arthrogryposis v0.292 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26365340, 33820833, 34128869; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Repeat Disorders v0.145 OPMD Zornitza Stark Tag adult-onset tag was added to STR: OPMD.
Repeat Disorders v0.145 OPDM2 Zornitza Stark Tag adult-onset tag was added to STR: OPDM2.
Repeat Disorders v0.145 MEDPSACH Zornitza Stark Tag paediatric-onset tag was added to STR: MEDPSACH.
Repeat Disorders v0.145 HSAN8 Zornitza Stark Tag paediatric-onset tag was added to STR: HSAN8.
Repeat Disorders v0.145 FRA2A Bryony Thompson Marked STR: FRA2A as ready
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.145 FRA2A Bryony Thompson Classified STR: FRA2A as Amber List (moderate evidence)
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.144 FRA2A Bryony Thompson STR: FRA2A was added
STR: FRA2A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA2A were set to 24763282
Phenotypes for STR: FRA2A were set to Neurodevelopmental delay
Review for STR: FRA2A was set to AMBER
Added comment: Three families with a wide spectrum of neurodevelopmental phenotypes with expression of folate-sensitive fragile site FRA2A. The CGG repeat is in an alternative promoter for AFF3, active in the brain. Expansion of >300 repeats causes expression of FRA2A and is associated with hypermethylation and silencing of AFF3 in at least one individual. There were 3-20 repeats in normal controls.
Sources: Literature
Red cell disorders v0.72 GPI Zornitza Stark Marked gene: GPI as ready
Red cell disorders v0.72 GPI Zornitza Stark Gene: gpi has been classified as Green List (High Evidence).
Red cell disorders v0.72 GPI Zornitza Stark Phenotypes for gene: GPI were changed from 613470 Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency; Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency, 613470 to Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470
Red cell disorders v0.71 GPI Zornitza Stark Publications for gene: GPI were set to 411100
Red cell disorders v0.70 GPI Zornitza Stark reviewed gene: GPI: Rating: GREEN; Mode of pathogenicity: None; Publications: 8499925, 9856489, 32103498; Phenotypes: Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Marked gene: UMPS as ready
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria MIM# 258900
Intellectual disability syndromic and non-syndromic v0.4108 UMPS Zornitza Stark Publications for gene: UMPS were set to
Intellectual disability syndromic and non-syndromic v0.4107 UMPS Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4106 UMPS Zornitza Stark reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9104 UMPS Zornitza Stark Marked gene: UMPS as ready
Mendeliome v0.9104 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Mendeliome v0.9104 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria, MIM# 258900
Mendeliome v0.9103 UMPS Zornitza Stark Publications for gene: UMPS were set to
Mendeliome v0.9102 UMPS Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9101 UMPS Zornitza Stark edited their review of gene: UMPS: Added comment: 20 unrelated patients have been reported with biallelic missense variants; one mouse model

Orotic aciduria is characterised by megaloblastic anaemia and orotic acid crystalluria, frequently associated with a degree of physical and intellectual disability. Other features include, congenital malformations (Atrial/ Ventricular septal defect) and immunodeficiencies (T-cell dysfunction, failure to thrive, recurrent infections).

Haematology features
- Megaloblastic anaemia
- Low to normal reticulocyte count
- Anisocytosis
- Poikilocytosis
- Hypochromia; Changed publications: 9042911, 33489760; Changed phenotypes: Orotic aciduria, MIM# 258900
Red cell disorders v0.70 UMPS Zornitza Stark Marked gene: UMPS as ready
Red cell disorders v0.70 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Red cell disorders v0.70 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from 258900 Orotic aciduria with megaloblastic anaemia to Orotic aciduria MIM# 258900; megaloblastic anaemia; orotic acid crystalluria; ID; immunodeficiencies
Red cell disorders v0.69 UMPS Zornitza Stark Publications for gene: UMPS were set to 9042911
Imprinting disorders v0.3 MAGEL2 Anna Le Fevre gene: MAGEL2 was added
gene: MAGEL2 was added to Imprinting disorders. Sources: Literature
Mode of inheritance for gene: MAGEL2 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Publications for gene: MAGEL2 were set to 24076603; 31397880; 29599419; 30302899
Phenotypes for gene: MAGEL2 were set to Schaaf-Yang syndrome; Chitayat-Hall Syndrome
Review for gene: MAGEL2 was set to GREEN
Added comment: MAGEL2 is a single-exon gene.
Frameshift mutations may not cause nonsense-mediated decay, but instead a variety of truncated or elongated protein products.
The pathogenicity of haploinsufficiency of the paternal allele is uncertain (ClinGen review 2018). A dominant-negative effect has been suggested. Haploinsufficiency may play a role.
Sources: Literature
Autism v0.167 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Marked gene: TMPRSS6 as ready
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence).
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia
Mendeliome v0.9100 TMPRSS6 Zornitza Stark Publications for gene: TMPRSS6 were set to
Mendeliome v0.9099 TMPRSS6 Zornitza Stark Mode of inheritance for gene: TMPRSS6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Marked gene: TMPRSS6 as ready
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence).
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from Iron refractoryirondeficiencyanemia,206200; Iron-Refractory Iron Deficiency Anemia; 206200 Iron refractoryirondeficiencyanemia to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia
Red cell disorders v0.67 TMPRSS6 Zornitza Stark Publications for gene: TMPRSS6 were set to 18408718
Mendeliome v0.9098 TPI1 Zornitza Stark changed review comment from: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; to: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital haemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.
Mendeliome v0.9098 TPI1 Zornitza Stark edited their review of gene: TPI1: Added comment: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; Changed publications: 9338582, 32873690, 8503454; Changed phenotypes: Haemolytic anaemia due to triosephosphate isomerase deficiency, MIM# 615512
Red cell disorders v0.66 TPI1 Zornitza Stark Marked gene: TPI1 as ready
Red cell disorders v0.66 TPI1 Zornitza Stark Gene: tpi1 has been classified as Green List (High Evidence).
Red cell disorders v0.66 TPI1 Zornitza Stark Phenotypes for gene: TPI1 were changed from 615512 Hemolytic anemia due to triosephosphate isomerase deficiency; Enzyme Disorder; Hemolytic anemia due to triosephosphate isomerase deficiency,615512 to Haemolytic anaemia due to triosephosphate isomerase deficiency MIM# 615512; chronic haemolytic anaemia; neuromuscular dysfunction; intracellular accumulation of dihydroxyacetone phosphate (DHAP)
Red cell disorders v0.65 TPI1 Zornitza Stark Publications for gene: TPI1 were set to 11698297; 9338582
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre Deleted their review
Mitochondrial disease v0.648 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Mitochondrial disease v0.648 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Mitochondrial disease v0.648 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Mitochondrial disease v0.647 YARS2 Zornitza Stark Publications for gene: YARS2 were set to
Mitochondrial disease v0.646 YARS2 Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.645 YARS2 Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9098 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Mendeliome v0.9098 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: ; Mode of pathogenicity: None; Publications: 24076603, 30302899, 31397880; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9098 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Mendeliome v0.9097 YARS2 Zornitza Stark Publications for gene: YARS2 were set to
Mendeliome v0.9096 YARS2 Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 YARS2 Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 TPI1 Danielle Ariti reviewed gene: TPI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9338582, 32873690, 8503454; Phenotypes: Hemolytic anemia due to triosephosphate isomerase deficiency MIM# 615512, chronic hemolytic anaemia, neuromuscular dysfunction, intracellular accumulation of dihydroxyacetone phosphate (DHAP); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 GLRX5 Zornitza Stark Marked gene: GLRX5 as ready
Red cell disorders v0.64 GLRX5 Zornitza Stark Gene: glrx5 has been classified as Green List (High Evidence).
Red cell disorders v0.64 GLRX5 Zornitza Stark Phenotypes for gene: GLRX5 were changed from 616860 Pyridoxine refractory sideroblastic anaemia 3; Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive, 205950; 205950 Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive to Anaemia, sideroblastic, 3, pyridoxine-refractory, MIM# 616860
Red cell disorders v0.63 GLRX5 Zornitza Stark Publications for gene: GLRX5 were set to 20364084; 25342667; 17485548
Red cell disorders v0.62 GLRX5 Zornitza Stark changed review comment from: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.; to: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anaemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.
Red cell disorders v0.62 GIF Zornitza Stark Marked gene: GIF as ready
Red cell disorders v0.62 GIF Zornitza Stark Gene: gif has been classified as Green List (High Evidence).
Red cell disorders v0.62 GIF Zornitza Stark Phenotypes for gene: GIF were changed from 261000 Intrinsic factor deficiency to Intrinsic factor deficiency, MIM# 261000
Red cell disorders v0.61 GIF Zornitza Stark Publications for gene: GIF were set to 15738392; 14576042
Red cell disorders v0.60 GIF Zornitza Stark reviewed gene: GIF: Rating: GREEN; Mode of pathogenicity: None; Publications: 14695536, 14576042, 15738392; Phenotypes: Intrinsic factor deficiency, MIM# 261000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Regression v0.371 GCLC Zornitza Stark Marked gene: GCLC as ready
Regression v0.371 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Regression v0.371 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Regression v0.370 GCLC Zornitza Stark Publications for gene: GCLC were set to
Regression v0.369 GCLC Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.368 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28571779, 10515893; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 GCLC Zornitza Stark Marked gene: GCLC as ready
Mendeliome v0.9095 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Red cell disorders v0.60 UMPS Danielle Ariti reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900, megaloblastic anaemia, orotic acid crystalluria, ID, immunodeficiencies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450; Disorders of the gamma-glutamyl cycle
Mendeliome v0.9094 GCLC Zornitza Stark Publications for gene: GCLC were set to
Mendeliome v0.9093 GCLC Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9092 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.60 GCLC Zornitza Stark Marked gene: GCLC as ready
Red cell disorders v0.60 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Red cell disorders v0.60 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Red cell disorders v0.59 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from 230450 Glutamate-cysteine ligase deficiency; Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, 230450; Enzyme Disorder; Glutamate-cysteine ligase deficiency; 230450 Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency to Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Red cell disorders v0.58 GCLC Zornitza Stark Publications for gene: GCLC were set to 10515893
Red cell disorders v0.57 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.143 FRA7A Bryony Thompson Marked STR: FRA7A as ready
Repeat Disorders v0.143 FRA7A Bryony Thompson Str: fra7a has been classified as Red List (Low Evidence).
Repeat Disorders v0.143 FRA7A Bryony Thompson STR: FRA7A was added
STR: FRA7A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA7A were set to 25196122
Phenotypes for STR: FRA7A were set to Autism spectrum disorder
Review for STR: FRA7A was set to AMBER
Added comment: A de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. The expanded allele showed hypermethylation of the adjacent CpG island and reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line. The probands mother had a pre-mutation with 85 repeats. Controls showed a CGG-repeat range of 5 to 22. In a second family a pre-mutation (66-72) was identified in 3 siblings with ASD and an unaffected father. One of the siblings had mitotic instability.
Sources: Literature
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Marked gene: MAP1B as ready
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Gene: map1b has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Classified gene: MAP1B as Green List (high evidence)
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Gene: map1b has been classified as Green List (High Evidence).
Mendeliome v0.9092 PDGFRL Zornitza Stark Marked gene: PDGFRL as ready
Mendeliome v0.9092 PDGFRL Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence).
Mendeliome v0.9092 PDGFRL Zornitza Stark Classified gene: PDGFRL as Red List (low evidence)
Mendeliome v0.9092 PDGFRL Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence).
Red cell disorders v0.57 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Red cell disorders v0.57 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Red cell disorders v0.57 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from 613561 Myopathy, lactic acidosis, and sideroblastic anemia 2; Myopathy, lactic acidosis, and sideroblastic anemia 2, 613561 to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Red cell disorders v0.56 YARS2 Zornitza Stark Publications for gene: YARS2 were set to 23918765; 22504945; 20598274
Repeat Disorders v0.142 VACTERLX Bryony Thompson Marked STR: VACTERLX as ready
Repeat Disorders v0.142 VACTERLX Bryony Thompson Str: vacterlx has been classified as Red List (Low Evidence).
Repeat Disorders v0.142 VACTERLX Bryony Thompson STR: VACTERLX was added
STR: VACTERLX was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: VACTERLX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: VACTERLX were set to 20452998; 32639022
Phenotypes for STR: VACTERLX were set to VACTERL association, X-linked MIM#314390
Review for STR: VACTERLX was set to RED
Added comment: NM_003413.4(ZIC3):c.163GCC[X]
PMID: 20452998 - reports a single case with VACTERL association and an expansion of the poly-Ala tract from 10 to 12 alanines.
PMID: 32639022 - a family with Oculo-auriculo-vertebral spectrum (OAVS) segregates the 11 alanine expansion in affected males
This polyalanine tract is highly polymorphic in gnomAD v2.1, there are 86 hemizygote 12 alanine expansions present and 65 hemizygotes with the 11 alanine expansion. The 13 polyalanine expansion is also present in 13 hemizygotes.
Sources: Literature
Mendeliome v0.9091 PDGFRL Michelle Torres reviewed gene: PDGFRL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown; Current diagnostic: yes
Repeat Disorders v0.141 FRA12A Bryony Thompson Marked STR: FRA12A as ready
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.141 FRA12A Bryony Thompson Classified STR: FRA12A as Amber List (moderate evidence)
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.140 FRA12A Bryony Thompson STR: FRA12A was added
STR: FRA12A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA12A were set to 17236128
Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630
Review for STR: FRA12A was set to AMBER
Added comment: NM_173602.2:c.-137CGG[X]
All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp.
70 controls used to determine the "normal" repeat range.
Sources: Literature
Red cell disorders v0.55 XK Danielle Ariti reviewed gene: XK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8004674, 30128557, 30800707; Phenotypes: McLeod syndrome with or without chronic granulomatous disease MIM# 300842, absence of red blood cell Kx antigen, weak expression of Kell red blood cell antigens, neuroacanthocytosis (peripheral and central nervous systems), cardiovascular abnormalities, myopathy; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Repeat Disorders v0.139 FRA11A Bryony Thompson Marked STR: FRA11A as ready
Repeat Disorders v0.139 FRA11A Bryony Thompson Str: fra11a has been classified as Red List (Low Evidence).
Repeat Disorders v0.139 FRA11A Bryony Thompson STR: FRA11A was added
STR: FRA11A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11A was set to Unknown
Publications for STR: FRA11A were set to 18160775; 453198
Phenotypes for STR: FRA11A were set to Intellectual disability
Review for STR: FRA11A was set to RED
Added comment: Expansion of a polymorphic CGG-repeat located at the 5' end of the C11orf80 gene causes expression of the folate-sensitive fragile site FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. The expansion was identified in the 15-year-old proband with intellectual disability as well as in phenotypically normal members of the family.
Sources: Literature
Red cell disorders v0.55 YARS2 Danielle Ariti reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.138 TOF Bryony Thompson Marked STR: TOF as ready
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.138 TOF Bryony Thompson Classified STR: TOF as Green List (high evidence)
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.137 TOF Bryony Thompson STR: TOF was added
STR: TOF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: TOF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TOF were set to 19948535; 11748311
Phenotypes for STR: TOF were set to Tetralogy of Fallot MIM#187500
Review for STR: TOF was set to GREEN
STR: TOF was marked as clinically relevant
Added comment: Poly-alanine tract expansion. In vitro functional assays demonstrated the expansion lead to protein aggregation in cells. Two unrelated cases reported with 25 repeats, one case with isolated interrupted aortic arch and one case with scoliosis, facial asymmetry, upslanting
palpebral fissures, absent PV, isolated left pulmonary artery (expected de novo - excluded in mother and father not available for testing). Other variant types cause disease in this gene.
Sources: Literature
Deafness_IsolatedAndComplex v1.90 MAP1B Elena Savva gene: MAP1B was added
gene: MAP1B was added to Deafness_IsolatedAndComplex. Sources: Literature
Mode of inheritance for gene: MAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAP1B were set to PMID: 33268592
Phenotypes for gene: MAP1B were set to Periventricular nodular heterotopia 9 MIM#618918; sensorineural hearing loss
Review for gene: MAP1B was set to GREEN
Added comment: PMID: 33268592 - three unrelated patients with heterozygous missense variants and nonsyndromic sensorineural hearing loss. Functional studies on one missense show reduced protein expression and less phosphorylation.
Variant correction via CRISPR rescued cell dysfunction, and K/O mice show hearing loss
Sources: Literature
Repeat Disorders v0.136 FRAXF Bryony Thompson Marked STR: FRAXF as ready
Repeat Disorders v0.136 FRAXF Bryony Thompson Str: fraxf has been classified as Red List (Low Evidence).
Repeat Disorders v0.136 FRAXF Bryony Thompson STR: FRAXF was added
STR: FRAXF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRAXF was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXF were set to 7874164; 10094554; 8651274
Phenotypes for STR: FRAXF were set to Intellectual disability
Review for STR: FRAXF was set to RED
Added comment: FRAXF is a folate-sensitive fragile site, where expansion was identified in a male with developmental delay. However, further studies found that expression of the fragile site through expansion is not associated with a disease phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Cataract v0.287 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Cataract v0.287 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Cataract v0.287 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Cataract v0.287 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Mendeliome v0.9091 IFIH1 Zornitza Stark Marked gene: IFIH1 as ready
Mendeliome v0.9091 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Mendeliome v0.9091 IFIH1 Zornitza Stark Phenotypes for gene: IFIH1 were changed from to Aicardi-Goutieres syndrome 7, MIM#615846; Early-onset Inflammatory Bowel Disease
Mendeliome v0.9090 IFIH1 Zornitza Stark Publications for gene: IFIH1 were set to
Mendeliome v0.9089 IFIH1 Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence)
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1191 PRICKLE2 Zornitza Stark gene: PRICKLE2 was added
gene: PRICKLE2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Repeat Disorders v0.135 FRA11B Bryony Thompson Classified STR: FRA11B as Red List (low evidence)
Repeat Disorders v0.135 FRA11B Bryony Thompson Added comment: Comment on list classification: Low evidence of clinical relevance of expression of the fragile site.
Repeat Disorders v0.135 FRA11B Bryony Thompson Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.134 FRA11B Bryony Thompson STR: FRA11B was added
STR: FRA11B was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA11B were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933
Phenotypes for STR: FRA11B were set to Jacobsen syndrome MIM#147791
Review for STR: FRA11B was set to AMBER
Added comment: FRA11B is a rare folate sensitive fragile site caused by expansion of (CCG)n in the 5'UTR of CBL, and hypermethylation of adjacent CpG islands. There are commonly 11 repeats. The pre-mutation ranges from 80-100, while >100 leads to expression of the fragile site. Two cases of Jacobsen (llq-) syndrome, which is the clinical presentation of the loss of part of the long arm of chromosome 11, have been associated with the FRA11B repeat expansion (expected breakpoint). The estimated prevalence of the FRA11B expansion is 1 in 5,000, which the estimated prevalence of Jacobsen syndrome is <1 in 100,000.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4104 PRICKLE2 Hazel Phillimore gene: PRICKLE2 was added
gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to PMID: 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.

Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Inflammatory bowel disease v0.59 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Sources: Literature; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified.
Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant.
Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis.
Sources: Literature
Mendeliome v0.9088 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified.
Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant.
Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis.
Mendeliome v0.9088 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Mendeliome v0.9088 PRICKLE2 Hazel Phillimore changed review comment from: Six subjects from four unrelated families with heterozygous variants (two de novo missense (c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg)), one de novo nonsense variant (c.214 C>T; p.(Arg72*) and one frameshift variant (c.1286_1287delGT; p.(Ser429Thrfs*56)) which segregated with the disease in three affected females.

Loss-of-function (homozygous) variants cause seizures in flies, and both heterozygous and homozygous mice showed behavioral abnormalities including altered social interaction, learning abnormalities, and behavioural inflexibility. PubMed: 21276947.; to: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.
Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PubMed: 21276947).
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Marked gene: IFIH1 as ready
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Classified gene: IFIH1 as Green List (high evidence)
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Mendeliome v0.9088 IFIH1 Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Inflammatory bowel disease v0.58 IFIH1 Sarah Pantaleo gene: IFIH1 was added
gene: IFIH1 was added to Inflammatory bowel disease. Sources: Literature
Mode of inheritance for gene: IFIH1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: IFIH1 were set to 34185153
Phenotypes for gene: IFIH1 were set to Inflammatory Bowel Disease
Penetrance for gene: IFIH1 were set to Incomplete
Review for gene: IFIH1 was set to GREEN
Added comment: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Sources: Literature
Mendeliome v0.9088 FGF8 Zornitza Stark Marked gene: FGF8 as ready
Mendeliome v0.9088 FGF8 Zornitza Stark Gene: fgf8 has been classified as Green List (High Evidence).
Mendeliome v0.9088 FGF8 Zornitza Stark Phenotypes for gene: FGF8 were changed from to Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Femoral hypoplasia
Mendeliome v0.9087 FGF8 Zornitza Stark Publications for gene: FGF8 were set to
Mendeliome v0.9086 FGF8 Zornitza Stark Mode of inheritance for gene: FGF8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Susceptibility to Viral Infections v0.77 IFIH1 Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9085 FGF8 Zornitza Stark Tag SV/CNV tag was added to gene: FGF8.
Mendeliome v0.9085 FGF8 Zornitza Stark reviewed gene: FGF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cataract v0.286 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Cataract. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Mendeliome v0.9085 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Mendeliome v0.9085 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Phenotypes for gene: PRICKLE2 were changed from to Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.
Mendeliome v0.9084 PRICKLE2 Zornitza Stark Publications for gene: PRICKLE2 were set to
Intellectual disability syndromic and non-syndromic v0.4104 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Mendeliome v0.9083 PRICKLE2 Zornitza Stark Mode of inheritance for gene: PRICKLE2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Marked gene: COPB2 as ready
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9082 PRICKLE2 Hazel Phillimore reviewed gene: PRICKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34092786; Phenotypes: Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9082 UBE2U Ee Ming Wong changed review comment from: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature; to: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9082 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Mendeliome v0.9082 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 COPB2 Belinda Chong gene: COPB2 was added
gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COPB2 were set to PMID: 34450031
Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay
Review for gene: COPB2 was set to AMBER
Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis

3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous).
Sources: Literature
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Classified gene: GRIK2 as Green List (high evidence)
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9081 FGF8 Dean Phelan reviewed gene: FGF8: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 34433009; Phenotypes: Femoral hypoplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9081 LRP1 Seb Lunke Marked gene: LRP1 as ready
Mendeliome v0.9081 LRP1 Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence).
Growth failure v1.4 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Growth failure v1.4 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1188 GRIK2 Zornitza Stark Classified gene: GRIK2 as Green List (high evidence)
Genetic Epilepsy v0.1188 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9081 LRP1 Seb Lunke Classified gene: LRP1 as Red List (low evidence)
Mendeliome v0.9081 LRP1 Seb Lunke Added comment: Comment on list classification: Two papers without related phenotypes and little overall evidence for gene disease association.
Mendeliome v0.9081 LRP1 Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence).
Growth failure v1.4 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Growth failure v1.4 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9080 COPB2 Zornitza Stark Phenotypes for gene: COPB2 were changed from Microcephaly 19, primary, autosomal recessive, MIM# 617800 to Microcephaly 19, primary, autosomal recessive, MIM# 617800; Osteoporosis and developmental delay
Mendeliome v0.9079 COPB2 Zornitza Stark Publications for gene: COPB2 were set to 29036432
Mendeliome v0.9078 COPB2 Zornitza Stark Mode of inheritance for gene: COPB2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1187 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9077 COPB2 Zornitza Stark Classified gene: COPB2 as Green List (high evidence)
Mendeliome v0.9077 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9076 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Mendeliome v0.9076 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1187 GRIK2 Danielle Ariti gene: GRIK2 was added
gene: GRIK2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: GRIK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: GRIK2 were set to 34375587; 17847003; 25039795
Phenotypes for gene: GRIK2 were set to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD)
Review for gene: GRIK2 was set to GREEN
Added comment: Over 10 individuals with variants in GRIK2; Bi-allelic and mono-allelic; loss of function

2 (sibs) with bi-allelic truncating variants and 1 family with bi-allelic deletion (removing exons 7 and 8).
11 individuals with de novo mono-allelic missense variants
(5x with the same missense variant c.1969G>A (p.Ala657Thr) all the others were near this location).

Associated with nonsyndromic neurodevelopmental disorder (NDD) with intellectual disability and developmental delay as core features with 30-50% individuals experiencing seizures.
Sources: Literature
Mendeliome v0.9076 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Mendeliome v0.9076 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant
Mendeliome v0.9075 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4101 GRIK2 Zornitza Stark Publications for gene: GRIK2 were set to
Growth failure v1.3 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Growth failure. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to AMBER
gene: ZNF668 was marked as current diagnostic
Added comment: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9075 LRP1 Elena Savva reviewed gene: LRP1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 26142438, 33776059; Phenotypes: ?Keratosis pilaris atrophicans MIM#604093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4100 GRIK2 Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9075 COPB2 Belinda Chong reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34450031; Phenotypes: Osteoporosis and developmental delay; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4099 GRIK2 Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9075 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Mendeliome v0.9075 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9075 CFAP206 Seb Lunke Marked gene: CFAP206 as ready
Mendeliome v0.9075 CFAP206 Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9075 GRIK2 Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; Nonsyndromic neurodevelopmental disorder, autosomal dominant
Mendeliome v0.9074 CFAP206 Seb Lunke Publications for gene: CFAP206 were set to
Mendeliome v0.9073 GRIK2 Zornitza Stark Publications for gene: GRIK2 were set to
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9072 GRIK2 Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9071 CFAP206 Seb Lunke Classified gene: CFAP206 as Amber List (moderate evidence)
Mendeliome v0.9071 CFAP206 Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9070 CFAP206 Seb Lunke Phenotypes for gene: CFAP206 were changed from Multiple morphological abnormalities of the fagella to Multiple morphological abnormalities of the flagella
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Microcephaly v1.45 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Microcephaly v1.45 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9069 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Mendeliome v0.9069 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9069 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Mendeliome v0.9069 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9068 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9068 GRIK2 Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER
Microcephaly v1.44 ZNF668 Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER
Microcephaly v1.44 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9068 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Marked gene: LAMA1 as ready
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Classified gene: LAMA1 as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Classified gene: LAMA1 as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Mendeliome v0.9068 GLIS1 Seb Lunke Marked gene: GLIS1 as ready
Mendeliome v0.9068 GLIS1 Seb Lunke Gene: glis1 has been classified as Red List (Low Evidence).
Microcephaly v1.44 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9068 GLIS1 Seb Lunke Phenotypes for gene: GLIS1 were changed from Increased ocular pressure to Increased ocular pressure; Glaucoma
Joubert syndrome and other neurological ciliopathies v1.13 LAMA1 Zornitza Stark gene: LAMA1 was added
gene: LAMA1 was added to Joubert syndrome and other neurological ciliopathies. Sources: Literature
Mode of inheritance for gene: LAMA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LAMA1 were set to 34423300
Phenotypes for gene: LAMA1 were set to Poretti-Boltshauser syndrome, MIM# 615960
Review for gene: LAMA1 was set to GREEN
Added comment: Four families with Poretti-Bolthauser syndrome identified in a cohort of 'unsolved' Joubert syndrome patients -- included due to phenotypic overlap.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9067 GLIS1 Seb Lunke changed review comment from: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.
Sources: Literature; to: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.

The authors did show dysregulation of GLIS1 in a human cell line study, and performed linkage analysis suggesting an association of the GLIS1 locus with Glaucoma in UK biobank samples.
Sources: Literature
Mendeliome v0.9067 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9067 CFAP206 Ain Roesley gene: CFAP206 was added
gene: CFAP206 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CFAP206 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFAP206 were set to Multiple morphological abnormalities of the fagella
Penetrance for gene: CFAP206 were set to unknown
Review for gene: CFAP206 was set to AMBER
Added comment: 1x hom with a fs variant

Sperm from knockout mouse model mainly had a fagellum of normal length but most of them showed abnormal forms including bent and coiled fagella. There was also a significant increase of sperm cells with absent or short fagella compared to the WT mice.
Sources: Literature
Mendeliome v0.9067 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Marked gene: SLC32A1 as ready
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence)
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1186 SLC32A1 Zornitza Stark gene: SLC32A1 was added
gene: SLC32A1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC32A1 were set to 34038384
Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus
Review for gene: SLC32A1 was set to GREEN
Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition.
Sources: Literature
Mendeliome v0.9067 SLC32A1 Zornitza Stark Marked gene: SLC32A1 as ready
Mendeliome v0.9067 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Mendeliome v0.9067 GLIS1 Seb Lunke gene: GLIS1 was added
gene: GLIS1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GLIS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLIS1 were set to 34385434
Phenotypes for gene: GLIS1 were set to Increased ocular pressure
Review for gene: GLIS1 was set to RED
Added comment: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.
Sources: Literature
Mendeliome v0.9066 SLC32A1 Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence)
Mendeliome v0.9066 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Mendeliome v0.9065 SLC32A1 Zornitza Stark gene: SLC32A1 was added
gene: SLC32A1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC32A1 were set to 34038384
Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus
Review for gene: SLC32A1 was set to GREEN
Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition.
Sources: Literature
Red cell disorders v0.55 GATA1 Zornitza Stark Marked gene: GATA1 as ready
Red cell disorders v0.55 GATA1 Zornitza Stark Gene: gata1 has been classified as Green List (High Evidence).
Red cell disorders v0.55 GATA1 Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 to Thrombocytopaenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Red cell disorders v0.54 GATA1 Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anemia 300367; 300367 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; Myelodysplastic syndrome (MDS), Paediatric; Diamond-Blackfan anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities 300835; Diamond Blackfan Anaemia; 300835 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; 300367 Diamond Blackfan Anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities; Thrombocytopenia, X-linked, with or without dyserythropoietic anemia, 300367 to Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Red cell disorders v0.53 GATA1 Zornitza Stark edited their review of gene: GATA1: Changed publications: 30228860, 24766296, 22706301
Red cell disorders v0.53 GATA1 Zornitza Stark edited their review of gene: GATA1: Changed phenotypes: Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Mendeliome v0.9064 G6PD Zornitza Stark Marked gene: G6PD as ready
Mendeliome v0.9064 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Mendeliome v0.9064 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908
Mendeliome v0.9063 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from to Haemolytic anemia, G6PD deficient (favism), MIM# 300908
Mendeliome v0.9062 G6PD Zornitza Stark Publications for gene: G6PD were set to
Mendeliome v0.9061 G6PD Zornitza Stark Mode of inheritance for gene: G6PD was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9060 G6PD Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: 18177777; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Red cell disorders v0.53 G6PD Zornitza Stark Marked gene: G6PD as ready
Red cell disorders v0.53 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Red cell disorders v0.53 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908
Red cell disorders v0.52 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from 300908 Hemolytic anemia, G6PD deficient (favism); Enzyme Disorder; 300908 Hemolytic anemia due to G6PD deficiency; Hemolytic anemia due to G6PD deficiency, 300908 to Haemolytic anemia, G6PD deficient (favism), MIM# 300908
Red cell disorders v0.51 G6PD Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9060 EPB42 Zornitza Stark Marked gene: EPB42 as ready
Mendeliome v0.9060 EPB42 Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence).
Mendeliome v0.9060 EPB42 Zornitza Stark Phenotypes for gene: EPB42 were changed from to Spherocytosis, type 5, MIM# 612690
Mendeliome v0.9059 EPB42 Zornitza Stark Publications for gene: EPB42 were set to
Mendeliome v0.9058 EPB42 Zornitza Stark Mode of inheritance for gene: EPB42 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9057 EPB42 Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.51 EPB42 Zornitza Stark Marked gene: EPB42 as ready
Red cell disorders v0.51 EPB42 Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence).
Red cell disorders v0.51 EPB42 Zornitza Stark Phenotypes for gene: EPB42 were changed from Spherocytosis, type 5, 612690; 612690 Hereditary spherocytosis type 5; RBC membrane abnormality; Hereditary spherocytosis type 5; 612690 Spherocytosis, type 5; EPB42-related hereditary spherocytosis; Minkowski-Chauffard disease; Spherocytosis, Recessive; Elliptocytosis to Spherocytosis, type 5, MIM# 612690
Red cell disorders v0.50 EPB42 Zornitza Stark Publications for gene: EPB42 were set to 12176912; 7772513; 1558976
Red cell disorders v0.49 EPB42 Zornitza Stark edited their review of gene: EPB42: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.49 EPB42 Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: None
Mendeliome v0.9057 EPB41 Zornitza Stark Marked gene: EPB41 as ready
Mendeliome v0.9057 EPB41 Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence).
Mendeliome v0.9057 EPB41 Zornitza Stark Phenotypes for gene: EPB41 were changed from to Elliptocytosis-1, MIM# 611804
Mendeliome v0.9056 EPB41 Zornitza Stark Publications for gene: EPB41 were set to
Mendeliome v0.9055 EPB41 Zornitza Stark Mode of inheritance for gene: EPB41 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9054 EPB41 Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.49 EPB41 Zornitza Stark Marked gene: EPB41 as ready
Red cell disorders v0.49 EPB41 Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence).
Red cell disorders v0.49 EPB41 Zornitza Stark Phenotypes for gene: EPB41 were changed from Elliptocytosis-1,611804; RBC membrane abnormality; 611804 Hereditary elliptocytosis; 611804 Elliptocytosis-1; Elliptocytosis; Hereditary elliptocytosis to Elliptocytosis-1, MIM# 611804
Red cell disorders v0.48 EPB41 Zornitza Stark Publications for gene: EPB41 were set to 8423235; 1430200; 3134067
Red cell disorders v0.47 EPB41 Zornitza Stark Mode of inheritance for gene: EPB41 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.46 EPB41 Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9054 DHFR Zornitza Stark Marked gene: DHFR as ready
Mendeliome v0.9054 DHFR Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence).
Mendeliome v0.9054 DHFR Zornitza Stark Phenotypes for gene: DHFR were changed from to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839
Mendeliome v0.9053 DHFR Zornitza Stark Publications for gene: DHFR were set to
Mendeliome v0.9052 DHFR Zornitza Stark Mode of inheritance for gene: DHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9051 DHFR Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.46 DHFR Zornitza Stark Marked gene: DHFR as ready
Red cell disorders v0.46 DHFR Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence).
Red cell disorders v0.46 DHFR Zornitza Stark Phenotypes for gene: DHFR were changed from Megaloblastic anemia due to dihydrofolate reductase deficiency, 613839; 613839 Megaloblastic anemia due to dihydrofolate reductase deficiency to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839
Red cell disorders v0.45 DHFR Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9051 CYB5R3 Zornitza Stark Marked gene: CYB5R3 as ready
Mendeliome v0.9051 CYB5R3 Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence).
Mendeliome v0.9051 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from to Methaemoglobinaemia, type I and II, MIM# 250800
Mendeliome v0.9050 CYB5R3 Zornitza Stark Publications for gene: CYB5R3 were set to
Mendeliome v0.9049 CYB5R3 Zornitza Stark Mode of inheritance for gene: CYB5R3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9048 CYB5R3 Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methaemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.45 CYB5R3 Zornitza Stark Marked gene: CYB5R3 as ready
Red cell disorders v0.45 CYB5R3 Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence).
Red cell disorders v0.45 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methemoglobinaemia, type I and II, MIM# 250800 to Methaemoglobinaemia, type I and II, MIM# 250800
Red cell disorders v0.44 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methaemoglobinaemia; 250800 Methemoglobinemia; Methaemoglobinaemia type I and II, 250800; 250800 Methaemoglobinaemia type I and II to Methemoglobinaemia, type I and II, MIM# 250800
Red cell disorders v0.43 CYB5R3 Zornitza Stark Publications for gene: CYB5R3 were set to 18318771; 15921385
Red cell disorders v0.42 CYB5R3 Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.133 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.133 NIPA1 Bryony Thompson Added comment: Comment on list classification: This is an association/risk allele rather than high-risk disease-causing expansion, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.133 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.132 NIPA1 Bryony Thompson Deleted their comment
Repeat Disorders v0.132 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.132 NIPA1 Bryony Thompson Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.132 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.131 NIPA1 Bryony Thompson STR: NIPA1 was added
STR: NIPA1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIPA1 was set to Unknown
Publications for STR: NIPA1 were set to 30342764; 22378146
Phenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis
Review for STR: NIPA1 was set to GREEN
Added comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5.
Sources: Literature
Red cell disorders v0.42 CUBN Zornitza Stark Marked gene: CUBN as ready
Red cell disorders v0.42 CUBN Zornitza Stark Gene: cubn has been classified as Green List (High Evidence).
Red cell disorders v0.42 CUBN Zornitza Stark Phenotypes for gene: CUBN were changed from Megaloblastic anemia-1, Finnish type, 261100; Megaloblastic Anemia; 261100 Megaloblastic anemia-1, Finnish type to Imerslund-Grasbeck syndrome 1, MIM# 261100
Red cell disorders v0.41 CUBN Zornitza Stark Publications for gene: CUBN were set to 17285242; 15024727
Red cell disorders v0.40 CUBN Zornitza Stark reviewed gene: CUBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10080186, 21208123, 17668238]; Phenotypes: Imerslund-Grasbeck syndrome 1, MIM# 261100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.40 COX4I2 Zornitza Stark changed review comment from: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs).; to: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs). Note no other variants reported in this gene since original report in 2009. All variants submitted to ClinVar are VOUS/LB/B.
Red cell disorders v0.40 COX4I2 Zornitza Stark Marked gene: COX4I2 as ready
Red cell disorders v0.40 COX4I2 Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence).
Red cell disorders v0.40 COX4I2 Zornitza Stark Phenotypes for gene: COX4I2 were changed from Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, 612714; 612714 Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, andCalvarial Hyperostosis; 612714 Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714
Red cell disorders v0.39 COX4I2 Zornitza Stark Publications for gene: COX4I2 were set to 19268275
Red cell disorders v0.38 COX4I2 Zornitza Stark Classified gene: COX4I2 as Red List (low evidence)
Red cell disorders v0.38 COX4I2 Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence).
Red cell disorders v0.37 COX4I2 Zornitza Stark reviewed gene: COX4I2: Rating: RED; Mode of pathogenicity: None; Publications: 19268275, 22730437; Phenotypes: Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.37 CDAN1 Zornitza Stark Marked gene: CDAN1 as ready
Red cell disorders v0.37 CDAN1 Zornitza Stark Gene: cdan1 has been classified as Green List (High Evidence).
Red cell disorders v0.37 CDAN1 Zornitza Stark Phenotypes for gene: CDAN1 were changed from 224120 Dyserythropoietic anemia, congenital, type Ia; 224120 Congenital dyserythropoietic anaemia type 1a; Dyserythropoietic anemia, congenital, type Ia, 224120 to Dyserythropoietic anaemia, congenital, type Ia, 224120
Red cell disorders v0.36 CDAN1 Zornitza Stark Publications for gene: CDAN1 were set to 16098079; 12434312
Red cell disorders v0.35 CDAN1 Zornitza Stark edited their review of gene: CDAN1: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ia, 224120
Red cell disorders v0.35 ALDOA Zornitza Stark Marked gene: ALDOA as ready
Red cell disorders v0.35 ALDOA Zornitza Stark Gene: aldoa has been classified as Green List (High Evidence).
Red cell disorders v0.35 ALDOA Zornitza Stark Phenotypes for gene: ALDOA were changed from Enzyme Disorder; Glycogen storage disease; Aldolase A deficiency; 611881 Aldolase A deficiency; 611881 Glycogen storage disease XII; Glycogen storage disease XII, 611881; Glycogen storage disease due to aldolase A deficiency to Glycogen storage disease XII , MIM#611881
Red cell disorders v0.34 ALDOA Zornitza Stark Publications for gene: ALDOA were set to 8598869; 7331996
Red cell disorders v0.33 ALDOA Zornitza Stark reviewed gene: ALDOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7331996, 8598869, 25392908; Phenotypes: Glycogen storage disease XII , MIM#611881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9048 CD59 Zornitza Stark Marked gene: CD59 as ready
Mendeliome v0.9048 CD59 Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence).
Mendeliome v0.9048 CD59 Zornitza Stark Phenotypes for gene: CD59 were changed from to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300
Mendeliome v0.9047 CD59 Zornitza Stark Publications for gene: CD59 were set to
Mendeliome v0.9046 CD59 Zornitza Stark Mode of inheritance for gene: CD59 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.33 CD59 Zornitza Stark changed review comment from: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.; to: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.

More than 5 unrelated families reported.
Mendeliome v0.9045 CD59 Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.33 CD59 Zornitza Stark Marked gene: CD59 as ready
Red cell disorders v0.33 CD59 Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence).
Red cell disorders v0.33 CD59 Zornitza Stark Phenotypes for gene: CD59 were changed from Dyskeratosis congenita, X-linked, 305000; 305000 Dyskeratosis congenita, X-linked to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300
Red cell disorders v0.32 CD59 Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.32 C15orf41 Zornitza Stark Marked gene: C15orf41 as ready
Red cell disorders v0.32 C15orf41 Zornitza Stark Gene: c15orf41 has been classified as Green List (High Evidence).
Red cell disorders v0.32 C15orf41 Zornitza Stark Phenotypes for gene: C15orf41 were changed from 615631 Congenital dyserythropoietic anaemia type 1b; Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib; 615631 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib, 615631 to Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631
Red cell disorders v0.31 C15orf41 Zornitza Stark Publications for gene: C15orf41 were set to 29031773; 23716552; 29885034
Red cell disorders v0.30 C15orf41 Zornitza Stark edited their review of gene: C15orf41: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631
Repeat Disorders v0.130 HSAN8 Bryony Thompson Marked STR: HSAN8 as ready
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.130 HSAN8 Bryony Thompson Classified STR: HSAN8 as Green List (high evidence)
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.129 HSAN8 Bryony Thompson STR: HSAN8 was added
STR: HSAN8 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: HSAN8 were set to 26005867
Phenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488
Review for STR: HSAN8 was set to GREEN
STR: HSAN8 was marked as clinically relevant
Added comment: NM_021619.3(PRDM12):c.1041CGC[X]
Poly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson Marked STR: RCPS as ready
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.128 RCPS Bryony Thompson Classified STR: RCPS as Green List (high evidence)
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.127 RCPS Bryony Thompson STR: RCPS was added
STR: RCPS was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RCPS were set to 24360810; 29112243
Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: RCPS was set to GREEN
STR: RCPS was marked as clinically relevant
Added comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Periventricular Grey Matter Heterotopia v1.0 Zornitza Stark promoted panel to version 1.0
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark Marked gene: SYNCRIP as ready
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark Gene: syncrip has been classified as Red List (Low Evidence).
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark gene: SYNCRIP was added
gene: SYNCRIP was added to Periventricular Grey Matter Heterotopia. Sources: Literature
Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SYNCRIP were set to 34157790
Phenotypes for gene: SYNCRIP were set to SYNCRIP-related neurodevelopmental disorder
Review for gene: SYNCRIP was set to RED
Added comment: One of 8 individuals reported so far had PVNH.
Sources: Literature
Mendeliome v0.9045 NEDD4L Zornitza Stark Marked gene: NEDD4L as ready
Mendeliome v0.9045 NEDD4L Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence).
Mendeliome v0.9045 NEDD4L Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201
Mendeliome v0.9044 NEDD4L Zornitza Stark Publications for gene: NEDD4L were set to
Mendeliome v0.9043 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9042 NEDD4L Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Marked gene: NEDD4L as ready
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201
Periventricular Grey Matter Heterotopia v0.28 NEDD4L Zornitza Stark Publications for gene: NEDD4L were set to
Periventricular Grey Matter Heterotopia v0.27 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.27 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.26 NEDD4L Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Marked STR: MEDPSACH as ready
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Classified STR: MEDPSACH as Green List (high evidence)
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.125 MEDPSACH Bryony Thompson STR: MEDPSACH was added
STR: MEDPSACH was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MEDPSACH were set to 9887340; 17133256; 21922596
Phenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170
Review for STR: MEDPSACH was set to GREEN
STR: MEDPSACH was marked as clinically relevant
STR: MEDPSACH was marked as current diagnostic
Added comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene.
Sources: Literature
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Marked gene: FLNA as ready
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Gene: flna has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Phenotypes for gene: FLNA were changed from to Heterotopia, periventricular, 1 , MIM#300049
Periventricular Grey Matter Heterotopia v0.25 FLNA Zornitza Stark Publications for gene: FLNA were set to
Periventricular Grey Matter Heterotopia v0.24 FLNA Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Periventricular Grey Matter Heterotopia v0.23 FLNA Zornitza Stark reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: 9883725, 15668422, 15994863; Phenotypes: Heterotopia, periventricular, 1 , MIM#300049; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Marked gene: ARF1 as ready
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Marked gene: DCHS1 as ready
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Gene: dchs1 has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Phenotypes for gene: DCHS1 were changed from to Van Maldergem syndrome 1, MIM# 601390
Periventricular Grey Matter Heterotopia v0.21 DCHS1 Zornitza Stark Publications for gene: DCHS1 were set to
Periventricular Grey Matter Heterotopia v0.20 DCHS1 Zornitza Stark Mode of inheritance for gene: DCHS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Periventricular Grey Matter Heterotopia v0.19 DCHS1 Zornitza Stark reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Classified gene: ARF1 as Green List (high evidence)
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1184 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Marked gene: ARF1 as ready
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Classified gene: ARF1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4097 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark changed review comment from: Additional reported of affected parent and child.; to: Additional report of affected parent and child.
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark commented on gene: ARF1: Additional reported of affected parent and child.
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark edited their review of gene: ARF1: Changed publications: 28868155, 34353862; Changed phenotypes: Periventricular nodular heterotopia 8, MIM# 618185
Mendeliome v0.9042 ARF1 Zornitza Stark Publications for gene: ARF1 were set to 28868155
Craniosynostosis v1.25 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Craniosynostosis v1.25 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Craniosynostosis v1.25 GINS2 Zornitza Stark gene: GINS2 was added
gene: GINS2 was added to Craniosynostosis. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included.

GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Growth failure v1.3 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Growth failure v1.3 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Growth failure v1.3 GINS2 Zornitza Stark gene: GINS2 was added
gene: GINS2 was added to Growth failure. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Mendeliome v0.9041 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Mendeliome v0.9041 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Mendeliome v0.9041 GINS2 Zornitza Stark Classified gene: GINS2 as Red List (low evidence)
Mendeliome v0.9041 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Red cell disorders v0.30 ANK1 Zornitza Stark Marked gene: ANK1 as ready
Red cell disorders v0.30 ANK1 Zornitza Stark Gene: ank1 has been classified as Green List (High Evidence).
Red cell disorders v0.30 ANK1 Zornitza Stark Phenotypes for gene: ANK1 were changed from Spherocytosis, type 1; Spherocytosis, type 1,182900; RBC membrane abnormality; 182900 Spherocytosis, type 1; 182900 RBC membrane abnormality to Spherocytosis, type 1, MIM# 182900
Red cell disorders v0.29 ANK1 Zornitza Stark Publications for gene: ANK1 were set to 7883994; 9590147; 11167760
Red cell disorders v0.28 ANK1 Zornitza Stark reviewed gene: ANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8640229; Phenotypes: Spherocytosis, type 1, MIM# 182900; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9040 AMN Zornitza Stark Marked gene: AMN as ready
Mendeliome v0.9040 AMN Zornitza Stark Gene: amn has been classified as Green List (High Evidence).
Mendeliome v0.9040 AMN Zornitza Stark Phenotypes for gene: AMN were changed from to Imerslund-Grasbeck syndrome 2, MIM# 618882
Mendeliome v0.9039 AMN Zornitza Stark Publications for gene: AMN were set to
Mendeliome v0.9038 AMN Zornitza Stark Mode of inheritance for gene: AMN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9037 AMN Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.28 AMN Zornitza Stark Marked gene: AMN as ready
Red cell disorders v0.28 AMN Zornitza Stark Gene: amn has been classified as Green List (High Evidence).
Red cell disorders v0.28 AMN Zornitza Stark Phenotypes for gene: AMN were changed from 261100 Megaloblastic anemia-1, Norwegian type; Megaloblastic anemia-1, Norwegian type, 261100 to Imerslund-Grasbeck syndrome 2, MIM# 618882
Red cell disorders v0.27 AMN Zornitza Stark Publications for gene: AMN were set to 17285242; 12590260
Red cell disorders v0.26 AMN Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.124 DMD Bryony Thompson Marked STR: DMD as ready
Repeat Disorders v0.124 DMD Bryony Thompson Str: dmd has been classified as Red List (Low Evidence).
Repeat Disorders v0.124 DMD Bryony Thompson STR: DMD was added
STR: DMD was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: DMD was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: DMD were set to 27417533
Phenotypes for STR: DMD were set to Duchenne muscular dystrophy MIM#310200; Becker muscular dystrophy MIM#300376
Review for STR: DMD was set to RED
Added comment: Single family reported with GAA repeat expansion in intron 62. Normal repeat range 11-33 in healthy controls. Expanded repeats range from 59-82 in the family, with 2 female carriers manifesting symptoms, a male foetus, 2 asymptomatic female carriers, and 2 male asymptomatic carriers ages 6 and 4 years.
Sources: Literature
Mendeliome v0.9037 AK1 Zornitza Stark Marked gene: AK1 as ready
Mendeliome v0.9037 AK1 Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence).
Mendeliome v0.9037 AK1 Zornitza Stark Phenotypes for gene: AK1 were changed from to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631
Mendeliome v0.9036 AK1 Zornitza Stark Publications for gene: AK1 were set to
Mendeliome v0.9035 AK1 Zornitza Stark Mode of inheritance for gene: AK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9034 AK1 Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.26 AK1 Zornitza Stark Marked gene: AK1 as ready
Red cell disorders v0.26 AK1 Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence).
Red cell disorders v0.26 AK1 Zornitza Stark Phenotypes for gene: AK1 were changed from 612631 Hemolytic anemia due to adenylate kinase deficiency; Hemolytic anemia due to adenylate kinase deficiency, 612631 to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631
Red cell disorders v0.25 AK1 Zornitza Stark Publications for gene: AK1 were set to 28211224
Red cell disorders v0.24 AK1 Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9034 ALAS2 Zornitza Stark Marked gene: ALAS2 as ready
Mendeliome v0.9034 ALAS2 Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence).
Mendeliome v0.9034 ALAS2 Zornitza Stark Phenotypes for gene: ALAS2 were changed from to Anaemia, sideroblastic, 1, MIM# 300751; Protoporphyria, erythropoietic, X-linked, MIM# 300752
Mendeliome v0.9033 ALAS2 Zornitza Stark Publications for gene: ALAS2 were set to
Mendeliome v0.9032 ALAS2 Zornitza Stark Mode of inheritance for gene: ALAS2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9031 ALAS2 Zornitza Stark reviewed gene: ALAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10029606, 7949148, 10029606, 25615817; Phenotypes: Anaemia, sideroblastic, 1, MIM# 300751, Protoporphyria, erythropoietic, X-linked, MIM# 300752; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.24 ALAS2 Zornitza Stark Marked gene: ALAS2 as ready
Red cell disorders v0.24 ALAS2 Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence).
Red cell disorders v0.24 ALAS2 Zornitza Stark Phenotypes for gene: ALAS2 were changed from Anemia, sideroblastic, 1 300751; Anemia, sideroblastic, 1, 300751; 300751 Sideroblastic anaemia 1; 300751 Anemia, sideroblastic, 1 to Anaemia, sideroblastic, 1, MIM# 300751
Red cell disorders v0.23 ALAS2 Zornitza Stark Publications for gene: ALAS2 were set to 10029606
Red cell disorders v0.22 ALAS2 Zornitza Stark edited their review of gene: ALAS2: Added comment: The essential features of X-linked sideroblastic anemia include: (1) a hypochromic microcytic anaemia and 2 discrete populations of red blood cells, one microcytic and the other normocytic; (2) marrow ringed sideroblasts, particularly prominent in the late erythroid precursors; (3) a variable haematologic response to pharmacologic doses of pyridoxine; and (4) systemic iron overload secondary to chronic ineffective erythropoiesis. The age of clinical onset of the disorder can vary from in utero to the ninth decade.

Well established gene-disease association.; Changed publications: 10029606, 7949148, 10029606
Red cell disorders v0.22 ALAS2 Zornitza Stark edited their review of gene: ALAS2: Changed phenotypes: Anaemia, sideroblastic, 1, MIM# 300751
Red cell disorders v0.22 ABCG8 Zornitza Stark Marked gene: ABCG8 as ready
Red cell disorders v0.22 ABCG8 Zornitza Stark Gene: abcg8 has been classified as Green List (High Evidence).
Red cell disorders v0.22 ABCG8 Zornitza Stark Phenotypes for gene: ABCG8 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolemia 1, MIM# 210250
Red cell disorders v0.21 ABCG8 Zornitza Stark Publications for gene: ABCG8 were set to
Red cell disorders v0.20 ABCG8 Zornitza Stark reviewed gene: ABCG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 33807969; Phenotypes: Sitosterolemia 1, MIM# 210250; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.20 ADA2 Zornitza Stark Marked gene: ADA2 as ready
Red cell disorders v0.20 ADA2 Zornitza Stark Gene: ada2 has been classified as Green List (High Evidence).
Red cell disorders v0.20 ADA2 Zornitza Stark Phenotypes for gene: ADA2 were changed from Diamond Blackfan anaemia to Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome, MIM# 615688
Red cell disorders v0.19 ADA2 Zornitza Stark Publications for gene: ADA2 were set to
Red cell disorders v0.18 ADA2 Zornitza Stark changed review comment from: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency.

At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.; to: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency.

At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.

Anaemia is a reported feature.
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666
Familial hypercholesterolaemia v0.17 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Familial hypercholesterolaemia v0.16 ABCG5 Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Familial hypercholesterolaemia v0.15 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9031 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Mendeliome v0.9031 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Mendeliome v0.9031 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666
Mendeliome v0.9030 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Mendeliome v0.9029 ABCG5 Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9028 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.18 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Red cell disorders v0.18 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Red cell disorders v0.18 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to 32546081; 23556150
Red cell disorders v0.17 ABCG5 Zornitza Stark edited their review of gene: ABCG5: Changed publications: 34304999, 33907061, 32546081, 23556150
Red cell disorders v0.17 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolaemia 2, MIM# 618666
Red cell disorders v0.16 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Red cell disorders v0.15 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v1.2 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Rare Disease
Regression v0.368 ABCB7 Zornitza Stark Marked gene: ABCB7 as ready
Regression v0.368 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence).
Regression v0.368 ABCB7 Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Regression v0.367 ABCB7 Zornitza Stark Phenotypes for gene: ABCB7 were changed from to Anaemia, sideroblastic, with ataxia, MIM# 301310
Regression v0.366 ABCB7 Zornitza Stark Publications for gene: ABCB7 were set to
Regression v0.366 ABCB7 Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Regression v0.365 ABCB7 Zornitza Stark Classified gene: ABCB7 as Red List (low evidence)
Regression v0.365 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence).
Regression v0.364 ABCB7 Zornitza Stark reviewed gene: ABCB7: Rating: RED; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.14 ABCB7 Zornitza Stark Marked gene: ABCB7 as ready
Red cell disorders v0.14 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Green List (High Evidence).
Red cell disorders v0.14 ABCB7 Zornitza Stark Phenotypes for gene: ABCB7 were changed from 301310 Sideroblastic anaemia; Anemia, sideroblastic, with ataxia; Anemia, sideroblastic, with ataxia, 301310; 301310 Sideroblastic Anemia and Ataxia; Sideroblastic Anemia and Ataxia to Anaemia, sideroblastic, with ataxia, MIM# 301310
Red cell disorders v0.13 ABCB7 Zornitza Stark Publications for gene: ABCB7 were set to 11843825; 4045952; 11050011
Red cell disorders v0.12 ABCB7 Zornitza Stark reviewed gene: ABCB7: Rating: GREEN; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.11 Zornitza Stark Panel name changed from Rare anaemia_GEL to Red cell disorders
Callosome v0.320 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Genetic Epilepsy v0.1183 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Genetic Epilepsy v0.1182 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Mendeliome v0.9028 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Mendeliome v0.9027 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4096 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Callosome v0.320 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Callosome v0.319 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Genetic Epilepsy v0.1182 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Genetic Epilepsy v0.1181 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Mendeliome v0.9027 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Mendeliome v0.9026 CLCN3 Zornitza Stark reviewed gene: CLCN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Mode of inheritance: None
Mendeliome v0.9026 TOM1 Zornitza Stark Marked gene: TOM1 as ready
Mendeliome v0.9026 TOM1 Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence).
Mendeliome v0.9026 TOM1 Zornitza Stark gene: TOM1 was added
gene: TOM1 was added to Mendeliome. Sources: Expert list
Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TOM1 were set to 31263572
Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510
Review for gene: TOM1 was set to RED
Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data.
Sources: Expert list
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark Marked gene: TOM1 as ready
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence).
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark gene: TOM1 was added
gene: TOM1 was added to Combined Immunodeficiency. Sources: Expert list
Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TOM1 were set to 31263572
Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510
Review for gene: TOM1 was set to RED
Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data.
Sources: Expert list
Mendeliome v0.9025 ARF1 Arina Puzriakova reviewed gene: ARF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28868155, 34353862; Phenotypes: Periventricular nodular heterotopia 8, OMIM:618185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9025 GINS2 Arina Puzriakova gene: GINS2 was added
gene: GINS2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included.

GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Mendeliome v0.9025 DNAH10 Zornitza Stark Phenotypes for gene: DNAH10 were changed from primary male infertility with asthenoteratozoospermia to Spermatogenic failure 56, MIM# 619515
Mendeliome v0.9024 DNAH10 Zornitza Stark reviewed gene: DNAH10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 56, MIM# 619515; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4095 GNB2 Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503
Intellectual disability syndromic and non-syndromic v0.4094 GNB2 Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503
Mendeliome v0.9024 GNB2 Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503
Mendeliome v0.9023 GNB2 Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503
Mendeliome v0.9023 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; cerebral ventriculomegaly; limb contractures to Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; Ventriculomegaly and arthrogryposis, MIM# 619501
Mendeliome v0.9022 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296, Ventriculomegaly and arthrogryposis, MIM# 619501
Hydrocephalus_Ventriculomegaly v0.94 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures
Hydrocephalus_Ventriculomegaly v0.93 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures
Arthrogryposis v0.292 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures
Arthrogryposis v0.291 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures
Growth failure v1.1 Zornitza Stark Panel name changed from Growth failure in early childhood to Growth failure
Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Growth failure v1.0 Zornitza Stark promoted panel to version 1.0
Growth failure v0.404 ZFP57 Zornitza Stark edited their review of gene: ZFP57: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.404 ZFP57 Zornitza Stark Marked gene: ZFP57 as ready
Growth failure v0.404 ZFP57 Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence).
Growth failure v0.404 ZFP57 Zornitza Stark Phenotypes for gene: ZFP57 were changed from diabetes mellitus, transient neonatal, 1MONDO:0011073; Diabetes mellitus, transient neonatal 1 OMIM:601410; IUGR; Multi Locus Imprinting Disturbance to Diabetes mellitus, transient neonatal 1, MIM# 601410
Growth failure v0.403 ZFP57 Zornitza Stark Classified gene: ZFP57 as Green List (high evidence)
Growth failure v0.403 ZFP57 Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence).
Growth failure v0.402 ZFP57 Zornitza Stark reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393; Phenotypes: Diabetes mellitus, transient neonatal 1, MIM# 601410; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Classified gene: GOSR2 as Green List (high evidence)
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Added comment: Comment on list classification: Additional cases reported with muscular dystrophy
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Gene: gosr2 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.91 GOSR2 Bryony Thompson reviewed gene: GOSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34167170, 33639315, 33639315, 29855340, DOI:https://doi.org/10.1016/j.nmd.2013.06.404; Phenotypes: Epilepsy, progressive myoclonic 6 MIM#614018, congenital muscluar dystrophy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.402 PADI6 Zornitza Stark Marked gene: PADI6 as ready
Growth failure v0.402 PADI6 Zornitza Stark Gene: padi6 has been classified as Amber List (Moderate Evidence).
Growth failure v0.402 PADI6 Zornitza Stark Phenotypes for gene: PADI6 were changed from miscarriages in the family; Preimplantation embryonic lethality 2 OMIM:617234; Short stature; preimplantation embryonic lethality 2 MONDO:0014978; Multi Locus Imprinting Disturbance; IUGR; Beckwith-Wiedemann syndrome to IUGR
Growth failure v0.401 PADI6 Zornitza Stark Mode of inheritance for gene: PADI6 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.400 PADI6 Zornitza Stark reviewed gene: PADI6: Rating: AMBER; Mode of pathogenicity: None; Publications: 33221824, 32928291, 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.400 NLRP7 Zornitza Stark Marked gene: NLRP7 as ready
Growth failure v0.400 NLRP7 Zornitza Stark Gene: nlrp7 has been classified as Amber List (Moderate Evidence).
Growth failure v0.400 NLRP7 Zornitza Stark Phenotypes for gene: NLRP7 were changed from hydatidiform mole, recurrent, 1 MONDO:0009273; Short stature; fetal wastage; Hydatidiform mole, recurrent, 1 OMIM:231090; IUGR; Multi Locus Imprinting Disturbance to IUGR
Growth failure v0.399 NLRP7 Zornitza Stark Mode of inheritance for gene: NLRP7 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.398 NLRP7 Zornitza Stark reviewed gene: NLRP7: Rating: AMBER; Mode of pathogenicity: None; Publications: 28561018; Phenotypes: IUGR; Mode of inheritance: Other
Myopathy Superpanel v1.43 Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Myopathy - adult onset; Muscular dystrophy_Paediatric; Rhabdomyolysis; Limb Girdle Muscular Dystrophy
Mendeliome v0.9022 CHRM1 Bryony Thompson Marked gene: CHRM1 as ready
Mendeliome v0.9022 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Marked gene: CHRM1 as ready
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4093 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Mendeliome v0.9022 CHRM1 Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence)
Mendeliome v0.9022 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9021 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Mendeliome v0.9020 FGF20 Zornitza Stark Marked gene: FGF20 as ready
Mendeliome v0.9020 FGF20 Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9020 FGF20 Zornitza Stark Classified gene: FGF20 as Amber List (moderate evidence)
Mendeliome v0.9020 FGF20 Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9019 FGF20 Zornitza Stark gene: FGF20 was added
gene: FGF20 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: FGF20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FGF20 were set to 22698282
Phenotypes for gene: FGF20 were set to Renal hypodysplasia/aplasia 2, MIM#615721
Review for gene: FGF20 was set to AMBER
Added comment: Multiple affected fetuses in a consanguineous family; functional data.
Sources: Expert Review
Mendeliome v0.9018 ITGA8 Zornitza Stark Marked gene: ITGA8 as ready
Mendeliome v0.9018 ITGA8 Zornitza Stark Gene: itga8 has been classified as Green List (High Evidence).
Mendeliome v0.9018 ITGA8 Zornitza Stark Phenotypes for gene: ITGA8 were changed from to Renal hypodysplasia/aplasia 1, MIM# 191830
Mendeliome v0.9017 ITGA8 Zornitza Stark Publications for gene: ITGA8 were set to
Mendeliome v0.9016 ITGA8 Zornitza Stark Mode of inheritance for gene: ITGA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9015 ITGA8 Zornitza Stark reviewed gene: ITGA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 24439109; Phenotypes: Renal hypodysplasia/aplasia 1, MIM# 191830; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.398 NLRP5 Zornitza Stark Marked gene: NLRP5 as ready
Growth failure v0.398 NLRP5 Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence).
Growth failure v0.398 NLRP5 Zornitza Stark Phenotypes for gene: NLRP5 were changed from body asymmetry; Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR to Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR
Growth failure v0.397 NLRP5 Zornitza Stark Mode of inheritance for gene: NLRP5 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.396 NLRP5 Zornitza Stark Classified gene: NLRP5 as Amber List (moderate evidence)
Growth failure v0.396 NLRP5 Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence).
Growth failure v0.395 NLRP5 Zornitza Stark changed review comment from: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP2 in the MOTHER of the patient.

Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother.

Current trio filtering protocols may not account for this adequately.; to: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP5 in the MOTHER of the patient.

Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother.

Current trio filtering protocols may not account for this adequately.
Growth failure v0.395 NLRP5 Zornitza Stark reviewed gene: NLRP5: Rating: AMBER; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.395 STAT3 Zornitza Stark Marked gene: STAT3 as ready
Growth failure v0.395 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Growth failure v0.395 STAT3 Zornitza Stark Classified gene: STAT3 as Green List (high evidence)
Growth failure v0.395 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Growth failure v0.394 Zornitza Stark removed gene:NPR2 from the panel
Mendeliome v0.9015 NPR2 Zornitza Stark Marked gene: NPR2 as ready
Mendeliome v0.9015 NPR2 Zornitza Stark Gene: npr2 has been classified as Green List (High Evidence).
Mendeliome v0.9015 NPR2 Zornitza Stark Phenotypes for gene: NPR2 were changed from to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Epiphyseal chondrodysplasia, Miura type, MIM# 615923; Short stature with nonspecific skeletal abnormalities, MIM# 616255
Mendeliome v0.9014 NPR2 Zornitza Stark Publications for gene: NPR2 were set to
Mendeliome v0.9013 NPR2 Zornitza Stark Mode of inheritance for gene: NPR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9012 NPR2 Zornitza Stark changed review comment from: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.; to: Bi-allelic variants: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.

Mono-allelic variants have been linked to both tall stature and short stature disorders. Multiple families.
Mendeliome v0.9012 NPR2 Zornitza Stark edited their review of gene: NPR2: Changed publications: 31555216, 16384845, 15146390, 22870295, 24057292, 24259409, 16384845, 24471569; Changed phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Epiphyseal chondrodysplasia, Miura type, MIM# 615923, Short stature with nonspecific skeletal abnormalities, MIM# 616255; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9012 NPR2 Zornitza Stark reviewed gene: NPR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31555216, 16384845, 15146390; Phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Short stature, disproportionate, Oval vertebral bodies in infancy, Progressive shortening of humerus, radius and ulna in first year, dwarfism, Prominent forehead; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.393 Zornitza Stark removed gene:RAPSN from the panel
Arthrogryposis v0.291 RAPSN Zornitza Stark Marked gene: RAPSN as ready
Arthrogryposis v0.291 RAPSN Zornitza Stark Gene: rapsn has been classified as Green List (High Evidence).
Arthrogryposis v0.291 RAPSN Zornitza Stark Phenotypes for gene: RAPSN were changed from to Fetal akinesia deformation sequence 2 MIM# 618388; AChR deficiency; fetal akinesia; IUGR; micrognathia; hypokinesia; contractures; muscular hypotonia; feeding difficulties; severe respiratory insufficiency; history of miscarriage
Arthrogryposis v0.290 RAPSN Zornitza Stark Publications for gene: RAPSN were set to
Arthrogryposis v0.289 RAPSN Zornitza Stark Mode of inheritance for gene: RAPSN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Arthrogryposis v0.288 RAPSN Zornitza Stark reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region)
Mendeliome v0.9011 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Mendeliome v0.9010 RPS6KA3 Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9009 RPS6KA3 Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.392 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Growth failure v0.392 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Growth failure v0.392 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from Coffin Lowry to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region)
Growth failure v0.391 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Growth failure v0.390 RPS6KA3 Zornitza Stark Classified gene: RPS6KA3 as Green List (high evidence)
Growth failure v0.390 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark gene: SHOX2 was added
gene: SHOX2 was added to Atrial Fibrillation. Sources: Expert Review
Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHOX2 were set to 30443179
Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation
Review for gene: SHOX2 was set to RED
Added comment: Single family reported with LoF in this gene and AF.
Sources: Expert Review
Mendeliome v0.9009 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Mendeliome v0.9009 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Mendeliome v0.9009 SHOX2 Zornitza Stark gene: SHOX2 was added
gene: SHOX2 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHOX2 were set to 30443179
Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation
Review for gene: SHOX2 was set to RED
Added comment: Single family reported with LoF in this gene and AF.
Sources: Expert Review
Growth failure v0.389 SHOX2 Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.388 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Growth failure v0.388 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Growth failure v0.388 SHOX2 Zornitza Stark Phenotypes for gene: SHOX2 were changed from to Sinus Node Dysfunction; Atrial Fibrillation
Growth failure v0.387 SHOX2 Zornitza Stark Publications for gene: SHOX2 were set to
Growth failure v0.386 SHOX2 Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.385 SMARCAL1 Zornitza Stark Marked gene: SMARCAL1 as ready
Growth failure v0.385 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Growth failure v0.385 SMARCAL1 Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from to Schimke immune-osseous dysplasia MIM# 242900; T cell deficiency; Short stature; IUGR; spondyloepiphyseal dysplasia; growth retardation; renal dysfunction; lymphocytopaenia; nephropathy; bacterial/viral/fungal infections; may present as SCID; bone marrow failure
Growth failure v0.384 SMARCAL1 Zornitza Stark Publications for gene: SMARCAL1 were set to
Growth failure v0.383 SMARCAL1 Zornitza Stark Mode of inheritance for gene: SMARCAL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.382 SMARCAL1 Zornitza Stark Classified gene: SMARCAL1 as Green List (high evidence)
Growth failure v0.382 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Growth failure v0.381 NPR2 Danielle Ariti gene: NPR2 was added
gene: NPR2 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: NPR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NPR2 were set to 31555216; 16384845; 15146390
Phenotypes for gene: NPR2 were set to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Short stature, disproportionate; Oval vertebral bodies in infancy; Progressive shortening of humerus, radius and ulna in first year; dwarfism; Prominent forehead
Review for gene: NPR2 was set to GREEN
Added comment: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.
Sources: Literature
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Marked gene: EPHB4 as ready
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence).
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Classified gene: EPHB4 as Amber List (moderate evidence)
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence).
Vascular Malformations_Somatic v1.5 EPHB4 Bryony Thompson gene: EPHB4 was added
gene: EPHB4 was added to Vascular Malformations_Somatic. Sources: Other
Mode of inheritance for gene: EPHB4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHB4 were set to 31300548; 30760892
Phenotypes for gene: EPHB4 were set to Capillary malformation-arteriovenous malformation
Review for gene: EPHB4 was set to AMBER
Added comment: A single CV-AVM case has been reported with mosaicism of an EPHB4 variant. Mosaicism has also been reported for the other CV-AVM gene, RASA1.
Sources: Other
Growth failure v0.381 STAT3 Danielle Ariti gene: STAT3 was added
gene: STAT3 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: STAT3 were set to 25349174; 25038750; 25359994
Phenotypes for gene: STAT3 were set to Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Lymphoproliferation; solid organ autoimmunity; growth failure; recurrent infections; short stature; IUGR; eczema; delayed puberty; dental abnormalities; autoimmune interstitial lung disease; juvenile-onset arthritis; primary hypothyroidism
Mode of pathogenicity for gene: STAT3 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: STAT3 was set to GREEN
Added comment: 18 individuals from 15 unrelated families; monoallelic (missense or in-frame del) variants; gain of function; Multiple mouse models

Individuals exhibited various clinical features, with most presenting with early-onset autoimmunity and growth failure (IUGR, lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, recurrent infections, and short stature (<2SDS)).
Sources: Literature
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Marked gene: HS2ST1 as ready
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Classified gene: HS2ST1 as Green List (high evidence)
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.84 HS2ST1 Zornitza Stark gene: HS2ST1 was added
gene: HS2ST1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review
Mode of inheritance for gene: HS2ST1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HS2ST1 were set to 33159882
Phenotypes for gene: HS2ST1 were set to Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194
Review for gene: HS2ST1 was set to GREEN
Added comment: 4 individuals from 3 unrelated families reported.
Sources: Expert Review
Repeat Disorders v0.123 PHPX Zornitza Stark Tag paediatric-onset tag was added to STR: PHPX.
Growth failure v0.381 RAPSN Danielle Ariti reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mirror movements v1.0 Bryony Thompson promoted panel to version 1.0
Mirror movements v0.9 Bryony Thompson Panel status changed from internal to public
Mirror movements v0.8 DNAL4 Bryony Thompson gene: DNAL4 was added
gene: DNAL4 was added to Mirror movements. Sources: Other
Mode of inheritance for gene: DNAL4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAL4 were set to 25098561; 25236653
Phenotypes for gene: DNAL4 were set to Mirror movements 3 MIM#616059
Review for gene: DNAL4 was set to RED
Added comment: Only a single large consanguineous Pakastani family with a homozygous variant reported.
Sources: Other
Mirror movements v0.7 RAD51 Bryony Thompson Marked gene: RAD51 as ready
Mirror movements v0.7 RAD51 Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence).
Mirror movements v0.7 RAD51 Bryony Thompson Classified gene: RAD51 as Green List (high evidence)
Mirror movements v0.7 RAD51 Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence).
Mirror movements v0.6 RAD51 Bryony Thompson gene: RAD51 was added
gene: RAD51 was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAD51 were set to 25763452; 22305526; 27830107; 24808016
Phenotypes for gene: RAD51 were set to Mirror movements 2 MIM#614508
Review for gene: RAD51 was set to GREEN
gene: RAD51 was marked as current diagnostic
Added comment: >3 families/probands reported with mirror movements
Sources: Expert list
Growth failure v0.381 RPS6KA3 Danielle Ariti reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.381 SHOX2 Danielle Ariti reviewed gene: SHOX2: Rating: RED; Mode of pathogenicity: None; Publications: 30443179, 16537395, 16537395; Phenotypes: Linked to Sinus Node Dysfunction, Linked to Atrial Fibrillation; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.381 SMARCAL1 Danielle Ariti reviewed gene: SMARCAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301550, 17089404, 20036229; Phenotypes: Schimke immune-osseous dysplasia MIM# 242900, T cell deficiency, Short stature, IUGR, spondyloepiphyseal dysplasia, growth retardation, renal dysfunction, lymphocytopaenia, nephropathy, bacterial/viral/fungal infections, may present as SCID, bone marrow failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mirror movements v0.5 NTN1 Bryony Thompson Marked gene: NTN1 as ready
Mirror movements v0.5 NTN1 Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence).
Mirror movements v0.5 NTN1 Bryony Thompson Classified gene: NTN1 as Green List (high evidence)
Mirror movements v0.5 NTN1 Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence).
Mirror movements v0.4 NTN1 Bryony Thompson gene: NTN1 was added
gene: NTN1 was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: NTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NTN1 were set to 25763452; 28945198; 33472083
Phenotypes for gene: NTN1 were set to Mirror movements 4 MIM#618264
Review for gene: NTN1 was set to GREEN
gene: NTN1 was marked as current diagnostic
Added comment: Two unrelated families and an unrelated proband with mirror movements. Also, a mouse model recapitulates the human phenotype.
Sources: Expert list
Repeat Disorders v0.123 HPE5 Zornitza Stark Tag paediatric-onset tag was added to STR: HPE5.
Repeat Disorders v0.123 HMNMYO Zornitza Stark Tag paediatric-onset tag was added to STR: HMNMYO.
Repeat Disorders v0.123 HFGS_tract3 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract3.
Repeat Disorders v0.123 HFGS_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract2.
Repeat Disorders v0.123 HFGS_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract1.
Repeat Disorders v0.123 HDL2 Zornitza Stark Tag adult-onset tag was added to STR: HDL2.
Repeat Disorders v0.123 HD Zornitza Stark Tag adult-onset tag was added to STR: HD.
Repeat Disorders v0.123 GDPAG Zornitza Stark Tag paediatric-onset tag was added to STR: GDPAG.
Repeat Disorders v0.123 FXTAS Zornitza Stark Tag adult-onset tag was added to STR: FXTAS.
Repeat Disorders v0.123 FXS Zornitza Stark Tag paediatric-onset tag was added to STR: FXS.
Repeat Disorders v0.123 FXPOI Zornitza Stark Tag adult-onset tag was added to STR: FXPOI.
Mirror movements v0.3 DCC Bryony Thompson Classified gene: DCC as Green List (high evidence)
Mirror movements v0.3 DCC Bryony Thompson Gene: dcc has been classified as Green List (High Evidence).
Mirror movements v0.2 DCC Bryony Thompson gene: DCC was added
gene: DCC was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: DCC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DCC were set to 20431009; 25763452; 28250454
Phenotypes for gene: DCC were set to Mirror movements 1 and/or agenesis of the corpus callosum MIM#157600
Review for gene: DCC was set to GREEN
gene: DCC was marked as current diagnostic
Added comment: Well-established and most common cause of congenital mirror movements. >20 cases reported.
Sources: Expert list
Mirror movements v0.1 Bryony Thompson Panel name changed from Osteoporosis to Mirror movements
Panel status changed from deleted to internal
Repeat Disorders v0.123 FTDALS Zornitza Stark Tag adult-onset tag was added to STR: FTDALS.
Repeat Disorders v0.123 FRDA Zornitza Stark Tag paediatric-onset tag was added to STR: FRDA.
Repeat Disorders v0.123 FRAXE Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXE.
Repeat Disorders v0.123 FECD3 Zornitza Stark Tag adult-onset tag was added to STR: FECD3.
Repeat Disorders v0.123 FAME3 Zornitza Stark Tag adult-onset tag was added to STR: FAME3.
Repeat Disorders v0.123 FAME2 Zornitza Stark Tag adult-onset tag was added to STR: FAME2.
Repeat Disorders v0.123 FAME1 Zornitza Stark Tag adult-onset tag was added to STR: FAME1.
Repeat Disorders v0.123 EPM1 Zornitza Stark Tag paediatric-onset tag was added to STR: EPM1.
Repeat Disorders v0.123 EIEE1_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract2.
Repeat Disorders v0.123 EIEE1_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract1.
Repeat Disorders v0.123 DRPLA Zornitza Stark Tag adult-onset tag was added to STR: DRPLA.
Tag paediatric-onset tag was added to STR: DRPLA.
Repeat Disorders v0.123 DM2 Zornitza Stark Tag adult-onset tag was added to STR: DM2.
Repeat Disorders v0.123 DM1 Zornitza Stark Tag adult-onset tag was added to STR: DM1.
Tag paediatric-onset tag was added to STR: DM1.
Repeat Disorders v0.123 DBQD2 Zornitza Stark Tag paediatric-onset tag was added to STR: DBQD2.
Repeat Disorders v0.123 CJD Zornitza Stark Tag adult-onset tag was added to STR: CJD.
Repeat Disorders v0.123 CCHS Zornitza Stark Tag paediatric-onset tag was added to STR: CCHS.
Repeat Disorders v0.123 CANVAS Zornitza Stark Tag adult-onset tag was added to STR: CANVAS.
Repeat Disorders v0.123 BPES Zornitza Stark Tag paediatric-onset tag was added to STR: BPES.
Growth failure v0.381 MSTO1 Zornitza Stark Marked gene: MSTO1 as ready
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.381 MSTO1 Zornitza Stark Classified gene: MSTO1 as Green List (high evidence)
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.380 MSTO1 Zornitza Stark reviewed gene: MSTO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28544275, 29339779, 30684668; Phenotypes: Myopathy, mitochondrial, and ataxia, MIM# 617675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9007 KCTD7 Zornitza Stark Marked gene: KCTD7 as ready
Mendeliome v0.9007 KCTD7 Zornitza Stark Gene: kctd7 has been classified as Green List (High Evidence).
Mendeliome v0.9007 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726)
Mendeliome v0.9006 KCTD7 Zornitza Stark Publications for gene: KCTD7 were set to
Mendeliome v0.9005 KCTD7 Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9004 KCTD7 Kristin Rigbye reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 22693283, 22748208; Phenotypes: Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.139 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Clefting disorders v0.138 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4092 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4091 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Genetic Epilepsy v0.1181 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Genetic Epilepsy v0.1180 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Mendeliome v0.9004 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Mendeliome v0.9003 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Growth failure v0.380 RPL10 Zornitza Stark Marked gene: RPL10 as ready
Growth failure v0.380 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Growth failure v0.380 RPL10 Zornitza Stark Phenotypes for gene: RPL10 were changed from Mental retardation, X-linked, syndromic, 35 to Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998; severe growth retardation; intrauterine growth restriction; short stature; dysmorphic facial features (prognathism, dental crowding, thin upper lip); microcephaly; seizures; hypotonia; genitourinary abnormalities; cerebellar hypoplasia
Growth failure v0.379 RPL10 Zornitza Stark Publications for gene: RPL10 were set to 25316788
Growth failure v0.378 RPL10 Zornitza Stark Classified gene: RPL10 as Green List (high evidence)
Growth failure v0.378 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Mendeliome v0.9003 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face; Brachydactyly, type B1 MIM# 113000; hypoplasia/aplasia of distal phalanges and nails (2-5)
Mendeliome v0.9002 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Mendeliome v0.9001 ROR2 Zornitza Stark Mode of inheritance for gene: ROR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9000 ROR2 Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.377 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Growth failure v0.377 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Growth failure v0.377 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face
Growth failure v0.376 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Growth failure v0.375 ROR2 Zornitza Stark Classified gene: ROR2 as Green List (high evidence)
Growth failure v0.375 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Mendeliome v0.9000 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Mendeliome v0.8999 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Mendeliome v0.8998 PROP1 Zornitza Stark Mode of inheritance for gene: PROP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 PROP1 Zornitza Stark reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.374 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Growth failure v0.374 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.374 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from Pituitary hormone deficiency, combined to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Growth failure v0.373 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Growth failure v0.372 PROP1 Zornitza Stark Classified gene: PROP1 as Green List (high evidence)
Growth failure v0.372 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Marked gene: PROKR2 as ready
Growth failure v0.371 PROKR2 Zornitza Stark Gene: prokr2 has been classified as Red List (Low Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Phenotypes for gene: PROKR2 were changed from hypopituitarism, Hypoplastic corpus callosum, normal or small anterior pituitary, Club foot, syrinx spinal cord, microcephaly, epilepsy to Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200; Kallmann syndrome (KS); normosmic idiopathic hypogonadotropic hypogonadism (nIHH); Anosmia; GnRH deficiency; cleft lip and palate; renal agenesis; Hypogonadotropic hypogonadism; low testosterone/ estradiol; Absent/ partial Puberty; Hearing loss
Growth failure v0.370 PROKR2 Zornitza Stark Publications for gene: PROKR2 were set to 22319038
Growth failure v0.369 PROKR2 Zornitza Stark Mode of inheritance for gene: PROKR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 RPL10 Danielle Ariti Deleted their comment
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti edited their review of gene: RPL10: Added comment: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; Changed phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, short stature, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, severe growth restriction (IUGR), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti reviewed gene: RPL10: Rating: GREEN; Mode of pathogenicity: None; Publications: 25316788, 25846674, 26290468; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature in early childhood is not a prominent feature; Changed rating: RED
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 ROR2 Danielle Ariti reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.368 PROP1 Danielle Ariti reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/ partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their review
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), Normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Marked gene: WRN as ready
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Cancer Predisposition_Paediatric v0.112 WRN Zornitza Stark Publications for gene: WRN were set to
Cancer Predisposition_Paediatric v0.111 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cancer Predisposition_Paediatric v0.110 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 WRN Zornitza Stark Marked gene: WRN as ready
Mendeliome v0.8997 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Mendeliome v0.8997 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Mendeliome v0.8996 WRN Zornitza Stark Publications for gene: WRN were set to
Mendeliome v0.8995 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8994 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 WRN Zornitza Stark Marked gene: WRN as ready
Growth failure v0.368 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.368 WRN Zornitza Stark Phenotypes for gene: WRN were changed from Werner syndrome to Werner syndrome, MIM# 277700; MONDO:0010196
Growth failure v0.367 WRN Zornitza Stark Publications for gene: WRN were set to
Growth failure v0.366 WRN Zornitza Stark Classified gene: WRN as Green List (high evidence)
Growth failure v0.366 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.365 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from Pituitary hormone deficiency, combined, 1 (613038) to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Pituitary hormone deficiency v0.16 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Pituitary hormone deficiency v0.15 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.148 CJD Bryony Thompson Marked STR: CJD as ready
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.148 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.147 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8994 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Mendeliome v0.8994 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8994 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Mendeliome v0.8993 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Mendeliome v0.8992 POU1F1 Zornitza Stark Mode of inheritance for gene: POU1F1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8991 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.146 Bryony Thompson removed STR:PRNP from the panel
Repeat Disorders v0.123 CJD Bryony Thompson Marked STR: CJD as ready
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.123 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.122 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8991 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Growth failure v0.365 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from GH, PRL deficiencies; variable degree of TSH deficiency to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Growth failure v0.364 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Growth failure v0.363 POU1F1 Zornitza Stark Classified gene: POU1F1 as Green List (high evidence)
Growth failure v0.363 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8991 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.363 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Regression. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Growth failure v0.362 POU1F1 Danielle Ariti reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Regression v0.362 NOP56 Bryony Thompson Classified gene: NOP56 as No list
Regression v0.362 NOP56 Bryony Thompson Added comment: Comment on list classification: STR expansion is the only reported cause of disease for this gene. An STR has been added to this panel under SCA36
Regression v0.362 NOP56 Bryony Thompson Gene: nop56 has been removed from the panel.
Mendeliome v0.8990 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Literature
Repeat Disorders v0.121 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.121 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.120 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Expert list
Mendeliome v0.8989 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Mendeliome v0.8989 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Mendeliome v0.8989 GIPC1 Bryony Thompson Classified gene: GIPC1 as No list
Mendeliome v0.8989 GIPC1 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under OPDM2
Mendeliome v0.8989 GIPC1 Bryony Thompson Gene: gipc1 has been removed from the panel.
Mendeliome v0.8988 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Mendeliome v0.8988 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Marked STR: FAME3 as ready
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Classified STR: FAME3 as Green List (high evidence)
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.118 FAME3 Bryony Thompson STR: FAME3 was added
STR: FAME3 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME3 were set to 31664039
Phenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: FAME3 was set to GREEN
STR: FAME3 was marked as clinically relevant
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Mendeliome v0.8987 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.85 BRWD3 Chirag Patel Classified gene: BRWD3 as Green List (high evidence)
Macrocephaly_Megalencephaly v0.85 BRWD3 Chirag Patel Gene: brwd3 has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.84 BRWD3 Chirag Patel gene: BRWD3 was added
gene: BRWD3 was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: BRWD3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: BRWD3 were set to PMID: 30628072, 24462886
Phenotypes for gene: BRWD3 were set to Intellectual developmental disorder, X-linked 93; OMIM # 300659
Review for gene: BRWD3 was set to GREEN
Added comment: 10 patients (from 6 unrelated families) with ID, macrocephaly and dysmorphic facial features.
Sources: Literature
Mendeliome v0.8986 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Mendeliome v0.8986 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Mendeliome v0.8986 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Overgrowth v1.4 BRWD3 Chirag Patel Classified gene: BRWD3 as Green List (high evidence)
Overgrowth v1.4 BRWD3 Chirag Patel Gene: brwd3 has been classified as Green List (High Evidence).
Overgrowth v1.3 BRWD3 Chirag Patel reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, OMIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1179 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Repeat Disorders v0.117 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.117 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.116 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.83 PPP2R5D Chirag Patel Classified gene: PPP2R5D as Green List (high evidence)
Macrocephaly_Megalencephaly v0.83 PPP2R5D Chirag Patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Overgrowth v1.3 PPP2R5D Chirag Patel Classified gene: PPP2R5D as Green List (high evidence)
Overgrowth v1.3 PPP2R5D Chirag Patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.82 PPP2R5D Chirag Patel gene: PPP2R5D was added
gene: PPP2R5D was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: PPP2R5D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5D were set to PMID: 26168268, 25972378, 25533962; 34448180
Phenotypes for gene: PPP2R5D were set to Mental retardation, autosomal dominant 35, MIM# 616355
Review for gene: PPP2R5D was set to GREEN
Added comment: Phenotype of macrocephaly is consistent, and multiple patients reported
Sources: Literature
Overgrowth v1.2 PPP2R5D Chirag Patel reviewed gene: PPP2R5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Repeat Disorders v0.115 FAME4 Bryony Thompson Marked STR: FAME4 as ready
Repeat Disorders v0.115 FAME4 Bryony Thompson Str: fame4 has been classified as Red List (Low Evidence).
Repeat Disorders v0.115 FAME4 Bryony Thompson STR: FAME4 was added
STR: FAME4 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME4 were set to 31539032
Phenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127
Review for STR: FAME4 was set to RED
Added comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease.
Sources: Literature
Repeat Disorders v0.114 OPML1 Bryony Thompson Marked STR: OPML1 as ready
Repeat Disorders v0.114 OPML1 Bryony Thompson Str: opml1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.114 OPML1 Bryony Thompson STR: OPML1 was added
STR: OPML1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPML1 were set to 31332380
Phenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637
Review for STR: OPML1 was set to RED
Added comment: NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Mendeliome v0.8985 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986; 24355708
Mendeliome v0.8984 PNPLA6 Zornitza Stark changed review comment from: Ataxia is part of the phenotype.
Sources: Expert list; to: Variants in this gene are associated with multiple phenotypes.

Oliver-McFarlane syndrome is a rare congenital disorder characterized by trichomegaly, severe chorioretinal atrophy and multiple pituitary hormone deficiencies, including growth hormone. At least 10 families reported.

Laurence-Moon syndrome has a clinical presentation similar to that of Oliver-McFarlane syndrome, including chorioretinopathy and pituitary dysfunction, but with childhood onset of ataxia, peripheral neuropathy, and spastic paraplegia and without trichomegaly. Single family reported.
Mendeliome v0.8984 PNPLA6 Zornitza Stark edited their review of gene: PNPLA6: Changed publications: 25480986, 33818269, 32758583, 30097146; Changed phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800
Growth failure v0.362 PNPLA6 Zornitza Stark Marked gene: PNPLA6 as ready
Growth failure v0.362 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.362 PNPLA6 Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Oliver-Mcfarlane syndrome, Trichomegaly, GH deficiency, retinal dystrophy, hypogonadotrophic hypogonadism to Oliver-McFarlane syndrome, MIM# 275400; Laurence-Moon syndrome, MIM# 245800
Growth failure v0.361 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986
Growth failure v0.360 PNPLA6 Zornitza Stark Classified gene: PNPLA6 as Green List (high evidence)
Growth failure v0.360 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.359 PNPLA6 Zornitza Stark reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480986, 33818269, 32758583, 30097146; Phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8984 PI4KA Zornitza Stark Phenotypes for gene: PI4KA were changed from Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531 to Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531; Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Mendeliome v0.8983 PI4KA Zornitza Stark Publications for gene: PI4KA were set to 25855803
Mendeliome v0.8982 PI4KA Zornitza Stark Classified gene: PI4KA as Green List (high evidence)
Mendeliome v0.8982 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Mendeliome v0.8981 PI4KA Zornitza Stark changed review comment from: Single family reported, aware of at least one other yet to be published family identified internally.; to: PMG: Single family reported, aware of at least one other yet to be published family identified internally.
Mendeliome v0.8981 PI4KA Zornitza Stark edited their review of gene: PI4KA: Added comment: Neurodevelopmental syndrome with hypomyelinating leukodystrophy: 10 unrelated patients harbouring biallelic variants in PI4KA reported with a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.; Changed rating: GREEN; Changed publications: 25855803, 34415322; Changed phenotypes: Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531, Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Hereditary Spastic Paraplegia v1.17 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Hereditary Spastic Paraplegia v1.17 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy v0.232 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Leukodystrophy v0.232 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.17 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Hereditary Spastic Paraplegia v1.17 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.16 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy v0.232 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Leukodystrophy v0.232 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4090 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Leukodystrophy v0.231 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Leukodystrophy - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Repeat Disorders v0.113 OPDM1 Bryony Thompson Marked STR: OPDM1 as ready
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.113 OPDM1 Bryony Thompson Classified STR: OPDM1 as Green List (high evidence)
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.112 OPDM1 Bryony Thompson STR: OPDM1 was added
STR: OPDM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM1 were set to 31332380; 34047774
Phenotypes for STR: OPDM1 were set to Oculopharyngodistal myopathy 1 MIM#164310
Review for STR: OPDM1 was set to GREEN
STR: OPDM1 was marked as clinically relevant
Added comment: NM_013437.5:c.-102CGG[X]
RNA-mediated toxicity is thought to be the mechanism of disease. Sixty-five Japanese patients with oculopharyngodistal myopathy (OPDM) from 59 families with CGG repeat expansions in LRP12. This represents the most common OPDM subtype among all patients in Japan with genetically diagnosed OPDM.
Normal: 13 to 45 repeats.
Pathogenic: 85 to 289 repeats.
Sources: Expert list
Early-onset Dementia v0.145 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.145 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.144 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.143 Bryony Thompson removed STR:NIID from the panel
Hereditary Neuropathy v0.117 NIID Bryony Thompson Marked STR: NIID as ready
Hereditary Neuropathy v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy v0.117 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Hereditary Neuropathy v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy v0.116 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Hereditary Neuropathy - complex. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Hereditary Neuropathy v0.115 Bryony Thompson removed STR:NIID from the panel
Regression v0.361 NIID Bryony Thompson Marked STR: NIID as ready
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.361 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.360 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Regression. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Regression v0.359 Bryony Thompson removed STR:NIID from the panel
Mendeliome v0.8981 NIID Bryony Thompson Marked STR: NIID as ready
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8981 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8980 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Mendeliome v0.8979 Bryony Thompson removed STR:NIID from the panel
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.119 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Parkinson disease v0.118 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.111 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.111 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.110 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Expert list
Repeat Disorders v0.109 Bryony Thompson removed STR:NIID from the panel
Growth failure v0.359 PITX2 Zornitza Stark Marked gene: PITX2 as ready
Growth failure v0.359 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.359 PITX2 Zornitza Stark Phenotypes for gene: PITX2 were changed from AXENFELD-RIEGER SYNDROME to Axenfeld-Rieger syndrome, type 1, MIM# 180500
Growth failure v0.358 PITX2 Zornitza Stark Classified gene: PITX2 as Green List (high evidence)
Growth failure v0.358 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.357 PITX2 Zornitza Stark reviewed gene: PITX2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Axenfeld-Rieger syndrome, type 1, MIM# 180500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8978 SUCO Bryony Thompson Marked gene: SUCO as ready
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8978 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8977 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Literature
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Marked gene: SUCO as ready
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.62 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Classified gene: ANO5 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Gene: ano5 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.60 ANO5 Bryony Thompson gene: ANO5 was added
gene: ANO5 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: ANO5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANO5 were set to 30712070; 15124103; 30641283; 29175271
Phenotypes for gene: ANO5 were set to Gnathodiaphyseal dysplasia MIM#166260
Review for gene: ANO5 was set to GREEN
gene: ANO5 was marked as current diagnostic
Added comment: Bone fragility is a feature of the condition, which is an overlapping feature with OI and could be a differential diagnosis. >3 families/probands and a null mouse model reported.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Classified gene: XYLT2 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.58 XYLT2 Bryony Thompson gene: XYLT2 was added
gene: XYLT2 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: XYLT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: XYLT2 were set to 26027496; 26987875
Phenotypes for gene: XYLT2 were set to Spondyloocular syndrome MIM#605822
Review for gene: XYLT2 was set to GREEN
gene: XYLT2 was marked as current diagnostic
Added comment: Generalised osteoporosis and recurrent fractures are a feature of the condition, which overlaps with the OI phenotype. >3 families reported.
Sources: Expert list
Growth failure v0.357 OTX2 Zornitza Stark Marked gene: OTX2 as ready
Growth failure v0.357 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.357 OTX2 Zornitza Stark Phenotypes for gene: OTX2 were changed from Microcephaly, bilateral anopthalmia, developmental delay, cleft palate to Pituitary hormone deficiency, combined, 6, MIM# 613986; Microphthalmia, syndromic 5, MIM# 610125
Growth failure v0.356 OTX2 Zornitza Stark Publications for gene: OTX2 were set to 18728160
Growth failure v0.355 OTX2 Zornitza Stark Classified gene: OTX2 as Green List (high evidence)
Growth failure v0.355 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.354 OTX2 Zornitza Stark reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 18728160, 33950863, 15846561; Phenotypes: Pituitary hormone deficiency, combined, 6, MIM# 613986, Microphthalmia, syndromic 5, MIM# 610125; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.354 MCM5 Zornitza Stark Marked gene: MCM5 as ready
Growth failure v0.354 MCM5 Zornitza Stark Gene: mcm5 has been classified as Red List (Low Evidence).
Growth failure v0.354 MCM5 Zornitza Stark Phenotypes for gene: MCM5 were changed from ?Meier-Gorlin syndrome 8 to Meier-Gorlin syndrome 8 (MIM#617564)
Growth failure v0.353 MCM5 Zornitza Stark reviewed gene: MCM5: Rating: RED; Mode of pathogenicity: None; Publications: 28198391; Phenotypes: Meier-Gorlin syndrome 8 (MIM#617564); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.353 LIG1 Zornitza Stark Marked gene: LIG1 as ready
Growth failure v0.353 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.353 LIG1 Zornitza Stark Phenotypes for gene: LIG1 were changed from immunodeficiency, sun sensitivity, growth reatrdation to Combined immunodeficiency; Lymphopaenia; Hypogammaglobulinaemia; Recurrent bacterial and viral infections; Growth retardation; Sun sensitivity, radiation sensitivity; Macrocytosis
Growth failure v0.352 LIG1 Zornitza Stark Publications for gene: LIG1 were set to 1581963, 1351188
Growth failure v0.351 LIG1 Zornitza Stark Classified gene: LIG1 as Green List (high evidence)
Growth failure v0.351 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.350 LIG1 Zornitza Stark reviewed gene: LIG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30395541; Phenotypes: Combined immunodeficiency, Lymphopaenia, Hypogammaglobulinaemia, Recurrent bacterial and viral infections, Growth retardation, Sun sensitivity, radiation sensitivity, Macrocytosis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v0.57 WNT4 Bryony Thompson gene: WNT4 was added
gene: WNT4 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: WNT4 was set to Unknown
Publications for gene: WNT4 were set to 25108526; 26733379
Phenotypes for gene: WNT4 were set to Osteoporosis
Review for gene: WNT4 was set to RED
Added comment: Mouse model where recombinant Wnt4 alleviated bone loss and inflammation by inhibiting NF-κB in vivo in mouse models of bone disease. However, no reported association with Mendelian disease. A common SNP (rs10917157) has been associated with bone mineral density.
Sources: Expert list
Mirror movements v0.0 Bryony Thompson Panel deleted
Growth failure v0.350 LHX4 Zornitza Stark Marked gene: LHX4 as ready
Growth failure v0.350 LHX4 Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence).
Growth failure v0.350 LHX4 Zornitza Stark Phenotypes for gene: LHX4 were changed from hypopituitarism to Pituitary hormone deficiency, combined, 4, MIM# 262700
Growth failure v0.349 LHX4 Zornitza Stark Publications for gene: LHX4 were set to 11567216, 18073311
Growth failure v0.348 LHX4 Zornitza Stark Classified gene: LHX4 as Green List (high evidence)